>Feature sequence001 373 1878 gene locus_tag LOCUS_00010 gene lysS 373 1878 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 protein_id gnl|my_center|LOCUS_00010 2795 1944 gene locus_tag LOCUS_00020 2795 1944 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405327.1 protein_id gnl|my_center|LOCUS_00020 4020 2974 gene locus_tag LOCUS_00030 4020 2974 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_00030 4118 4495 gene locus_tag LOCUS_00040 gene sdhC 4118 4495 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220642.1 protein_id gnl|my_center|LOCUS_00040 4495 4836 gene locus_tag LOCUS_00050 4495 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4850 6625 gene locus_tag LOCUS_00060 gene sdhA 4850 6625 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946277.1 protein_id gnl|my_center|LOCUS_00060 6628 7332 gene locus_tag LOCUS_00070 6628 7332 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_00070 7334 7594 gene locus_tag LOCUS_00080 gene sdhE 7334 7594 CDS product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351186.1 protein_id gnl|my_center|LOCUS_00080 7557 7991 gene locus_tag LOCUS_00090 7557 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9727 8069 gene locus_tag LOCUS_00100 gene nadB 9727 8069 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405338.1 protein_id gnl|my_center|LOCUS_00100 10044 10619 gene locus_tag LOCUS_00110 gene rpoE 10044 10619 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_00110 10819 11529 gene locus_tag LOCUS_00120 10819 11529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11708 12319 gene locus_tag LOCUS_00130 11708 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12325 13809 gene locus_tag LOCUS_00140 gene mucD 12325 13809 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_00140 13950 15746 gene locus_tag LOCUS_00150 gene lepA 13950 15746 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958269.1 protein_id gnl|my_center|LOCUS_00150 15743 16576 gene locus_tag LOCUS_00160 gene lepB 15743 16576 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363711.1 protein_id gnl|my_center|LOCUS_00160 16747 17103 gene locus_tag LOCUS_00170 16747 17103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17100 17786 gene locus_tag LOCUS_00180 gene rnc 17100 17786 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068343.1 protein_id gnl|my_center|LOCUS_00180 17794 18864 gene locus_tag LOCUS_00190 gene era 17794 18864 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_00190 18876 19679 gene locus_tag LOCUS_00200 gene recO 18876 19679 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279493.1 protein_id gnl|my_center|LOCUS_00200 19687 20484 gene locus_tag LOCUS_00210 gene pdxJ 19687 20484 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 protein_id gnl|my_center|LOCUS_00210 20573 20977 gene locus_tag LOCUS_00220 gene acpS 20573 20977 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635063.1 protein_id gnl|my_center|LOCUS_00220 21019 21095 gene locus_tag LOCUS_t00010 21019 21095 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21286 22689 gene locus_tag LOCUS_00230 21286 22689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23271 23732 gene locus_tag LOCUS_00240 gene rimP 23271 23732 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_00240 23792 25321 gene locus_tag LOCUS_00250 gene nusA 23792 25321 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037645.1 protein_id gnl|my_center|LOCUS_00250 25352 28090 gene locus_tag LOCUS_00260 25352 28090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 28147 28515 gene locus_tag LOCUS_00270 gene rbfA 28147 28515 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_00270 28597 29487 gene locus_tag LOCUS_00280 gene truB 28597 29487 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958222.1 protein_id gnl|my_center|LOCUS_00280 29619 29888 gene locus_tag LOCUS_00290 gene rpsO 29619 29888 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 protein_id gnl|my_center|LOCUS_00290 29968 32067 gene locus_tag LOCUS_00300 gene pnp 29968 32067 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957848.1 protein_id gnl|my_center|LOCUS_00300 32272 35259 gene locus_tag LOCUS_00310 32272 35259 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_00310 35648 35244 gene locus_tag LOCUS_00320 35648 35244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 35928 36860 gene locus_tag LOCUS_00330 gene cysM 35928 36860 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_00330 36864 37733 gene locus_tag LOCUS_00340 36864 37733 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 protein_id gnl|my_center|LOCUS_00340 37723 38196 gene locus_tag LOCUS_00350 37723 38196 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_00350 38214 39779 gene locus_tag LOCUS_00360 38214 39779 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538266.1 protein_id gnl|my_center|LOCUS_00360 39793 40329 gene locus_tag LOCUS_00370 39793 40329 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_00370 40342 41265 gene locus_tag LOCUS_00380 40342 41265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_00380 41278 42081 gene locus_tag LOCUS_00390 41278 42081 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_00390 42132 43175 gene locus_tag LOCUS_00400 gene nagZ 42132 43175 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_00400 43236 44249 gene locus_tag LOCUS_00410 gene ccpA 43236 44249 CDS product diheme cytochrome c5 peroxidase CcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072214.1 protein_id gnl|my_center|LOCUS_00410 45151 44288 gene locus_tag LOCUS_00420 45151 44288 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529440.1 protein_id gnl|my_center|LOCUS_00420 45621 45316 gene locus_tag LOCUS_00430 45621 45316 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_00430 45750 46670 gene locus_tag LOCUS_00440 45750 46670 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_00440 46670 47305 gene locus_tag LOCUS_00450 46670 47305 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 protein_id gnl|my_center|LOCUS_00450 47435 48127 gene locus_tag LOCUS_00460 47435 48127 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_00460 48235 49455 gene locus_tag LOCUS_00470 48235 49455 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356903.1 protein_id gnl|my_center|LOCUS_00470 49527 50378 gene locus_tag LOCUS_00480 49527 50378 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404131.1 protein_id gnl|my_center|LOCUS_00480 50359 51069 gene locus_tag LOCUS_00490 50359 51069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 51041 51949 gene locus_tag LOCUS_00500 gene rluB 51041 51949 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072841.1 protein_id gnl|my_center|LOCUS_00500 51954 52637 gene locus_tag LOCUS_00510 51954 52637 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_00510 52684 53949 gene locus_tag LOCUS_00520 52684 53949 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_00520 53942 54634 gene locus_tag LOCUS_00530 gene lolD 53942 54634 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161961949.1 protein_id gnl|my_center|LOCUS_00530 55297 54656 gene locus_tag LOCUS_00540 55297 54656 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881633.1 protein_id gnl|my_center|LOCUS_00540 55364 57715 gene locus_tag LOCUS_00550 55364 57715 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152615065.1 protein_id gnl|my_center|LOCUS_00550 57811 58449 gene locus_tag LOCUS_00560 57811 58449 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_00560 58446 58862 gene locus_tag LOCUS_00570 58446 58862 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_00570 58889 59071 gene locus_tag LOCUS_00580 58889 59071 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947637.1 protein_id gnl|my_center|LOCUS_00580 59068 59826 gene locus_tag LOCUS_00590 gene kdsB 59068 59826 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 protein_id gnl|my_center|LOCUS_00590 60215 59883 gene locus_tag LOCUS_00600 60215 59883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 60442 60948 gene locus_tag LOCUS_00610 60442 60948 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_00610 61065 61559 gene locus_tag LOCUS_00620 61065 61559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 62685 62236 gene locus_tag LOCUS_00630 62685 62236 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269266.1 protein_id gnl|my_center|LOCUS_00630 62973 64208 gene locus_tag LOCUS_00640 62973 64208 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_00640 64186 65532 gene locus_tag LOCUS_00650 64186 65532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 65887 65591 gene locus_tag LOCUS_00660 65887 65591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 66723 65926 gene locus_tag LOCUS_00670 66723 65926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 67258 67106 gene locus_tag LOCUS_00680 67258 67106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 68994 67879 gene locus_tag LOCUS_00690 68994 67879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 70435 69383 gene locus_tag LOCUS_00700 gene ccpA 70435 69383 CDS product diheme cytochrome c5 peroxidase CcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072214.1 protein_id gnl|my_center|LOCUS_00700 72353 70656 gene locus_tag LOCUS_00710 gene glgP 72353 70656 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545636.1 protein_id gnl|my_center|LOCUS_00710 73616 72504 gene locus_tag LOCUS_00720 73616 72504 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_00720 74246 73623 gene locus_tag LOCUS_00730 74246 73623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 74938 74276 gene locus_tag LOCUS_00740 74938 74276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 75085 75432 gene locus_tag LOCUS_00750 75085 75432 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246096.1 protein_id gnl|my_center|LOCUS_00750 77732 75450 gene locus_tag LOCUS_00760 gene metE 77732 75450 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 protein_id gnl|my_center|LOCUS_00760 77843 78775 gene locus_tag LOCUS_00770 gene metR 77843 78775 CDS product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405405.1 protein_id gnl|my_center|LOCUS_00770 79364 82219 gene locus_tag LOCUS_00780 79364 82219 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082358.1 protein_id gnl|my_center|LOCUS_00780 82272 83489 gene locus_tag LOCUS_00790 82272 83489 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958298.1 protein_id gnl|my_center|LOCUS_00790 84585 83416 gene locus_tag LOCUS_00800 84585 83416 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528269.1 protein_id gnl|my_center|LOCUS_00800 84944 86146 gene locus_tag LOCUS_00810 84944 86146 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_00810 87127 86279 gene locus_tag LOCUS_00820 87127 86279 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228479.1 protein_id gnl|my_center|LOCUS_00820 88442 87237 gene locus_tag LOCUS_00830 88442 87237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 88866 88435 gene locus_tag LOCUS_00840 88866 88435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 90969 88867 gene locus_tag LOCUS_00850 90969 88867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 91733 90966 gene locus_tag LOCUS_00860 91733 90966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_00860 92566 91751 gene locus_tag LOCUS_00870 92566 91751 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_00870 92935 92609 gene locus_tag LOCUS_00880 92935 92609 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808480.1 protein_id gnl|my_center|LOCUS_00880 96179 93009 gene locus_tag LOCUS_00890 96179 93009 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_00890 97899 96172 gene locus_tag LOCUS_00900 97899 96172 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_00900 99187 97892 gene locus_tag LOCUS_00910 99187 97892 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_00910 99317 99517 gene locus_tag LOCUS_00920 99317 99517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 99859 99485 gene locus_tag LOCUS_00930 99859 99485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 101184 99988 gene locus_tag LOCUS_00940 101184 99988 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_00940 103634 101226 gene locus_tag LOCUS_00950 103634 101226 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_00950 103812 105854 gene locus_tag LOCUS_00960 103812 105854 CDS product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 protein_id gnl|my_center|LOCUS_00960 106356 105817 gene locus_tag LOCUS_00970 106356 105817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 107425 106430 gene locus_tag LOCUS_00980 107425 106430 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188687.1 protein_id gnl|my_center|LOCUS_00980 107634 108428 gene locus_tag LOCUS_00990 107634 108428 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_00990 110897 108444 gene locus_tag LOCUS_01000 gene ppsA 110897 108444 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023333.1 protein_id gnl|my_center|LOCUS_01000 112333 110930 gene locus_tag LOCUS_01010 112333 110930 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_01010 112701 113819 gene locus_tag LOCUS_01020 gene lptF 112701 113819 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779645.1 protein_id gnl|my_center|LOCUS_01020 113816 114886 gene locus_tag LOCUS_01030 gene lptG 113816 114886 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223173.1 protein_id gnl|my_center|LOCUS_01030 115717 114869 gene locus_tag LOCUS_01040 115717 114869 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_01040 115893 116993 gene locus_tag LOCUS_01050 115893 116993 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919044.1 protein_id gnl|my_center|LOCUS_01050 116997 117956 gene locus_tag LOCUS_01060 116997 117956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 118006 119109 gene locus_tag LOCUS_01070 118006 119109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 119102 120076 gene locus_tag LOCUS_01080 119102 120076 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393323.1 protein_id gnl|my_center|LOCUS_01080 121299 120103 gene locus_tag LOCUS_01090 gene waaL 121299 120103 CDS product O-antigen ligase WaaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114546.1 protein_id gnl|my_center|LOCUS_01090 122226 121321 gene locus_tag LOCUS_01100 122226 121321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 123174 122269 gene locus_tag LOCUS_01110 123174 122269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 >Feature sequence002 2376 1075 gene locus_tag LOCUS_01120 gene tyrS 2376 1075 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957422.1 protein_id gnl|my_center|LOCUS_01120 2553 3995 gene locus_tag LOCUS_01130 2553 3995 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_01130 3979 5142 gene locus_tag LOCUS_01140 3979 5142 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 protein_id gnl|my_center|LOCUS_01140 5603 5229 gene locus_tag LOCUS_01150 gene erpA 5603 5229 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071517.1 protein_id gnl|my_center|LOCUS_01150 6224 5775 gene locus_tag LOCUS_01160 6224 5775 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_01160 6958 6236 gene locus_tag LOCUS_01170 6958 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 8014 6974 gene locus_tag LOCUS_01180 gene argC 8014 6974 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_01180 9093 8182 gene locus_tag LOCUS_01190 9093 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 10280 9135 gene locus_tag LOCUS_01200 10280 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 10510 11199 gene locus_tag LOCUS_01210 10510 11199 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_01210 11230 12345 gene locus_tag LOCUS_01220 11230 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 15196 12635 gene locus_tag LOCUS_01230 15196 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 16815 15433 gene locus_tag LOCUS_01240 16815 15433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 17905 16835 gene locus_tag LOCUS_01250 17905 16835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 18460 18122 gene locus_tag LOCUS_01260 18460 18122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 19077 18562 gene locus_tag LOCUS_01270 19077 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 20514 19225 gene locus_tag LOCUS_01280 gene ccmI 20514 19225 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_01280 21053 20511 gene locus_tag LOCUS_01290 21053 20511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 21648 21112 gene locus_tag LOCUS_01300 21648 21112 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_01300 23678 21645 gene locus_tag LOCUS_01310 23678 21645 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_01310 24214 23675 gene locus_tag LOCUS_01320 gene ccmE 24214 23675 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_01320 24991 24308 gene locus_tag LOCUS_01330 gene ccmC 24991 24308 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_01330 25793 25125 gene locus_tag LOCUS_01340 gene ccmB 25793 25125 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_01340 26423 25797 gene locus_tag LOCUS_01350 gene ccmA 26423 25797 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895571.1 protein_id gnl|my_center|LOCUS_01350 26737 27693 gene locus_tag LOCUS_01360 26737 27693 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 protein_id gnl|my_center|LOCUS_01360 27846 28763 gene locus_tag LOCUS_01370 27846 28763 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817503.1 protein_id gnl|my_center|LOCUS_01370 28786 29322 gene locus_tag LOCUS_01380 28786 29322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 29335 30348 gene locus_tag LOCUS_01390 29335 30348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 30345 32180 gene locus_tag LOCUS_01400 30345 32180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 32174 33946 gene locus_tag LOCUS_01410 32174 33946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 34736 33993 gene locus_tag LOCUS_01420 gene rqpR 34736 33993 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_01420 35669 34962 gene locus_tag LOCUS_01430 35669 34962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 36430 35717 gene locus_tag LOCUS_01440 36430 35717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 37296 36430 gene locus_tag LOCUS_01450 gene ccsA 37296 36430 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941366.1 protein_id gnl|my_center|LOCUS_01450 38333 37296 gene locus_tag LOCUS_01460 38333 37296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 40999 38330 gene locus_tag LOCUS_01470 40999 38330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 42045 41011 gene locus_tag LOCUS_01480 42045 41011 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_01480 42935 42093 gene locus_tag LOCUS_01490 42935 42093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 43618 43067 gene locus_tag LOCUS_01500 43618 43067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 45098 43848 gene locus_tag LOCUS_01510 45098 43848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 46363 45698 gene locus_tag LOCUS_01520 46363 45698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 46834 46388 gene locus_tag LOCUS_01530 46834 46388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 48767 47025 gene locus_tag LOCUS_01540 48767 47025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 49802 48858 gene locus_tag LOCUS_01550 49802 48858 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942716.1 protein_id gnl|my_center|LOCUS_01550 50838 50029 gene locus_tag LOCUS_01560 50838 50029 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646584.1 protein_id gnl|my_center|LOCUS_01560 52339 51248 gene locus_tag LOCUS_01570 52339 51248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 53633 52674 gene locus_tag LOCUS_01580 53633 52674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 54007 53934 gene locus_tag LOCUS_t00020 54007 53934 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 54547 54173 gene locus_tag LOCUS_01590 gene rpsI 54547 54173 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829824.1 protein_id gnl|my_center|LOCUS_01590 55017 54589 gene locus_tag LOCUS_01600 gene rplM 55017 54589 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210132.1 protein_id gnl|my_center|LOCUS_01600 55608 55228 gene locus_tag LOCUS_01610 55608 55228 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_01610 55723 56964 gene locus_tag LOCUS_01620 55723 56964 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_01620 57655 56987 gene locus_tag LOCUS_01630 gene coq7 57655 56987 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119684.1 protein_id gnl|my_center|LOCUS_01630 58481 57660 gene locus_tag LOCUS_01640 gene speD 58481 57660 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101641.1 protein_id gnl|my_center|LOCUS_01640 58965 58543 gene locus_tag LOCUS_01650 58965 58543 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_01650 59381 58962 gene locus_tag LOCUS_01660 59381 58962 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_01660 59656 60291 gene locus_tag LOCUS_01670 gene crp 59656 60291 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_01670 60569 61570 gene locus_tag LOCUS_01680 60569 61570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 62715 61630 gene locus_tag LOCUS_01690 62715 61630 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_01690 63588 62716 gene locus_tag LOCUS_01700 63588 62716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 64623 63766 gene locus_tag LOCUS_01710 gene trpC 64623 63766 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_01710 65657 64620 gene locus_tag LOCUS_01720 gene trpD 65657 64620 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118605.1 protein_id gnl|my_center|LOCUS_01720 66295 65654 gene locus_tag LOCUS_01730 66295 65654 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_01730 67836 66292 gene locus_tag LOCUS_01740 gene trpE 67836 66292 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 protein_id gnl|my_center|LOCUS_01740 68570 67839 gene locus_tag LOCUS_01750 68570 67839 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_01750 69247 68567 gene locus_tag LOCUS_01760 gene rpe 69247 68567 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070664.1 protein_id gnl|my_center|LOCUS_01760 69519 70409 gene locus_tag LOCUS_01770 69519 70409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 71538 70492 gene locus_tag LOCUS_01780 71538 70492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_01780 72190 71633 gene locus_tag LOCUS_01790 72190 71633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 72717 72190 gene locus_tag LOCUS_01800 72717 72190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 74171 72720 gene locus_tag LOCUS_01810 gene nrfD 74171 72720 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228899.1 protein_id gnl|my_center|LOCUS_01810 75109 74237 gene locus_tag LOCUS_01820 75109 74237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 77316 75109 gene locus_tag LOCUS_01830 77316 75109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 77913 77371 gene locus_tag LOCUS_01840 77913 77371 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_01840 79740 78970 gene locus_tag LOCUS_01850 79740 78970 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_01850 79774 80994 gene locus_tag LOCUS_01860 gene algW 79774 80994 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098831.1 protein_id gnl|my_center|LOCUS_01860 81762 81004 gene locus_tag LOCUS_01870 gene tatC 81762 81004 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704121.1 protein_id gnl|my_center|LOCUS_01870 82294 81734 gene locus_tag LOCUS_01880 82294 81734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 82680 82417 gene locus_tag LOCUS_01890 gene tatA 82680 82417 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260926.1 protein_id gnl|my_center|LOCUS_01890 83158 82793 gene locus_tag LOCUS_01900 83158 82793 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_01900 83645 83151 gene locus_tag LOCUS_01910 gene hisI 83645 83151 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815804.1 protein_id gnl|my_center|LOCUS_01910 84460 83681 gene locus_tag LOCUS_01920 gene hisF 84460 83681 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_01920 85252 84488 gene locus_tag LOCUS_01930 gene hisA 85252 84488 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_01930 85971 85306 gene locus_tag LOCUS_01940 gene hisH 85971 85306 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 protein_id gnl|my_center|LOCUS_01940 86709 86047 gene locus_tag LOCUS_01950 gene hisB 86709 86047 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 protein_id gnl|my_center|LOCUS_01950 88001 86820 gene locus_tag LOCUS_01960 gene hisC 88001 86820 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_01960 89379 88072 gene locus_tag LOCUS_01970 gene hisD 89379 88072 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_01970 90106 89384 gene locus_tag LOCUS_01980 gene hisG 90106 89384 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766526.1 protein_id gnl|my_center|LOCUS_01980 91386 90127 gene locus_tag LOCUS_01990 gene murA 91386 90127 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_01990 91725 91462 gene locus_tag LOCUS_02000 91725 91462 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 protein_id gnl|my_center|LOCUS_02000 92125 91820 gene locus_tag LOCUS_02010 92125 91820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 92870 92118 gene locus_tag LOCUS_02020 92870 92118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 93337 92876 gene locus_tag LOCUS_02030 gene mlaD 93337 92876 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_02030 94192 93410 gene locus_tag LOCUS_02040 gene mlaE 94192 93410 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_02040 95013 94189 gene locus_tag LOCUS_02050 95013 94189 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_02050 95883 95029 gene locus_tag LOCUS_02060 95883 95029 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_02060 <97211 95973 gene locus_tag LOCUS_02070 <97211 95973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112738.1:YhdP family protein >Feature sequence003 201 1574 gene locus_tag LOCUS_02080 gene opmH 201 1574 CDS product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_02080 1938 1723 gene locus_tag LOCUS_02090 1938 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 2888 1956 gene locus_tag LOCUS_02100 gene ilvE 2888 1956 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_02100 6064 3098 gene locus_tag LOCUS_02110 gene glnE 6064 3098 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_02110 6176 7318 gene locus_tag LOCUS_02120 gene tapW 6176 7318 CDS product type IVa pilus ATPase TapW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_02120 9096 7456 gene locus_tag LOCUS_02130 gene groL 9096 7456 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_02130 9430 9140 gene locus_tag LOCUS_02140 gene groES 9430 9140 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_02140 10485 9892 gene locus_tag LOCUS_02150 10485 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 12248 10488 gene locus_tag LOCUS_02160 gene argS 12248 10488 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_02160 14579 12354 gene locus_tag LOCUS_02170 14579 12354 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_02170 15387 14962 gene locus_tag LOCUS_02180 gene hemJ 15387 14962 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377457.1 protein_id gnl|my_center|LOCUS_02180 15782 16228 gene locus_tag LOCUS_02190 15782 16228 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337356.1 protein_id gnl|my_center|LOCUS_02190 17358 16279 gene locus_tag LOCUS_02200 17358 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 17544 21404 gene locus_tag LOCUS_02210 17544 21404 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815152.1 protein_id gnl|my_center|LOCUS_02210 21679 21479 gene locus_tag LOCUS_02220 21679 21479 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040115264.1 protein_id gnl|my_center|LOCUS_02220 22350 21694 gene locus_tag LOCUS_02230 gene rpiA 22350 21694 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 protein_id gnl|my_center|LOCUS_02230 22470 23993 gene locus_tag LOCUS_02240 gene ilvA 22470 23993 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_02240 24416 24165 gene locus_tag LOCUS_02250 24416 24165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 25368 24895 gene locus_tag LOCUS_02260 25368 24895 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_02260 25964 25365 gene locus_tag LOCUS_02270 25964 25365 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266316.1 protein_id gnl|my_center|LOCUS_02270 26690 26373 gene locus_tag LOCUS_02280 26690 26373 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_02280 26917 26687 gene locus_tag LOCUS_02290 26917 26687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 27089 27691 gene locus_tag LOCUS_02300 27089 27691 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099193.1 protein_id gnl|my_center|LOCUS_02300 27731 29113 gene locus_tag LOCUS_02310 gene pepP 27731 29113 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_02310 29233 30468 gene locus_tag LOCUS_02320 gene ubiH 29233 30468 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703430.1 protein_id gnl|my_center|LOCUS_02320 30470 31693 gene locus_tag LOCUS_02330 30470 31693 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105378.1 protein_id gnl|my_center|LOCUS_02330 31714 32967 gene locus_tag LOCUS_02340 31714 32967 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_02340 34228 33059 gene locus_tag LOCUS_02350 34228 33059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 35452 34391 gene locus_tag LOCUS_02360 35452 34391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 36882 35449 gene locus_tag LOCUS_02370 36882 35449 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_02370 37627 36923 gene locus_tag LOCUS_02380 37627 36923 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463963.1 protein_id gnl|my_center|LOCUS_02380 38678 37668 gene locus_tag LOCUS_02390 gene gpsA 38678 37668 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_02390 39241 38726 gene locus_tag LOCUS_02400 gene secB 39241 38726 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704300.1 protein_id gnl|my_center|LOCUS_02400 39943 39329 gene locus_tag LOCUS_02410 39943 39329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 40149 41669 gene locus_tag LOCUS_02420 gene gpmI 40149 41669 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_02420 41779 42990 gene locus_tag LOCUS_02430 41779 42990 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_02430 43057 44373 gene locus_tag LOCUS_02440 gene cptA 43057 44373 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_02440 44586 45422 gene locus_tag LOCUS_02450 44586 45422 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 protein_id gnl|my_center|LOCUS_02450 45836 47122 gene locus_tag LOCUS_02460 45836 47122 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_02460 47119 47670 gene locus_tag LOCUS_02470 47119 47670 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 protein_id gnl|my_center|LOCUS_02470 48617 47913 gene locus_tag LOCUS_02480 48617 47913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 49162 49713 gene locus_tag LOCUS_02490 49162 49713 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_02490 50104 51963 gene locus_tag LOCUS_02500 50104 51963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 52062 53066 gene locus_tag LOCUS_02510 52062 53066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 53063 53629 gene locus_tag LOCUS_02520 53063 53629 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_02520 53672 54277 gene locus_tag LOCUS_02530 53672 54277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 54351 55982 gene locus_tag LOCUS_02540 54351 55982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 56016 56231 gene locus_tag LOCUS_02550 56016 56231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 56345 56683 gene locus_tag LOCUS_02560 56345 56683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 56766 58493 gene locus_tag LOCUS_02570 56766 58493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 60497 58851 gene locus_tag LOCUS_02580 gene ubiB 60497 58851 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_02580 61162 60494 gene locus_tag LOCUS_02590 61162 60494 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_02590 61971 61174 gene locus_tag LOCUS_02600 gene ubiE 61971 61174 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099241.1 protein_id gnl|my_center|LOCUS_02600 62339 61968 gene locus_tag LOCUS_02610 62339 61968 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 protein_id gnl|my_center|LOCUS_02610 63675 62350 gene locus_tag LOCUS_02620 gene hslU 63675 62350 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208943.1 protein_id gnl|my_center|LOCUS_02620 64220 63672 gene locus_tag LOCUS_02630 gene hslV 64220 63672 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_02630 65249 64296 gene locus_tag LOCUS_02640 gene xerC 65249 64296 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 protein_id gnl|my_center|LOCUS_02640 65969 65262 gene locus_tag LOCUS_02650 65969 65262 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 protein_id gnl|my_center|LOCUS_02650 66796 65966 gene locus_tag LOCUS_02660 gene dapF 66796 65966 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_02660 66795 67442 gene locus_tag LOCUS_02670 66795 67442 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455144.1 protein_id gnl|my_center|LOCUS_02670 67551 68993 gene locus_tag LOCUS_02680 67551 68993 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_02680 69791 70174 gene locus_tag LOCUS_02690 69791 70174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 71406 70210 gene locus_tag LOCUS_02700 71406 70210 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408362.1 protein_id gnl|my_center|LOCUS_02700 73232 71748 gene locus_tag LOCUS_02710 gene ubiD 73232 71748 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496900.1 protein_id gnl|my_center|LOCUS_02710 73474 73962 gene locus_tag LOCUS_02720 73474 73962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 74060 75067 gene locus_tag LOCUS_02730 gene cas6 74060 75067 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_02730 75153 76307 gene locus_tag LOCUS_02740 75153 76307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 76379 77644 gene locus_tag LOCUS_02750 76379 77644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 77656 79806 gene locus_tag LOCUS_02760 77656 79806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 79803 80459 gene locus_tag LOCUS_02770 79803 80459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 80456 81511 gene locus_tag LOCUS_02780 80456 81511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 81719 81519 gene locus_tag LOCUS_02790 81719 81519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 82111 81896 gene locus_tag LOCUS_02800 82111 81896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 82165 85101 gene locus_tag LOCUS_02810 gene cas10 82165 85101 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274454.1 protein_id gnl|my_center|LOCUS_02810 85098 86228 gene locus_tag LOCUS_02820 85098 86228 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229143.1 protein_id gnl|my_center|LOCUS_02820 86276 87178 gene locus_tag LOCUS_02830 gene cmr4 86276 87178 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_02830 87190 87576 gene locus_tag LOCUS_02840 87190 87576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 87917 87585 gene locus_tag LOCUS_02850 87917 87585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 88240 88001 gene locus_tag LOCUS_02860 88240 88001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 88271 89596 gene locus_tag LOCUS_02870 88271 89596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 89593 89904 gene locus_tag LOCUS_02880 89593 89904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 90369 91286 gene locus_tag LOCUS_02890 gene cas1 90369 91286 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_02890 92030 92419 gene locus_tag LOCUS_02900 92030 92419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 92544 92995 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttggaaaccttgccctgaagaaaaagggattaagac >Feature sequence004 231 1040 gene locus_tag LOCUS_02910 231 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 1068 2600 gene locus_tag LOCUS_02920 1068 2600 CDS product lysine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886371.1 protein_id gnl|my_center|LOCUS_02920 3964 2621 gene locus_tag LOCUS_02930 gene accC 3964 2621 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884639.1 protein_id gnl|my_center|LOCUS_02930 4455 3991 gene locus_tag LOCUS_02940 gene accB 4455 3991 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707112.1 protein_id gnl|my_center|LOCUS_02940 4977 4528 gene locus_tag LOCUS_02950 gene aroQ 4977 4528 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_02950 5854 5282 gene locus_tag LOCUS_02960 5854 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 7872 5854 gene locus_tag LOCUS_02970 gene dsbD 7872 5854 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_02970 8330 8001 gene locus_tag LOCUS_02980 8330 8001 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 protein_id gnl|my_center|LOCUS_02980 8430 8918 gene locus_tag LOCUS_02990 8430 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 10919 9006 gene locus_tag LOCUS_03000 10919 9006 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946745.1 protein_id gnl|my_center|LOCUS_03000 11255 10923 gene locus_tag LOCUS_03010 11255 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 14344 11252 gene locus_tag LOCUS_03020 14344 11252 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942780.1 protein_id gnl|my_center|LOCUS_03020 15616 14357 gene locus_tag LOCUS_03030 15616 14357 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941496.1 protein_id gnl|my_center|LOCUS_03030 16926 15619 gene locus_tag LOCUS_03040 16926 15619 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 protein_id gnl|my_center|LOCUS_03040 17325 16993 gene locus_tag LOCUS_03050 17325 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 18123 17506 gene locus_tag LOCUS_03060 18123 17506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 19006 18227 gene locus_tag LOCUS_03070 19006 18227 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_03070 20105 19023 gene locus_tag LOCUS_03080 20105 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 20540 20812 gene locus_tag LOCUS_03090 20540 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 20978 21244 gene locus_tag LOCUS_03100 20978 21244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 21241 21609 gene locus_tag LOCUS_03110 21241 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 22291 21626 gene locus_tag LOCUS_03120 22291 21626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 23171 22281 gene locus_tag LOCUS_03130 23171 22281 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 protein_id gnl|my_center|LOCUS_03130 23468 26293 gene locus_tag LOCUS_03140 23468 26293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 26290 26721 gene locus_tag LOCUS_03150 26290 26721 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_03150 26908 28725 gene locus_tag LOCUS_03160 26908 28725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 29211 28870 gene locus_tag LOCUS_03170 gene nirD 29211 28870 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_03170 31652 29232 gene locus_tag LOCUS_03180 gene nirB 31652 29232 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_03180 32153 33640 gene locus_tag LOCUS_03190 32153 33640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 33685 35415 gene locus_tag LOCUS_03200 33685 35415 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_03200 37816 35900 gene locus_tag LOCUS_03210 gene speA 37816 35900 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038943.1 protein_id gnl|my_center|LOCUS_03210 37843 38745 gene locus_tag LOCUS_03220 gene speE 37843 38745 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 protein_id gnl|my_center|LOCUS_03220 39202 38711 gene locus_tag LOCUS_03230 39202 38711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 40077 39286 gene locus_tag LOCUS_03240 gene fetB 40077 39286 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_03240 40676 40074 gene locus_tag LOCUS_03250 40676 40074 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382896.1 protein_id gnl|my_center|LOCUS_03250 40793 41032 gene locus_tag LOCUS_03260 40793 41032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 42371 41094 gene locus_tag LOCUS_03270 42371 41094 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_03270 42747 42409 gene locus_tag LOCUS_03280 gene glnK 42747 42409 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555808.1 protein_id gnl|my_center|LOCUS_03280 43032 43319 gene locus_tag LOCUS_03290 43032 43319 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212191.1 protein_id gnl|my_center|LOCUS_03290 43374 44882 gene locus_tag LOCUS_03300 43374 44882 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_03300 45295 45140 gene locus_tag LOCUS_03310 45295 45140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 46617 45727 gene locus_tag LOCUS_03320 46617 45727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 47730 46663 gene locus_tag LOCUS_03330 gene hemE 47730 46663 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_03330 49169 47727 gene locus_tag LOCUS_03340 49169 47727 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448901.1 protein_id gnl|my_center|LOCUS_03340 53856 49162 gene locus_tag LOCUS_03350 gene gltB 53856 49162 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 protein_id gnl|my_center|LOCUS_03350 56286 54085 gene locus_tag LOCUS_03360 56286 54085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 56563 56312 gene locus_tag LOCUS_03370 56563 56312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 57791 56613 gene locus_tag LOCUS_03380 57791 56613 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521919.1 protein_id gnl|my_center|LOCUS_03380 58936 57845 gene locus_tag LOCUS_03390 gene aroB 58936 57845 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_03390 59499 58969 gene locus_tag LOCUS_03400 59499 58969 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_03400 60455 59703 gene locus_tag LOCUS_03410 60455 59703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 62808 60823 gene locus_tag LOCUS_03420 62808 60823 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 protein_id gnl|my_center|LOCUS_03420 63578 63027 gene locus_tag LOCUS_03430 gene pilP 63578 63027 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_03430 64225 63575 gene locus_tag LOCUS_03440 gene pilO 64225 63575 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_03440 64797 64222 gene locus_tag LOCUS_03450 64797 64222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 65867 64794 gene locus_tag LOCUS_03460 65867 64794 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_03460 66137 68644 gene locus_tag LOCUS_03470 66137 68644 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_03470 70065 68770 gene locus_tag LOCUS_03480 gene gltA 70065 68770 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312523.1 protein_id gnl|my_center|LOCUS_03480 71045 70125 gene locus_tag LOCUS_03490 gene mdh 71045 70125 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933173.1 protein_id gnl|my_center|LOCUS_03490 72615 71344 gene locus_tag LOCUS_03500 72615 71344 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_03500 73513 72857 gene locus_tag LOCUS_03510 73513 72857 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105331.1 protein_id gnl|my_center|LOCUS_03510 73896 73687 gene locus_tag LOCUS_03520 gene rpmE 73896 73687 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027123.1 protein_id gnl|my_center|LOCUS_03520 74995 74006 gene locus_tag LOCUS_03530 74995 74006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 75769 75032 gene locus_tag LOCUS_03540 75769 75032 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876426.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence005 348 1034 gene locus_tag LOCUS_03550 348 1034 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_03550 1031 1747 gene locus_tag LOCUS_03560 1031 1747 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_03560 1980 4664 gene locus_tag LOCUS_03570 1980 4664 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144184.1 protein_id gnl|my_center|LOCUS_03570 5151 6929 gene locus_tag LOCUS_03580 gene btuB 5151 6929 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_03580 7166 6840 gene locus_tag LOCUS_03590 7166 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 7165 8931 gene locus_tag LOCUS_03600 7165 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 8999 9565 gene locus_tag LOCUS_03610 8999 9565 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_03610 10571 9609 gene locus_tag LOCUS_03620 10571 9609 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_03620 11175 10576 gene locus_tag LOCUS_03630 11175 10576 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_03630 11741 11172 gene locus_tag LOCUS_03640 gene ampD 11741 11172 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 protein_id gnl|my_center|LOCUS_03640 12708 11797 gene locus_tag LOCUS_03650 12708 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 12929 14722 gene locus_tag LOCUS_03660 12929 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 15019 14756 gene locus_tag LOCUS_03670 15019 14756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 15206 15131 gene locus_tag LOCUS_t00030 15206 15131 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16395 15250 gene locus_tag LOCUS_03680 gene thiO 16395 15250 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_03680 16575 17099 gene locus_tag LOCUS_03690 gene tppE 16575 17099 CDS product type IVa pilus pseudopilin TppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704647.1 protein_id gnl|my_center|LOCUS_03690 17197 17628 gene locus_tag LOCUS_03700 17197 17628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 17625 18677 gene locus_tag LOCUS_03710 17625 18677 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_03710 18674 19240 gene locus_tag LOCUS_03720 18674 19240 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704650.1 protein_id gnl|my_center|LOCUS_03720 19277 22834 gene locus_tag LOCUS_03730 19277 22834 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_03730 22848 23261 gene locus_tag LOCUS_03740 22848 23261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 23258 23680 gene locus_tag LOCUS_03750 gene pilE 23258 23680 CDS product type 4a pilus minor pilin PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_03750 24778 23822 gene locus_tag LOCUS_03760 gene ispH 24778 23822 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769262.1 protein_id gnl|my_center|LOCUS_03760 25320 24781 gene locus_tag LOCUS_03770 gene lspA 25320 24781 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_03770 28164 25327 gene locus_tag LOCUS_03780 gene ileS 28164 25327 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704643.1 protein_id gnl|my_center|LOCUS_03780 29220 28240 gene locus_tag LOCUS_03790 gene ribF 29220 28240 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704642.1 protein_id gnl|my_center|LOCUS_03790 30957 29401 gene locus_tag LOCUS_03800 gene murJ 30957 29401 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957545.1 protein_id gnl|my_center|LOCUS_03800 30914 31111 gene locus_tag LOCUS_03810 30914 31111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 31296 31562 gene locus_tag LOCUS_03820 gene rpsT 31296 31562 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094744.1 protein_id gnl|my_center|LOCUS_03820 32159 31638 gene locus_tag LOCUS_03830 32159 31638 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 protein_id gnl|my_center|LOCUS_03830 32339 32995 gene locus_tag LOCUS_03840 32339 32995 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_03840 33018 34088 gene locus_tag LOCUS_03850 33018 34088 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_03850 34085 34918 gene locus_tag LOCUS_03860 34085 34918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_03860 35604 34915 gene locus_tag LOCUS_03870 35604 34915 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_03870 35748 36785 gene locus_tag LOCUS_03880 gene pilT 35748 36785 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_03880 36903 37730 gene locus_tag LOCUS_03890 gene proC 36903 37730 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275316.1 protein_id gnl|my_center|LOCUS_03890 37727 38305 gene locus_tag LOCUS_03900 37727 38305 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_03900 38381 40720 gene locus_tag LOCUS_03910 38381 40720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 41161 43185 gene locus_tag LOCUS_03920 41161 43185 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_03920 43696 43217 gene locus_tag LOCUS_03930 43696 43217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 44255 43740 gene locus_tag LOCUS_03940 44255 43740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 44909 45928 gene locus_tag LOCUS_03950 44909 45928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 45981 46748 gene locus_tag LOCUS_03960 45981 46748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 47201 46755 gene locus_tag LOCUS_03970 47201 46755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 47443 48759 gene locus_tag LOCUS_03980 47443 48759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 48775 49167 gene locus_tag LOCUS_03990 48775 49167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 52907 50262 gene locus_tag LOCUS_04000 52907 50262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 53295 52921 gene locus_tag LOCUS_04010 53295 52921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 54714 53641 gene locus_tag LOCUS_04020 54714 53641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 55236 54757 gene locus_tag LOCUS_04030 55236 54757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 55723 55229 gene locus_tag LOCUS_04040 55723 55229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 56001 55720 gene locus_tag LOCUS_04050 56001 55720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 56349 56014 gene locus_tag LOCUS_04060 56349 56014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 57619 56969 gene locus_tag LOCUS_04070 57619 56969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 58551 57640 gene locus_tag LOCUS_04080 58551 57640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 60152 58743 gene locus_tag LOCUS_04090 gene ccoN 60152 58743 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_04090 60674 60384 gene locus_tag LOCUS_04100 60674 60384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 61147 61416 gene locus_tag LOCUS_04110 61147 61416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 >Feature sequence006 3 1571 gene locus_tag LOCUS_04120 3 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 1590 2663 gene locus_tag LOCUS_04130 gene rsxD 1590 2663 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061001934.1 protein_id gnl|my_center|LOCUS_04130 2667 3323 gene locus_tag LOCUS_04140 gene rsxG 2667 3323 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_04140 3310 4011 gene locus_tag LOCUS_04150 3310 4011 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_04150 4049 4684 gene locus_tag LOCUS_04160 gene nth 4049 4684 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 protein_id gnl|my_center|LOCUS_04160 4737 5186 gene locus_tag LOCUS_04170 4737 5186 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688307.1 protein_id gnl|my_center|LOCUS_04170 5273 6121 gene locus_tag LOCUS_04180 5273 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_04180 6130 7206 gene locus_tag LOCUS_04190 6130 7206 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083076.1 protein_id gnl|my_center|LOCUS_04190 7530 7195 gene locus_tag LOCUS_04200 7530 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 7683 8873 gene locus_tag LOCUS_04210 7683 8873 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705473.1 protein_id gnl|my_center|LOCUS_04210 8885 11116 gene locus_tag LOCUS_04220 8885 11116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 11499 12296 gene locus_tag LOCUS_04230 11499 12296 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112316.1 protein_id gnl|my_center|LOCUS_04230 12339 12641 gene locus_tag LOCUS_04240 gene ureA 12339 12641 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186513.1 protein_id gnl|my_center|LOCUS_04240 12675 13004 gene locus_tag LOCUS_04250 12675 13004 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_04250 13001 14704 gene locus_tag LOCUS_04260 gene ureC 13001 14704 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205201.1 protein_id gnl|my_center|LOCUS_04260 14804 15523 gene locus_tag LOCUS_04270 14804 15523 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 protein_id gnl|my_center|LOCUS_04270 15586 16221 gene locus_tag LOCUS_04280 gene ureG 15586 16221 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_04280 16466 17578 gene locus_tag LOCUS_04290 16466 17578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 17640 18929 gene locus_tag LOCUS_04300 gene urtA 17640 18929 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969811.1 protein_id gnl|my_center|LOCUS_04300 19016 20650 gene locus_tag LOCUS_04310 gene urtB 19016 20650 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 protein_id gnl|my_center|LOCUS_04310 20654 21796 gene locus_tag LOCUS_04320 gene urtC 20654 21796 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 protein_id gnl|my_center|LOCUS_04320 21793 22629 gene locus_tag LOCUS_04330 gene urtD 21793 22629 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 protein_id gnl|my_center|LOCUS_04330 22626 23339 gene locus_tag LOCUS_04340 gene urtE 22626 23339 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_04340 24096 23359 gene locus_tag LOCUS_04350 24096 23359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 26118 24124 gene locus_tag LOCUS_04360 26118 24124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 28275 26128 gene locus_tag LOCUS_04370 28275 26128 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_04370 30135 28291 gene locus_tag LOCUS_04380 30135 28291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 30031 30357 gene locus_tag LOCUS_04390 30031 30357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 30597 30244 gene locus_tag LOCUS_04400 30597 30244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 52323 30697 gene locus_tag LOCUS_04410 52323 30697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 53850 52513 gene locus_tag LOCUS_04420 gene opmH 53850 52513 CDS product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_04420 54282 54788 gene locus_tag LOCUS_04430 54282 54788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 55186 54812 gene locus_tag LOCUS_04440 55186 54812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence007 2716 443 gene locus_tag LOCUS_04450 gene bamA 2716 443 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266976.1 protein_id gnl|my_center|LOCUS_04450 4150 2786 gene locus_tag LOCUS_04460 gene rseP 4150 2786 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 protein_id gnl|my_center|LOCUS_04460 5424 4147 gene locus_tag LOCUS_04470 gene ispC 5424 4147 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_04470 6355 5435 gene locus_tag LOCUS_04480 6355 5435 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036560.1 protein_id gnl|my_center|LOCUS_04480 7233 6412 gene locus_tag LOCUS_04490 gene uppS 7233 6412 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 protein_id gnl|my_center|LOCUS_04490 7813 7256 gene locus_tag LOCUS_04500 gene frr 7813 7256 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958191.1 protein_id gnl|my_center|LOCUS_04500 8544 7825 gene locus_tag LOCUS_04510 gene pyrH 8544 7825 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_04510 9426 8554 gene locus_tag LOCUS_04520 gene tsf 9426 8554 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_04520 10517 9501 gene locus_tag LOCUS_04530 gene rpsB 10517 9501 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036567.1 protein_id gnl|my_center|LOCUS_04530 10779 11546 gene locus_tag LOCUS_04540 gene map 10779 11546 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_04540 11596 14247 gene locus_tag LOCUS_04550 11596 14247 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_04550 14244 14855 gene locus_tag LOCUS_04560 14244 14855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 15842 14913 gene locus_tag LOCUS_04570 15842 14913 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_04570 16082 17278 gene locus_tag LOCUS_04580 gene dapC 16082 17278 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_04580 17344 18165 gene locus_tag LOCUS_04590 gene dapD 17344 18165 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_04590 18197 19330 gene locus_tag LOCUS_04600 gene dapE 18197 19330 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082377.1 protein_id gnl|my_center|LOCUS_04600 19375 19758 gene locus_tag LOCUS_04610 gene mapZ 19375 19758 CDS product cyclic di-GMP-binding protein MapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094864.1 protein_id gnl|my_center|LOCUS_04610 21592 19823 gene locus_tag LOCUS_04620 21592 19823 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_04620 22316 21699 gene locus_tag LOCUS_04630 gene cysC 22316 21699 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_04630 22907 22368 gene locus_tag LOCUS_04640 22907 22368 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_04640 23111 23779 gene locus_tag LOCUS_04650 23111 23779 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090386.1 protein_id gnl|my_center|LOCUS_04650 25626 23833 gene locus_tag LOCUS_04660 gene recJ 25626 23833 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_04660 26711 25638 gene locus_tag LOCUS_04670 26711 25638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 27123 26725 gene locus_tag LOCUS_04680 27123 26725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 27363 27887 gene locus_tag LOCUS_04690 27363 27887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 27881 28585 gene locus_tag LOCUS_04700 27881 28585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 28582 29124 gene locus_tag LOCUS_04710 28582 29124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 29124 29630 gene locus_tag LOCUS_04720 29124 29630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 30847 29585 gene locus_tag LOCUS_04730 30847 29585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 30943 33912 gene locus_tag LOCUS_04740 30943 33912 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894214.1 protein_id gnl|my_center|LOCUS_04740 34011 34460 gene locus_tag LOCUS_04750 34011 34460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 35601 34750 gene locus_tag LOCUS_04760 gene rpoH 35601 34750 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402233.1 protein_id gnl|my_center|LOCUS_04760 39952 35876 gene locus_tag LOCUS_04770 39952 35876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 41277 40198 gene locus_tag LOCUS_04780 gene thrC 41277 40198 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048893.1 protein_id gnl|my_center|LOCUS_04780 42636 41320 gene locus_tag LOCUS_04790 42636 41320 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_04790 43877 42633 gene locus_tag LOCUS_04800 gene alaC 43877 42633 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947188.1 protein_id gnl|my_center|LOCUS_04800 44135 44059 gene locus_tag LOCUS_t00040 44135 44059 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44537 44181 gene locus_tag LOCUS_04810 44537 44181 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_04810 44817 44515 gene locus_tag LOCUS_04820 gene ihfA 44817 44515 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_04820 47206 44822 gene locus_tag LOCUS_04830 gene pheT 47206 44822 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114408.1 protein_id gnl|my_center|LOCUS_04830 48304 47273 gene locus_tag LOCUS_04840 gene pheS 48304 47273 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_04840 48819 48460 gene locus_tag LOCUS_04850 gene rplT 48819 48460 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_04850 49054 48857 gene locus_tag LOCUS_04860 gene rpmI 49054 48857 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 protein_id gnl|my_center|LOCUS_04860 49608 49108 gene locus_tag LOCUS_04870 gene infC 49608 49108 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119938.1 protein_id gnl|my_center|LOCUS_04870 51562 49637 gene locus_tag LOCUS_04880 gene thrS 51562 49637 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443963.1 protein_id gnl|my_center|LOCUS_04880 51743 51667 gene locus_tag LOCUS_t00050 51743 51667 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 60 150 gene locus_tag LOCUS_t00060 60 150 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2566 539 gene locus_tag LOCUS_04890 2566 539 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018575409.1 protein_id gnl|my_center|LOCUS_04890 3265 2855 gene locus_tag LOCUS_04900 3265 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 4608 3262 gene locus_tag LOCUS_04910 4608 3262 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_04910 5036 4605 gene locus_tag LOCUS_04920 5036 4605 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_04920 5218 5033 gene locus_tag LOCUS_04930 5218 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5870 5445 gene locus_tag LOCUS_04940 5870 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 6915 5914 gene locus_tag LOCUS_04950 6915 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 7842 6943 gene locus_tag LOCUS_04960 7842 6943 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084482.1 protein_id gnl|my_center|LOCUS_04960 8147 7824 gene locus_tag LOCUS_04970 8147 7824 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668232.1 protein_id gnl|my_center|LOCUS_04970 8289 9458 gene locus_tag LOCUS_04980 8289 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 9458 10417 gene locus_tag LOCUS_04990 9458 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 10501 11100 gene locus_tag LOCUS_05000 10501 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 11435 11656 gene locus_tag LOCUS_05010 11435 11656 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490270.1 protein_id gnl|my_center|LOCUS_05010 11653 12129 gene locus_tag LOCUS_05020 11653 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 12186 13106 gene locus_tag LOCUS_05030 12186 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 13106 13696 gene locus_tag LOCUS_05040 13106 13696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 13709 15433 gene locus_tag LOCUS_05050 13709 15433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 15430 15786 gene locus_tag LOCUS_05060 15430 15786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 15798 16556 gene locus_tag LOCUS_05070 15798 16556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 16556 18730 gene locus_tag LOCUS_05080 16556 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 19033 19503 gene locus_tag LOCUS_05090 19033 19503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 19500 19889 gene locus_tag LOCUS_05100 19500 19889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 20148 21446 gene locus_tag LOCUS_05110 20148 21446 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_05110 21883 21458 gene locus_tag LOCUS_05120 21883 21458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 22119 21907 gene locus_tag LOCUS_05130 22119 21907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 22239 22778 gene locus_tag LOCUS_05140 22239 22778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 22726 24753 gene locus_tag LOCUS_05150 22726 24753 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_05150 24763 24990 gene locus_tag LOCUS_05160 24763 24990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 24996 26531 gene locus_tag LOCUS_05170 24996 26531 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975801.1 protein_id gnl|my_center|LOCUS_05170 26503 27723 gene locus_tag LOCUS_05180 26503 27723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 27720 28106 gene locus_tag LOCUS_05190 27720 28106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 28118 29149 gene locus_tag LOCUS_05200 28118 29149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 29161 29490 gene locus_tag LOCUS_05210 29161 29490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 29550 29879 gene locus_tag LOCUS_05220 29550 29879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 29885 30421 gene locus_tag LOCUS_05230 29885 30421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 30418 30921 gene locus_tag LOCUS_05240 30418 30921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113200.1 protein_id gnl|my_center|LOCUS_05240 30905 31486 gene locus_tag LOCUS_05250 30905 31486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 31489 31824 gene locus_tag LOCUS_05260 31489 31824 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038106.1 protein_id gnl|my_center|LOCUS_05260 31821 32717 gene locus_tag LOCUS_05270 31821 32717 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085151.1 protein_id gnl|my_center|LOCUS_05270 32710 33447 gene locus_tag LOCUS_05280 32710 33447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 33444 34403 gene locus_tag LOCUS_05290 33444 34403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 34403 34747 gene locus_tag LOCUS_05300 34403 34747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 34779 36008 gene locus_tag LOCUS_05310 34779 36008 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113197.1 protein_id gnl|my_center|LOCUS_05310 36021 36524 gene locus_tag LOCUS_05320 36021 36524 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247634.1 protein_id gnl|my_center|LOCUS_05320 36541 36822 gene locus_tag LOCUS_05330 36541 36822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 36819 37061 gene locus_tag LOCUS_05340 36819 37061 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104527.1 protein_id gnl|my_center|LOCUS_05340 37196 39496 gene locus_tag LOCUS_05350 37196 39496 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390260.1 protein_id gnl|my_center|LOCUS_05350 39790 39542 gene locus_tag LOCUS_05360 39790 39542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816259.1 protein_id gnl|my_center|LOCUS_05360 39872 40312 gene locus_tag LOCUS_05370 39872 40312 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140365.1 protein_id gnl|my_center|LOCUS_05370 40312 40521 gene locus_tag LOCUS_05380 40312 40521 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339239.1 protein_id gnl|my_center|LOCUS_05380 40526 41497 gene locus_tag LOCUS_05390 40526 41497 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132828.1 protein_id gnl|my_center|LOCUS_05390 41560 41847 gene locus_tag LOCUS_05400 41560 41847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 41850 42308 gene locus_tag LOCUS_05410 41850 42308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 42310 42789 gene locus_tag LOCUS_05420 42310 42789 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 protein_id gnl|my_center|LOCUS_05420 43182 44243 gene locus_tag LOCUS_05430 43182 44243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 46698 44251 gene locus_tag LOCUS_05440 46698 44251 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681132.1 protein_id gnl|my_center|LOCUS_05440 47875 47051 gene locus_tag LOCUS_05450 47875 47051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05450 48135 47869 gene locus_tag LOCUS_05460 48135 47869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05460 50737 48446 gene locus_tag LOCUS_05470 50737 48446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 51091 50888 gene locus_tag LOCUS_05480 51091 50888 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775716.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence009 895 275 gene locus_tag LOCUS_05490 895 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 1303 902 gene locus_tag LOCUS_05500 1303 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2385 1300 gene locus_tag LOCUS_05510 2385 1300 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_05510 3461 2487 gene locus_tag LOCUS_05520 gene gshB 3461 2487 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100943.1 protein_id gnl|my_center|LOCUS_05520 4839 3517 gene locus_tag LOCUS_05530 gene gshA 4839 3517 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_05530 5724 4984 gene locus_tag LOCUS_05540 5724 4984 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_05540 7165 5807 gene locus_tag LOCUS_05550 7165 5807 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266413.1 protein_id gnl|my_center|LOCUS_05550 9147 7219 gene locus_tag LOCUS_05560 9147 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 9398 9159 gene locus_tag LOCUS_05570 9398 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 9318 9686 gene locus_tag LOCUS_05580 9318 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 10767 9748 gene locus_tag LOCUS_05590 10767 9748 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_05590 11057 12079 gene locus_tag LOCUS_05600 gene birA 11057 12079 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 protein_id gnl|my_center|LOCUS_05600 12097 12981 gene locus_tag LOCUS_05610 12097 12981 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_05610 12978 13676 gene locus_tag LOCUS_05620 12978 13676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 13828 13903 gene locus_tag LOCUS_t00070 13828 13903 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14123 14500 gene locus_tag LOCUS_05630 14123 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 15227 14820 gene locus_tag LOCUS_05640 15227 14820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 15432 17492 gene locus_tag LOCUS_05650 15432 17492 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_05650 17629 20199 gene locus_tag LOCUS_05660 17629 20199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 21271 20264 gene locus_tag LOCUS_05670 21271 20264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 21603 22280 gene locus_tag LOCUS_05680 21603 22280 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965709.1 protein_id gnl|my_center|LOCUS_05680 22285 23748 gene locus_tag LOCUS_05690 22285 23748 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_05690 23851 24912 gene locus_tag LOCUS_05700 23851 24912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 25041 26003 gene locus_tag LOCUS_05710 gene pip 25041 26003 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_05710 26000 26455 gene locus_tag LOCUS_05720 gene dtd 26000 26455 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337353.1 protein_id gnl|my_center|LOCUS_05720 26463 27281 gene locus_tag LOCUS_05730 gene apaH 26463 27281 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095538.1 protein_id gnl|my_center|LOCUS_05730 28284 27373 gene locus_tag LOCUS_05740 gene hemF 28284 27373 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_05740 28915 28352 gene locus_tag LOCUS_05750 28915 28352 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097300.1 protein_id gnl|my_center|LOCUS_05750 29421 28912 gene locus_tag LOCUS_05760 gene purE 29421 28912 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_05760 30811 29504 gene locus_tag LOCUS_05770 gene purD 30811 29504 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197681.1 protein_id gnl|my_center|LOCUS_05770 31045 30887 gene locus_tag LOCUS_05780 31045 30887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 31080 37046 gene locus_tag LOCUS_05790 31080 37046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 38676 37090 gene locus_tag LOCUS_05800 gene purH 38676 37090 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057885.1 protein_id gnl|my_center|LOCUS_05800 39004 38720 gene locus_tag LOCUS_05810 gene fis 39004 38720 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210061.1 protein_id gnl|my_center|LOCUS_05810 39987 39001 gene locus_tag LOCUS_05820 gene dusB 39987 39001 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035999.1 protein_id gnl|my_center|LOCUS_05820 40963 40259 gene locus_tag LOCUS_05830 40963 40259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 41954 41040 gene locus_tag LOCUS_05840 gene prmA 41954 41040 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_05840 42721 41951 gene locus_tag LOCUS_05850 42721 41951 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_05850 43891 42758 gene locus_tag LOCUS_05860 43891 42758 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257894.1 protein_id gnl|my_center|LOCUS_05860 44739 43888 gene locus_tag LOCUS_05870 44739 43888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 45587 44739 gene locus_tag LOCUS_05880 45587 44739 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence010 1570 755 gene locus_tag LOCUS_05890 1570 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 2630 1584 gene locus_tag LOCUS_05900 2630 1584 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_05900 3044 2886 gene locus_tag LOCUS_05910 3044 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3218 3134 gene locus_tag LOCUS_t00080 3218 3134 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5272 3302 gene locus_tag LOCUS_05920 5272 3302 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_05920 5469 5396 gene locus_tag LOCUS_t00090 5469 5396 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5635 5560 gene locus_tag LOCUS_t00100 5635 5560 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6279 5722 gene locus_tag LOCUS_05930 gene pgsA 6279 5722 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737927.1 protein_id gnl|my_center|LOCUS_05930 8177 6336 gene locus_tag LOCUS_05940 gene uvrC 8177 6336 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_05940 8921 8238 gene locus_tag LOCUS_05950 8921 8238 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389613.1 protein_id gnl|my_center|LOCUS_05950 9456 8926 gene locus_tag LOCUS_05960 gene raiA 9456 8926 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957331.1 protein_id gnl|my_center|LOCUS_05960 11872 9650 gene locus_tag LOCUS_05970 gene relA 11872 9650 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_05970 12524 12069 gene locus_tag LOCUS_05980 12524 12069 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_05980 13158 13607 gene locus_tag LOCUS_05990 13158 13607 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_05990 13619 14299 gene locus_tag LOCUS_06000 13619 14299 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_06000 15291 14371 gene locus_tag LOCUS_06010 15291 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 17773 15284 gene locus_tag LOCUS_06020 17773 15284 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_06020 19574 17829 gene locus_tag LOCUS_06030 19574 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143819.1 protein_id gnl|my_center|LOCUS_06030 19731 20159 gene locus_tag LOCUS_06040 19731 20159 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085898.1 protein_id gnl|my_center|LOCUS_06040 21663 20233 gene locus_tag LOCUS_06050 21663 20233 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356999.1 protein_id gnl|my_center|LOCUS_06050 22125 21694 gene locus_tag LOCUS_06060 22125 21694 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162839581.1 protein_id gnl|my_center|LOCUS_06060 23149 22334 gene locus_tag LOCUS_06070 23149 22334 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268467.1 protein_id gnl|my_center|LOCUS_06070 24773 23139 gene locus_tag LOCUS_06080 24773 23139 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268468.1 protein_id gnl|my_center|LOCUS_06080 25137 24928 gene locus_tag LOCUS_06090 25137 24928 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037421425.1 protein_id gnl|my_center|LOCUS_06090 27210 25318 gene locus_tag LOCUS_06100 27210 25318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 27703 27194 gene locus_tag LOCUS_06110 27703 27194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 28350 27700 gene locus_tag LOCUS_06120 gene lasI 28350 27700 CDS product acyl-homoserine-lactone synthase LasI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083017.1 protein_id gnl|my_center|LOCUS_06120 29374 28598 gene locus_tag LOCUS_06130 gene malR 29374 28598 CDS product LuxR family transcriptional regulator MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205386.1 protein_id gnl|my_center|LOCUS_06130 30351 29671 gene locus_tag LOCUS_06140 30351 29671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 31579 30596 gene locus_tag LOCUS_06150 31579 30596 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_06150 35607 31573 gene locus_tag LOCUS_06160 gene hrpA 35607 31573 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_06160 38568 35863 gene locus_tag LOCUS_06170 38568 35863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 38885 39745 gene locus_tag LOCUS_06180 38885 39745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 41626 39812 gene locus_tag LOCUS_06190 41626 39812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence011 236 421 gene locus_tag LOCUS_06200 236 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 528 2390 gene locus_tag LOCUS_06210 528 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2552 2950 gene locus_tag LOCUS_06220 2552 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3294 4583 gene locus_tag LOCUS_06230 3294 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 4827 6347 gene locus_tag LOCUS_06240 4827 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 7315 6401 gene locus_tag LOCUS_06250 7315 6401 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 protein_id gnl|my_center|LOCUS_06250 7469 7699 gene locus_tag LOCUS_06260 7469 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 7905 7981 gene locus_tag LOCUS_t00110 7905 7981 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8121 10097 gene locus_tag LOCUS_06270 8121 10097 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_06270 10197 11909 gene locus_tag LOCUS_06280 10197 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 13379 12039 gene locus_tag LOCUS_06290 13379 12039 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_06290 14086 13379 gene locus_tag LOCUS_06300 14086 13379 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_06300 14664 14293 gene locus_tag LOCUS_06310 gene nirM 14664 14293 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_06310 14818 15492 gene locus_tag LOCUS_06320 gene lexA 14818 15492 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267741.1 protein_id gnl|my_center|LOCUS_06320 15489 16742 gene locus_tag LOCUS_06330 gene dinB 15489 16742 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 protein_id gnl|my_center|LOCUS_06330 17110 16961 gene locus_tag LOCUS_06340 17110 16961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 17758 17387 gene locus_tag LOCUS_06350 17758 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 18108 19628 gene locus_tag LOCUS_06360 gene glpK 18108 19628 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919105.1 protein_id gnl|my_center|LOCUS_06360 19625 20422 gene locus_tag LOCUS_06370 19625 20422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 20422 21627 gene locus_tag LOCUS_06380 20422 21627 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 protein_id gnl|my_center|LOCUS_06380 22012 21668 gene locus_tag LOCUS_06390 22012 21668 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_06390 22485 22042 gene locus_tag LOCUS_06400 22485 22042 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125638.1 protein_id gnl|my_center|LOCUS_06400 23337 22513 gene locus_tag LOCUS_06410 gene cpdA 23337 22513 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707475.1 protein_id gnl|my_center|LOCUS_06410 23660 23334 gene locus_tag LOCUS_06420 23660 23334 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229084.1 protein_id gnl|my_center|LOCUS_06420 24405 23716 gene locus_tag LOCUS_06430 gene tsaB 24405 23716 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765933.1 protein_id gnl|my_center|LOCUS_06430 26351 24402 gene locus_tag LOCUS_06440 26351 24402 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_06440 26907 26401 gene locus_tag LOCUS_06450 26907 26401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 27523 26945 gene locus_tag LOCUS_06460 27523 26945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 28868 27516 gene locus_tag LOCUS_06470 28868 27516 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880881.1 protein_id gnl|my_center|LOCUS_06470 29979 28813 gene locus_tag LOCUS_06480 29979 28813 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_06480 30284 31144 gene locus_tag LOCUS_06490 30284 31144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 31208 32806 gene locus_tag LOCUS_06500 31208 32806 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_06500 34774 32810 gene locus_tag LOCUS_06510 34774 32810 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207273.1 protein_id gnl|my_center|LOCUS_06510 35259 34771 gene locus_tag LOCUS_06520 35259 34771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 35858 35463 gene locus_tag LOCUS_06530 35858 35463 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812171.1 protein_id gnl|my_center|LOCUS_06530 36135 35863 gene locus_tag LOCUS_06540 36135 35863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 37366 36263 gene locus_tag LOCUS_06550 gene amrS 37366 36263 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_06550 37607 38413 gene locus_tag LOCUS_06560 gene amrB 37607 38413 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_06560 38382 39005 gene locus_tag LOCUS_06570 38382 39005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 40014 39013 gene locus_tag LOCUS_06580 40014 39013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence012 326 1210 gene locus_tag LOCUS_06590 326 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1998 1288 gene locus_tag LOCUS_06600 1998 1288 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039188.1 protein_id gnl|my_center|LOCUS_06600 2827 1982 gene locus_tag LOCUS_06610 2827 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 3298 2945 gene locus_tag LOCUS_06620 3298 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 4331 3360 gene locus_tag LOCUS_06630 gene trxB 4331 3360 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941156.1 protein_id gnl|my_center|LOCUS_06630 4523 5605 gene locus_tag LOCUS_06640 gene ald 4523 5605 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143957.1 protein_id gnl|my_center|LOCUS_06640 5720 8071 gene locus_tag LOCUS_06650 5720 8071 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772567.1 protein_id gnl|my_center|LOCUS_06650 8077 8754 gene locus_tag LOCUS_06660 gene lolA 8077 8754 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162301084.1 protein_id gnl|my_center|LOCUS_06660 8824 10134 gene locus_tag LOCUS_06670 8824 10134 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_06670 10165 10539 gene locus_tag LOCUS_06680 gene crcB 10165 10539 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 protein_id gnl|my_center|LOCUS_06680 10536 10871 gene locus_tag LOCUS_06690 10536 10871 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957951.1 protein_id gnl|my_center|LOCUS_06690 11008 12195 gene locus_tag LOCUS_06700 11008 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 14182 12224 gene locus_tag LOCUS_06710 gene mutL 14182 12224 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_06710 15756 14458 gene locus_tag LOCUS_06720 gene amiB 15756 14458 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_06720 16482 15946 gene locus_tag LOCUS_06730 gene tsaE 16482 15946 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815423.1 protein_id gnl|my_center|LOCUS_06730 18056 16479 gene locus_tag LOCUS_06740 18056 16479 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_06740 18180 19412 gene locus_tag LOCUS_06750 gene queG 18180 19412 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266491.1 protein_id gnl|my_center|LOCUS_06750 19313 20032 gene locus_tag LOCUS_06760 19313 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 20320 23124 gene locus_tag LOCUS_06770 gene ppc 20320 23124 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_06770 23669 23199 gene locus_tag LOCUS_06780 23669 23199 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 protein_id gnl|my_center|LOCUS_06780 24686 23817 gene locus_tag LOCUS_06790 gene panC 24686 23817 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262612.1 protein_id gnl|my_center|LOCUS_06790 25520 24708 gene locus_tag LOCUS_06800 gene panB 25520 24708 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_06800 26195 25527 gene locus_tag LOCUS_06810 26195 25527 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_06810 26787 26173 gene locus_tag LOCUS_06820 gene folK 26787 26173 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771454.1 protein_id gnl|my_center|LOCUS_06820 28167 26788 gene locus_tag LOCUS_06830 28167 26788 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_06830 28364 28439 gene locus_tag LOCUS_t00120 28364 28439 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 29218 28739 gene locus_tag LOCUS_06840 29218 28739 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971406.1 protein_id gnl|my_center|LOCUS_06840 29713 29450 gene locus_tag LOCUS_06850 29713 29450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 29938 29717 gene locus_tag LOCUS_06860 29938 29717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 29873 30316 gene locus_tag LOCUS_06870 29873 30316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06870 30742 30341 gene locus_tag LOCUS_06880 30742 30341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 32301 31312 gene locus_tag LOCUS_06890 32301 31312 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840062.1 protein_id gnl|my_center|LOCUS_06890 32480 32917 gene locus_tag LOCUS_06900 gene hslR 32480 32917 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660485.1 protein_id gnl|my_center|LOCUS_06900 33339 33136 gene locus_tag LOCUS_06910 33339 33136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 33571 33792 gene locus_tag LOCUS_06920 33571 33792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 34423 34235 gene locus_tag LOCUS_06930 34423 34235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 34376 35242 gene locus_tag LOCUS_06940 34376 35242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 36411 35446 gene locus_tag LOCUS_06950 36411 35446 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_06950 37404 36415 gene locus_tag LOCUS_06960 37404 36415 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 protein_id gnl|my_center|LOCUS_06960 37869 37666 gene locus_tag LOCUS_06970 gene cspC 37869 37666 CDS product cold shock-like protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874276.1 protein_id gnl|my_center|LOCUS_06970 38261 38737 gene locus_tag LOCUS_06980 38261 38737 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_06980 39659 38844 gene locus_tag LOCUS_06990 39659 38844 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139985.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence013 1235 2983 gene locus_tag LOCUS_07000 1235 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 3366 3016 gene locus_tag LOCUS_07010 3366 3016 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_07010 4000 5022 gene locus_tag LOCUS_07020 4000 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 5035 5724 gene locus_tag LOCUS_07030 5035 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 5721 6098 gene locus_tag LOCUS_07040 5721 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 6182 7180 gene locus_tag LOCUS_07050 6182 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 7942 7247 gene locus_tag LOCUS_07060 7942 7247 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337653.1 protein_id gnl|my_center|LOCUS_07060 8969 8070 gene locus_tag LOCUS_07070 8969 8070 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_07070 10178 9051 gene locus_tag LOCUS_07080 10178 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 10719 10940 gene locus_tag LOCUS_07090 10719 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140188.1 protein_id gnl|my_center|LOCUS_07090 10946 11758 gene locus_tag LOCUS_07100 10946 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 11808 12362 gene locus_tag LOCUS_07110 11808 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 12373 13779 gene locus_tag LOCUS_07120 gene mpl 12373 13779 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 protein_id gnl|my_center|LOCUS_07120 13776 14438 gene locus_tag LOCUS_07130 gene ubiX 13776 14438 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_07130 15564 14509 gene locus_tag LOCUS_07140 15564 14509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 16502 15561 gene locus_tag LOCUS_07150 16502 15561 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_07150 16967 16584 gene locus_tag LOCUS_07160 16967 16584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 18428 17151 gene locus_tag LOCUS_07170 18428 17151 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 protein_id gnl|my_center|LOCUS_07170 19424 18447 gene locus_tag LOCUS_07180 19424 18447 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_07180 19633 21003 gene locus_tag LOCUS_07190 19633 21003 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037479.1 protein_id gnl|my_center|LOCUS_07190 20985 21719 gene locus_tag LOCUS_07200 20985 21719 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 protein_id gnl|my_center|LOCUS_07200 24749 21756 gene locus_tag LOCUS_07210 24749 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 26127 24847 gene locus_tag LOCUS_07220 gene hemL 26127 24847 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 protein_id gnl|my_center|LOCUS_07220 26902 26354 gene locus_tag LOCUS_07230 26902 26354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 27849 26965 gene locus_tag LOCUS_07240 27849 26965 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427216.1 protein_id gnl|my_center|LOCUS_07240 27985 28158 gene locus_tag LOCUS_07250 27985 28158 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947264.1 protein_id gnl|my_center|LOCUS_07250 28603 28262 gene locus_tag LOCUS_07260 gene nirM 28603 28262 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_07260 29256 29026 gene locus_tag LOCUS_07270 29256 29026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 30135 29419 gene locus_tag LOCUS_07280 30135 29419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_07280 32309 30156 gene locus_tag LOCUS_07290 32309 30156 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_07290 33819 32638 gene locus_tag LOCUS_07300 gene sat 33819 32638 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_07300 34890 33961 gene locus_tag LOCUS_07310 34890 33961 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 protein_id gnl|my_center|LOCUS_07310 35489 34941 gene locus_tag LOCUS_07320 gene ppa 35489 34941 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948454.1 protein_id gnl|my_center|LOCUS_07320 35971 37980 gene locus_tag LOCUS_07330 35971 37980 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_07330 39417 38155 gene locus_tag LOCUS_07340 39417 38155 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence014 697 359 gene locus_tag LOCUS_07350 697 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 800 1423 gene locus_tag LOCUS_07360 gene rlmE 800 1423 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_07360 1697 3646 gene locus_tag LOCUS_07370 gene ftsH 1697 3646 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_07370 3762 4634 gene locus_tag LOCUS_07380 gene folP 3762 4634 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_07380 4756 6153 gene locus_tag LOCUS_07390 gene glmM 4756 6153 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_07390 6404 7078 gene locus_tag LOCUS_07400 gene tpiA 6404 7078 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100513.1 protein_id gnl|my_center|LOCUS_07400 7095 7556 gene locus_tag LOCUS_07410 7095 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 7586 7670 gene locus_tag LOCUS_t00130 7586 7670 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7961 8317 gene locus_tag LOCUS_07420 7961 8317 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_07420 8442 8918 gene locus_tag LOCUS_07430 8442 8918 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_07430 8927 9550 gene locus_tag LOCUS_07440 8927 9550 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958234.1 protein_id gnl|my_center|LOCUS_07440 9543 10796 gene locus_tag LOCUS_07450 9543 10796 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948475.1 protein_id gnl|my_center|LOCUS_07450 10793 11299 gene locus_tag LOCUS_07460 gene nuoE 10793 11299 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_07460 11304 12611 gene locus_tag LOCUS_07470 gene nuoF 11304 12611 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_07470 12608 15007 gene locus_tag LOCUS_07480 gene nuoG 12608 15007 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948472.1 protein_id gnl|my_center|LOCUS_07480 15118 16173 gene locus_tag LOCUS_07490 gene nuoH 15118 16173 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_07490 16186 16674 gene locus_tag LOCUS_07500 gene nuoI 16186 16674 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_07500 16741 17346 gene locus_tag LOCUS_07510 16741 17346 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_07510 17511 17816 gene locus_tag LOCUS_07520 gene nuoK 17511 17816 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005914274.1 protein_id gnl|my_center|LOCUS_07520 17830 19782 gene locus_tag LOCUS_07530 gene nuoL 17830 19782 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813919.1 protein_id gnl|my_center|LOCUS_07530 19875 21389 gene locus_tag LOCUS_07540 19875 21389 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_07540 21432 22868 gene locus_tag LOCUS_07550 gene nuoN 21432 22868 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958226.1 protein_id gnl|my_center|LOCUS_07550 22995 23786 gene locus_tag LOCUS_07560 gene surE 22995 23786 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770587.1 protein_id gnl|my_center|LOCUS_07560 23786 24445 gene locus_tag LOCUS_07570 23786 24445 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036884.1 protein_id gnl|my_center|LOCUS_07570 24476 25045 gene locus_tag LOCUS_07580 24476 25045 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_07580 25544 25915 gene locus_tag LOCUS_07590 25544 25915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 26029 26799 gene locus_tag LOCUS_07600 26029 26799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 27307 26858 gene locus_tag LOCUS_07610 27307 26858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 28091 27402 gene locus_tag LOCUS_07620 28091 27402 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838970.1 protein_id gnl|my_center|LOCUS_07620 29211 28177 gene locus_tag LOCUS_07630 29211 28177 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_07630 30150 29350 gene locus_tag LOCUS_07640 30150 29350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 31069 30290 gene locus_tag LOCUS_07650 gene coxK1 31069 30290 CDS product Dot/Icm T4SS effector protein kinase CoxK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957418.1 protein_id gnl|my_center|LOCUS_07650 31632 31192 gene locus_tag LOCUS_07660 31632 31192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 32492 32950 gene locus_tag LOCUS_07670 32492 32950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 32958 34460 gene locus_tag LOCUS_07680 gene yegQ 32958 34460 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209798.1 protein_id gnl|my_center|LOCUS_07680 34471 35391 gene locus_tag LOCUS_07690 34471 35391 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_07690 35562 36401 gene locus_tag LOCUS_07700 35562 36401 CDS product DUF3014 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275299.1 protein_id gnl|my_center|LOCUS_07700 36398 37021 gene locus_tag LOCUS_07710 36398 37021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 37169 37582 gene locus_tag LOCUS_07720 37169 37582 CDS product DUF3775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957756.1 protein_id gnl|my_center|LOCUS_07720 37999 39033 gene locus_tag LOCUS_07730 37999 39033 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence015 1083 40 gene locus_tag LOCUS_07740 1083 40 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_07740 1541 2044 gene locus_tag LOCUS_07750 gene def 1541 2044 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401459.1 protein_id gnl|my_center|LOCUS_07750 2059 3054 gene locus_tag LOCUS_07760 gene fmt 2059 3054 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174602.1 protein_id gnl|my_center|LOCUS_07760 3065 4366 gene locus_tag LOCUS_07770 gene rsmB 3065 4366 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_07770 4451 5065 gene locus_tag LOCUS_07780 4451 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 5062 7368 gene locus_tag LOCUS_07790 5062 7368 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_07790 7365 8708 gene locus_tag LOCUS_07800 7365 8708 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384095.1 protein_id gnl|my_center|LOCUS_07800 8861 10234 gene locus_tag LOCUS_07810 gene trkA 8861 10234 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_07810 10292 11743 gene locus_tag LOCUS_07820 10292 11743 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260910.1 protein_id gnl|my_center|LOCUS_07820 11757 12329 gene locus_tag LOCUS_07830 11757 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 12758 16213 gene locus_tag LOCUS_07840 12758 16213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 17057 16236 gene locus_tag LOCUS_07850 17057 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 20086 17063 gene locus_tag LOCUS_07860 20086 17063 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_07860 21192 20260 gene locus_tag LOCUS_07870 21192 20260 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_07870 21608 21799 gene locus_tag LOCUS_07880 21608 21799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 22172 23446 gene locus_tag LOCUS_07890 22172 23446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 23884 23561 gene locus_tag LOCUS_07900 23884 23561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 24537 24127 gene locus_tag LOCUS_07910 gene msrB 24537 24127 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144322.1 protein_id gnl|my_center|LOCUS_07910 24743 25549 gene locus_tag LOCUS_07920 24743 25549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 25579 26556 gene locus_tag LOCUS_07930 gene cmoB 25579 26556 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114185.1 protein_id gnl|my_center|LOCUS_07930 26724 27746 gene locus_tag LOCUS_07940 26724 27746 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_07940 28583 27831 gene locus_tag LOCUS_07950 28583 27831 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704670.1 protein_id gnl|my_center|LOCUS_07950 28691 29641 gene locus_tag LOCUS_07960 28691 29641 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_07960 30427 29684 gene locus_tag LOCUS_07970 30427 29684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 31962 30739 gene locus_tag LOCUS_07980 31962 30739 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_07980 32872 32351 gene locus_tag LOCUS_07990 32872 32351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 33764 33015 gene locus_tag LOCUS_08000 33764 33015 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855402.1 protein_id gnl|my_center|LOCUS_08000 34013 33789 gene locus_tag LOCUS_08010 34013 33789 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_08010 37341 34033 gene locus_tag LOCUS_08020 37341 34033 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933702.1 protein_id gnl|my_center|LOCUS_08020 38477 37338 gene locus_tag LOCUS_08030 38477 37338 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence016 <1 930 gene locus_tag LOCUS_08040 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113969.1:molybdopterin molybdotransferase MoeA 2974 950 gene locus_tag LOCUS_08050 2974 950 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_08050 4473 2980 gene locus_tag LOCUS_08060 4473 2980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_08060 5463 4486 gene locus_tag LOCUS_08070 5463 4486 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_08070 7671 5467 gene locus_tag LOCUS_08080 7671 5467 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_08080 8207 8989 gene locus_tag LOCUS_08090 gene fabI 8207 8989 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_08090 9017 10249 gene locus_tag LOCUS_08100 9017 10249 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 protein_id gnl|my_center|LOCUS_08100 12179 10254 gene locus_tag LOCUS_08110 12179 10254 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036187.1 protein_id gnl|my_center|LOCUS_08110 12461 12385 gene locus_tag LOCUS_t00140 12461 12385 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 12593 12518 gene locus_tag LOCUS_t00150 12593 12518 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15525 13072 gene locus_tag LOCUS_08120 gene lon 15525 13072 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_08120 17097 15805 gene locus_tag LOCUS_08130 gene clpX 17097 15805 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_08130 17735 17154 gene locus_tag LOCUS_08140 gene clpP 17735 17154 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891956.1 protein_id gnl|my_center|LOCUS_08140 19331 18015 gene locus_tag LOCUS_08150 gene tig 19331 18015 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087920.1 protein_id gnl|my_center|LOCUS_08150 19487 19403 gene locus_tag LOCUS_t00160 19487 19403 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19854 19779 gene locus_tag LOCUS_t00170 19854 19779 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 20026 19951 gene locus_tag LOCUS_t00180 20026 19951 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 20121 20045 gene locus_tag LOCUS_t00190 20121 20045 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20287 20211 gene locus_tag LOCUS_t00200 20287 20211 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21542 20409 gene locus_tag LOCUS_08160 21542 20409 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 protein_id gnl|my_center|LOCUS_08160 22745 21648 gene locus_tag LOCUS_08170 gene aroC 22745 21648 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918437.1 protein_id gnl|my_center|LOCUS_08170 24219 22831 gene locus_tag LOCUS_08180 gene hemN 24219 22831 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_08180 25343 24402 gene locus_tag LOCUS_08190 gene prmB 25343 24402 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_08190 25523 27187 gene locus_tag LOCUS_08200 gene ettA 25523 27187 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_08200 27184 27942 gene locus_tag LOCUS_08210 27184 27942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 27939 28502 gene locus_tag LOCUS_08220 gene rimI 27939 28502 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_08220 30119 28578 gene locus_tag LOCUS_08230 30119 28578 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_08230 31313 30486 gene locus_tag LOCUS_08240 gene pssA 31313 30486 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_08240 31962 31354 gene locus_tag LOCUS_08250 31962 31354 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531897.1 protein_id gnl|my_center|LOCUS_08250 33046 32030 gene locus_tag LOCUS_08260 gene ilvC 33046 32030 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_08260 33609 33118 gene locus_tag LOCUS_08270 gene ilvN 33609 33118 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_08270 35324 33615 gene locus_tag LOCUS_08280 35324 33615 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_08280 35481 35825 gene locus_tag LOCUS_08290 35481 35825 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811601.1 protein_id gnl|my_center|LOCUS_08290 36566 35913 gene locus_tag LOCUS_08300 36566 35913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 <38247 36628 gene locus_tag LOCUS_08310 <38247 36628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204961.1:FtsX-like permease family protein >Feature sequence017 2646 457 gene locus_tag LOCUS_08320 gene glgB 2646 457 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_08320 2872 4203 gene locus_tag LOCUS_08330 gene glgC 2872 4203 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_08330 4193 5914 gene locus_tag LOCUS_08340 4193 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 5923 7437 gene locus_tag LOCUS_08350 gene malQ 5923 7437 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_08350 10179 7615 gene locus_tag LOCUS_08360 10179 7615 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_08360 10570 10484 gene locus_tag LOCUS_t00210 10570 10484 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10615 11739 gene locus_tag LOCUS_08370 gene queA 10615 11739 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_08370 11757 12872 gene locus_tag LOCUS_08380 gene tgt 11757 12872 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 protein_id gnl|my_center|LOCUS_08380 12972 13301 gene locus_tag LOCUS_08390 gene yajC 12972 13301 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_08390 13367 15223 gene locus_tag LOCUS_08400 gene secD 13367 15223 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_08400 15251 16186 gene locus_tag LOCUS_08410 gene secF 15251 16186 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_08410 17897 16278 gene locus_tag LOCUS_08420 17897 16278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 18399 19658 gene locus_tag LOCUS_08430 18399 19658 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895616.1 protein_id gnl|my_center|LOCUS_08430 19707 20249 gene locus_tag LOCUS_08440 gene nrdR 19707 20249 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_08440 20246 21397 gene locus_tag LOCUS_08450 gene ribD 20246 21397 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707100.1 protein_id gnl|my_center|LOCUS_08450 21422 22114 gene locus_tag LOCUS_08460 21422 22114 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103236.1 protein_id gnl|my_center|LOCUS_08460 22117 23253 gene locus_tag LOCUS_08470 gene ribBA 22117 23253 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_08470 23250 23738 gene locus_tag LOCUS_08480 gene ribE 23250 23738 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119264.1 protein_id gnl|my_center|LOCUS_08480 23797 24276 gene locus_tag LOCUS_08490 gene nusB 23797 24276 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073312.1 protein_id gnl|my_center|LOCUS_08490 24307 25287 gene locus_tag LOCUS_08500 gene thiL 24307 25287 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704562.1 protein_id gnl|my_center|LOCUS_08500 25280 25783 gene locus_tag LOCUS_08510 25280 25783 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_08510 26177 26488 gene locus_tag LOCUS_08520 26177 26488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 28523 26505 gene locus_tag LOCUS_08530 28523 26505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 28990 28520 gene locus_tag LOCUS_08540 28990 28520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 30051 28987 gene locus_tag LOCUS_08550 30051 28987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 31026 30331 gene locus_tag LOCUS_08560 31026 30331 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_08560 31833 31033 gene locus_tag LOCUS_08570 gene folE2 31833 31033 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_08570 32234 31830 gene locus_tag LOCUS_08580 gene queD 32234 31830 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_08580 34154 32253 gene locus_tag LOCUS_08590 gene dxs 34154 32253 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102816.1 protein_id gnl|my_center|LOCUS_08590 35147 34242 gene locus_tag LOCUS_08600 35147 34242 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_08600 35412 35140 gene locus_tag LOCUS_08610 35412 35140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence018 3595 2618 gene locus_tag LOCUS_08620 3595 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 5011 3596 gene locus_tag LOCUS_08630 5011 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 5709 5083 gene locus_tag LOCUS_08640 5709 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 6669 5851 gene locus_tag LOCUS_08650 6669 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 7918 6857 gene locus_tag LOCUS_08660 7918 6857 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_08660 9059 8115 gene locus_tag LOCUS_08670 9059 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 10237 9620 gene locus_tag LOCUS_08680 gene cobC 10237 9620 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_08680 10716 10255 gene locus_tag LOCUS_08690 gene nikR 10716 10255 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_08690 11726 11058 gene locus_tag LOCUS_08700 11726 11058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 12944 11853 gene locus_tag LOCUS_08710 12944 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 13747 12947 gene locus_tag LOCUS_08720 13747 12947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 14400 13744 gene locus_tag LOCUS_08730 gene cbiM 14400 13744 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_08730 15171 14527 gene locus_tag LOCUS_08740 15171 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 15988 15515 gene locus_tag LOCUS_08750 gene moaE 15988 15515 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350081.1 protein_id gnl|my_center|LOCUS_08750 16224 15991 gene locus_tag LOCUS_08760 gene moaD 16224 15991 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 protein_id gnl|my_center|LOCUS_08760 16782 16294 gene locus_tag LOCUS_08770 gene moaC 16782 16294 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_08770 17851 16877 gene locus_tag LOCUS_08780 gene moaA 17851 16877 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933001.1 protein_id gnl|my_center|LOCUS_08780 18610 19539 gene locus_tag LOCUS_08790 18610 19539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 19557 20357 gene locus_tag LOCUS_08800 gene moeB 19557 20357 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929912.1 protein_id gnl|my_center|LOCUS_08800 20622 21791 gene locus_tag LOCUS_08810 gene moeB 20622 21791 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_08810 22690 21815 gene locus_tag LOCUS_08820 22690 21815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 25996 22913 gene locus_tag LOCUS_08830 25996 22913 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_08830 27117 25993 gene locus_tag LOCUS_08840 27117 25993 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_08840 28200 27166 gene locus_tag LOCUS_08850 28200 27166 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_08850 31324 28193 gene locus_tag LOCUS_08860 31324 28193 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 protein_id gnl|my_center|LOCUS_08860 32721 31474 gene locus_tag LOCUS_08870 32721 31474 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 protein_id gnl|my_center|LOCUS_08870 32805 34991 gene locus_tag LOCUS_08880 gene lptD 32805 34991 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_08880 35173 36417 gene locus_tag LOCUS_08890 35173 36417 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence019 91 1770 gene locus_tag LOCUS_08900 gene xcpR 91 1770 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_08900 1803 3020 gene locus_tag LOCUS_08910 gene gspF 1803 3020 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_08910 3047 3463 gene locus_tag LOCUS_08920 gene xcpT 3047 3463 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_08920 3546 4016 gene locus_tag LOCUS_08930 3546 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4006 4428 gene locus_tag LOCUS_08940 4006 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 4449 5096 gene locus_tag LOCUS_08950 4449 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 5077 6048 gene locus_tag LOCUS_08960 gene xcpX 5077 6048 CDS product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 protein_id gnl|my_center|LOCUS_08960 6048 7301 gene locus_tag LOCUS_08970 gene lspL 6048 7301 CDS product GspL family type II secretion system protein LspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947594.1 protein_id gnl|my_center|LOCUS_08970 7298 7789 gene locus_tag LOCUS_08980 7298 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 7786 8688 gene locus_tag LOCUS_08990 7786 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 10109 8853 gene locus_tag LOCUS_09000 gene rho 10109 8853 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769919.1 protein_id gnl|my_center|LOCUS_09000 10830 10504 gene locus_tag LOCUS_09010 gene trxA 10830 10504 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_09010 11170 12576 gene locus_tag LOCUS_09020 gene rhlB 11170 12576 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750771.1 protein_id gnl|my_center|LOCUS_09020 12590 13336 gene locus_tag LOCUS_09030 12590 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 14644 13382 gene locus_tag LOCUS_09040 14644 13382 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_09040 16047 14641 gene locus_tag LOCUS_09050 16047 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 16921 16040 gene locus_tag LOCUS_09060 gene hemD 16921 16040 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883127.1 protein_id gnl|my_center|LOCUS_09060 17878 16949 gene locus_tag LOCUS_09070 gene hemC 17878 16949 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208189.1 protein_id gnl|my_center|LOCUS_09070 19028 18288 gene locus_tag LOCUS_09080 19028 18288 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 protein_id gnl|my_center|LOCUS_09080 20152 19025 gene locus_tag LOCUS_09090 gene algZ 20152 19025 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_09090 20301 21734 gene locus_tag LOCUS_09100 gene argH 20301 21734 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_09100 22072 24921 gene locus_tag LOCUS_09110 22072 24921 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103041.1 protein_id gnl|my_center|LOCUS_09110 25407 24970 gene locus_tag LOCUS_09120 25407 24970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 25406 25618 gene locus_tag LOCUS_09130 25406 25618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 25947 26813 gene locus_tag LOCUS_09140 25947 26813 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_09140 28590 26896 gene locus_tag LOCUS_09150 28590 26896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 28731 28910 gene locus_tag LOCUS_09160 28731 28910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 29519 28956 gene locus_tag LOCUS_09170 29519 28956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 29721 30242 gene locus_tag LOCUS_09180 29721 30242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 31982 30297 gene locus_tag LOCUS_09190 31982 30297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence020 591 1079 gene locus_tag LOCUS_09200 gene fabZ 591 1079 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_09200 1076 1693 gene locus_tag LOCUS_09210 gene rnhB 1076 1693 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063751.1 protein_id gnl|my_center|LOCUS_09210 1801 5274 gene locus_tag LOCUS_09220 gene dnaE 1801 5274 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946697.1 protein_id gnl|my_center|LOCUS_09220 5521 6492 gene locus_tag LOCUS_09230 gene accA 5521 6492 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_09230 6537 7907 gene locus_tag LOCUS_09240 gene tilS 6537 7907 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_09240 9903 7924 gene locus_tag LOCUS_09250 gene acs 9903 7924 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926941.1 protein_id gnl|my_center|LOCUS_09250 10978 10157 gene locus_tag LOCUS_09260 10978 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 11212 11985 gene locus_tag LOCUS_09270 11212 11985 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_09270 12074 13237 gene locus_tag LOCUS_09280 12074 13237 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113459.1 protein_id gnl|my_center|LOCUS_09280 14047 13250 gene locus_tag LOCUS_09290 14047 13250 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119813.1 protein_id gnl|my_center|LOCUS_09290 14814 14044 gene locus_tag LOCUS_09300 gene cysZ 14814 14044 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213487.1 protein_id gnl|my_center|LOCUS_09300 16151 14811 gene locus_tag LOCUS_09310 16151 14811 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920846.1 protein_id gnl|my_center|LOCUS_09310 16581 16192 gene locus_tag LOCUS_09320 gene queF 16581 16192 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 protein_id gnl|my_center|LOCUS_09320 16790 20299 gene locus_tag LOCUS_09330 gene smc 16790 20299 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_09330 20378 22450 gene locus_tag LOCUS_09340 gene ligA 20378 22450 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172221.1 protein_id gnl|my_center|LOCUS_09340 22691 23827 gene locus_tag LOCUS_09350 22691 23827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 23984 25021 gene locus_tag LOCUS_09360 23984 25021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 25168 26421 gene locus_tag LOCUS_09370 25168 26421 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546769.1 protein_id gnl|my_center|LOCUS_09370 27198 26425 gene locus_tag LOCUS_09380 27198 26425 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919005.1 protein_id gnl|my_center|LOCUS_09380 28149 27457 gene locus_tag LOCUS_09390 28149 27457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 28312 29700 gene locus_tag LOCUS_09400 gene rlmD 28312 29700 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence021 6030 2953 gene locus_tag LOCUS_09410 6030 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 6484 6161 gene locus_tag LOCUS_09420 6484 6161 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_09420 9154 6578 gene locus_tag LOCUS_09430 gene mutS 9154 6578 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073287.1 protein_id gnl|my_center|LOCUS_09430 10100 9276 gene locus_tag LOCUS_09440 gene rhdA 10100 9276 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_09440 9546 9621 gene locus_tag LOCUS_t00220 9546 9621 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 11041 10235 gene locus_tag LOCUS_09450 11041 10235 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_09450 11219 11962 gene locus_tag LOCUS_09460 gene trmJ 11219 11962 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_09460 12298 13161 gene locus_tag LOCUS_09470 gene cysE 12298 13161 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_09470 13226 13714 gene locus_tag LOCUS_09480 gene iscR 13226 13714 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 protein_id gnl|my_center|LOCUS_09480 13773 14981 gene locus_tag LOCUS_09490 13773 14981 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388823.1 protein_id gnl|my_center|LOCUS_09490 14999 16273 gene locus_tag LOCUS_09500 14999 16273 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092832.1 protein_id gnl|my_center|LOCUS_09500 16332 16745 gene locus_tag LOCUS_09510 gene iscU 16332 16745 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_09510 16742 17146 gene locus_tag LOCUS_09520 gene iscA 16742 17146 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_09520 17279 17839 gene locus_tag LOCUS_09530 gene hscB 17279 17839 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172628.1 protein_id gnl|my_center|LOCUS_09530 17901 19772 gene locus_tag LOCUS_09540 gene hscA 17901 19772 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100622.1 protein_id gnl|my_center|LOCUS_09540 19785 20123 gene locus_tag LOCUS_09550 gene fdx 19785 20123 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_09550 20120 20341 gene locus_tag LOCUS_09560 gene iscX 20120 20341 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_09560 20570 21001 gene locus_tag LOCUS_09570 gene ndk 20570 21001 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958107.1 protein_id gnl|my_center|LOCUS_09570 21044 22210 gene locus_tag LOCUS_09580 21044 22210 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_09580 22321 23049 gene locus_tag LOCUS_09590 gene tapF 22321 23049 CDS product PilW family type IVa pilus biogenesis/stability lipoprotein TapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705643.1 protein_id gnl|my_center|LOCUS_09590 23046 24050 gene locus_tag LOCUS_09600 23046 24050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 24128 25270 gene locus_tag LOCUS_09610 gene ispG 24128 25270 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_09610 25302 26669 gene locus_tag LOCUS_09620 gene hisS 25302 26669 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140461.1 protein_id gnl|my_center|LOCUS_09620 26686 27321 gene locus_tag LOCUS_09630 26686 27321 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_09630 27366 28607 gene locus_tag LOCUS_09640 gene bamB 27366 28607 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209814.1 protein_id gnl|my_center|LOCUS_09640 28653 30101 gene locus_tag LOCUS_09650 gene der 28653 30101 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence022 198 1046 gene locus_tag LOCUS_09660 gene nadC 198 1046 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_09660 1475 1116 gene locus_tag LOCUS_09670 1475 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1840 1571 gene locus_tag LOCUS_09680 1840 1571 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036098.1 protein_id gnl|my_center|LOCUS_09680 1994 3391 gene locus_tag LOCUS_09690 1994 3391 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909061.1 protein_id gnl|my_center|LOCUS_09690 4070 3435 gene locus_tag LOCUS_09700 4070 3435 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_09700 5458 4142 gene locus_tag LOCUS_09710 5458 4142 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946380.1 protein_id gnl|my_center|LOCUS_09710 5995 5504 gene locus_tag LOCUS_09720 5995 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 6298 6648 gene locus_tag LOCUS_09730 gene arsC 6298 6648 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098232.1 protein_id gnl|my_center|LOCUS_09730 6661 7278 gene locus_tag LOCUS_09740 gene wrbA 6661 7278 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115189.1 protein_id gnl|my_center|LOCUS_09740 8314 7265 gene locus_tag LOCUS_09750 8314 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 8629 8553 gene locus_tag LOCUS_t00230 8629 8553 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9839 8748 gene locus_tag LOCUS_09760 gene ychF 9839 8748 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 protein_id gnl|my_center|LOCUS_09760 10495 9860 gene locus_tag LOCUS_09770 gene pth 10495 9860 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 protein_id gnl|my_center|LOCUS_09770 11186 10548 gene locus_tag LOCUS_09780 11186 10548 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948352.1 protein_id gnl|my_center|LOCUS_09780 12336 11353 gene locus_tag LOCUS_09790 12336 11353 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099281.1 protein_id gnl|my_center|LOCUS_09790 12574 12500 gene locus_tag LOCUS_t00240 12574 12500 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13559 12654 gene locus_tag LOCUS_09800 gene ispE 13559 12654 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_09800 14194 13601 gene locus_tag LOCUS_09810 gene lolB 14194 13601 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095005.1 protein_id gnl|my_center|LOCUS_09810 15971 14406 gene locus_tag LOCUS_09820 gene lbcA 15971 14406 CDS product proteolytic complex protein LbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352693.1 protein_id gnl|my_center|LOCUS_09820 16410 17672 gene locus_tag LOCUS_09830 gene hemA 16410 17672 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_09830 17689 18774 gene locus_tag LOCUS_09840 gene prfA 17689 18774 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804726.1 protein_id gnl|my_center|LOCUS_09840 18771 19676 gene locus_tag LOCUS_09850 gene prmC 18771 19676 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705084.1 protein_id gnl|my_center|LOCUS_09850 19673 20131 gene locus_tag LOCUS_09860 19673 20131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 20797 20228 gene locus_tag LOCUS_09870 20797 20228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 21247 20873 gene locus_tag LOCUS_09880 21247 20873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 21686 22351 gene locus_tag LOCUS_09890 21686 22351 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_09890 23869 22412 gene locus_tag LOCUS_09900 gene gatB 23869 22412 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_09900 25348 23888 gene locus_tag LOCUS_09910 gene gatA 25348 23888 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766477.1 protein_id gnl|my_center|LOCUS_09910 25715 25422 gene locus_tag LOCUS_09920 gene gatC 25715 25422 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_09920 26003 27046 gene locus_tag LOCUS_09930 26003 27046 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308111.1 protein_id gnl|my_center|LOCUS_09930 27180 28025 gene locus_tag LOCUS_09940 gene mreC 27180 28025 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09940 28022 28510 gene locus_tag LOCUS_09950 gene mreD 28022 28510 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence023 <1 547 gene locus_tag LOCUS_09960 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038050.1:energy transducer TonB 593 1156 gene locus_tag LOCUS_09970 593 1156 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461717.1 protein_id gnl|my_center|LOCUS_09970 1153 1665 gene locus_tag LOCUS_09980 gene ruvX 1153 1665 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 protein_id gnl|my_center|LOCUS_09980 1662 2231 gene locus_tag LOCUS_09990 gene pyrR 1662 2231 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_09990 2228 3235 gene locus_tag LOCUS_10000 2228 3235 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736952.1 protein_id gnl|my_center|LOCUS_10000 3232 4575 gene locus_tag LOCUS_10010 3232 4575 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_10010 4562 5431 gene locus_tag LOCUS_10020 4562 5431 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_10020 5543 6982 gene locus_tag LOCUS_10030 5543 6982 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941969.1 protein_id gnl|my_center|LOCUS_10030 8147 7026 gene locus_tag LOCUS_10040 8147 7026 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 protein_id gnl|my_center|LOCUS_10040 9186 8206 gene locus_tag LOCUS_10050 gene arsS 9186 8206 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_10050 9492 10643 gene locus_tag LOCUS_10060 9492 10643 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_10060 10640 10948 gene locus_tag LOCUS_10070 10640 10948 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_10070 10951 12318 gene locus_tag LOCUS_10080 10951 12318 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_10080 12357 13358 gene locus_tag LOCUS_10090 gene galE 12357 13358 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544967.1 protein_id gnl|my_center|LOCUS_10090 13480 14154 gene locus_tag LOCUS_10100 13480 14154 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733229.1 protein_id gnl|my_center|LOCUS_10100 14157 15881 gene locus_tag LOCUS_10110 14157 15881 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707374.1 protein_id gnl|my_center|LOCUS_10110 16080 16679 gene locus_tag LOCUS_10120 16080 16679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 17340 16717 gene locus_tag LOCUS_10130 17340 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 19076 17397 gene locus_tag LOCUS_10140 gene ilvD 19076 17397 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 protein_id gnl|my_center|LOCUS_10140 19168 20010 gene locus_tag LOCUS_10150 gene ttcA 19168 20010 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946435.1 protein_id gnl|my_center|LOCUS_10150 20080 21681 gene locus_tag LOCUS_10160 20080 21681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 22291 21689 gene locus_tag LOCUS_10170 22291 21689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 22404 23675 gene locus_tag LOCUS_10180 gene argA 22404 23675 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930879.1 protein_id gnl|my_center|LOCUS_10180 27177 23731 gene locus_tag LOCUS_10190 27177 23731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 28416 27421 gene locus_tag LOCUS_10200 28416 27421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence024 3653 204 gene locus_tag LOCUS_10210 3653 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 5300 3741 gene locus_tag LOCUS_10220 5300 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 7616 5304 gene locus_tag LOCUS_10230 7616 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 8591 7743 gene locus_tag LOCUS_10240 gene flgJ 8591 7743 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097775.1 protein_id gnl|my_center|LOCUS_10240 9712 8594 gene locus_tag LOCUS_10250 9712 8594 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_10250 10439 9747 gene locus_tag LOCUS_10260 gene flgH 10439 9747 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106240.1 protein_id gnl|my_center|LOCUS_10260 11238 10453 gene locus_tag LOCUS_10270 gene flgG 11238 10453 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946953.1 protein_id gnl|my_center|LOCUS_10270 12027 11284 gene locus_tag LOCUS_10280 12027 11284 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767027.1 protein_id gnl|my_center|LOCUS_10280 13655 12042 gene locus_tag LOCUS_10290 13655 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 14357 13686 gene locus_tag LOCUS_10300 gene flgD 14357 13686 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082153.1 protein_id gnl|my_center|LOCUS_10300 14790 14383 gene locus_tag LOCUS_10310 gene flgC 14790 14383 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462293.1 protein_id gnl|my_center|LOCUS_10310 15185 14793 gene locus_tag LOCUS_10320 gene flgB 15185 14793 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_10320 16214 15366 gene locus_tag LOCUS_10330 gene cheR 16214 15366 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_10330 17277 16321 gene locus_tag LOCUS_10340 17277 16321 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_10340 17537 18283 gene locus_tag LOCUS_10350 gene flgA 17537 18283 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098745.1 protein_id gnl|my_center|LOCUS_10350 18395 18712 gene locus_tag LOCUS_10360 gene flgM 18395 18712 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073137.1 protein_id gnl|my_center|LOCUS_10360 18736 19197 gene locus_tag LOCUS_10370 18736 19197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 19450 19797 gene locus_tag LOCUS_10380 19450 19797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 19810 20172 gene locus_tag LOCUS_10390 19810 20172 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_10390 20194 22236 gene locus_tag LOCUS_10400 20194 22236 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037054.1 protein_id gnl|my_center|LOCUS_10400 22256 22792 gene locus_tag LOCUS_10410 22256 22792 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_10410 23452 25851 gene locus_tag LOCUS_10420 23452 25851 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896388.1 protein_id gnl|my_center|LOCUS_10420 25905 26741 gene locus_tag LOCUS_10430 25905 26741 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337486.1 protein_id gnl|my_center|LOCUS_10430 26745 27404 gene locus_tag LOCUS_10440 gene cheD 26745 27404 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_10440 27429 28520 gene locus_tag LOCUS_10450 27429 28520 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence025 1713 1393 gene locus_tag LOCUS_10460 1713 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2087 1698 gene locus_tag LOCUS_10470 gene rnpA 2087 1698 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260895.1 protein_id gnl|my_center|LOCUS_10470 2756 4126 gene locus_tag LOCUS_10480 gene dnaA 2756 4126 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945763.1 protein_id gnl|my_center|LOCUS_10480 4320 5420 gene locus_tag LOCUS_10490 gene dnaN 4320 5420 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097262.1 protein_id gnl|my_center|LOCUS_10490 6052 6750 gene locus_tag LOCUS_10500 6052 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 6857 9268 gene locus_tag LOCUS_10510 gene gyrB 6857 9268 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220005.1 protein_id gnl|my_center|LOCUS_10510 10359 9316 gene locus_tag LOCUS_10520 10359 9316 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_10520 11186 10356 gene locus_tag LOCUS_10530 gene pgl 11186 10356 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_10530 11448 12458 gene locus_tag LOCUS_10540 11448 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 13037 12489 gene locus_tag LOCUS_10550 gene folA 13037 12489 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_10550 13838 13044 gene locus_tag LOCUS_10560 13838 13044 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_10560 14713 13850 gene locus_tag LOCUS_10570 gene lgt 14713 13850 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_10570 15980 14841 gene locus_tag LOCUS_10580 15980 14841 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_10580 16499 17512 gene locus_tag LOCUS_10590 16499 17512 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189384.1 protein_id gnl|my_center|LOCUS_10590 17787 18782 gene locus_tag LOCUS_10600 17787 18782 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928654.1 protein_id gnl|my_center|LOCUS_10600 18848 20425 gene locus_tag LOCUS_10610 18848 20425 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141015.1 protein_id gnl|my_center|LOCUS_10610 20551 21051 gene locus_tag LOCUS_10620 20551 21051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 21246 22349 gene locus_tag LOCUS_10630 gene gcvT 21246 22349 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_10630 22363 22860 gene locus_tag LOCUS_10640 gene gcvH 22363 22860 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703428.1 protein_id gnl|my_center|LOCUS_10640 22868 24241 gene locus_tag LOCUS_10650 gene gcvPA 22868 24241 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770511.1 protein_id gnl|my_center|LOCUS_10650 24246 24749 gene locus_tag LOCUS_10660 gene tpx 24246 24749 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402767.1 protein_id gnl|my_center|LOCUS_10660 24796 26268 gene locus_tag LOCUS_10670 gene gcvPB 24796 26268 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_10670 26298 27230 gene locus_tag LOCUS_10680 26298 27230 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_10680 28246 27200 gene locus_tag LOCUS_10690 28246 27200 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence026 505 107 gene locus_tag LOCUS_10700 505 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 676 1683 gene locus_tag LOCUS_10710 676 1683 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_10710 1785 2252 gene locus_tag LOCUS_10720 1785 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2331 2744 gene locus_tag LOCUS_10730 2331 2744 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_10730 2874 3665 gene locus_tag LOCUS_10740 gene djlA 2874 3665 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167009.1 protein_id gnl|my_center|LOCUS_10740 4097 4699 gene locus_tag LOCUS_10750 gene sspA 4097 4699 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_10750 4766 5122 gene locus_tag LOCUS_10760 4766 5122 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037463.1 protein_id gnl|my_center|LOCUS_10760 6594 5167 gene locus_tag LOCUS_10770 6594 5167 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_10770 7185 6604 gene locus_tag LOCUS_10780 gene dolP 7185 6604 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070669.1 protein_id gnl|my_center|LOCUS_10780 7704 7321 gene locus_tag LOCUS_10790 7704 7321 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_10790 9580 7730 gene locus_tag LOCUS_10800 9580 7730 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_10800 9883 10818 gene locus_tag LOCUS_10810 gene rsmI 9883 10818 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_10810 11553 12005 gene locus_tag LOCUS_10820 gene mraZ 11553 12005 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103101.1 protein_id gnl|my_center|LOCUS_10820 12130 13074 gene locus_tag LOCUS_10830 gene rsmH 12130 13074 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095568.1 protein_id gnl|my_center|LOCUS_10830 13064 13432 gene locus_tag LOCUS_10840 13064 13432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 13459 15183 gene locus_tag LOCUS_10850 gene ftsI 13459 15183 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_10850 15180 16727 gene locus_tag LOCUS_10860 15180 16727 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112751.1 protein_id gnl|my_center|LOCUS_10860 16754 18217 gene locus_tag LOCUS_10870 16754 18217 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_10870 18219 19301 gene locus_tag LOCUS_10880 gene mraY 18219 19301 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_10880 19340 20743 gene locus_tag LOCUS_10890 gene murD 19340 20743 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766566.1 protein_id gnl|my_center|LOCUS_10890 20740 21906 gene locus_tag LOCUS_10900 gene ftsW 20740 21906 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216490.1 protein_id gnl|my_center|LOCUS_10900 21903 23111 gene locus_tag LOCUS_10910 gene murG 21903 23111 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_10910 23104 24588 gene locus_tag LOCUS_10920 gene murC 23104 24588 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_10920 24585 25493 gene locus_tag LOCUS_10930 gene murB 24585 25493 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_10930 25490 26479 gene locus_tag LOCUS_10940 25490 26479 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence027 268 585 gene locus_tag LOCUS_10950 gene rpsJ 268 585 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103876.1 protein_id gnl|my_center|LOCUS_10950 629 1255 gene locus_tag LOCUS_10960 gene rplC 629 1255 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218932.1 protein_id gnl|my_center|LOCUS_10960 1266 1886 gene locus_tag LOCUS_10970 gene rplD 1266 1886 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005340616.1 protein_id gnl|my_center|LOCUS_10970 1883 2179 gene locus_tag LOCUS_10980 gene rplW 1883 2179 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 protein_id gnl|my_center|LOCUS_10980 2245 3072 gene locus_tag LOCUS_10990 gene rplB 2245 3072 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417230.1 protein_id gnl|my_center|LOCUS_10990 3147 3419 gene locus_tag LOCUS_11000 gene rpsS 3147 3419 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093734.1 protein_id gnl|my_center|LOCUS_11000 3439 3771 gene locus_tag LOCUS_11010 gene rplV 3439 3771 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_11010 3796 4482 gene locus_tag LOCUS_11020 gene rpsC 3796 4482 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_11020 4509 4922 gene locus_tag LOCUS_11030 gene rplP 4509 4922 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215430.1 protein_id gnl|my_center|LOCUS_11030 4922 5125 gene locus_tag LOCUS_11040 gene rpmC 4922 5125 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644739.1 protein_id gnl|my_center|LOCUS_11040 5122 5382 gene locus_tag LOCUS_11050 gene rpsQ 5122 5382 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_11050 5423 5791 gene locus_tag LOCUS_11060 gene rplN 5423 5791 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_11060 5827 6144 gene locus_tag LOCUS_11070 gene rplX 5827 6144 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 protein_id gnl|my_center|LOCUS_11070 6224 6763 gene locus_tag LOCUS_11080 gene rplE 6224 6763 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946090.1 protein_id gnl|my_center|LOCUS_11080 6792 7082 gene locus_tag LOCUS_11090 gene rpsN 6792 7082 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049689.1 protein_id gnl|my_center|LOCUS_11090 7183 7572 gene locus_tag LOCUS_11100 gene rpsH 7183 7572 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644434.1 protein_id gnl|my_center|LOCUS_11100 7590 8123 gene locus_tag LOCUS_11110 gene rplF 7590 8123 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_11110 8278 8637 gene locus_tag LOCUS_11120 gene rplR 8278 8637 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014360.1 protein_id gnl|my_center|LOCUS_11120 8658 9164 gene locus_tag LOCUS_11130 gene rpsE 8658 9164 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_11130 9169 9357 gene locus_tag LOCUS_11140 gene rpmD 9169 9357 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771513.1 protein_id gnl|my_center|LOCUS_11140 9359 9793 gene locus_tag LOCUS_11150 gene rplO 9359 9793 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957463.1 protein_id gnl|my_center|LOCUS_11150 9795 11138 gene locus_tag LOCUS_11160 gene secY 9795 11138 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481401.1 protein_id gnl|my_center|LOCUS_11160 11472 11828 gene locus_tag LOCUS_11170 gene rpsM 11472 11828 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555467.1 protein_id gnl|my_center|LOCUS_11170 11903 12247 gene locus_tag LOCUS_11180 gene rpsK 11903 12247 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543603.1 protein_id gnl|my_center|LOCUS_11180 12261 12887 gene locus_tag LOCUS_11190 gene rpsD 12261 12887 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 protein_id gnl|my_center|LOCUS_11190 12923 13942 gene locus_tag LOCUS_11200 gene rpoA 12923 13942 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_11200 13993 14385 gene locus_tag LOCUS_11210 gene rplQ 13993 14385 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417273.1 protein_id gnl|my_center|LOCUS_11210 14464 15198 gene locus_tag LOCUS_11220 14464 15198 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_11220 15419 16516 gene locus_tag LOCUS_11230 15419 16516 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_11230 17037 16567 gene locus_tag LOCUS_11240 17037 16567 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_11240 17676 17131 gene locus_tag LOCUS_11250 17676 17131 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_11250 17902 18462 gene locus_tag LOCUS_11260 17902 18462 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142456.1 protein_id gnl|my_center|LOCUS_11260 18629 19504 gene locus_tag LOCUS_11270 gene dapA 18629 19504 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_11270 19540 19857 gene locus_tag LOCUS_11280 19540 19857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 19854 20642 gene locus_tag LOCUS_11290 19854 20642 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_11290 20694 21407 gene locus_tag LOCUS_11300 20694 21407 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 protein_id gnl|my_center|LOCUS_11300 21519 25415 gene locus_tag LOCUS_11310 gene purL 21519 25415 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_11310 25876 25421 gene locus_tag LOCUS_11320 25876 25421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 26262 25963 gene locus_tag LOCUS_11330 26262 25963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence028 77 1 gene locus_tag LOCUS_t00250 77 1 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2662 275 gene locus_tag LOCUS_11340 2662 275 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 protein_id gnl|my_center|LOCUS_11340 4814 2664 gene locus_tag LOCUS_11350 4814 2664 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_11350 5745 4807 gene locus_tag LOCUS_11360 5745 4807 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_11360 7501 6014 gene locus_tag LOCUS_11370 7501 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 9970 8138 gene locus_tag LOCUS_11380 gene glmS 9970 8138 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099409.1 protein_id gnl|my_center|LOCUS_11380 11084 9990 gene locus_tag LOCUS_11390 gene glmU 11084 9990 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114651.1 protein_id gnl|my_center|LOCUS_11390 11010 11303 gene locus_tag LOCUS_11400 11010 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 11966 11550 gene locus_tag LOCUS_11410 11966 11550 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 protein_id gnl|my_center|LOCUS_11410 13389 12010 gene locus_tag LOCUS_11420 gene atpD 13389 12010 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649402.1 protein_id gnl|my_center|LOCUS_11420 14303 13443 gene locus_tag LOCUS_11430 gene atpG 14303 13443 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_11430 15886 14345 gene locus_tag LOCUS_11440 gene atpA 15886 14345 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_11440 16461 15913 gene locus_tag LOCUS_11450 16461 15913 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105592.1 protein_id gnl|my_center|LOCUS_11450 16941 16468 gene locus_tag LOCUS_11460 16941 16468 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 protein_id gnl|my_center|LOCUS_11460 17270 16983 gene locus_tag LOCUS_11470 gene atpE 17270 16983 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948671.1 protein_id gnl|my_center|LOCUS_11470 18261 17416 gene locus_tag LOCUS_11480 gene atpB 18261 17416 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 protein_id gnl|my_center|LOCUS_11480 18769 18362 gene locus_tag LOCUS_11490 18769 18362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 18966 18766 gene locus_tag LOCUS_11500 18966 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 20016 19060 gene locus_tag LOCUS_11510 20016 19060 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_11510 20819 20025 gene locus_tag LOCUS_11520 20819 20025 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 protein_id gnl|my_center|LOCUS_11520 21575 20829 gene locus_tag LOCUS_11530 gene rsmG 21575 20829 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367844.1 protein_id gnl|my_center|LOCUS_11530 24231 21718 gene locus_tag LOCUS_11540 24231 21718 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence029 653 192 gene locus_tag LOCUS_11550 gene greA 653 192 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128178593.1 protein_id gnl|my_center|LOCUS_11550 3886 665 gene locus_tag LOCUS_11560 gene carB 3886 665 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 protein_id gnl|my_center|LOCUS_11560 5105 3927 gene locus_tag LOCUS_11570 gene carA 5105 3927 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095209.1 protein_id gnl|my_center|LOCUS_11570 6072 5314 gene locus_tag LOCUS_11580 6072 5314 CDS product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 protein_id gnl|my_center|LOCUS_11580 6970 6224 gene locus_tag LOCUS_11590 6970 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 7499 7077 gene locus_tag LOCUS_11600 7499 7077 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080926.1 protein_id gnl|my_center|LOCUS_11600 8435 7644 gene locus_tag LOCUS_11610 8435 7644 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_11610 9867 8437 gene locus_tag LOCUS_11620 9867 8437 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113277.1 protein_id gnl|my_center|LOCUS_11620 10871 9990 gene locus_tag LOCUS_11630 gene sucD 10871 9990 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025451.1 protein_id gnl|my_center|LOCUS_11630 12058 10868 gene locus_tag LOCUS_11640 gene sucC 12058 10868 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958199.1 protein_id gnl|my_center|LOCUS_11640 13535 12093 gene locus_tag LOCUS_11650 gene lpdA 13535 12093 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_11650 14906 13551 gene locus_tag LOCUS_11660 gene odhB 14906 13551 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 protein_id gnl|my_center|LOCUS_11660 17864 14979 gene locus_tag LOCUS_11670 17864 14979 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366703.1 protein_id gnl|my_center|LOCUS_11670 19039 18014 gene locus_tag LOCUS_11680 19039 18014 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679870.1 protein_id gnl|my_center|LOCUS_11680 19239 19027 gene locus_tag LOCUS_11690 19239 19027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 19872 21794 gene locus_tag LOCUS_11700 19872 21794 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192719.1 protein_id gnl|my_center|LOCUS_11700 21764 23077 gene locus_tag LOCUS_11710 21764 23077 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443933.1 protein_id gnl|my_center|LOCUS_11710 23074 24567 gene locus_tag LOCUS_11720 23074 24567 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192871.1 protein_id gnl|my_center|LOCUS_11720 24841 24581 gene locus_tag LOCUS_11730 24841 24581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 <26361 24838 gene locus_tag LOCUS_11740 <26361 24838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038915.1:bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA >Feature sequence030 842 15 gene locus_tag LOCUS_11750 842 15 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_11750 901 1944 gene locus_tag LOCUS_11760 gene bioB 901 1944 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_11760 1975 3273 gene locus_tag LOCUS_11770 gene bioF 1975 3273 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_11770 3270 4070 gene locus_tag LOCUS_11780 3270 4070 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947203.1 protein_id gnl|my_center|LOCUS_11780 4060 5013 gene locus_tag LOCUS_11790 gene bioC 4060 5013 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_11790 5013 5696 gene locus_tag LOCUS_11800 gene bioD 5013 5696 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103336.1 protein_id gnl|my_center|LOCUS_11800 6841 5768 gene locus_tag LOCUS_11810 gene ftsX 6841 5768 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_11810 7591 6908 gene locus_tag LOCUS_11820 gene ftsE 7591 6908 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_11820 8796 7714 gene locus_tag LOCUS_11830 8796 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 8934 10328 gene locus_tag LOCUS_11840 8934 10328 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958525.1 protein_id gnl|my_center|LOCUS_11840 10363 11781 gene locus_tag LOCUS_11850 10363 11781 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_11850 11801 12394 gene locus_tag LOCUS_11860 gene rsmD 11801 12394 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050158543.1 protein_id gnl|my_center|LOCUS_11860 12470 13021 gene locus_tag LOCUS_11870 gene coaD 12470 13021 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348749.1 protein_id gnl|my_center|LOCUS_11870 13036 13290 gene locus_tag LOCUS_11880 13036 13290 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_11880 13370 15100 gene locus_tag LOCUS_11890 gene ggt 13370 15100 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946295.1 protein_id gnl|my_center|LOCUS_11890 16420 15113 gene locus_tag LOCUS_11900 16420 15113 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_11900 17135 16461 gene locus_tag LOCUS_11910 17135 16461 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530054.1 protein_id gnl|my_center|LOCUS_11910 18419 17160 gene locus_tag LOCUS_11920 gene lysA 18419 17160 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_11920 18613 18419 gene locus_tag LOCUS_11930 18613 18419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 18686 19399 gene locus_tag LOCUS_11940 18686 19399 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_11940 19538 20689 gene locus_tag LOCUS_11950 19538 20689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 20850 22073 gene locus_tag LOCUS_11960 20850 22073 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_11960 22113 23609 gene locus_tag LOCUS_11970 gene glcD 22113 23609 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114372.1 protein_id gnl|my_center|LOCUS_11970 23696 24763 gene locus_tag LOCUS_11980 gene glcE 23696 24763 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_11980 24766 26043 gene locus_tag LOCUS_11990 gene glcF 24766 26043 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence031 333 1907 gene locus_tag LOCUS_12000 333 1907 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_12000 3077 1890 gene locus_tag LOCUS_12010 gene sugC 3077 1890 CDS product trehalose ABC transporter ATP-binding protein SugC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406299.1 protein_id gnl|my_center|LOCUS_12010 3959 3129 gene locus_tag LOCUS_12020 3959 3129 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974523.1 protein_id gnl|my_center|LOCUS_12020 4831 3956 gene locus_tag LOCUS_12030 4831 3956 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942201.1 protein_id gnl|my_center|LOCUS_12030 6177 4828 gene locus_tag LOCUS_12040 6177 4828 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396358.1 protein_id gnl|my_center|LOCUS_12040 7573 6407 gene locus_tag LOCUS_12050 7573 6407 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_12050 8420 7575 gene locus_tag LOCUS_12060 8420 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 protein_id gnl|my_center|LOCUS_12060 10138 8432 gene locus_tag LOCUS_12070 10138 8432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870027.1 protein_id gnl|my_center|LOCUS_12070 11313 10180 gene locus_tag LOCUS_12080 11313 10180 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_12080 11721 12182 gene locus_tag LOCUS_12090 gene tadA 11721 12182 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191221.1 protein_id gnl|my_center|LOCUS_12090 12295 12918 gene locus_tag LOCUS_12100 12295 12918 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266412.1 protein_id gnl|my_center|LOCUS_12100 12999 13523 gene locus_tag LOCUS_12110 12999 13523 CDS product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783513.1 protein_id gnl|my_center|LOCUS_12110 13529 14248 gene locus_tag LOCUS_12120 13529 14248 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932386.1 protein_id gnl|my_center|LOCUS_12120 14311 14934 gene locus_tag LOCUS_12130 14311 14934 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942571.1 protein_id gnl|my_center|LOCUS_12130 14931 15407 gene locus_tag LOCUS_12140 14931 15407 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405106.1 protein_id gnl|my_center|LOCUS_12140 15579 15671 gene locus_tag LOCUS_t00260 15579 15671 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15889 16338 gene locus_tag LOCUS_12150 15889 16338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 16640 17011 gene locus_tag LOCUS_12160 16640 17011 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060873.1 protein_id gnl|my_center|LOCUS_12160 17289 19928 gene locus_tag LOCUS_12170 17289 19928 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_12170 19989 21260 gene locus_tag LOCUS_12180 19989 21260 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_12180 21263 22411 gene locus_tag LOCUS_12190 21263 22411 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 protein_id gnl|my_center|LOCUS_12190 22411 23250 gene locus_tag LOCUS_12200 22411 23250 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_12200 23342 23743 gene locus_tag LOCUS_12210 23342 23743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 24476 23748 gene locus_tag LOCUS_12220 24476 23748 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence032 313 957 gene locus_tag LOCUS_12230 313 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 959 1846 gene locus_tag LOCUS_12240 gene ubiA 959 1846 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704199.1 protein_id gnl|my_center|LOCUS_12240 1863 2843 gene locus_tag LOCUS_12250 1863 2843 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_12250 2960 3994 gene locus_tag LOCUS_12260 2960 3994 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_12260 4082 4654 gene locus_tag LOCUS_12270 4082 4654 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_12270 4661 5242 gene locus_tag LOCUS_12280 gene lptA 4661 5242 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120916.1 protein_id gnl|my_center|LOCUS_12280 5253 6008 gene locus_tag LOCUS_12290 gene lptB 5253 6008 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_12290 6157 7647 gene locus_tag LOCUS_12300 6157 7647 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377556.1 protein_id gnl|my_center|LOCUS_12300 8091 8582 gene locus_tag LOCUS_12310 gene ptsN 8091 8582 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_12310 8696 9691 gene locus_tag LOCUS_12320 gene hprK 8696 9691 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993219.1 protein_id gnl|my_center|LOCUS_12320 9688 10560 gene locus_tag LOCUS_12330 gene rapZ 9688 10560 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_12330 10569 10985 gene locus_tag LOCUS_12340 10569 10985 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_12340 10975 11244 gene locus_tag LOCUS_12350 10975 11244 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_12350 11368 13107 gene locus_tag LOCUS_12360 gene ptsP 11368 13107 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_12360 13273 14631 gene locus_tag LOCUS_12370 gene mgtE 13273 14631 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 protein_id gnl|my_center|LOCUS_12370 16677 14674 gene locus_tag LOCUS_12380 16677 14674 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_12380 16806 17621 gene locus_tag LOCUS_12390 gene mutM 16806 17621 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_12390 17724 18206 gene locus_tag LOCUS_12400 17724 18206 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881365.1 protein_id gnl|my_center|LOCUS_12400 19785 18217 gene locus_tag LOCUS_12410 19785 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 20818 21513 gene locus_tag LOCUS_12420 20818 21513 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260948.1 protein_id gnl|my_center|LOCUS_12420 21757 22362 gene locus_tag LOCUS_12430 21757 22362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 22355 22909 gene locus_tag LOCUS_12440 22355 22909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 23025 23405 gene locus_tag LOCUS_12450 23025 23405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 23421 23888 gene locus_tag LOCUS_12460 23421 23888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence033 357 2945 gene locus_tag LOCUS_12470 gene clpB 357 2945 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_12470 3275 3009 gene locus_tag LOCUS_12480 3275 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 6135 3328 gene locus_tag LOCUS_12490 gene acnA 6135 3328 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941510.1 protein_id gnl|my_center|LOCUS_12490 6311 7162 gene locus_tag LOCUS_12500 6311 7162 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167389.1 protein_id gnl|my_center|LOCUS_12500 9975 7309 gene locus_tag LOCUS_12510 9975 7309 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975944.1 protein_id gnl|my_center|LOCUS_12510 11083 10418 gene locus_tag LOCUS_12520 11083 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 12957 11083 gene locus_tag LOCUS_12530 12957 11083 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852913.1 protein_id gnl|my_center|LOCUS_12530 13207 13491 gene locus_tag LOCUS_12540 13207 13491 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772089.1 protein_id gnl|my_center|LOCUS_12540 13530 14171 gene locus_tag LOCUS_12550 13530 14171 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_12550 14431 16209 gene locus_tag LOCUS_12560 gene aspS 14431 16209 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104814.1 protein_id gnl|my_center|LOCUS_12560 16341 17447 gene locus_tag LOCUS_12570 gene nadA 16341 17447 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_12570 17464 18252 gene locus_tag LOCUS_12580 17464 18252 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_12580 18236 18979 gene locus_tag LOCUS_12590 gene cvpC 18236 18979 CDS product Dot/Icm type IV secretion system effector transcriptional regulator CvpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772098.1 protein_id gnl|my_center|LOCUS_12590 19025 19525 gene locus_tag LOCUS_12600 gene ruvC 19025 19525 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_12600 19522 20115 gene locus_tag LOCUS_12610 gene ruvA 19522 20115 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_12610 20120 21163 gene locus_tag LOCUS_12620 gene ruvB 20120 21163 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086123.1 protein_id gnl|my_center|LOCUS_12620 21294 21776 gene locus_tag LOCUS_12630 gene ybgC 21294 21776 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038138.1 protein_id gnl|my_center|LOCUS_12630 21766 22443 gene locus_tag LOCUS_12640 gene tolQ 21766 22443 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707366.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence034 986 744 gene locus_tag LOCUS_12650 986 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 3155 1122 gene locus_tag LOCUS_12660 3155 1122 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449670.1 protein_id gnl|my_center|LOCUS_12660 3893 3459 gene locus_tag LOCUS_12670 3893 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 5050 4049 gene locus_tag LOCUS_12680 5050 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 6108 5047 gene locus_tag LOCUS_12690 6108 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 6309 6716 gene locus_tag LOCUS_12700 6309 6716 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972106.1 protein_id gnl|my_center|LOCUS_12700 7417 6776 gene locus_tag LOCUS_12710 gene nfi 7417 6776 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_12710 8025 7471 gene locus_tag LOCUS_12720 8025 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 8150 8491 gene locus_tag LOCUS_12730 8150 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 8496 9365 gene locus_tag LOCUS_12740 8496 9365 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966070.1 protein_id gnl|my_center|LOCUS_12740 9373 9747 gene locus_tag LOCUS_12750 9373 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 9804 11984 gene locus_tag LOCUS_12760 gene uvrD 9804 11984 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383400.1 protein_id gnl|my_center|LOCUS_12760 12698 11988 gene locus_tag LOCUS_12770 12698 11988 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_12770 12759 13154 gene locus_tag LOCUS_12780 12759 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 13933 13172 gene locus_tag LOCUS_12790 13933 13172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 14279 14076 gene locus_tag LOCUS_12800 14279 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 14491 16560 gene locus_tag LOCUS_12810 14491 16560 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_12810 16626 17894 gene locus_tag LOCUS_12820 16626 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 17970 18809 gene locus_tag LOCUS_12830 17970 18809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 19616 19798 gene locus_tag LOCUS_12840 19616 19798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 20708 20064 gene locus_tag LOCUS_12850 20708 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 21330 20890 gene locus_tag LOCUS_12860 21330 20890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 21990 21634 gene locus_tag LOCUS_12870 21990 21634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence035 264 175 gene locus_tag LOCUS_t00270 264 175 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1300 317 gene locus_tag LOCUS_12880 1300 317 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937401.1 protein_id gnl|my_center|LOCUS_12880 2381 1293 gene locus_tag LOCUS_12890 gene gmd 2381 1293 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_12890 4102 2621 gene locus_tag LOCUS_12900 4102 2621 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529087.1 protein_id gnl|my_center|LOCUS_12900 5476 4172 gene locus_tag LOCUS_12910 5476 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 6677 5604 gene locus_tag LOCUS_12920 6677 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 7027 6737 gene locus_tag LOCUS_12930 7027 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 7858 7145 gene locus_tag LOCUS_12940 gene pyrF 7858 7145 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072377.1 protein_id gnl|my_center|LOCUS_12940 8161 7874 gene locus_tag LOCUS_12950 8161 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 8647 8255 gene locus_tag LOCUS_12960 8647 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 10475 8793 gene locus_tag LOCUS_12970 gene rpsA 10475 8793 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_12970 11292 10594 gene locus_tag LOCUS_12980 gene cmk 11292 10594 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616463.1 protein_id gnl|my_center|LOCUS_12980 12622 11297 gene locus_tag LOCUS_12990 12622 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 13652 12744 gene locus_tag LOCUS_13000 13652 12744 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_13000 14673 13657 gene locus_tag LOCUS_13010 gene aroF 14673 13657 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_13010 15803 14718 gene locus_tag LOCUS_13020 gene pheA 15803 14718 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_13020 16973 15810 gene locus_tag LOCUS_13030 16973 15810 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_13030 18106 17021 gene locus_tag LOCUS_13040 gene serC 18106 17021 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_13040 20792 18234 gene locus_tag LOCUS_13050 gene gyrA 20792 18234 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence036 3112 224 gene locus_tag LOCUS_13060 gene uvrA 3112 224 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_13060 3332 4795 gene locus_tag LOCUS_13070 3332 4795 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400420.1 protein_id gnl|my_center|LOCUS_13070 4837 5298 gene locus_tag LOCUS_13080 gene ssb 4837 5298 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_13080 5526 7391 gene locus_tag LOCUS_13090 5526 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 7510 9144 gene locus_tag LOCUS_13100 7510 9144 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 protein_id gnl|my_center|LOCUS_13100 9433 9771 gene locus_tag LOCUS_13110 gene glnB 9433 9771 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 protein_id gnl|my_center|LOCUS_13110 10707 9811 gene locus_tag LOCUS_13120 10707 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 11928 10810 gene locus_tag LOCUS_13130 11928 10810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 12059 13096 gene locus_tag LOCUS_13140 gene rluD 12059 13096 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957782.1 protein_id gnl|my_center|LOCUS_13140 13093 13878 gene locus_tag LOCUS_13150 gene yfiH 13093 13878 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040142.1 protein_id gnl|my_center|LOCUS_13150 14032 14772 gene locus_tag LOCUS_13160 14032 14772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 14769 15566 gene locus_tag LOCUS_13170 14769 15566 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930274.1 protein_id gnl|my_center|LOCUS_13170 15960 16391 gene locus_tag LOCUS_13180 15960 16391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 16517 17506 gene locus_tag LOCUS_13190 gene nhaR 16517 17506 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_13190 17503 18954 gene locus_tag LOCUS_13200 gene nhaA 17503 18954 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107366.1 protein_id gnl|my_center|LOCUS_13200 19762 19415 gene locus_tag LOCUS_13210 19762 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 20087 19809 gene locus_tag LOCUS_13220 20087 19809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13220 20983 20153 gene locus_tag LOCUS_13230 20983 20153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13230 >Feature sequence037 400 510 gene locus_tag LOCUS_r00010 400 510 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 597 1322 gene locus_tag LOCUS_13240 597 1322 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 protein_id gnl|my_center|LOCUS_13240 2256 1384 gene locus_tag LOCUS_13250 gene metF 2256 1384 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118821.1 protein_id gnl|my_center|LOCUS_13250 3656 2343 gene locus_tag LOCUS_13260 gene ahcY 3656 2343 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_13260 4863 3700 gene locus_tag LOCUS_13270 gene metK 4863 3700 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_13270 5208 5768 gene locus_tag LOCUS_13280 5208 5768 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_13280 6351 8345 gene locus_tag LOCUS_13290 gene tkt 6351 8345 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209965.1 protein_id gnl|my_center|LOCUS_13290 8406 9410 gene locus_tag LOCUS_13300 gene gap 8406 9410 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_13300 9521 10705 gene locus_tag LOCUS_13310 9521 10705 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_13310 10759 12228 gene locus_tag LOCUS_13320 gene pyk 10759 12228 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453949.1 protein_id gnl|my_center|LOCUS_13320 12434 13498 gene locus_tag LOCUS_13330 gene fba 12434 13498 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316351.1 protein_id gnl|my_center|LOCUS_13330 14603 13596 gene locus_tag LOCUS_13340 14603 13596 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_13340 15883 14624 gene locus_tag LOCUS_13350 gene tviB 15883 14624 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063859.1 protein_id gnl|my_center|LOCUS_13350 17313 15910 gene locus_tag LOCUS_13360 17313 15910 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_13360 17743 19137 gene locus_tag LOCUS_13370 17743 19137 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence038 13 225 gene locus_tag LOCUS_13380 13 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 369 1745 gene locus_tag LOCUS_13390 369 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 3723 1945 gene locus_tag LOCUS_13400 3723 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 4166 5770 gene locus_tag LOCUS_13410 4166 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 5833 6156 gene locus_tag LOCUS_13420 5833 6156 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_13420 6170 6775 gene locus_tag LOCUS_13430 gene recR 6170 6775 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087237.1 protein_id gnl|my_center|LOCUS_13430 6888 8099 gene locus_tag LOCUS_13440 6888 8099 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_13440 8104 8502 gene locus_tag LOCUS_13450 8104 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 8676 9203 gene locus_tag LOCUS_13460 8676 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 9387 9617 gene locus_tag LOCUS_13470 gene rpsR 9387 9617 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874511.1 protein_id gnl|my_center|LOCUS_13470 9752 10675 gene locus_tag LOCUS_13480 9752 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620823.1 protein_id gnl|my_center|LOCUS_13480 10716 11165 gene locus_tag LOCUS_13490 gene rplI 10716 11165 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368607.1 protein_id gnl|my_center|LOCUS_13490 11243 12640 gene locus_tag LOCUS_13500 gene dnaB 11243 12640 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112283.1 protein_id gnl|my_center|LOCUS_13500 12665 13780 gene locus_tag LOCUS_13510 gene alr 12665 13780 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817869.1 protein_id gnl|my_center|LOCUS_13510 13809 15146 gene locus_tag LOCUS_13520 gene radA 13809 15146 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094867.1 protein_id gnl|my_center|LOCUS_13520 18672 15211 gene locus_tag LOCUS_13530 gene mfd 18672 15211 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_13530 20191 19010 gene locus_tag LOCUS_13540 20191 19010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13540 20367 20188 gene locus_tag LOCUS_13550 20367 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence039 215 670 gene locus_tag LOCUS_13560 215 670 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_13560 869 2050 gene locus_tag LOCUS_13570 gene mnmA 869 2050 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 protein_id gnl|my_center|LOCUS_13570 2040 2660 gene locus_tag LOCUS_13580 gene hflD 2040 2660 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262317.1 protein_id gnl|my_center|LOCUS_13580 2693 4057 gene locus_tag LOCUS_13590 gene purB 2693 4057 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210915.1 protein_id gnl|my_center|LOCUS_13590 4492 5775 gene locus_tag LOCUS_13600 gene serS 4492 5775 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211336.1 protein_id gnl|my_center|LOCUS_13600 5779 7179 gene locus_tag LOCUS_13610 gene cysG 5779 7179 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_13610 8254 7199 gene locus_tag LOCUS_13620 8254 7199 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104504.1 protein_id gnl|my_center|LOCUS_13620 9293 8265 gene locus_tag LOCUS_13630 gene epmB 9293 8265 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_13630 9437 10006 gene locus_tag LOCUS_13640 gene efp 9437 10006 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_13640 10034 11080 gene locus_tag LOCUS_13650 gene epmA 10034 11080 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175550.1 protein_id gnl|my_center|LOCUS_13650 11438 11214 gene locus_tag LOCUS_13660 11438 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 11382 12281 gene locus_tag LOCUS_13670 gene prfB 11382 12281 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13670 13560 14975 gene locus_tag LOCUS_13680 13560 14975 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_13680 15042 15386 gene locus_tag LOCUS_13690 15042 15386 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_13690 16198 17715 gene locus_tag LOCUS_13700 16198 17715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 18539 19267 gene locus_tag LOCUS_13710 18539 19267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 19521 19766 gene locus_tag LOCUS_13720 19521 19766 CDS product carboxysome peptide B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124709.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence040 2906 1710 gene locus_tag LOCUS_13730 2906 1710 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524929.1 protein_id gnl|my_center|LOCUS_13730 3151 2906 gene locus_tag LOCUS_13740 3151 2906 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248097.1 protein_id gnl|my_center|LOCUS_13740 4287 3346 gene locus_tag LOCUS_13750 4287 3346 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077158.1 protein_id gnl|my_center|LOCUS_13750 6075 4315 gene locus_tag LOCUS_13760 6075 4315 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390306.1 protein_id gnl|my_center|LOCUS_13760 6981 8117 gene locus_tag LOCUS_13770 gene yghO 6981 8117 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331688.1 protein_id gnl|my_center|LOCUS_13770 8110 8949 gene locus_tag LOCUS_13780 8110 8949 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640161.1 protein_id gnl|my_center|LOCUS_13780 9127 10128 gene locus_tag LOCUS_13790 gene gldA 9127 10128 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_13790 10121 13066 gene locus_tag LOCUS_13800 10121 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 13063 14046 gene locus_tag LOCUS_13810 13063 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 14652 14086 gene locus_tag LOCUS_13820 gene dcd 14652 14086 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_13820 15765 14674 gene locus_tag LOCUS_13830 gene apbC 15765 14674 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_13830 16020 18101 gene locus_tag LOCUS_13840 gene metG 16020 18101 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072568.1 protein_id gnl|my_center|LOCUS_13840 18293 18874 gene locus_tag LOCUS_13850 gene rsxA 18293 18874 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_13850 18878 19429 gene locus_tag LOCUS_13860 gene rsxB 18878 19429 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072472.1 protein_id gnl|my_center|LOCUS_13860 19638 19396 gene locus_tag LOCUS_13870 19638 19396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence041 <1 633 gene locus_tag LOCUS_13880 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083052.1:flagellar type III secretion system pore protein FliP 654 923 gene locus_tag LOCUS_13890 gene fliQ 654 923 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_13890 928 1701 gene locus_tag LOCUS_13900 gene fliR 928 1701 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_13900 1705 2835 gene locus_tag LOCUS_13910 gene flhB 1705 2835 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_13910 2883 4967 gene locus_tag LOCUS_13920 gene flhA 2883 4967 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_13920 5017 6258 gene locus_tag LOCUS_13930 gene flhF 5017 6258 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114281.1 protein_id gnl|my_center|LOCUS_13930 6245 7141 gene locus_tag LOCUS_13940 gene fleN 6245 7141 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412391.1 protein_id gnl|my_center|LOCUS_13940 7138 7872 gene locus_tag LOCUS_13950 gene fliA 7138 7872 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_13950 7892 8287 gene locus_tag LOCUS_13960 gene cheY 7892 8287 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634617.1 protein_id gnl|my_center|LOCUS_13960 8298 9062 gene locus_tag LOCUS_13970 8298 9062 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705289.1 protein_id gnl|my_center|LOCUS_13970 9071 11458 gene locus_tag LOCUS_13980 9071 11458 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114282.1 protein_id gnl|my_center|LOCUS_13980 11468 12520 gene locus_tag LOCUS_13990 11468 12520 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705291.1 protein_id gnl|my_center|LOCUS_13990 12547 13290 gene locus_tag LOCUS_14000 12547 13290 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378725.1 protein_id gnl|my_center|LOCUS_14000 13300 14727 gene locus_tag LOCUS_14010 13300 14727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 14779 15576 gene locus_tag LOCUS_14020 14779 15576 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705294.1 protein_id gnl|my_center|LOCUS_14020 15580 16218 gene locus_tag LOCUS_14030 15580 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 16292 16768 gene locus_tag LOCUS_14040 16292 16768 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298836.1 protein_id gnl|my_center|LOCUS_14040 17001 17423 gene locus_tag LOCUS_14050 17001 17423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 19411 17486 gene locus_tag LOCUS_14060 19411 17486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence042 308 39 gene locus_tag LOCUS_14070 308 39 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942006.1 protein_id gnl|my_center|LOCUS_14070 1132 410 gene locus_tag LOCUS_14080 1132 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1308 1129 gene locus_tag LOCUS_14090 1308 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1591 1515 gene locus_tag LOCUS_t00280 1591 1515 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3512 1701 gene locus_tag LOCUS_14100 gene rpoD 3512 1701 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704782.1 protein_id gnl|my_center|LOCUS_14100 5350 3599 gene locus_tag LOCUS_14110 gene dnaG 5350 3599 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038900.1 protein_id gnl|my_center|LOCUS_14110 5906 5457 gene locus_tag LOCUS_14120 5906 5457 CDS product CBU_1594 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772128.1 protein_id gnl|my_center|LOCUS_14120 6170 5952 gene locus_tag LOCUS_14130 gene rpsU 6170 5952 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551877.1 protein_id gnl|my_center|LOCUS_14130 6296 7429 gene locus_tag LOCUS_14140 gene rfbB 6296 7429 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035864.1 protein_id gnl|my_center|LOCUS_14140 7426 8307 gene locus_tag LOCUS_14150 gene rfbA 7426 8307 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 protein_id gnl|my_center|LOCUS_14150 8388 9044 gene locus_tag LOCUS_14160 gene pyrE 8388 9044 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 protein_id gnl|my_center|LOCUS_14160 9968 9210 gene locus_tag LOCUS_14170 9968 9210 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124872.1 protein_id gnl|my_center|LOCUS_14170 10890 10021 gene locus_tag LOCUS_14180 gene argB 10890 10021 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_14180 11099 12031 gene locus_tag LOCUS_14190 11099 12031 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086588.1 protein_id gnl|my_center|LOCUS_14190 12037 12978 gene locus_tag LOCUS_14200 12037 12978 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_14200 14489 13059 gene locus_tag LOCUS_14210 14489 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 14967 14512 gene locus_tag LOCUS_14220 gene dut 14967 14512 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077682.1 protein_id gnl|my_center|LOCUS_14220 16156 14939 gene locus_tag LOCUS_14230 gene coaBC 16156 14939 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_14230 16276 16950 gene locus_tag LOCUS_14240 gene radC 16276 16950 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_14240 17234 17740 gene locus_tag LOCUS_14250 gene petA 17234 17740 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388117.1 protein_id gnl|my_center|LOCUS_14250 17744 18649 gene locus_tag LOCUS_14260 17744 18649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14260 18580 18981 gene locus_tag LOCUS_14270 18580 18981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14270 >Feature sequence043 228 1394 gene locus_tag LOCUS_14280 gene dprA 228 1394 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807293.1 protein_id gnl|my_center|LOCUS_14280 1391 1894 gene locus_tag LOCUS_14290 1391 1894 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 protein_id gnl|my_center|LOCUS_14290 2099 4408 gene locus_tag LOCUS_14300 gene topA 2099 4408 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958589.1 protein_id gnl|my_center|LOCUS_14300 5360 4440 gene locus_tag LOCUS_14310 gene cysB 5360 4440 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_14310 5686 7998 gene locus_tag LOCUS_14320 5686 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 8491 8051 gene locus_tag LOCUS_14330 8491 8051 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814554.1 protein_id gnl|my_center|LOCUS_14330 10280 8478 gene locus_tag LOCUS_14340 10280 8478 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_14340 12398 10368 gene locus_tag LOCUS_14350 12398 10368 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957672.1 protein_id gnl|my_center|LOCUS_14350 13719 12403 gene locus_tag LOCUS_14360 13719 12403 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810114.1 protein_id gnl|my_center|LOCUS_14360 16158 13726 gene locus_tag LOCUS_14370 16158 13726 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810115.1 protein_id gnl|my_center|LOCUS_14370 16334 17107 gene locus_tag LOCUS_14380 gene xth 16334 17107 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_14380 17220 18662 gene locus_tag LOCUS_14390 17220 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence044 <1 939 gene locus_tag LOCUS_14400 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259235.1:S8 family peptidase 1113 2510 gene locus_tag LOCUS_14410 gene miaB 1113 2510 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947064.1 protein_id gnl|my_center|LOCUS_14410 2579 3619 gene locus_tag LOCUS_14420 2579 3619 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_14420 3616 4104 gene locus_tag LOCUS_14430 gene ybeY 3616 4104 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191149949.1 protein_id gnl|my_center|LOCUS_14430 4151 5032 gene locus_tag LOCUS_14440 4151 5032 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_14440 5181 6713 gene locus_tag LOCUS_14450 gene lnt 5181 6713 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 protein_id gnl|my_center|LOCUS_14450 6793 9288 gene locus_tag LOCUS_14460 gene leuS 6793 9288 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957661.1 protein_id gnl|my_center|LOCUS_14460 9430 9984 gene locus_tag LOCUS_14470 9430 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 9981 11021 gene locus_tag LOCUS_14480 gene holA 9981 11021 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_14480 11077 12342 gene locus_tag LOCUS_14490 11077 12342 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_14490 12496 13215 gene locus_tag LOCUS_14500 gene nadD 12496 13215 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_14500 13212 13655 gene locus_tag LOCUS_14510 13212 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 13627 14160 gene locus_tag LOCUS_14520 gene rlmH 13627 14160 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701620.1 protein_id gnl|my_center|LOCUS_14520 14157 14789 gene locus_tag LOCUS_14530 14157 14789 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_14530 14782 16266 gene locus_tag LOCUS_14540 gene rng 14782 16266 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence045 864 1688 gene locus_tag LOCUS_14550 864 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1766 3322 gene locus_tag LOCUS_14560 1766 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 3325 4857 gene locus_tag LOCUS_14570 3325 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 5249 4872 gene locus_tag LOCUS_14580 5249 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 6698 5253 gene locus_tag LOCUS_14590 gene merA 6698 5253 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14590 7102 6695 gene locus_tag LOCUS_14600 7102 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 7501 7106 gene locus_tag LOCUS_14610 7501 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 7697 8107 gene locus_tag LOCUS_14620 7697 8107 CDS product MerR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967151.1 protein_id gnl|my_center|LOCUS_14620 8402 9124 gene locus_tag LOCUS_14630 8402 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 9112 9477 gene locus_tag LOCUS_14640 9112 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 9474 10475 gene locus_tag LOCUS_14650 9474 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 10545 10997 gene locus_tag LOCUS_14660 10545 10997 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_14660 11667 11149 gene locus_tag LOCUS_14670 11667 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 11933 12517 gene locus_tag LOCUS_14680 gene moaB 11933 12517 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093023.1 protein_id gnl|my_center|LOCUS_14680 12677 13276 gene locus_tag LOCUS_14690 12677 13276 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327091.1 protein_id gnl|my_center|LOCUS_14690 13403 14224 gene locus_tag LOCUS_14700 13403 14224 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 protein_id gnl|my_center|LOCUS_14700 14435 14256 gene locus_tag LOCUS_14710 14435 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 14678 16969 gene locus_tag LOCUS_14720 14678 16969 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_14720 17134 17841 gene locus_tag LOCUS_14730 17134 17841 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_14730 17831 18256 gene locus_tag LOCUS_14740 17831 18256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence046 1464 301 gene locus_tag LOCUS_14750 1464 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1684 1451 gene locus_tag LOCUS_14760 1684 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2202 1681 gene locus_tag LOCUS_14770 2202 1681 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_14770 2811 2227 gene locus_tag LOCUS_14780 2811 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 3683 2892 gene locus_tag LOCUS_14790 3683 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 6334 3764 gene locus_tag LOCUS_14800 6334 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 6787 8037 gene locus_tag LOCUS_14810 6787 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 8041 10533 gene locus_tag LOCUS_14820 8041 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 10548 12140 gene locus_tag LOCUS_14830 10548 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 12337 12897 gene locus_tag LOCUS_14840 12337 12897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 12956 14899 gene locus_tag LOCUS_14850 12956 14899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 14896 17736 gene locus_tag LOCUS_14860 14896 17736 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence047 3877 770 gene locus_tag LOCUS_14870 gene fimV 3877 770 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_14870 5070 4042 gene locus_tag LOCUS_14880 5070 4042 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 protein_id gnl|my_center|LOCUS_14880 6176 5067 gene locus_tag LOCUS_14890 gene leuB 6176 5067 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_14890 6834 6187 gene locus_tag LOCUS_14900 gene leuD 6834 6187 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 protein_id gnl|my_center|LOCUS_14900 8277 6856 gene locus_tag LOCUS_14910 gene leuC 8277 6856 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_14910 8495 9367 gene locus_tag LOCUS_14920 gene folD 8495 9367 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404473.1 protein_id gnl|my_center|LOCUS_14920 10886 9477 gene locus_tag LOCUS_14930 gene cysS 10886 9477 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913180.1 protein_id gnl|my_center|LOCUS_14930 11126 11857 gene locus_tag LOCUS_14940 11126 11857 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_14940 13028 11880 gene locus_tag LOCUS_14950 gene hemH 13028 11880 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925680.1 protein_id gnl|my_center|LOCUS_14950 13412 15046 gene locus_tag LOCUS_14960 13412 15046 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_14960 15514 15155 gene locus_tag LOCUS_14970 15514 15155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 17398 15779 gene locus_tag LOCUS_14980 17398 15779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence048 486 49 gene locus_tag LOCUS_14990 gene holC 486 49 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100593.1 protein_id gnl|my_center|LOCUS_14990 1988 483 gene locus_tag LOCUS_15000 gene pepA 1988 483 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_15000 2349 2089 gene locus_tag LOCUS_15010 2349 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2503 2763 gene locus_tag LOCUS_15020 2503 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2867 3859 gene locus_tag LOCUS_15030 2867 3859 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461587.1 protein_id gnl|my_center|LOCUS_15030 4463 3984 gene locus_tag LOCUS_15040 4463 3984 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978442.1 protein_id gnl|my_center|LOCUS_15040 4668 5336 gene locus_tag LOCUS_15050 4668 5336 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_15050 5448 6680 gene locus_tag LOCUS_15060 gene trpB 5448 6680 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_15060 6677 7549 gene locus_tag LOCUS_15070 gene trpA 6677 7549 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_15070 7546 8655 gene locus_tag LOCUS_15080 gene accD 7546 8655 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_15080 8689 10065 gene locus_tag LOCUS_15090 gene folC 8689 10065 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 protein_id gnl|my_center|LOCUS_15090 10062 10919 gene locus_tag LOCUS_15100 10062 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 11102 11602 gene locus_tag LOCUS_15110 11102 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 11635 13134 gene locus_tag LOCUS_15120 gene purF 11635 13134 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381064.1 protein_id gnl|my_center|LOCUS_15120 13172 14368 gene locus_tag LOCUS_15130 13172 14368 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_15130 14410 15774 gene locus_tag LOCUS_15140 14410 15774 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384388.1 protein_id gnl|my_center|LOCUS_15140 15982 17091 gene locus_tag LOCUS_15150 15982 17091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 17106 17582 gene locus_tag LOCUS_15160 17106 17582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence049 444 1691 gene locus_tag LOCUS_15170 444 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2469 1723 gene locus_tag LOCUS_15180 2469 1723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931877.1 protein_id gnl|my_center|LOCUS_15180 3725 2505 gene locus_tag LOCUS_15190 3725 2505 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461138.1 protein_id gnl|my_center|LOCUS_15190 3943 4959 gene locus_tag LOCUS_15200 gene tsaD 3943 4959 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 protein_id gnl|my_center|LOCUS_15200 5563 4943 gene locus_tag LOCUS_15210 gene plsY 5563 4943 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071503.1 protein_id gnl|my_center|LOCUS_15210 5617 5979 gene locus_tag LOCUS_15220 gene folB 5617 5979 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_15220 6005 6517 gene locus_tag LOCUS_15230 gene folK 6005 6517 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_15230 7367 6603 gene locus_tag LOCUS_15240 7367 6603 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_15240 7534 8790 gene locus_tag LOCUS_15250 7534 8790 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_15250 9775 8810 gene locus_tag LOCUS_15260 gene lipA 9775 8810 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958112.1 protein_id gnl|my_center|LOCUS_15260 10428 9772 gene locus_tag LOCUS_15270 gene lipB 10428 9772 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038550.1 protein_id gnl|my_center|LOCUS_15270 10775 10494 gene locus_tag LOCUS_15280 10775 10494 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237935.1 protein_id gnl|my_center|LOCUS_15280 11620 10772 gene locus_tag LOCUS_15290 11620 10772 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_15290 12734 11625 gene locus_tag LOCUS_15300 12734 11625 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_15300 13928 12999 gene locus_tag LOCUS_15310 13928 12999 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_15310 14952 13945 gene locus_tag LOCUS_15320 gene mltB 14952 13945 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_15320 16082 14949 gene locus_tag LOCUS_15330 gene mrdB 16082 14949 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_15330 <17738 16079 gene locus_tag LOCUS_15340 <17738 16079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093191.1:penicillin-binding protein 2 >Feature sequence050 864 496 gene locus_tag LOCUS_15350 864 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1175 1741 gene locus_tag LOCUS_15360 1175 1741 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_15360 2541 1762 gene locus_tag LOCUS_15370 gene truA 2541 1762 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768766.1 protein_id gnl|my_center|LOCUS_15370 2700 3662 gene locus_tag LOCUS_15380 gene msrP 2700 3662 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113450.1 protein_id gnl|my_center|LOCUS_15380 3702 4319 gene locus_tag LOCUS_15390 gene msrQ 3702 4319 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036769.1 protein_id gnl|my_center|LOCUS_15390 6032 4362 gene locus_tag LOCUS_15400 gene pgi 6032 4362 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789981.1 protein_id gnl|my_center|LOCUS_15400 7534 6032 gene locus_tag LOCUS_15410 gene zwf 7534 6032 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_15410 8457 7534 gene locus_tag LOCUS_15420 gene gnd 8457 7534 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350162.1 protein_id gnl|my_center|LOCUS_15420 8785 10248 gene locus_tag LOCUS_15430 gene glgA 8785 10248 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_15430 10889 10344 gene locus_tag LOCUS_15440 gene orn 10889 10344 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_15440 11133 12425 gene locus_tag LOCUS_15450 11133 12425 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_15450 12513 13427 gene locus_tag LOCUS_15460 gene rsgA 12513 13427 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763005.1 protein_id gnl|my_center|LOCUS_15460 14052 13519 gene locus_tag LOCUS_15470 14052 13519 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948236.1 protein_id gnl|my_center|LOCUS_15470 15040 14249 gene locus_tag LOCUS_15480 gene rlmB 15040 14249 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 protein_id gnl|my_center|LOCUS_15480 <17322 15037 gene locus_tag LOCUS_15490 <17322 15037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958002.1:ribonuclease R >Feature sequence051 334 1413 gene locus_tag LOCUS_15500 334 1413 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_15500 1434 2216 gene locus_tag LOCUS_15510 gene cmoA 1434 2216 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705416.1 protein_id gnl|my_center|LOCUS_15510 3907 2579 gene locus_tag LOCUS_15520 3907 2579 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_15520 4482 3907 gene locus_tag LOCUS_15530 4482 3907 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_15530 5146 4550 gene locus_tag LOCUS_15540 5146 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122761.1 protein_id gnl|my_center|LOCUS_15540 7295 5313 gene locus_tag LOCUS_15550 gene mnmG 7295 5313 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993407.1 protein_id gnl|my_center|LOCUS_15550 7533 8486 gene locus_tag LOCUS_15560 7533 8486 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_15560 8502 9494 gene locus_tag LOCUS_15570 8502 9494 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_15570 9491 11464 gene locus_tag LOCUS_15580 gene tgpA 9491 11464 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_15580 11644 12159 gene locus_tag LOCUS_15590 11644 12159 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245797.1 protein_id gnl|my_center|LOCUS_15590 15057 12220 gene locus_tag LOCUS_15600 15057 12220 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968623.1 protein_id gnl|my_center|LOCUS_15600 15620 15054 gene locus_tag LOCUS_15610 15620 15054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 16804 15617 gene locus_tag LOCUS_15620 16804 15617 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence052 <1 825 gene locus_tag LOCUS_15630 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192544.1:UTP--glucose-1-phosphate uridylyltransferase GalU 2384 1164 gene locus_tag LOCUS_15640 2384 1164 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_15640 5104 2474 gene locus_tag LOCUS_15650 5104 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 5643 6656 gene locus_tag LOCUS_15660 gene rluC 5643 6656 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693754.1 protein_id gnl|my_center|LOCUS_15660 6693 7403 gene locus_tag LOCUS_15670 6693 7403 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_15670 7448 8476 gene locus_tag LOCUS_15680 gene sppA 7448 8476 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_15680 9055 8453 gene locus_tag LOCUS_15690 9055 8453 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 protein_id gnl|my_center|LOCUS_15690 9116 9640 gene locus_tag LOCUS_15700 9116 9640 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_15700 9692 9871 gene locus_tag LOCUS_15710 gene rpmF 9692 9871 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947121.1 protein_id gnl|my_center|LOCUS_15710 9875 10897 gene locus_tag LOCUS_15720 gene plsX 9875 10897 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_15720 10942 11862 gene locus_tag LOCUS_15730 10942 11862 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_15730 11933 12883 gene locus_tag LOCUS_15740 gene fabD 11933 12883 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816075.1 protein_id gnl|my_center|LOCUS_15740 12946 13689 gene locus_tag LOCUS_15750 gene fabG 12946 13689 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706106.1 protein_id gnl|my_center|LOCUS_15750 13836 14078 gene locus_tag LOCUS_15760 gene acpP 13836 14078 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 protein_id gnl|my_center|LOCUS_15760 14307 15548 gene locus_tag LOCUS_15770 gene fabF 14307 15548 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104132.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence053 300 1952 gene locus_tag LOCUS_15780 300 1952 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958369.1 protein_id gnl|my_center|LOCUS_15780 1949 2782 gene locus_tag LOCUS_15790 gene kdsA 1949 2782 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946916.1 protein_id gnl|my_center|LOCUS_15790 2906 4219 gene locus_tag LOCUS_15800 gene eno 2906 4219 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_15800 4369 4665 gene locus_tag LOCUS_15810 gene ftsB 4369 4665 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455577.1 protein_id gnl|my_center|LOCUS_15810 4745 5434 gene locus_tag LOCUS_15820 gene ispD 4745 5434 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092359.1 protein_id gnl|my_center|LOCUS_15820 5431 5928 gene locus_tag LOCUS_15830 gene ispF 5431 5928 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_15830 5951 7000 gene locus_tag LOCUS_15840 gene truD 5951 7000 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 protein_id gnl|my_center|LOCUS_15840 8156 7020 gene locus_tag LOCUS_15850 gene aroF 8156 7020 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083125.1 protein_id gnl|my_center|LOCUS_15850 9228 8305 gene locus_tag LOCUS_15860 9228 8305 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_15860 10223 9225 gene locus_tag LOCUS_15870 10223 9225 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_15870 10828 10361 gene locus_tag LOCUS_15880 10828 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 11850 10918 gene locus_tag LOCUS_15890 11850 10918 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_15890 12229 14121 gene locus_tag LOCUS_15900 12229 14121 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_15900 15451 14189 gene locus_tag LOCUS_15910 gene hpnE 15451 14189 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_15910 16471 15605 gene locus_tag LOCUS_15920 gene hpnD 16471 15605 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence054 14 1153 gene locus_tag LOCUS_15930 14 1153 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258940.1 protein_id gnl|my_center|LOCUS_15930 1183 1884 gene locus_tag LOCUS_15940 1183 1884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 protein_id gnl|my_center|LOCUS_15940 1881 4460 gene locus_tag LOCUS_15950 1881 4460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942827.1 protein_id gnl|my_center|LOCUS_15950 4457 5638 gene locus_tag LOCUS_15960 4457 5638 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_15960 5905 6828 gene locus_tag LOCUS_15970 5905 6828 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_15970 7352 7053 gene locus_tag LOCUS_15980 7352 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 7836 7510 gene locus_tag LOCUS_15990 7836 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 7982 8170 gene locus_tag LOCUS_16000 7982 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16000 8167 8877 gene locus_tag LOCUS_16010 gene nth 8167 8877 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_16010 8937 9800 gene locus_tag LOCUS_16020 gene trxA 8937 9800 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_16020 10398 9841 gene locus_tag LOCUS_16030 10398 9841 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_16030 10727 10425 gene locus_tag LOCUS_16040 10727 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 11119 11535 gene locus_tag LOCUS_16050 11119 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 11778 12497 gene locus_tag LOCUS_16060 11778 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_16060 12513 13343 gene locus_tag LOCUS_16070 12513 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 14159 13353 gene locus_tag LOCUS_16080 14159 13353 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_16080 14956 14135 gene locus_tag LOCUS_16090 14956 14135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_16090 15494 15033 gene locus_tag LOCUS_16100 15494 15033 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_16100 15795 15535 gene locus_tag LOCUS_16110 15795 15535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence055 2211 112 gene locus_tag LOCUS_16120 gene fusA 2211 112 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 protein_id gnl|my_center|LOCUS_16120 2744 2274 gene locus_tag LOCUS_16130 gene rpsG 2744 2274 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093742.1 protein_id gnl|my_center|LOCUS_16130 3148 2774 gene locus_tag LOCUS_16140 gene rpsL 3148 2774 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450478.1 protein_id gnl|my_center|LOCUS_16140 7635 3430 gene locus_tag LOCUS_16150 gene rpoC 7635 3430 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_16150 11838 7699 gene locus_tag LOCUS_16160 gene rpoB 11838 7699 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_16160 12397 12014 gene locus_tag LOCUS_16170 gene rplL 12397 12014 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_16170 12985 12461 gene locus_tag LOCUS_16180 gene rplJ 12985 12461 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771616.1 protein_id gnl|my_center|LOCUS_16180 14033 13338 gene locus_tag LOCUS_16190 gene rplA 14033 13338 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 protein_id gnl|my_center|LOCUS_16190 14466 14035 gene locus_tag LOCUS_16200 gene rplK 14466 14035 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 protein_id gnl|my_center|LOCUS_16200 15079 14543 gene locus_tag LOCUS_16210 gene nusG 15079 14543 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 protein_id gnl|my_center|LOCUS_16210 15433 15086 gene locus_tag LOCUS_16220 gene secE 15433 15086 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771610.1 protein_id gnl|my_center|LOCUS_16220 15551 15476 gene locus_tag LOCUS_t00290 15551 15476 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence056 2314 1931 gene locus_tag LOCUS_16230 2314 1931 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_16230 4655 2409 gene locus_tag LOCUS_16240 gene spoT 4655 2409 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404001.1 protein_id gnl|my_center|LOCUS_16240 5033 4713 gene locus_tag LOCUS_16250 5033 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 5884 5234 gene locus_tag LOCUS_16260 gene gmk 5884 5234 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369144.1 protein_id gnl|my_center|LOCUS_16260 6743 5874 gene locus_tag LOCUS_16270 6743 5874 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403997.1 protein_id gnl|my_center|LOCUS_16270 7010 7732 gene locus_tag LOCUS_16280 gene rph 7010 7732 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_16280 7744 8349 gene locus_tag LOCUS_16290 7744 8349 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704791.1 protein_id gnl|my_center|LOCUS_16290 12113 8382 gene locus_tag LOCUS_16300 12113 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence057 195 575 gene locus_tag LOCUS_16310 195 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1191 736 gene locus_tag LOCUS_16320 1191 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3057 1348 gene locus_tag LOCUS_16330 3057 1348 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833883.1 protein_id gnl|my_center|LOCUS_16330 5682 3076 gene locus_tag LOCUS_16340 5682 3076 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933347.1 protein_id gnl|my_center|LOCUS_16340 7660 5690 gene locus_tag LOCUS_16350 gene ftsH 7660 5690 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_16350 8783 7803 gene locus_tag LOCUS_16360 8783 7803 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152113.1 protein_id gnl|my_center|LOCUS_16360 8980 9513 gene locus_tag LOCUS_16370 8980 9513 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_16370 9927 10448 gene locus_tag LOCUS_16380 9927 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16380 10458 10850 gene locus_tag LOCUS_16390 10458 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16390 10769 11461 gene locus_tag LOCUS_16400 10769 11461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16400 12162 11488 gene locus_tag LOCUS_16410 gene purN 12162 11488 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_16410 13322 12186 gene locus_tag LOCUS_16420 gene purM 13322 12186 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295474.1 protein_id gnl|my_center|LOCUS_16420 13171 13077 gene locus_tag LOCUS_t00300 13171 13077 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence058 938 444 gene locus_tag LOCUS_16430 938 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1201 896 gene locus_tag LOCUS_16440 1201 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2317 1706 gene locus_tag LOCUS_16450 2317 1706 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_16450 2643 2356 gene locus_tag LOCUS_16460 2643 2356 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975509.1 protein_id gnl|my_center|LOCUS_16460 3384 2749 gene locus_tag LOCUS_16470 3384 2749 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 protein_id gnl|my_center|LOCUS_16470 4511 3429 gene locus_tag LOCUS_16480 4511 3429 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_16480 5173 4694 gene locus_tag LOCUS_16490 5173 4694 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194993.1 protein_id gnl|my_center|LOCUS_16490 5569 5222 gene locus_tag LOCUS_16500 5569 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 6259 5642 gene locus_tag LOCUS_16510 6259 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 6816 6256 gene locus_tag LOCUS_16520 6816 6256 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809462.1 protein_id gnl|my_center|LOCUS_16520 7700 6813 gene locus_tag LOCUS_16530 gene ilvE 7700 6813 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_16530 8490 7693 gene locus_tag LOCUS_16540 8490 7693 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123301.1 protein_id gnl|my_center|LOCUS_16540 8666 10090 gene locus_tag LOCUS_16550 8666 10090 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_16550 10328 11029 gene locus_tag LOCUS_16560 10328 11029 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_16560 11291 11482 gene locus_tag LOCUS_16570 11291 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 11463 13985 gene locus_tag LOCUS_16580 11463 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence059 307 807 gene locus_tag LOCUS_16590 307 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 825 2150 gene locus_tag LOCUS_16600 825 2150 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888818.1 protein_id gnl|my_center|LOCUS_16600 2473 2922 gene locus_tag LOCUS_16610 2473 2922 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552310.1 protein_id gnl|my_center|LOCUS_16610 3134 4483 gene locus_tag LOCUS_16620 gene gorA 3134 4483 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703747.1 protein_id gnl|my_center|LOCUS_16620 4527 5084 gene locus_tag LOCUS_16630 4527 5084 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103010.1 protein_id gnl|my_center|LOCUS_16630 6708 5146 gene locus_tag LOCUS_16640 6708 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 7696 6845 gene locus_tag LOCUS_16650 7696 6845 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_16650 8162 7719 gene locus_tag LOCUS_16660 8162 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942792.1 protein_id gnl|my_center|LOCUS_16660 9080 8193 gene locus_tag LOCUS_16670 gene aroE 9080 8193 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_16670 10349 9093 gene locus_tag LOCUS_16680 10349 9093 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_16680 11051 10377 gene locus_tag LOCUS_16690 11051 10377 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_16690 12220 11201 gene locus_tag LOCUS_16700 gene hemB 12220 11201 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027069842.1 protein_id gnl|my_center|LOCUS_16700 13413 12256 gene locus_tag LOCUS_16710 13413 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence060 595 296 gene locus_tag LOCUS_16720 595 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1993 950 gene locus_tag LOCUS_16730 1993 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 5403 2092 gene locus_tag LOCUS_16740 5403 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 7385 5757 gene locus_tag LOCUS_16750 7385 5757 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058062.1 protein_id gnl|my_center|LOCUS_16750 8488 7382 gene locus_tag LOCUS_16760 8488 7382 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262887.1 protein_id gnl|my_center|LOCUS_16760 9124 8492 gene locus_tag LOCUS_16770 9124 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 11390 9114 gene locus_tag LOCUS_16780 11390 9114 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058064.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16780 12089 11574 gene locus_tag LOCUS_16790 12089 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16790 12323 12129 gene locus_tag LOCUS_16800 12323 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 12535 12323 gene locus_tag LOCUS_16810 12535 12323 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_16810 12945 13349 gene locus_tag LOCUS_16820 12945 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence061 <1 3638 gene locus_tag LOCUS_16830 <1 3638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030211.1:glycoside hydrolase family 18 chitinase 3881 4162 gene locus_tag LOCUS_16840 3881 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4242 5369 gene locus_tag LOCUS_16850 gene hemW 4242 5369 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_16850 5525 6352 gene locus_tag LOCUS_16860 gene serB 5525 6352 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_16860 7035 6364 gene locus_tag LOCUS_16870 gene trmB 7035 6364 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_16870 7890 7087 gene locus_tag LOCUS_16880 7890 7087 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 protein_id gnl|my_center|LOCUS_16880 8143 7916 gene locus_tag LOCUS_16890 gene thiS 8143 7916 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_16890 9294 8155 gene locus_tag LOCUS_16900 9294 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 9312 9385 gene locus_tag LOCUS_t00310 9312 9385 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9947 9447 gene locus_tag LOCUS_16910 9947 9447 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141072.1 protein_id gnl|my_center|LOCUS_16910 10568 10191 gene locus_tag LOCUS_16920 10568 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 10807 12798 gene locus_tag LOCUS_16930 gene asmA 10807 12798 CDS product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816716.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence062 93 1139 gene locus_tag LOCUS_16940 gene ntrB 93 1139 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_16940 1136 2557 gene locus_tag LOCUS_16950 gene ntrC 1136 2557 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_16950 3735 2635 gene locus_tag LOCUS_16960 3735 2635 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 protein_id gnl|my_center|LOCUS_16960 4825 3854 gene locus_tag LOCUS_16970 4825 3854 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 protein_id gnl|my_center|LOCUS_16970 5106 4825 gene locus_tag LOCUS_16980 5106 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 6476 5283 gene locus_tag LOCUS_16990 gene cgtA 6476 5283 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094758.1 protein_id gnl|my_center|LOCUS_16990 6849 6592 gene locus_tag LOCUS_17000 gene rpmA 6849 6592 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 protein_id gnl|my_center|LOCUS_17000 7249 6935 gene locus_tag LOCUS_17010 gene rplU 7249 6935 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626416.1 protein_id gnl|my_center|LOCUS_17010 7554 8552 gene locus_tag LOCUS_17020 gene ispB 7554 8552 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_17020 8570 8646 gene locus_tag LOCUS_t00320 8570 8646 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8814 10193 gene locus_tag LOCUS_17030 gene sthA 8814 10193 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120816.1 protein_id gnl|my_center|LOCUS_17030 10566 11639 gene locus_tag LOCUS_17040 10566 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence063 829 125 gene locus_tag LOCUS_17050 829 125 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_17050 2323 932 gene locus_tag LOCUS_17060 2323 932 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860184.1 protein_id gnl|my_center|LOCUS_17060 3228 2320 gene locus_tag LOCUS_17070 gene rfbD 3228 2320 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186608.1 protein_id gnl|my_center|LOCUS_17070 3987 3382 gene locus_tag LOCUS_17080 gene rfbC 3987 3382 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_17080 4638 4069 gene locus_tag LOCUS_17090 4638 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 5446 4640 gene locus_tag LOCUS_17100 5446 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 6698 5499 gene locus_tag LOCUS_17110 6698 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 7384 6779 gene locus_tag LOCUS_17120 7384 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 7743 7910 gene locus_tag LOCUS_17130 7743 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 8039 7857 gene locus_tag LOCUS_17140 8039 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 8317 8036 gene locus_tag LOCUS_17150 8317 8036 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_17150 8467 9240 gene locus_tag LOCUS_17160 8467 9240 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_17160 9317 10024 gene locus_tag LOCUS_17170 gene phoB 9317 10024 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113934.1 protein_id gnl|my_center|LOCUS_17170 10043 11341 gene locus_tag LOCUS_17180 gene phoR 10043 11341 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence064 <1 4265 gene locus_tag LOCUS_17190 <1 4265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097294.1:LysM peptidoglycan-binding domain-containing protein 4513 5625 gene locus_tag LOCUS_17200 4513 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5742 6641 gene locus_tag LOCUS_17210 5742 6641 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_17210 7043 8521 gene locus_tag LOCUS_17220 7043 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 8546 11179 gene locus_tag LOCUS_17230 8546 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence065 1584 280 gene locus_tag LOCUS_17240 1584 280 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_17240 2454 1651 gene locus_tag LOCUS_17250 2454 1651 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_17250 2966 3739 gene locus_tag LOCUS_17260 2966 3739 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_17260 3962 5305 gene locus_tag LOCUS_17270 gene ffh 3962 5305 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 protein_id gnl|my_center|LOCUS_17270 5422 5730 gene locus_tag LOCUS_17280 5422 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 5771 6337 gene locus_tag LOCUS_17290 gene rimM 5771 6337 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098350.1 protein_id gnl|my_center|LOCUS_17290 6334 7137 gene locus_tag LOCUS_17300 gene trmD 6334 7137 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469802.1 protein_id gnl|my_center|LOCUS_17300 7134 7478 gene locus_tag LOCUS_17310 gene rplS 7134 7478 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_17310 7642 8133 gene locus_tag LOCUS_17320 7642 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 8120 9016 gene locus_tag LOCUS_17330 gene xerD 8120 9016 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_17330 9233 10087 gene locus_tag LOCUS_17340 9233 10087 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_17340 10672 10094 gene locus_tag LOCUS_17350 10672 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence066 2675 1530 gene locus_tag LOCUS_17360 gene proB 2675 1530 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_17360 3398 2679 gene locus_tag LOCUS_17370 gene phoU 3398 2679 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096661.1 protein_id gnl|my_center|LOCUS_17370 4231 3410 gene locus_tag LOCUS_17380 gene pstB 4231 3410 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_17380 5918 4266 gene locus_tag LOCUS_17390 gene pstA 5918 4266 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_17390 8191 5915 gene locus_tag LOCUS_17400 8191 5915 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895703.1 protein_id gnl|my_center|LOCUS_17400 9509 8295 gene locus_tag LOCUS_17410 9509 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 <10477 9611 gene locus_tag LOCUS_17420 <10477 9611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096673.1:phosphate ABC transporter substrate-binding protein PstS >Feature sequence067 332 1369 gene locus_tag LOCUS_17430 gene hrcA 332 1369 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_17430 2021 2581 gene locus_tag LOCUS_17440 gene grpE 2021 2581 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313642.1 protein_id gnl|my_center|LOCUS_17440 2681 4636 gene locus_tag LOCUS_17450 gene dnaK 2681 4636 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 protein_id gnl|my_center|LOCUS_17450 4902 6038 gene locus_tag LOCUS_17460 gene dnaJ 4902 6038 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_17460 6191 7003 gene locus_tag LOCUS_17470 gene dapB 6191 7003 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_17470 8752 7007 gene locus_tag LOCUS_17480 8752 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 8996 9172 gene locus_tag LOCUS_17490 8996 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 9369 10190 gene locus_tag LOCUS_17500 9369 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence068 145 402 gene locus_tag LOCUS_17510 145 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2330 363 gene locus_tag LOCUS_17520 2330 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2666 2388 gene locus_tag LOCUS_17530 2666 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2873 2673 gene locus_tag LOCUS_17540 2873 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2970 4190 gene locus_tag LOCUS_17550 2970 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 4187 4957 gene locus_tag LOCUS_17560 4187 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 5099 5296 gene locus_tag LOCUS_17570 5099 5296 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209920.1 protein_id gnl|my_center|LOCUS_17570 5494 6381 gene locus_tag LOCUS_17580 5494 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 6378 7901 gene locus_tag LOCUS_17590 6378 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 7898 8560 gene locus_tag LOCUS_17600 7898 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 8588 9211 gene locus_tag LOCUS_17610 8588 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 9386 9296 gene locus_tag LOCUS_t00330 9386 9296 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence069 94 1146 gene locus_tag LOCUS_17620 94 1146 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975037.1 protein_id gnl|my_center|LOCUS_17620 1153 3318 gene locus_tag LOCUS_17630 1153 3318 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969651.1 protein_id gnl|my_center|LOCUS_17630 3850 3302 gene locus_tag LOCUS_17640 gene def 3850 3302 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_17640 3959 5101 gene locus_tag LOCUS_17650 3959 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 5827 5072 gene locus_tag LOCUS_17660 5827 5072 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_17660 6377 5820 gene locus_tag LOCUS_17670 6377 5820 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_17670 6526 8490 gene locus_tag LOCUS_17680 6526 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 8910 9107 gene locus_tag LOCUS_17690 8910 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 9200 9520 gene locus_tag LOCUS_17700 9200 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence070 785 294 gene locus_tag LOCUS_17710 785 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1142 792 gene locus_tag LOCUS_17720 1142 792 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_17720 2212 1262 gene locus_tag LOCUS_17730 2212 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3026 2814 gene locus_tag LOCUS_17740 3026 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2910 4586 gene locus_tag LOCUS_17750 2910 4586 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819691.1 protein_id gnl|my_center|LOCUS_17750 4725 8795 gene locus_tag LOCUS_17760 4725 8795 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039153.1 protein_id gnl|my_center|LOCUS_17760 9284 9027 gene locus_tag LOCUS_17770 9284 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence071 2075 498 gene locus_tag LOCUS_17780 2075 498 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133503194.1 protein_id gnl|my_center|LOCUS_17780 4524 2101 gene locus_tag LOCUS_17790 4524 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 5585 4923 gene locus_tag LOCUS_17800 5585 4923 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088434.1 protein_id gnl|my_center|LOCUS_17800 6654 5647 gene locus_tag LOCUS_17810 6654 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 7106 6759 gene locus_tag LOCUS_17820 7106 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392059.1 protein_id gnl|my_center|LOCUS_17820 7538 7344 gene locus_tag LOCUS_17830 7538 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 8979 7708 gene locus_tag LOCUS_17840 8979 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence072 1186 269 gene locus_tag LOCUS_17850 1186 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 3174 1183 gene locus_tag LOCUS_17860 3174 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3613 4173 gene locus_tag LOCUS_17870 3613 4173 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_17870 4289 5020 gene locus_tag LOCUS_17880 4289 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 5034 5792 gene locus_tag LOCUS_17890 5034 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 5985 7376 gene locus_tag LOCUS_17900 5985 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 8917 8534 gene locus_tag LOCUS_17910 8917 8534 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_17910 9219 8914 gene locus_tag LOCUS_17920 9219 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence073 1711 521 gene locus_tag LOCUS_17930 1711 521 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_17930 2244 1717 gene locus_tag LOCUS_17940 2244 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2474 2241 gene locus_tag LOCUS_17950 2474 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4334 2481 gene locus_tag LOCUS_17960 4334 2481 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965497.1 protein_id gnl|my_center|LOCUS_17960 5473 4442 gene locus_tag LOCUS_17970 5473 4442 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_17970 7581 5902 gene locus_tag LOCUS_17980 7581 5902 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_17980 8746 7556 gene locus_tag LOCUS_17990 8746 7556 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941287.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence074 <1 882 gene locus_tag LOCUS_18000 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109023.1:4-hydroxythreonine-4-phosphate dehydrogenase PdxA 879 1679 gene locus_tag LOCUS_18010 gene rsmA 879 1679 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_18010 1838 3022 gene locus_tag LOCUS_18020 1838 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3908 3090 gene locus_tag LOCUS_18030 3908 3090 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_18030 4438 3809 gene locus_tag LOCUS_18040 4438 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 6605 4473 gene locus_tag LOCUS_18050 gene glyS 6605 4473 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704155.1 protein_id gnl|my_center|LOCUS_18050 7534 6605 gene locus_tag LOCUS_18060 gene glyQ 7534 6605 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_18060 7753 8352 gene locus_tag LOCUS_18070 7753 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948505.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence075 901 434 gene locus_tag LOCUS_18080 901 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1642 941 gene locus_tag LOCUS_18090 gene dnaQ 1642 941 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770771.1 protein_id gnl|my_center|LOCUS_18090 2227 1724 gene locus_tag LOCUS_18100 gene rnhA 2227 1724 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_18100 3099 2224 gene locus_tag LOCUS_18110 3099 2224 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814735.1 protein_id gnl|my_center|LOCUS_18110 3176 3943 gene locus_tag LOCUS_18120 gene gloB 3176 3943 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957500.1 protein_id gnl|my_center|LOCUS_18120 4236 6158 gene locus_tag LOCUS_18130 4236 6158 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264066.1 protein_id gnl|my_center|LOCUS_18130 6891 6136 gene locus_tag LOCUS_18140 6891 6136 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084806.1 protein_id gnl|my_center|LOCUS_18140 7122 8417 gene locus_tag LOCUS_18150 7122 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence076 242 3010 gene locus_tag LOCUS_18160 gene polA 242 3010 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958446.1 protein_id gnl|my_center|LOCUS_18160 4098 3457 gene locus_tag LOCUS_18170 gene yihA 4098 3457 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096980.1 protein_id gnl|my_center|LOCUS_18170 4605 4117 gene locus_tag LOCUS_18180 4605 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 4789 5433 gene locus_tag LOCUS_18190 4789 5433 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403888.1 protein_id gnl|my_center|LOCUS_18190 5483 7126 gene locus_tag LOCUS_18200 5483 7126 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_18200 7139 7972 gene locus_tag LOCUS_18210 7139 7972 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613805.1 protein_id gnl|my_center|LOCUS_18210 8490 8107 gene locus_tag LOCUS_18220 8490 8107 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857681.1 protein_id gnl|my_center|LOCUS_18220 8744 8487 gene locus_tag LOCUS_18230 8744 8487 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence077 1441 221 gene locus_tag LOCUS_18240 1441 221 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_18240 4679 1530 gene locus_tag LOCUS_18250 4679 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 5911 4919 gene locus_tag LOCUS_18260 5911 4919 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_18260 6930 5914 gene locus_tag LOCUS_18270 gene pdhA 6930 5914 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928801.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence078 1305 91 gene locus_tag LOCUS_18280 gene argJ 1305 91 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268841.1 protein_id gnl|my_center|LOCUS_18280 4008 1309 gene locus_tag LOCUS_18290 gene secA 4008 1309 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073892.1 protein_id gnl|my_center|LOCUS_18290 5193 4273 gene locus_tag LOCUS_18300 5193 4273 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_18300 5351 5818 gene locus_tag LOCUS_18310 5351 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 7113 5959 gene locus_tag LOCUS_18320 gene ftsZ 7113 5959 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948309.1 protein_id gnl|my_center|LOCUS_18320 8414 7179 gene locus_tag LOCUS_18330 gene ftsA 8414 7179 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence079 591 1499 gene locus_tag LOCUS_18340 591 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1502 2488 gene locus_tag LOCUS_18350 1502 2488 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083852.1 protein_id gnl|my_center|LOCUS_18350 2586 3077 gene locus_tag LOCUS_18360 2586 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 3074 4345 gene locus_tag LOCUS_18370 3074 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4501 7527 gene locus_tag LOCUS_18380 4501 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 8016 7585 gene locus_tag LOCUS_18390 8016 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence080 415 5 gene locus_tag LOCUS_18400 415 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1440 412 gene locus_tag LOCUS_18410 gene fliM 1440 412 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037085.1 protein_id gnl|my_center|LOCUS_18410 2004 1447 gene locus_tag LOCUS_18420 2004 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3244 2882 gene locus_tag LOCUS_18430 3244 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 3352 4002 gene locus_tag LOCUS_18440 3352 4002 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928635.1 protein_id gnl|my_center|LOCUS_18440 5373 4066 gene locus_tag LOCUS_18450 gene fliK 5373 4066 CDS product flagellar hook length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097734.1 protein_id gnl|my_center|LOCUS_18450 5910 5470 gene locus_tag LOCUS_18460 5910 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 7361 5907 gene locus_tag LOCUS_18470 gene fliI 7361 5907 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 protein_id gnl|my_center|LOCUS_18470 8094 7354 gene locus_tag LOCUS_18480 8094 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 8497 8075 gene locus_tag LOCUS_18490 8497 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence081 909 364 gene locus_tag LOCUS_18500 909 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2965 1439 gene locus_tag LOCUS_18510 2965 1439 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_18510 3622 3251 gene locus_tag LOCUS_18520 3622 3251 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272733.1 protein_id gnl|my_center|LOCUS_18520 3856 4257 gene locus_tag LOCUS_18530 3856 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 4300 6228 gene locus_tag LOCUS_18540 4300 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 6856 6251 gene locus_tag LOCUS_18550 6856 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 7072 8133 gene locus_tag LOCUS_18560 gene mtnA 7072 8133 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091449.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence082 425 724 gene locus_tag LOCUS_18570 425 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3172 764 gene locus_tag LOCUS_18580 3172 764 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266649.1 protein_id gnl|my_center|LOCUS_18580 3868 3584 gene locus_tag LOCUS_18590 3868 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947734.1 protein_id gnl|my_center|LOCUS_18590 4421 4092 gene locus_tag LOCUS_18600 gene bolA 4421 4092 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 protein_id gnl|my_center|LOCUS_18600 4636 4995 gene locus_tag LOCUS_18610 4636 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 5067 5507 gene locus_tag LOCUS_18620 5067 5507 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_18620 5595 6557 gene locus_tag LOCUS_18630 5595 6557 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_18630 6575 6880 gene locus_tag LOCUS_18640 6575 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 7103 7456 gene locus_tag LOCUS_18650 7103 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 7462 7806 gene locus_tag LOCUS_18660 7462 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence083 199 1164 gene locus_tag LOCUS_18670 199 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2101 1103 gene locus_tag LOCUS_18680 2101 1103 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_18680 2348 3025 gene locus_tag LOCUS_18690 gene mip 2348 3025 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_18690 3105 4688 gene locus_tag LOCUS_18700 3105 4688 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946608.1 protein_id gnl|my_center|LOCUS_18700 5087 4695 gene locus_tag LOCUS_18710 5087 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 7907 5142 gene locus_tag LOCUS_18720 7907 5142 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113794.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence084 606 2015 gene locus_tag LOCUS_18730 gene fleQ 606 2015 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316803.1 protein_id gnl|my_center|LOCUS_18730 2143 3366 gene locus_tag LOCUS_18740 gene fleS 2143 3366 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_18740 3363 4781 gene locus_tag LOCUS_18750 3363 4781 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 protein_id gnl|my_center|LOCUS_18750 4834 5154 gene locus_tag LOCUS_18760 4834 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 5420 7093 gene locus_tag LOCUS_18770 gene fliF 5420 7093 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109118.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence085 1500 1018 gene locus_tag LOCUS_18780 gene smpB 1500 1018 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100496.1 protein_id gnl|my_center|LOCUS_18780 1661 3025 gene locus_tag LOCUS_18790 1661 3025 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_18790 3036 3497 gene locus_tag LOCUS_18800 3036 3497 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946119.1 protein_id gnl|my_center|LOCUS_18800 3484 3816 gene locus_tag LOCUS_18810 3484 3816 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918351.1 protein_id gnl|my_center|LOCUS_18810 4234 3869 gene locus_tag LOCUS_18820 4234 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4350 4772 gene locus_tag LOCUS_18830 gene fur 4350 4772 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_18830 6450 4780 gene locus_tag LOCUS_18840 gene recN 6450 4780 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 protein_id gnl|my_center|LOCUS_18840 7450 6530 gene locus_tag LOCUS_18850 7450 6530 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409651.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence086 3190 2597 gene locus_tag LOCUS_18860 3190 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 4205 3174 gene locus_tag LOCUS_18870 gene recA 4205 3174 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_18870 5003 4362 gene locus_tag LOCUS_18880 gene thpR 5003 4362 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209356.1 protein_id gnl|my_center|LOCUS_18880 5536 5000 gene locus_tag LOCUS_18890 5536 5000 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 protein_id gnl|my_center|LOCUS_18890 5659 6624 gene locus_tag LOCUS_18900 gene asd 5659 6624 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113924.1 protein_id gnl|my_center|LOCUS_18900 <7627 6640 gene locus_tag LOCUS_18910 <7627 6640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258140.1:TIGR03986 family CRISPR-associated RAMP protein >Feature sequence087 49 1224 gene locus_tag LOCUS_18920 49 1224 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_18920 1959 1189 gene locus_tag LOCUS_18930 1959 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 3226 2255 gene locus_tag LOCUS_18940 3226 2255 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038232.1 protein_id gnl|my_center|LOCUS_18940 4029 3223 gene locus_tag LOCUS_18950 4029 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 4367 5899 gene locus_tag LOCUS_18960 4367 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence088 815 42 gene locus_tag LOCUS_18970 815 42 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_18970 1792 812 gene locus_tag LOCUS_18980 1792 812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_18980 2210 1893 gene locus_tag LOCUS_18990 2210 1893 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064795.1 protein_id gnl|my_center|LOCUS_18990 3530 2310 gene locus_tag LOCUS_19000 gene fabB 3530 2310 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925736.1 protein_id gnl|my_center|LOCUS_19000 4077 3541 gene locus_tag LOCUS_19010 gene fabA 4077 3541 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921547.1 protein_id gnl|my_center|LOCUS_19010 4754 4563 gene locus_tag LOCUS_19020 4754 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 6438 5026 gene locus_tag LOCUS_19030 6438 5026 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_19030 7140 6523 gene locus_tag LOCUS_19040 7140 6523 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence089 <1 659 gene locus_tag LOCUS_19050 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007244945.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE 827 4696 gene locus_tag LOCUS_19060 827 4696 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968627.1 protein_id gnl|my_center|LOCUS_19060 4999 5283 gene locus_tag LOCUS_19070 4999 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 5322 5639 gene locus_tag LOCUS_19080 5322 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 5647 7020 gene locus_tag LOCUS_19090 5647 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19090 >Feature sequence090 635 1627 gene locus_tag LOCUS_19100 635 1627 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_19100 1605 2576 gene locus_tag LOCUS_19110 1605 2576 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546047.1 protein_id gnl|my_center|LOCUS_19110 2569 3363 gene locus_tag LOCUS_19120 2569 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3558 4214 gene locus_tag LOCUS_19130 3558 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 4224 4541 gene locus_tag LOCUS_19140 4224 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 4542 5471 gene locus_tag LOCUS_19150 4542 5471 CDS product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_19150 5468 6550 gene locus_tag LOCUS_19160 5468 6550 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence091 119 775 gene locus_tag LOCUS_19170 119 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 837 1682 gene locus_tag LOCUS_19180 837 1682 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 protein_id gnl|my_center|LOCUS_19180 1682 3343 gene locus_tag LOCUS_19190 1682 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3367 3972 gene locus_tag LOCUS_19200 3367 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3989 5410 gene locus_tag LOCUS_19210 3989 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 5483 6304 gene locus_tag LOCUS_19220 5483 6304 CDS product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895544.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence092 <1 516 gene locus_tag LOCUS_19230 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947758.1:tol-pal system protein YbgF 551 1210 gene locus_tag LOCUS_19240 gene queE 551 1210 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769397.1 protein_id gnl|my_center|LOCUS_19240 1207 1920 gene locus_tag LOCUS_19250 gene queC 1207 1920 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463447.1 protein_id gnl|my_center|LOCUS_19250 2086 2161 gene locus_tag LOCUS_t00340 2086 2161 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2513 5194 gene locus_tag LOCUS_19260 2513 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 6672 5227 gene locus_tag LOCUS_19270 6672 5227 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767670.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence093 366 1076 gene locus_tag LOCUS_19280 366 1076 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_19280 2412 1228 gene locus_tag LOCUS_19290 2412 1228 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_19290 2723 2424 gene locus_tag LOCUS_19300 gene lsrG 2723 2424 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181386.1 protein_id gnl|my_center|LOCUS_19300 4221 3058 gene locus_tag LOCUS_19310 4221 3058 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_19310 4616 4218 gene locus_tag LOCUS_19320 4616 4218 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099020.1 protein_id gnl|my_center|LOCUS_19320 4709 5035 gene locus_tag LOCUS_19330 4709 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 6051 5050 gene locus_tag LOCUS_19340 6051 5050 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence094 326 907 gene locus_tag LOCUS_19350 gene sodB 326 907 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094005.1 protein_id gnl|my_center|LOCUS_19350 980 1684 gene locus_tag LOCUS_19360 980 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 1779 2957 gene locus_tag LOCUS_19370 1779 2957 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 protein_id gnl|my_center|LOCUS_19370 2980 3909 gene locus_tag LOCUS_19380 gene argF 2980 3909 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092090.1 protein_id gnl|my_center|LOCUS_19380 3918 5006 gene locus_tag LOCUS_19390 3918 5006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_19390 5725 5081 gene locus_tag LOCUS_19400 5725 5081 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence095 2330 1446 gene locus_tag LOCUS_19410 gene htpX 2330 1446 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037436.1 protein_id gnl|my_center|LOCUS_19410 4742 2493 gene locus_tag LOCUS_19420 gene parC 4742 2493 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_19420 <6047 4788 gene locus_tag LOCUS_19430 <6047 4788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102062.1:DNA topoisomerase IV subunit B >Feature sequence096 2062 1556 gene locus_tag LOCUS_19440 2062 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2496 2224 gene locus_tag LOCUS_19450 2496 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2939 2733 gene locus_tag LOCUS_19460 2939 2733 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196837.1 protein_id gnl|my_center|LOCUS_19460 3169 4407 gene locus_tag LOCUS_19470 3169 4407 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626230.1 protein_id gnl|my_center|LOCUS_19470 4666 4472 gene locus_tag LOCUS_19480 4666 4472 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_19480 5522 4797 gene locus_tag LOCUS_19490 5522 4797 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence097 368 586 gene locus_tag LOCUS_19500 gene infA 368 586 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_19500 3015 751 gene locus_tag LOCUS_19510 gene clpA 3015 751 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_19510 3477 3145 gene locus_tag LOCUS_19520 gene clpS 3477 3145 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037130.1 protein_id gnl|my_center|LOCUS_19520 4032 4244 gene locus_tag LOCUS_19530 gene cspD 4032 4244 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 protein_id gnl|my_center|LOCUS_19530 5779 4523 gene locus_tag LOCUS_19540 gene icd 5779 4523 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078068420.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence098 1031 279 gene locus_tag LOCUS_19550 1031 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1198 1034 gene locus_tag LOCUS_19560 1198 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 1648 1205 gene locus_tag LOCUS_19570 1648 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1991 1656 gene locus_tag LOCUS_19580 1991 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 3068 2061 gene locus_tag LOCUS_19590 3068 2061 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339609.1 protein_id gnl|my_center|LOCUS_19590 3448 3071 gene locus_tag LOCUS_19600 3448 3071 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339610.1 protein_id gnl|my_center|LOCUS_19600 4658 3450 gene locus_tag LOCUS_19610 4658 3450 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339479.1 protein_id gnl|my_center|LOCUS_19610 3665 3747 gene locus_tag LOCUS_t00350 3665 3747 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 <5827 4655 gene locus_tag LOCUS_19620 <5827 4655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339612.1:phage portal protein >Feature sequence099 381 306 gene locus_tag LOCUS_t00360 381 306 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 536 463 gene locus_tag LOCUS_t00370 536 463 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 740 656 gene locus_tag LOCUS_t00380 740 656 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1796 942 gene locus_tag LOCUS_19630 gene mazG 1796 942 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389380.1 protein_id gnl|my_center|LOCUS_19630 2062 1793 gene locus_tag LOCUS_19640 2062 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2437 2862 gene locus_tag LOCUS_19650 2437 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 3108 5252 gene locus_tag LOCUS_19660 gene slt 3108 5252 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_19660 5526 5284 gene locus_tag LOCUS_19670 5526 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence100 119 775 gene locus_tag LOCUS_19680 119 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 837 1682 gene locus_tag LOCUS_19690 837 1682 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 protein_id gnl|my_center|LOCUS_19690 1721 3343 gene locus_tag LOCUS_19700 1721 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 3367 3972 gene locus_tag LOCUS_19710 3367 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 3989 5410 gene locus_tag LOCUS_19720 3989 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence101 1013 633 gene locus_tag LOCUS_19730 1013 633 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220683.1 protein_id gnl|my_center|LOCUS_19730 2576 1050 gene locus_tag LOCUS_19740 2576 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 4570 2579 gene locus_tag LOCUS_19750 gene dndD 4570 2579 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_19750 5193 4567 gene locus_tag LOCUS_19760 5193 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 5382 5197 gene locus_tag LOCUS_19770 5382 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence102 <1 1605 gene locus_tag LOCUS_19780 <1 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000079699.1:FliC/FljB family flagellin 1694 2101 gene locus_tag LOCUS_19790 1694 2101 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112502.1 protein_id gnl|my_center|LOCUS_19790 2217 4244 gene locus_tag LOCUS_19800 2217 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 4350 4793 gene locus_tag LOCUS_19810 gene fliS 4350 4793 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_19810 4856 5131 gene locus_tag LOCUS_19820 4856 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence103 1015 362 gene locus_tag LOCUS_19830 1015 362 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_19830 4500 1030 gene locus_tag LOCUS_19840 4500 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence104 <1 862 gene locus_tag LOCUS_19850 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113994.1:aminodeoxychorismate lyase 872 1870 gene locus_tag LOCUS_19860 gene mltG 872 1870 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_19860 1870 2529 gene locus_tag LOCUS_19870 gene tmk 1870 2529 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_19870 2526 3578 gene locus_tag LOCUS_19880 2526 3578 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267154.1 protein_id gnl|my_center|LOCUS_19880 3591 4058 gene locus_tag LOCUS_19890 3591 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4141 4947 gene locus_tag LOCUS_19900 4141 4947 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence105 1994 654 gene locus_tag LOCUS_19910 1994 654 CDS product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930348.1 protein_id gnl|my_center|LOCUS_19910 2708 2097 gene locus_tag LOCUS_19920 2708 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3283 2711 gene locus_tag LOCUS_19930 3283 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 4457 3537 gene locus_tag LOCUS_19940 4457 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence106 26 1336 gene locus_tag LOCUS_19950 26 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1341 1943 gene locus_tag LOCUS_19960 1341 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1940 2272 gene locus_tag LOCUS_19970 1940 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2348 3001 gene locus_tag LOCUS_19980 2348 3001 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_19980 3001 3510 gene locus_tag LOCUS_19990 3001 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3507 4016 gene locus_tag LOCUS_20000 3507 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence107 <1 705 gene locus_tag LOCUS_20010 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938997.1:type I restriction-modification system subunit M 2907 3215 gene locus_tag LOCUS_20020 2907 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence108 830 636 gene locus_tag LOCUS_20030 830 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1342 3111 gene locus_tag LOCUS_20040 1342 3111 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_20040 3749 3108 gene locus_tag LOCUS_20050 3749 3108 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533614.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence109 410 3193 gene locus_tag LOCUS_20060 410 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3638 3357 gene locus_tag LOCUS_20070 3638 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence110 653 447 gene locus_tag LOCUS_20080 653 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1107 655 gene locus_tag LOCUS_20090 1107 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 3059 1110 gene locus_tag LOCUS_20100 3059 1110 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence111 <1 549 gene locus_tag LOCUS_20110 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957904.1:A/G-specific adenine glycosylase 560 871 gene locus_tag LOCUS_20120 560 871 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768500.1 protein_id gnl|my_center|LOCUS_20120 1895 900 gene locus_tag LOCUS_20130 1895 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2017 2092 gene locus_tag LOCUS_t00390 2017 2092 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3243 2161 gene locus_tag LOCUS_20140 3243 2161 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence112 579 175 gene locus_tag LOCUS_20150 579 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1250 777 gene locus_tag LOCUS_20160 1250 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 1527 1243 gene locus_tag LOCUS_20170 1527 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence113 244 642 gene locus_tag LOCUS_20180 244 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1325 588 gene locus_tag LOCUS_20190 gene yrfG 1325 588 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_20190 1324 1956 gene locus_tag LOCUS_20200 gene nudE 1324 1956 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216848.1 protein_id gnl|my_center|LOCUS_20200 1928 2749 gene locus_tag LOCUS_20210 gene cysQ 1928 2749 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038007.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence114 1126 548 gene locus_tag LOCUS_20220 1126 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2458 1163 gene locus_tag LOCUS_20230 gene tolB 2458 1163 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_20230 <3122 2516 gene locus_tag LOCUS_20240 <3122 2516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024111687.1:cell envelope integrity protein TolA >Feature sequence115 <1 1125 gene locus_tag LOCUS_20250 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003314194.1:IMP dehydrogenase 1135 2715 gene locus_tag LOCUS_20260 gene guaA 1135 2715 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105901.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence116 1323 142 gene locus_tag LOCUS_20270 1323 142 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence117 2920 1700 gene locus_tag LOCUS_20280 gene prsR 2920 1700 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence118 363 881 gene locus_tag LOCUS_20290 363 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 969 1358 gene locus_tag LOCUS_20300 969 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 1561 2532 gene locus_tag LOCUS_20310 1561 2532 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104999.1 protein_id gnl|my_center|LOCUS_20310 2834 2592 gene locus_tag LOCUS_20320 2834 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence119 542 2002 gene locus_tag LOCUS_20330 gene xseA 542 2002 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099131.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence120 479 790 gene locus_tag LOCUS_20340 479 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 798 1208 gene locus_tag LOCUS_20350 798 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 1767 1243 gene locus_tag LOCUS_20360 1767 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence121 257 607 gene locus_tag LOCUS_20370 257 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20370 595 774 gene locus_tag LOCUS_20380 595 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20380 817 1515 gene locus_tag LOCUS_20390 817 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20390 1676 2059 gene locus_tag LOCUS_20400 1676 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2465 2148 gene locus_tag LOCUS_20410 2465 2148 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence122 296 1264 gene locus_tag LOCUS_20420 296 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20420 1261 1671 gene locus_tag LOCUS_20430 1261 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1845 2093 gene locus_tag LOCUS_20440 1845 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816259.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence123 90 2333 gene locus_tag LOCUS_20450 90 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence124 109 1980 gene locus_tag LOCUS_20460 gene thiC 109 1980 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence125 1306 329 gene locus_tag LOCUS_20470 1306 329 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_20470 1534 1707 gene locus_tag LOCUS_20480 1534 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2259 1924 gene locus_tag LOCUS_20490 2259 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence126 346 1626 gene locus_tag LOCUS_20500 346 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence127 1329 223 gene locus_tag LOCUS_20510 gene aroB 1329 223 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_20510 2226 1465 gene locus_tag LOCUS_20520 2226 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence128 211 555 gene locus_tag LOCUS_20530 211 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 567 1322 gene locus_tag LOCUS_20540 567 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence129 1302 913 gene locus_tag LOCUS_20550 1302 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2114 1299 gene locus_tag LOCUS_20560 2114 1299 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214390.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence130 1701 1471 gene locus_tag LOCUS_20570 gene tusA 1701 1471 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence131 650 1339 gene locus_tag LOCUS_20580 650 1339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence132