>Feature sequence001 377 27 gene locus_tag LOCUS_00010 377 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1000 488 gene locus_tag LOCUS_00020 1000 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1217 1504 gene locus_tag LOCUS_00030 gene groES 1217 1504 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_00030 1611 3203 gene locus_tag LOCUS_00040 gene groL 1611 3203 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_00040 3904 3278 gene locus_tag LOCUS_00050 3904 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6762 3901 gene locus_tag LOCUS_00060 6762 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6861 8492 gene locus_tag LOCUS_00070 6861 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8830 12324 gene locus_tag LOCUS_00080 8830 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12343 13953 gene locus_tag LOCUS_00090 12343 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_00090 15986 13971 gene locus_tag LOCUS_00100 15986 13971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 16162 18801 gene locus_tag LOCUS_00110 16162 18801 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_00110 18893 19321 gene locus_tag LOCUS_00120 18893 19321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 20725 19337 gene locus_tag LOCUS_00130 20725 19337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 21941 20766 gene locus_tag LOCUS_00140 21941 20766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 23627 22002 gene locus_tag LOCUS_00150 23627 22002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 24348 24103 gene locus_tag LOCUS_00160 24348 24103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 24975 24898 gene locus_tag LOCUS_t00010 24975 24898 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence002 837 364 gene locus_tag LOCUS_00170 837 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 2194 863 gene locus_tag LOCUS_00180 gene rimO 2194 863 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_00180 2869 2222 gene locus_tag LOCUS_00190 gene lolA 2869 2222 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405079.1 protein_id gnl|my_center|LOCUS_00190 5707 2963 gene locus_tag LOCUS_00200 5707 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 5834 6808 gene locus_tag LOCUS_00210 gene galE 5834 6808 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920241.1 protein_id gnl|my_center|LOCUS_00210 8056 6827 gene locus_tag LOCUS_00220 8056 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 8832 8275 gene locus_tag LOCUS_00230 8832 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 10366 8981 gene locus_tag LOCUS_00240 10366 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 11208 10678 gene locus_tag LOCUS_00250 11208 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 11799 11245 gene locus_tag LOCUS_00260 11799 11245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 12541 11882 gene locus_tag LOCUS_00270 12541 11882 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_00270 13014 12769 gene locus_tag LOCUS_00280 13014 12769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 14651 13014 gene locus_tag LOCUS_00290 14651 13014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 18145 14648 gene locus_tag LOCUS_00300 18145 14648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 20501 18147 gene locus_tag LOCUS_00310 20501 18147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 21261 20533 gene locus_tag LOCUS_00320 21261 20533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 23173 21533 gene locus_tag LOCUS_00330 gene dacB 23173 21533 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189150.1 protein_id gnl|my_center|LOCUS_00330 >Feature sequence003 1231 92 gene locus_tag LOCUS_00340 1231 92 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_00340 2577 1228 gene locus_tag LOCUS_00350 2577 1228 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_00350 2858 5590 gene locus_tag LOCUS_00360 2858 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 5960 5628 gene locus_tag LOCUS_00370 5960 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 6256 6957 gene locus_tag LOCUS_00380 6256 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 6981 8264 gene locus_tag LOCUS_00390 6981 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 8261 10033 gene locus_tag LOCUS_00400 8261 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 10030 13464 gene locus_tag LOCUS_00410 10030 13464 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_00410 13820 14290 gene locus_tag LOCUS_00420 13820 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 14287 15465 gene locus_tag LOCUS_00430 14287 15465 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_00430 15517 16827 gene locus_tag LOCUS_00440 15517 16827 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_00440 16871 17152 gene locus_tag LOCUS_00450 16871 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 17663 17154 gene locus_tag LOCUS_00460 17663 17154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 18684 17743 gene locus_tag LOCUS_00470 18684 17743 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257133.1 protein_id gnl|my_center|LOCUS_00470 19134 18697 gene locus_tag LOCUS_00480 19134 18697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 19124 19615 gene locus_tag LOCUS_00490 19124 19615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 22363 19625 gene locus_tag LOCUS_00500 22363 19625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 >Feature sequence004 55 189 gene locus_tag LOCUS_00510 55 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 183 2543 gene locus_tag LOCUS_00520 183 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 3387 2545 gene locus_tag LOCUS_00530 3387 2545 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040202.1 protein_id gnl|my_center|LOCUS_00530 5396 3441 gene locus_tag LOCUS_00540 gene htpG 5396 3441 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064608.1 protein_id gnl|my_center|LOCUS_00540 6616 5573 gene locus_tag LOCUS_00550 6616 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 8117 6684 gene locus_tag LOCUS_00560 8117 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 8245 10830 gene locus_tag LOCUS_00570 gene gyrA 8245 10830 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_00570 10911 11732 gene locus_tag LOCUS_00580 10911 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 11732 12307 gene locus_tag LOCUS_00590 11732 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 14761 12368 gene locus_tag LOCUS_00600 14761 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 14905 16182 gene locus_tag LOCUS_00610 gene hemL 14905 16182 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_00610 16262 16459 gene locus_tag LOCUS_00620 16262 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 16428 16805 gene locus_tag LOCUS_00630 16428 16805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 16805 17578 gene locus_tag LOCUS_00640 16805 17578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 17626 17949 gene locus_tag LOCUS_00650 17626 17949 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546507.1 protein_id gnl|my_center|LOCUS_00650 18158 19042 gene locus_tag LOCUS_00660 18158 19042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 19084 20070 gene locus_tag LOCUS_00670 19084 20070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 20067 20765 gene locus_tag LOCUS_00680 20067 20765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 20762 21973 gene locus_tag LOCUS_00690 20762 21973 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_00690 >Feature sequence005 1192 2121 gene locus_tag LOCUS_00700 1192 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 2118 3068 gene locus_tag LOCUS_00710 2118 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 3140 3553 gene locus_tag LOCUS_00720 3140 3553 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881282.1 protein_id gnl|my_center|LOCUS_00720 4940 3582 gene locus_tag LOCUS_00730 4940 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 5397 4933 gene locus_tag LOCUS_00740 5397 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 6590 5424 gene locus_tag LOCUS_00750 6590 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 7291 6713 gene locus_tag LOCUS_00760 7291 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 7438 8049 gene locus_tag LOCUS_00770 7438 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 8049 8906 gene locus_tag LOCUS_00780 8049 8906 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_00780 9004 9915 gene locus_tag LOCUS_00790 gene lipA 9004 9915 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174105.1 protein_id gnl|my_center|LOCUS_00790 9912 10715 gene locus_tag LOCUS_00800 9912 10715 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229326.1 protein_id gnl|my_center|LOCUS_00800 10736 12100 gene locus_tag LOCUS_00810 gene pdhC 10736 12100 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863430.1 protein_id gnl|my_center|LOCUS_00810 12097 12690 gene locus_tag LOCUS_00820 12097 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 12694 14094 gene locus_tag LOCUS_00830 gene lpdA 12694 14094 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_00830 15791 14223 gene locus_tag LOCUS_00840 15791 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 15905 16531 gene locus_tag LOCUS_00850 gene tmk 15905 16531 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_00850 16528 17196 gene locus_tag LOCUS_00860 16528 17196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 17215 17302 gene locus_tag LOCUS_t00020 17215 17302 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17334 17426 gene locus_tag LOCUS_t00030 17334 17426 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17442 17518 gene locus_tag LOCUS_t00040 17442 17518 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18831 17635 gene locus_tag LOCUS_00870 gene kbl 18831 17635 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213834.1 protein_id gnl|my_center|LOCUS_00870 20033 18867 gene locus_tag LOCUS_00880 gene tdh 20033 18867 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 protein_id gnl|my_center|LOCUS_00880 >Feature sequence006 3220 548 gene locus_tag LOCUS_00890 3220 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 3394 4986 gene locus_tag LOCUS_00900 3394 4986 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_00900 5027 6835 gene locus_tag LOCUS_00910 5027 6835 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_00910 6868 8727 gene locus_tag LOCUS_00920 6868 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 8793 9047 gene locus_tag LOCUS_00930 gene rpsP 8793 9047 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583886.1 protein_id gnl|my_center|LOCUS_00930 9040 9300 gene locus_tag LOCUS_00940 9040 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 9304 9840 gene locus_tag LOCUS_00950 gene rimM 9304 9840 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721394.1 protein_id gnl|my_center|LOCUS_00950 9840 10541 gene locus_tag LOCUS_00960 gene trmD 9840 10541 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_00960 10656 11012 gene locus_tag LOCUS_00970 gene rplS 10656 11012 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181402.1 protein_id gnl|my_center|LOCUS_00970 11013 11405 gene locus_tag LOCUS_00980 11013 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 12497 11418 gene locus_tag LOCUS_00990 12497 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 13969 12545 gene locus_tag LOCUS_01000 13969 12545 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_01000 14074 14601 gene locus_tag LOCUS_01010 14074 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 14640 16322 gene locus_tag LOCUS_01020 14640 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 16472 17398 gene locus_tag LOCUS_01030 16472 17398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 17484 18482 gene locus_tag LOCUS_01040 17484 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 19593 18502 gene locus_tag LOCUS_01050 19593 18502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 >Feature sequence007 1934 282 gene locus_tag LOCUS_01060 1934 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 2382 1942 gene locus_tag LOCUS_01070 2382 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 2366 2557 gene locus_tag LOCUS_01080 2366 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 2738 2541 gene locus_tag LOCUS_01090 2738 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 2750 3772 gene locus_tag LOCUS_01100 2750 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 6541 3833 gene locus_tag LOCUS_01110 6541 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 7199 6546 gene locus_tag LOCUS_01120 7199 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8833 7196 gene locus_tag LOCUS_01130 8833 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 9702 8830 gene locus_tag LOCUS_01140 9702 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 11486 9711 gene locus_tag LOCUS_01150 11486 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 13100 11607 gene locus_tag LOCUS_01160 13100 11607 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_01160 14659 13103 gene locus_tag LOCUS_01170 14659 13103 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_01170 15230 14661 gene locus_tag LOCUS_01180 15230 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01180 15350 15511 gene locus_tag LOCUS_01190 15350 15511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 17013 16702 gene locus_tag LOCUS_01200 gene nuoK 17013 16702 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_01200 17525 17013 gene locus_tag LOCUS_01210 17525 17013 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_01210 17881 18594 gene locus_tag LOCUS_01220 17881 18594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence008 <1 1258 gene locus_tag LOCUS_01230 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925153.1:histidine ammonia-lyase 1373 2557 gene locus_tag LOCUS_01240 1373 2557 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104435.1 protein_id gnl|my_center|LOCUS_01240 2589 3188 gene locus_tag LOCUS_01250 2589 3188 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967257.1 protein_id gnl|my_center|LOCUS_01250 3199 5007 gene locus_tag LOCUS_01260 3199 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 5024 6301 gene locus_tag LOCUS_01270 gene hacA 5024 6301 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_01270 6298 6783 gene locus_tag LOCUS_01280 gene leuD 6298 6783 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_01280 6780 8066 gene locus_tag LOCUS_01290 gene sucC 6780 8066 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_01290 8063 10147 gene locus_tag LOCUS_01300 8063 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 10328 12256 gene locus_tag LOCUS_01310 10328 12256 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266869.1 protein_id gnl|my_center|LOCUS_01310 12295 13188 gene locus_tag LOCUS_01320 12295 13188 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_01320 13485 13249 gene locus_tag LOCUS_01330 13485 13249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 13599 14951 gene locus_tag LOCUS_01340 13599 14951 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405201.1 protein_id gnl|my_center|LOCUS_01340 <17761 14955 gene locus_tag LOCUS_01350 <17761 14955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090068.1:UPF0182 family protein >Feature sequence009 <1 1333 gene locus_tag LOCUS_01360 <1 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640527.1:pitrilysin family protein 4771 1727 gene locus_tag LOCUS_01370 4771 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 6305 4938 gene locus_tag LOCUS_01380 gene argH 6305 4938 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066757.1 protein_id gnl|my_center|LOCUS_01380 7552 6305 gene locus_tag LOCUS_01390 7552 6305 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932792.1 protein_id gnl|my_center|LOCUS_01390 7888 7640 gene locus_tag LOCUS_01400 7888 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 8287 9711 gene locus_tag LOCUS_01410 gene pyk 8287 9711 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_01410 9771 10238 gene locus_tag LOCUS_01420 9771 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 10235 10909 gene locus_tag LOCUS_01430 10235 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 10946 13120 gene locus_tag LOCUS_01440 10946 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 13200 13946 gene locus_tag LOCUS_01450 13200 13946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 14177 13971 gene locus_tag LOCUS_01460 14177 13971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 16385 15396 gene locus_tag LOCUS_01470 16385 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 17311 16385 gene locus_tag LOCUS_01480 17311 16385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 >Feature sequence010 <1 1238 gene locus_tag LOCUS_01490 <1 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942130.1:tetratricopeptide repeat protein note possible pseudo, frameshifted 2908 1223 gene locus_tag LOCUS_01500 2908 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 3010 3417 gene locus_tag LOCUS_01510 3010 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 3569 4048 gene locus_tag LOCUS_01520 3569 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 4054 5079 gene locus_tag LOCUS_01530 4054 5079 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_01530 5827 5087 gene locus_tag LOCUS_01540 5827 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 5861 7144 gene locus_tag LOCUS_01550 5861 7144 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_01550 7141 7623 gene locus_tag LOCUS_01560 7141 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 7836 7726 gene locus_tag LOCUS_r00010 7836 7726 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 10861 7920 gene locus_tag LOCUS_r00020 10861 7920 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 12554 11042 gene locus_tag LOCUS_r00030 12554 11042 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 13512 13006 gene locus_tag LOCUS_01570 13512 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 13807 13514 gene locus_tag LOCUS_01580 13807 13514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 14916 13804 gene locus_tag LOCUS_01590 gene ftsY 14916 13804 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392477.1 protein_id gnl|my_center|LOCUS_01590 <17290 15001 gene locus_tag LOCUS_01600 <17290 15001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941791.1:chromosome segregation protein SMC >Feature sequence011 2246 171 gene locus_tag LOCUS_01610 gene fusA 2246 171 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228848.1 protein_id gnl|my_center|LOCUS_01610 2837 2367 gene locus_tag LOCUS_01620 gene rpsG 2837 2367 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626581.1 protein_id gnl|my_center|LOCUS_01620 3230 2847 gene locus_tag LOCUS_01630 gene rpsL 3230 2847 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_01630 8143 3368 gene locus_tag LOCUS_01640 8143 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 12476 8247 gene locus_tag LOCUS_01650 gene rpoB 12476 8247 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_01650 13261 12881 gene locus_tag LOCUS_01660 gene rplL 13261 12881 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_01660 13870 13337 gene locus_tag LOCUS_01670 gene rplJ 13870 13337 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_01670 14580 13882 gene locus_tag LOCUS_01680 gene rplA 14580 13882 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_01680 15136 14705 gene locus_tag LOCUS_01690 gene rplK 15136 14705 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156430.1 protein_id gnl|my_center|LOCUS_01690 15729 15196 gene locus_tag LOCUS_01700 gene nusG 15729 15196 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_01700 16172 15789 gene locus_tag LOCUS_01710 16172 15789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence012 471 2606 gene locus_tag LOCUS_01720 471 2606 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_01720 3403 2615 gene locus_tag LOCUS_01730 3403 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 3570 4565 gene locus_tag LOCUS_01740 3570 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 4565 7066 gene locus_tag LOCUS_01750 gene uvrA 4565 7066 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122979.1 protein_id gnl|my_center|LOCUS_01750 8653 7067 gene locus_tag LOCUS_01760 8653 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 8797 11706 gene locus_tag LOCUS_01770 8797 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 12143 11817 gene locus_tag LOCUS_01780 12143 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 12290 12144 gene locus_tag LOCUS_01790 12290 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 12434 13126 gene locus_tag LOCUS_01800 12434 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 13275 13673 gene locus_tag LOCUS_01810 13275 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 13928 13829 gene locus_tag LOCUS_t00050 13928 13829 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 14036 14956 gene locus_tag LOCUS_01820 14036 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 <15930 14957 gene locus_tag LOCUS_01830 <15930 14957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000689183.1:peptidase >Feature sequence013 127 804 gene locus_tag LOCUS_01840 127 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 801 1910 gene locus_tag LOCUS_01850 801 1910 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 protein_id gnl|my_center|LOCUS_01850 3199 1895 gene locus_tag LOCUS_01860 3199 1895 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_01860 3232 3810 gene locus_tag LOCUS_01870 3232 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 6106 3833 gene locus_tag LOCUS_01880 6106 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6193 6795 gene locus_tag LOCUS_01890 6193 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 7603 6824 gene locus_tag LOCUS_01900 7603 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 8119 7613 gene locus_tag LOCUS_01910 8119 7613 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507213.1 protein_id gnl|my_center|LOCUS_01910 8328 9641 gene locus_tag LOCUS_01920 8328 9641 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_01920 10717 9635 gene locus_tag LOCUS_01930 10717 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 10928 13048 gene locus_tag LOCUS_01940 10928 13048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 13533 13066 gene locus_tag LOCUS_01950 13533 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 14056 13538 gene locus_tag LOCUS_01960 14056 13538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 14773 14093 gene locus_tag LOCUS_01970 14773 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 <15920 15022 gene locus_tag LOCUS_01980 <15920 15022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938045.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence014 349 436 gene locus_tag LOCUS_t00060 349 436 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 926 486 gene locus_tag LOCUS_01990 926 486 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_01990 1680 1096 gene locus_tag LOCUS_02000 1680 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 2717 1716 gene locus_tag LOCUS_02010 2717 1716 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_02010 3242 2856 gene locus_tag LOCUS_02020 gene rpsK 3242 2856 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_02020 3620 3255 gene locus_tag LOCUS_02030 gene rpsM 3620 3255 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_02030 4560 3766 gene locus_tag LOCUS_02040 gene map 4560 3766 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_02040 5207 4557 gene locus_tag LOCUS_02050 5207 4557 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_02050 6554 5223 gene locus_tag LOCUS_02060 gene secY 6554 5223 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_02060 7027 6581 gene locus_tag LOCUS_02070 gene rplO 7027 6581 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_02070 7245 7051 gene locus_tag LOCUS_02080 gene rpmD 7245 7051 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720933.1 protein_id gnl|my_center|LOCUS_02080 7862 7272 gene locus_tag LOCUS_02090 gene rpsE 7862 7272 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_02090 8271 7903 gene locus_tag LOCUS_02100 gene rplR 8271 7903 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545340.1 protein_id gnl|my_center|LOCUS_02100 8819 8283 gene locus_tag LOCUS_02110 gene rplF 8819 8283 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_02110 9235 8843 gene locus_tag LOCUS_02120 gene rpsH 9235 8843 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567538.1 protein_id gnl|my_center|LOCUS_02120 9463 9278 gene locus_tag LOCUS_02130 9463 9278 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557082.1 protein_id gnl|my_center|LOCUS_02130 10034 9492 gene locus_tag LOCUS_02140 gene rplE 10034 9492 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_02140 10399 10082 gene locus_tag LOCUS_02150 gene rplX 10399 10082 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_02150 10777 10409 gene locus_tag LOCUS_02160 gene rplN 10777 10409 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536525.1 protein_id gnl|my_center|LOCUS_02160 11050 10835 gene locus_tag LOCUS_02170 11050 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 11702 11343 gene locus_tag LOCUS_02180 11702 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 12118 11702 gene locus_tag LOCUS_02190 gene rplP 12118 11702 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545254.1 protein_id gnl|my_center|LOCUS_02190 12820 12176 gene locus_tag LOCUS_02200 gene rpsC 12820 12176 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_02200 13224 12877 gene locus_tag LOCUS_02210 gene rplV 13224 12877 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943481.1 protein_id gnl|my_center|LOCUS_02210 13544 13266 gene locus_tag LOCUS_02220 gene rpsS 13544 13266 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_02220 14346 13570 gene locus_tag LOCUS_02230 gene rplB 14346 13570 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_02230 14690 14403 gene locus_tag LOCUS_02240 14690 14403 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_02240 15316 14693 gene locus_tag LOCUS_02250 gene rplD 15316 14693 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024827.1 protein_id gnl|my_center|LOCUS_02250 15650 15333 gene locus_tag LOCUS_02260 gene rpsJ 15650 15333 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence015 2795 408 gene locus_tag LOCUS_02270 2795 408 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615777.1 protein_id gnl|my_center|LOCUS_02270 3887 2949 gene locus_tag LOCUS_02280 3887 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4393 3884 gene locus_tag LOCUS_02290 4393 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 5433 4480 gene locus_tag LOCUS_02300 5433 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 6890 5481 gene locus_tag LOCUS_02310 6890 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 7805 6927 gene locus_tag LOCUS_02320 7805 6927 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_02320 8301 7816 gene locus_tag LOCUS_02330 8301 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 8401 8874 gene locus_tag LOCUS_02340 8401 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 10170 8881 gene locus_tag LOCUS_02350 gene eno 10170 8881 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_02350 10326 12563 gene locus_tag LOCUS_02360 10326 12563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 13020 12628 gene locus_tag LOCUS_02370 13020 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 <15679 13090 gene locus_tag LOCUS_02380 <15679 13090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704200.1:glycerol-3-phosphate 1-O-acyltransferase PlsB >Feature sequence016 453 1427 gene locus_tag LOCUS_02390 453 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1708 1433 gene locus_tag LOCUS_02400 gene rpsT 1708 1433 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_02400 2046 3356 gene locus_tag LOCUS_02410 2046 3356 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539365.1 protein_id gnl|my_center|LOCUS_02410 3383 5197 gene locus_tag LOCUS_02420 gene lepA 3383 5197 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938004.1 protein_id gnl|my_center|LOCUS_02420 5253 5681 gene locus_tag LOCUS_02430 5253 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 5759 6307 gene locus_tag LOCUS_02440 gene pyrR 5759 6307 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_02440 6304 7239 gene locus_tag LOCUS_02450 6304 7239 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_02450 7232 8509 gene locus_tag LOCUS_02460 7232 8509 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_02460 8564 9040 gene locus_tag LOCUS_02470 gene greA 8564 9040 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 protein_id gnl|my_center|LOCUS_02470 9050 11845 gene locus_tag LOCUS_02480 9050 11845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 11922 12350 gene locus_tag LOCUS_02490 11922 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 13304 12360 gene locus_tag LOCUS_02500 13304 12360 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839946.1 protein_id gnl|my_center|LOCUS_02500 13419 13847 gene locus_tag LOCUS_02510 13419 13847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 13894 15480 gene locus_tag LOCUS_02520 13894 15480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 15517 15592 gene locus_tag LOCUS_t00070 15517 15592 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence017 616 2481 gene locus_tag LOCUS_02530 616 2481 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_02530 2519 2884 gene locus_tag LOCUS_02540 2519 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 2885 3955 gene locus_tag LOCUS_02550 2885 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 4445 3942 gene locus_tag LOCUS_02560 4445 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 4890 4438 gene locus_tag LOCUS_02570 4890 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 5802 4936 gene locus_tag LOCUS_02580 gene selD 5802 4936 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201158.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02580 7059 6046 gene locus_tag LOCUS_02590 7059 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 8092 7061 gene locus_tag LOCUS_02600 8092 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 8700 8089 gene locus_tag LOCUS_02610 8700 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 9180 8752 gene locus_tag LOCUS_02620 9180 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 9339 9413 gene locus_tag LOCUS_t00080 9339 9413 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10675 9497 gene locus_tag LOCUS_02630 10675 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 11246 10668 gene locus_tag LOCUS_02640 11246 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142945.1 protein_id gnl|my_center|LOCUS_02640 11529 12287 gene locus_tag LOCUS_02650 11529 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 14106 12313 gene locus_tag LOCUS_02660 14106 12313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence018 243 968 gene locus_tag LOCUS_02670 243 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 1057 1605 gene locus_tag LOCUS_02680 1057 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 1609 2973 gene locus_tag LOCUS_02690 1609 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3005 4039 gene locus_tag LOCUS_02700 3005 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 6192 4027 gene locus_tag LOCUS_02710 6192 4027 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_02710 7400 6195 gene locus_tag LOCUS_02720 7400 6195 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_02720 7509 9257 gene locus_tag LOCUS_02730 7509 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 9279 11681 gene locus_tag LOCUS_02740 9279 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 13493 11685 gene locus_tag LOCUS_02750 13493 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 13631 14959 gene locus_tag LOCUS_02760 13631 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 >Feature sequence019 2537 375 gene locus_tag LOCUS_02770 2537 375 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_02770 3085 2534 gene locus_tag LOCUS_02780 3085 2534 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971001.1 protein_id gnl|my_center|LOCUS_02780 3115 5046 gene locus_tag LOCUS_02790 3115 5046 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_02790 5096 5413 gene locus_tag LOCUS_02800 5096 5413 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_02800 5410 5721 gene locus_tag LOCUS_02810 5410 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 6414 5743 gene locus_tag LOCUS_02820 6414 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 7189 6482 gene locus_tag LOCUS_02830 7189 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 7304 7846 gene locus_tag LOCUS_02840 7304 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02840 7843 10245 gene locus_tag LOCUS_02850 7843 10245 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_02850 10245 11168 gene locus_tag LOCUS_02860 10245 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 11524 11174 gene locus_tag LOCUS_02870 11524 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 12845 11622 gene locus_tag LOCUS_02880 12845 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 13603 12899 gene locus_tag LOCUS_02890 13603 12899 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 protein_id gnl|my_center|LOCUS_02890 14505 13624 gene locus_tag LOCUS_02900 14505 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 15238 14507 gene locus_tag LOCUS_02910 15238 14507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence020 1184 2344 gene locus_tag LOCUS_02920 1184 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2341 4533 gene locus_tag LOCUS_02930 2341 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 4784 5887 gene locus_tag LOCUS_02940 4784 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 5884 8034 gene locus_tag LOCUS_02950 5884 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 8897 8028 gene locus_tag LOCUS_02960 8897 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 9033 10463 gene locus_tag LOCUS_02970 9033 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 11796 10471 gene locus_tag LOCUS_02980 11796 10471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 12767 11796 gene locus_tag LOCUS_02990 12767 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 13435 12779 gene locus_tag LOCUS_03000 13435 12779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 14439 13615 gene locus_tag LOCUS_03010 gene ugpQ 14439 13615 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099123.1 protein_id gnl|my_center|LOCUS_03010 <15274 14452 gene locus_tag LOCUS_03020 <15274 14452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407374.1:lysophospholipid acyltransferase family protein >Feature sequence021 537 1724 gene locus_tag LOCUS_03030 537 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 1760 2662 gene locus_tag LOCUS_03040 1760 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 4578 3232 gene locus_tag LOCUS_03050 4578 3232 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804149.1 protein_id gnl|my_center|LOCUS_03050 5057 4680 gene locus_tag LOCUS_03060 5057 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 5179 5105 gene locus_tag LOCUS_t00090 5179 5105 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5753 5226 gene locus_tag LOCUS_03070 5753 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 6376 5750 gene locus_tag LOCUS_03080 6376 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 7153 6377 gene locus_tag LOCUS_03090 7153 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 7335 9605 gene locus_tag LOCUS_03100 7335 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 10415 9606 gene locus_tag LOCUS_03110 10415 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 11305 10412 gene locus_tag LOCUS_03120 11305 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 11937 11302 gene locus_tag LOCUS_03130 11937 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 13048 11921 gene locus_tag LOCUS_03140 13048 11921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 13944 13048 gene locus_tag LOCUS_03150 13944 13048 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143966.1 protein_id gnl|my_center|LOCUS_03150 14912 13941 gene locus_tag LOCUS_03160 14912 13941 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_03160 >Feature sequence022 <1 1143 gene locus_tag LOCUS_03170 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083904.1:OmpA family protein 1143 2609 gene locus_tag LOCUS_03180 1143 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 3430 2750 gene locus_tag LOCUS_03190 3430 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4641 3502 gene locus_tag LOCUS_03200 4641 3502 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_03200 4796 5398 gene locus_tag LOCUS_03210 4796 5398 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_03210 5401 5688 gene locus_tag LOCUS_03220 gene porD 5401 5688 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082458.1 protein_id gnl|my_center|LOCUS_03220 5689 6906 gene locus_tag LOCUS_03230 5689 6906 CDS product pyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393422.1 protein_id gnl|my_center|LOCUS_03230 6919 7845 gene locus_tag LOCUS_03240 gene porB 6919 7845 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 protein_id gnl|my_center|LOCUS_03240 7920 11411 gene locus_tag LOCUS_03250 7920 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 11647 12093 gene locus_tag LOCUS_03260 11647 12093 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_03260 <14857 12315 gene locus_tag LOCUS_03270 <14857 12315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122418.1:VIT domain-containing protein >Feature sequence023 298 1149 gene locus_tag LOCUS_03280 298 1149 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390505.1 protein_id gnl|my_center|LOCUS_03280 1153 2382 gene locus_tag LOCUS_03290 1153 2382 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390504.1 protein_id gnl|my_center|LOCUS_03290 4708 2810 gene locus_tag LOCUS_03300 4708 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 4841 5191 gene locus_tag LOCUS_03310 4841 5191 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397337.1 protein_id gnl|my_center|LOCUS_03310 7021 5210 gene locus_tag LOCUS_03320 7021 5210 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403360.1 protein_id gnl|my_center|LOCUS_03320 8277 7072 gene locus_tag LOCUS_03330 8277 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 8379 10934 gene locus_tag LOCUS_03340 gene glgX 8379 10934 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035667.1 protein_id gnl|my_center|LOCUS_03340 10936 12441 gene locus_tag LOCUS_03350 10936 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 12441 13001 gene locus_tag LOCUS_03360 12441 13001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 13013 14800 gene locus_tag LOCUS_03370 13013 14800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence024 1666 1591 gene locus_tag LOCUS_t00100 1666 1591 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3804 1735 gene locus_tag LOCUS_03380 3804 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 5220 3832 gene locus_tag LOCUS_03390 gene accC 5220 3832 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393033.1 protein_id gnl|my_center|LOCUS_03390 5636 5217 gene locus_tag LOCUS_03400 gene accB 5636 5217 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_03400 6079 5639 gene locus_tag LOCUS_03410 gene aroQ 6079 5639 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_03410 6686 6081 gene locus_tag LOCUS_03420 6686 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 7771 6668 gene locus_tag LOCUS_03430 gene aroB 7771 6668 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_03430 8232 7762 gene locus_tag LOCUS_03440 8232 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 10679 8265 gene locus_tag LOCUS_03450 10679 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 11201 10686 gene locus_tag LOCUS_03460 11201 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 11833 11198 gene locus_tag LOCUS_03470 11833 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 12439 11843 gene locus_tag LOCUS_03480 12439 11843 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_03480 13509 12436 gene locus_tag LOCUS_03490 gene pilM 13509 12436 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence025 2436 1435 gene locus_tag LOCUS_03500 2436 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2557 4218 gene locus_tag LOCUS_03510 2557 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 5890 4229 gene locus_tag LOCUS_03520 5890 4229 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627326.1 protein_id gnl|my_center|LOCUS_03520 6409 6023 gene locus_tag LOCUS_03530 6409 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 6681 6451 gene locus_tag LOCUS_03540 gene copZ 6681 6451 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723406.1 protein_id gnl|my_center|LOCUS_03540 7398 6751 gene locus_tag LOCUS_03550 gene queE 7398 6751 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769397.1 protein_id gnl|my_center|LOCUS_03550 7503 8285 gene locus_tag LOCUS_03560 7503 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 8345 10288 gene locus_tag LOCUS_03570 8345 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 10302 11015 gene locus_tag LOCUS_03580 10302 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 12066 10978 gene locus_tag LOCUS_03590 gene prfA 12066 10978 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_03590 13128 12106 gene locus_tag LOCUS_03600 13128 12106 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940173.1 protein_id gnl|my_center|LOCUS_03600 13437 13228 gene locus_tag LOCUS_03610 gene rpmE 13437 13228 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_03610 <14800 13562 gene locus_tag LOCUS_03620 <14800 13562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005378757.1:transcription termination factor Rho >Feature sequence026 142 3915 gene locus_tag LOCUS_03630 142 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5719 4028 gene locus_tag LOCUS_03640 5719 4028 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_03640 5820 7322 gene locus_tag LOCUS_03650 gene gltX 5820 7322 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_03650 7487 7876 gene locus_tag LOCUS_03660 7487 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 8536 8045 gene locus_tag LOCUS_03670 8536 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 10074 8533 gene locus_tag LOCUS_03680 10074 8533 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_03680 11168 10077 gene locus_tag LOCUS_03690 11168 10077 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_03690 13216 11174 gene locus_tag LOCUS_03700 13216 11174 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_03700 <14800 13476 gene locus_tag LOCUS_03710 <14800 13476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813543.1:sensor domain-containing diguanylate cyclase >Feature sequence027 2203 167 gene locus_tag LOCUS_03720 2203 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2309 2875 gene locus_tag LOCUS_03730 gene plsY 2309 2875 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_03730 3701 2880 gene locus_tag LOCUS_03740 3701 2880 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223870501.1 protein_id gnl|my_center|LOCUS_03740 3934 5391 gene locus_tag LOCUS_03750 3934 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 6909 5443 gene locus_tag LOCUS_03760 6909 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 9121 6986 gene locus_tag LOCUS_03770 gene vpsO 9121 6986 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_03770 9288 11666 gene locus_tag LOCUS_03780 9288 11666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 11687 12808 gene locus_tag LOCUS_03790 11687 12808 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205352220.1 protein_id gnl|my_center|LOCUS_03790 12795 13712 gene locus_tag LOCUS_03800 12795 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 14429 13722 gene locus_tag LOCUS_03810 14429 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence028 4628 3156 gene locus_tag LOCUS_03820 4628 3156 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_03820 4852 4682 gene locus_tag LOCUS_03830 4852 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 5436 4852 gene locus_tag LOCUS_03840 gene rsxA 5436 4852 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_03840 6080 5433 gene locus_tag LOCUS_03850 6080 5433 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940061.1 protein_id gnl|my_center|LOCUS_03850 6760 6077 gene locus_tag LOCUS_03860 6760 6077 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_03860 7791 6757 gene locus_tag LOCUS_03870 7791 6757 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082949.1 protein_id gnl|my_center|LOCUS_03870 9131 7788 gene locus_tag LOCUS_03880 gene rsxC 9131 7788 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082948.1 protein_id gnl|my_center|LOCUS_03880 13382 9135 gene locus_tag LOCUS_03890 13382 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 14223 13375 gene locus_tag LOCUS_03900 14223 13375 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence029 15 863 gene locus_tag LOCUS_03910 15 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 944 1822 gene locus_tag LOCUS_03920 944 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1914 2456 gene locus_tag LOCUS_03930 1914 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2478 4199 gene locus_tag LOCUS_03940 2478 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 5068 4205 gene locus_tag LOCUS_03950 5068 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 5550 5065 gene locus_tag LOCUS_03960 5550 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5953 5555 gene locus_tag LOCUS_03970 5953 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 6816 5950 gene locus_tag LOCUS_03980 6816 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 7834 6920 gene locus_tag LOCUS_03990 7834 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 9485 7851 gene locus_tag LOCUS_04000 9485 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 10216 9470 gene locus_tag LOCUS_04010 10216 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 10469 11587 gene locus_tag LOCUS_04020 10469 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 13452 11551 gene locus_tag LOCUS_04030 13452 11551 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence030 41 913 gene locus_tag LOCUS_04040 gene mtnP 41 913 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_04040 917 1654 gene locus_tag LOCUS_04050 gene pilW 917 1654 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227268.1 protein_id gnl|my_center|LOCUS_04050 1651 2286 gene locus_tag LOCUS_04060 1651 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2351 3703 gene locus_tag LOCUS_04070 gene mgtE 2351 3703 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404919.1 protein_id gnl|my_center|LOCUS_04070 3714 4475 gene locus_tag LOCUS_04080 gene recO 3714 4475 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859464.1 protein_id gnl|my_center|LOCUS_04080 4485 5243 gene locus_tag LOCUS_04090 4485 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 5243 5977 gene locus_tag LOCUS_04100 5243 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 6134 6415 gene locus_tag LOCUS_04110 6134 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 6459 7586 gene locus_tag LOCUS_04120 6459 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 7639 8499 gene locus_tag LOCUS_04130 gene glyQ 7639 8499 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_04130 8496 10523 gene locus_tag LOCUS_04140 gene glyS 8496 10523 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_04140 10554 11240 gene locus_tag LOCUS_04150 10554 11240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 11368 12801 gene locus_tag LOCUS_04160 11368 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 12732 13826 gene locus_tag LOCUS_04170 12732 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 14207 13860 gene locus_tag LOCUS_04180 14207 13860 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence031 2302 3696 gene locus_tag LOCUS_04190 2302 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3699 4262 gene locus_tag LOCUS_04200 3699 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4281 4499 gene locus_tag LOCUS_04210 4281 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4496 4867 gene locus_tag LOCUS_04220 4496 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 4864 5532 gene locus_tag LOCUS_04230 4864 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 5574 6926 gene locus_tag LOCUS_04240 5574 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 7790 7068 gene locus_tag LOCUS_04250 7790 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957581.1 protein_id gnl|my_center|LOCUS_04250 7948 9462 gene locus_tag LOCUS_04260 7948 9462 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975683.1 protein_id gnl|my_center|LOCUS_04260 9691 9891 gene locus_tag LOCUS_04270 9691 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 9899 10282 gene locus_tag LOCUS_04280 9899 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 10304 11095 gene locus_tag LOCUS_04290 10304 11095 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939259.1 protein_id gnl|my_center|LOCUS_04290 12430 11144 gene locus_tag LOCUS_04300 12430 11144 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 protein_id gnl|my_center|LOCUS_04300 <14329 12440 gene locus_tag LOCUS_04310 <14329 12440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877796.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein >Feature sequence032 524 3772 gene locus_tag LOCUS_04320 524 3772 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427762.1 protein_id gnl|my_center|LOCUS_04320 4021 4611 gene locus_tag LOCUS_04330 4021 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 4608 5225 gene locus_tag LOCUS_04340 4608 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 5880 5257 gene locus_tag LOCUS_04350 5880 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 7619 6006 gene locus_tag LOCUS_04360 7619 6006 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391431.1 protein_id gnl|my_center|LOCUS_04360 9481 7685 gene locus_tag LOCUS_04370 9481 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 9578 10096 gene locus_tag LOCUS_04380 9578 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 10158 10391 gene locus_tag LOCUS_04390 10158 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 13956 10318 gene locus_tag LOCUS_04400 13956 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence033 1737 3251 gene locus_tag LOCUS_04410 1737 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2717 2793 gene locus_tag LOCUS_t00110 2717 2793 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3277 5196 gene locus_tag LOCUS_04420 gene pepF 3277 5196 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868855.1 protein_id gnl|my_center|LOCUS_04420 6000 5206 gene locus_tag LOCUS_04430 6000 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6199 6639 gene locus_tag LOCUS_04440 6199 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 6741 7667 gene locus_tag LOCUS_04450 6741 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 7728 8534 gene locus_tag LOCUS_04460 gene yaaA 7728 8534 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092094.1 protein_id gnl|my_center|LOCUS_04460 8545 9717 gene locus_tag LOCUS_04470 8545 9717 CDS product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207351.1 protein_id gnl|my_center|LOCUS_04470 9782 10567 gene locus_tag LOCUS_04480 9782 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 11510 10578 gene locus_tag LOCUS_04490 gene trxB 11510 10578 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_04490 11883 11527 gene locus_tag LOCUS_04500 11883 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 12088 13491 gene locus_tag LOCUS_04510 12088 13491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 12228 12327 gene locus_tag LOCUS_t00120 12228 12327 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 791 2116 gene locus_tag LOCUS_04520 gene miaB 791 2116 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339445.1 protein_id gnl|my_center|LOCUS_04520 2219 3598 gene locus_tag LOCUS_04530 2219 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 3610 4308 gene locus_tag LOCUS_04540 3610 4308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_04540 4305 6146 gene locus_tag LOCUS_04550 4305 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6193 6951 gene locus_tag LOCUS_04560 gene modA 6193 6951 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_04560 6948 7721 gene locus_tag LOCUS_04570 6948 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 7714 8445 gene locus_tag LOCUS_04580 7714 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 8594 10156 gene locus_tag LOCUS_04590 8594 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 10274 11608 gene locus_tag LOCUS_04600 10274 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 12594 11713 gene locus_tag LOCUS_04610 12594 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 12802 13794 gene locus_tag LOCUS_04620 12802 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 >Feature sequence035 <1 2718 gene locus_tag LOCUS_04630 <1 2718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039076.1:MMPL family transporter 2715 3215 gene locus_tag LOCUS_04640 2715 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3205 5034 gene locus_tag LOCUS_04650 3205 5034 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925926.1 protein_id gnl|my_center|LOCUS_04650 5347 5054 gene locus_tag LOCUS_04660 5347 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 6711 5515 gene locus_tag LOCUS_04670 6711 5515 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707147.1 protein_id gnl|my_center|LOCUS_04670 8234 6750 gene locus_tag LOCUS_04680 8234 6750 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_04680 8675 8235 gene locus_tag LOCUS_04690 gene fabZ 8675 8235 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356286.1 protein_id gnl|my_center|LOCUS_04690 9894 8668 gene locus_tag LOCUS_04700 9894 8668 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_04700 10005 10460 gene locus_tag LOCUS_04710 10005 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 10730 10467 gene locus_tag LOCUS_04720 10730 10467 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316688.1 protein_id gnl|my_center|LOCUS_04720 13429 10898 gene locus_tag LOCUS_04730 13429 10898 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403520.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence036 3147 244 gene locus_tag LOCUS_04740 gene gcvP 3147 244 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_04740 3267 4361 gene locus_tag LOCUS_04750 gene gcvT 3267 4361 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_04750 4404 4793 gene locus_tag LOCUS_04760 gene gcvH 4404 4793 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865076.1 protein_id gnl|my_center|LOCUS_04760 4854 6416 gene locus_tag LOCUS_04770 4854 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 7302 6424 gene locus_tag LOCUS_04780 7302 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 6757 6840 gene locus_tag LOCUS_t00130 6757 6840 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7820 8446 gene locus_tag LOCUS_04790 7820 8446 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_04790 8447 8872 gene locus_tag LOCUS_04800 8447 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 9092 9376 gene locus_tag LOCUS_04810 9092 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 9390 10325 gene locus_tag LOCUS_04820 9390 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 10493 10867 gene locus_tag LOCUS_04830 10493 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 10864 11286 gene locus_tag LOCUS_04840 10864 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 11279 12916 gene locus_tag LOCUS_04850 11279 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence037 1235 2641 gene locus_tag LOCUS_04860 1235 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2638 4128 gene locus_tag LOCUS_04870 2638 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 4190 5464 gene locus_tag LOCUS_04880 4190 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 5458 6228 gene locus_tag LOCUS_04890 5458 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 6279 7172 gene locus_tag LOCUS_04900 6279 7172 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_04900 7169 8452 gene locus_tag LOCUS_04910 7169 8452 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730828.1 protein_id gnl|my_center|LOCUS_04910 9415 8462 gene locus_tag LOCUS_04920 9415 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 10117 9479 gene locus_tag LOCUS_04930 10117 9479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 10156 11610 gene locus_tag LOCUS_04940 10156 11610 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_04940 11607 12413 gene locus_tag LOCUS_04950 11607 12413 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339537.1 protein_id gnl|my_center|LOCUS_04950 12439 12813 gene locus_tag LOCUS_04960 12439 12813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 13248 12835 gene locus_tag LOCUS_04970 13248 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence038 915 208 gene locus_tag LOCUS_04980 915 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 999 2606 gene locus_tag LOCUS_04990 999 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 3976 2528 gene locus_tag LOCUS_05000 3976 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 4521 3973 gene locus_tag LOCUS_05010 4521 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 7361 4518 gene locus_tag LOCUS_05020 7361 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 8489 7521 gene locus_tag LOCUS_05030 8489 7521 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817156.1 protein_id gnl|my_center|LOCUS_05030 9359 8568 gene locus_tag LOCUS_05040 9359 8568 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_05040 10045 9356 gene locus_tag LOCUS_05050 gene fadR 10045 9356 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_05050 11557 10235 gene locus_tag LOCUS_05060 11557 10235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 12438 11554 gene locus_tag LOCUS_05070 12438 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 >Feature sequence039 <1 1796 gene locus_tag LOCUS_05080 <1 1796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062283476.1:TrkH family potassium uptake protein 1819 2475 gene locus_tag LOCUS_05090 1819 2475 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256116.1 protein_id gnl|my_center|LOCUS_05090 2477 3370 gene locus_tag LOCUS_05100 2477 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 3426 3824 gene locus_tag LOCUS_05110 3426 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6108 3850 gene locus_tag LOCUS_05120 6108 3850 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_05120 7390 6314 gene locus_tag LOCUS_05130 7390 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 7940 7464 gene locus_tag LOCUS_05140 gene moaC 7940 7464 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719152.1 protein_id gnl|my_center|LOCUS_05140 9139 7958 gene locus_tag LOCUS_05150 9139 7958 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937801.1 protein_id gnl|my_center|LOCUS_05150 9198 10496 gene locus_tag LOCUS_05160 9198 10496 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_05160 10504 11316 gene locus_tag LOCUS_05170 10504 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 11322 12857 gene locus_tag LOCUS_05180 11322 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05180 >Feature sequence040 1019 57 gene locus_tag LOCUS_05190 1019 57 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036211.1 protein_id gnl|my_center|LOCUS_05190 1474 1019 gene locus_tag LOCUS_05200 1474 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 1699 4227 gene locus_tag LOCUS_05210 1699 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 4624 4265 gene locus_tag LOCUS_05220 4624 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6031 4775 gene locus_tag LOCUS_05230 gene tyrS 6031 4775 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_05230 9408 6073 gene locus_tag LOCUS_05240 9408 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 9332 9565 gene locus_tag LOCUS_05250 9332 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 9963 9502 gene locus_tag LOCUS_05260 9963 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 10092 10583 gene locus_tag LOCUS_05270 10092 10583 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876911.1 protein_id gnl|my_center|LOCUS_05270 10661 11152 gene locus_tag LOCUS_05280 10661 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence041 1617 13 gene locus_tag LOCUS_05290 gene fumA 1617 13 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209418.1 protein_id gnl|my_center|LOCUS_05290 1834 3276 gene locus_tag LOCUS_05300 1834 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3383 4900 gene locus_tag LOCUS_05310 gene lysS 3383 4900 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_05310 4900 6309 gene locus_tag LOCUS_05320 4900 6309 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_05320 6323 7654 gene locus_tag LOCUS_05330 6323 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 7654 10401 gene locus_tag LOCUS_05340 gene bamA 7654 10401 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_05340 10488 11030 gene locus_tag LOCUS_05350 10488 11030 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545058.1 protein_id gnl|my_center|LOCUS_05350 11034 12089 gene locus_tag LOCUS_05360 gene lpxD 11034 12089 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_05360 12086 12568 gene locus_tag LOCUS_05370 gene fabZ 12086 12568 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969260.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence042 277 558 gene locus_tag LOCUS_05380 277 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 569 1327 gene locus_tag LOCUS_05390 569 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 1929 1330 gene locus_tag LOCUS_05400 gene udk 1929 1330 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_05400 2276 1926 gene locus_tag LOCUS_05410 2276 1926 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173792.1 protein_id gnl|my_center|LOCUS_05410 3185 2280 gene locus_tag LOCUS_05420 3185 2280 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_05420 4000 3182 gene locus_tag LOCUS_05430 4000 3182 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870446.1 protein_id gnl|my_center|LOCUS_05430 4276 5577 gene locus_tag LOCUS_05440 4276 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 5971 5714 gene locus_tag LOCUS_05450 5971 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 9207 5968 gene locus_tag LOCUS_05460 9207 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 9288 11576 gene locus_tag LOCUS_05470 9288 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 11645 12565 gene locus_tag LOCUS_05480 11645 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence043 2283 853 gene locus_tag LOCUS_05490 2283 853 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_05490 2745 2329 gene locus_tag LOCUS_05500 2745 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2885 4315 gene locus_tag LOCUS_05510 2885 4315 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063882.1 protein_id gnl|my_center|LOCUS_05510 4447 5808 gene locus_tag LOCUS_05520 4447 5808 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790434.1 protein_id gnl|my_center|LOCUS_05520 6372 5884 gene locus_tag LOCUS_05530 6372 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 8869 6413 gene locus_tag LOCUS_05540 8869 6413 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143626.1 protein_id gnl|my_center|LOCUS_05540 8859 10355 gene locus_tag LOCUS_05550 8859 10355 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090620.1 protein_id gnl|my_center|LOCUS_05550 10356 11540 gene locus_tag LOCUS_05560 10356 11540 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222035.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence044 1351 689 gene locus_tag LOCUS_05570 gene thiE 1351 689 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_05570 1521 3290 gene locus_tag LOCUS_05580 1521 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 4683 3310 gene locus_tag LOCUS_05590 4683 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 5285 4680 gene locus_tag LOCUS_05600 5285 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6948 5287 gene locus_tag LOCUS_05610 6948 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 8230 6962 gene locus_tag LOCUS_05620 8230 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 8976 8230 gene locus_tag LOCUS_05630 8976 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 9599 8973 gene locus_tag LOCUS_05640 9599 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 10333 9596 gene locus_tag LOCUS_05650 10333 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 10782 10339 gene locus_tag LOCUS_05660 gene gspG 10782 10339 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_05660 12106 10871 gene locus_tag LOCUS_05670 12106 10871 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_05670 12335 12120 gene locus_tag LOCUS_05680 12335 12120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence045 1977 358 gene locus_tag LOCUS_05690 1977 358 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986790.1 protein_id gnl|my_center|LOCUS_05690 2072 3550 gene locus_tag LOCUS_05700 2072 3550 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940278.1 protein_id gnl|my_center|LOCUS_05700 4649 3579 gene locus_tag LOCUS_05710 4649 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5571 4720 gene locus_tag LOCUS_05720 gene prmC 5571 4720 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640077.1 protein_id gnl|my_center|LOCUS_05720 6430 5597 gene locus_tag LOCUS_05730 gene fetB 6430 5597 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191253.1 protein_id gnl|my_center|LOCUS_05730 7211 6564 gene locus_tag LOCUS_05740 7211 6564 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535853.1 protein_id gnl|my_center|LOCUS_05740 8576 7212 gene locus_tag LOCUS_05750 gene hemG 8576 7212 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_05750 9944 8577 gene locus_tag LOCUS_05760 9944 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 11325 9958 gene locus_tag LOCUS_05770 gene hemN 11325 9958 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116090.1 protein_id gnl|my_center|LOCUS_05770 <12267 11316 gene locus_tag LOCUS_05780 <12267 11316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944063.1:uroporphyrinogen decarboxylase >Feature sequence046 343 681 gene locus_tag LOCUS_05790 343 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 1115 1606 gene locus_tag LOCUS_05800 1115 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 1625 2161 gene locus_tag LOCUS_05810 1625 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4361 2175 gene locus_tag LOCUS_05820 4361 2175 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_05820 4515 5447 gene locus_tag LOCUS_05830 4515 5447 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228782.1 protein_id gnl|my_center|LOCUS_05830 5559 6026 gene locus_tag LOCUS_05840 5559 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 6060 7685 gene locus_tag LOCUS_05850 gene gpmI 6060 7685 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_05850 7682 8692 gene locus_tag LOCUS_05860 7682 8692 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_05860 9667 8702 gene locus_tag LOCUS_05870 9667 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 9560 9799 gene locus_tag LOCUS_05880 9560 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 10506 9721 gene locus_tag LOCUS_05890 10506 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 12075 10516 gene locus_tag LOCUS_05900 12075 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence047 96 329 gene locus_tag LOCUS_05910 96 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 326 1009 gene locus_tag LOCUS_05920 326 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 1682 987 gene locus_tag LOCUS_05930 1682 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 3600 1774 gene locus_tag LOCUS_05940 3600 1774 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190081.1 protein_id gnl|my_center|LOCUS_05940 3700 4731 gene locus_tag LOCUS_05950 3700 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 4759 5676 gene locus_tag LOCUS_05960 4759 5676 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967711.1 protein_id gnl|my_center|LOCUS_05960 6471 5686 gene locus_tag LOCUS_05970 6471 5686 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 protein_id gnl|my_center|LOCUS_05970 7502 6471 gene locus_tag LOCUS_05980 7502 6471 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05980 9292 7499 gene locus_tag LOCUS_05990 9292 7499 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_05990 9442 10491 gene locus_tag LOCUS_06000 9442 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 12003 10516 gene locus_tag LOCUS_06010 12003 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence048 1506 181 gene locus_tag LOCUS_06020 1506 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 2957 1503 gene locus_tag LOCUS_06030 2957 1503 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_06030 3188 4198 gene locus_tag LOCUS_06040 3188 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4195 5130 gene locus_tag LOCUS_06050 4195 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 5127 6095 gene locus_tag LOCUS_06060 5127 6095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_06060 6092 7237 gene locus_tag LOCUS_06070 6092 7237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_06070 7234 8382 gene locus_tag LOCUS_06080 7234 8382 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_06080 8460 9776 gene locus_tag LOCUS_06090 8460 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 9840 10571 gene locus_tag LOCUS_06100 9840 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 <12065 10968 gene locus_tag LOCUS_06110 <12065 10968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000246120.1:alpha/beta fold hydrolase >Feature sequence049 <1 1226 gene locus_tag LOCUS_06120 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108446.1:SGNH/GDSL hydrolase family protein 2703 1234 gene locus_tag LOCUS_06130 2703 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 2762 4159 gene locus_tag LOCUS_06140 2762 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 4264 5586 gene locus_tag LOCUS_06150 4264 5586 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552000.1 protein_id gnl|my_center|LOCUS_06150 7084 5570 gene locus_tag LOCUS_06160 7084 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 7241 8077 gene locus_tag LOCUS_06170 7241 8077 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_06170 8085 9266 gene locus_tag LOCUS_06180 8085 9266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470532.1 protein_id gnl|my_center|LOCUS_06180 11850 9268 gene locus_tag LOCUS_06190 11850 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence050 860 1642 gene locus_tag LOCUS_06200 860 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2561 1647 gene locus_tag LOCUS_06210 2561 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3514 2579 gene locus_tag LOCUS_06220 3514 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 4620 3511 gene locus_tag LOCUS_06230 4620 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 8120 4617 gene locus_tag LOCUS_06240 8120 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 8570 8175 gene locus_tag LOCUS_06250 8570 8175 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_06250 9624 8584 gene locus_tag LOCUS_06260 9624 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 10315 9656 gene locus_tag LOCUS_06270 10315 9656 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence051 2627 6 gene locus_tag LOCUS_06280 2627 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4188 2644 gene locus_tag LOCUS_06290 4188 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 7721 4197 gene locus_tag LOCUS_06300 7721 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 8743 7739 gene locus_tag LOCUS_06310 8743 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 8949 10655 gene locus_tag LOCUS_06320 8949 10655 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228601.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence052 930 181 gene locus_tag LOCUS_06330 930 181 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_06330 2876 930 gene locus_tag LOCUS_06340 2876 930 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_06340 3584 2889 gene locus_tag LOCUS_06350 3584 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_06350 4295 3825 gene locus_tag LOCUS_06360 4295 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 4795 4292 gene locus_tag LOCUS_06370 4795 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 4904 5887 gene locus_tag LOCUS_06380 4904 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 6874 5900 gene locus_tag LOCUS_06390 6874 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 7820 6933 gene locus_tag LOCUS_06400 gene sucD 7820 6933 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_06400 9071 7830 gene locus_tag LOCUS_06410 gene sucC 9071 7830 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721255.1 protein_id gnl|my_center|LOCUS_06410 10337 9081 gene locus_tag LOCUS_06420 gene icd 10337 9081 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206898.1 protein_id gnl|my_center|LOCUS_06420 <11727 10546 gene locus_tag LOCUS_06430 <11727 10546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047817179.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence053 2134 1370 gene locus_tag LOCUS_06440 2134 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2278 3369 gene locus_tag LOCUS_06450 2278 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3921 3418 gene locus_tag LOCUS_06460 3921 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 4826 4095 gene locus_tag LOCUS_06470 4826 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 5817 4936 gene locus_tag LOCUS_06480 gene hslO 5817 4936 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_06480 5863 7365 gene locus_tag LOCUS_06490 5863 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 7398 8354 gene locus_tag LOCUS_06500 7398 8354 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_06500 9610 8363 gene locus_tag LOCUS_06510 9610 8363 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080938.1 protein_id gnl|my_center|LOCUS_06510 10506 9721 gene locus_tag LOCUS_06520 10506 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 11274 10591 gene locus_tag LOCUS_06530 11274 10591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 11685 11350 gene locus_tag LOCUS_06540 11685 11350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence054 550 1095 gene locus_tag LOCUS_06550 550 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 1803 1099 gene locus_tag LOCUS_06560 1803 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2591 1800 gene locus_tag LOCUS_06570 gene gloB 2591 1800 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337385.1 protein_id gnl|my_center|LOCUS_06570 2635 3201 gene locus_tag LOCUS_06580 2635 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5778 3355 gene locus_tag LOCUS_06590 gene qqaR 5778 3355 CDS product N-acyl homoserine lactone acylase QqaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_06590 5862 6494 gene locus_tag LOCUS_06600 5862 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 7932 6457 gene locus_tag LOCUS_06610 7932 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 8834 7935 gene locus_tag LOCUS_06620 8834 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 8967 9335 gene locus_tag LOCUS_06630 8967 9335 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 protein_id gnl|my_center|LOCUS_06630 10395 9319 gene locus_tag LOCUS_06640 10395 9319 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246120.1 protein_id gnl|my_center|LOCUS_06640 10797 10399 gene locus_tag LOCUS_06650 10797 10399 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence055 136 1785 gene locus_tag LOCUS_06660 136 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 1782 2243 gene locus_tag LOCUS_06670 1782 2243 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940913.1 protein_id gnl|my_center|LOCUS_06670 2454 2729 gene locus_tag LOCUS_06680 2454 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 2761 5529 gene locus_tag LOCUS_06690 gene napA 2761 5529 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 protein_id gnl|my_center|LOCUS_06690 5544 6056 gene locus_tag LOCUS_06700 5544 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 6053 6322 gene locus_tag LOCUS_06710 6053 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 6310 6915 gene locus_tag LOCUS_06720 6310 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 6968 7714 gene locus_tag LOCUS_06730 6968 7714 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390386.1 protein_id gnl|my_center|LOCUS_06730 7914 9077 gene locus_tag LOCUS_06740 7914 9077 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_06740 9088 10410 gene locus_tag LOCUS_06750 9088 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 11505 10552 gene locus_tag LOCUS_06760 gene arcC 11505 10552 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence056 <1 743 gene locus_tag LOCUS_06770 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205338.1:OmpA family protein 862 2985 gene locus_tag LOCUS_06780 gene flhA 862 2985 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_06780 3084 3884 gene locus_tag LOCUS_06790 3084 3884 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160341.1 protein_id gnl|my_center|LOCUS_06790 3881 4588 gene locus_tag LOCUS_06800 gene flgF 3881 4588 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081931.1 protein_id gnl|my_center|LOCUS_06800 4585 5361 gene locus_tag LOCUS_06810 gene flgG 4585 5361 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946953.1 protein_id gnl|my_center|LOCUS_06810 5369 6064 gene locus_tag LOCUS_06820 5369 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 6061 6843 gene locus_tag LOCUS_06830 6061 6843 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545249.1 protein_id gnl|my_center|LOCUS_06830 6941 8035 gene locus_tag LOCUS_06840 6941 8035 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_06840 8040 8810 gene locus_tag LOCUS_06850 8040 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 8853 9125 gene locus_tag LOCUS_06860 8853 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 9129 9455 gene locus_tag LOCUS_06870 9129 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 9452 10834 gene locus_tag LOCUS_06880 9452 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence057 2089 995 gene locus_tag LOCUS_06890 2089 995 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_06890 2261 2875 gene locus_tag LOCUS_06900 2261 2875 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_06900 2872 3150 gene locus_tag LOCUS_06910 2872 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3155 3934 gene locus_tag LOCUS_06920 gene cbiQ 3155 3934 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_06920 3931 4695 gene locus_tag LOCUS_06930 3931 4695 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_06930 4692 5444 gene locus_tag LOCUS_06940 4692 5444 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_06940 5489 6769 gene locus_tag LOCUS_06950 5489 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 8250 6748 gene locus_tag LOCUS_06960 8250 6748 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_06960 8409 9335 gene locus_tag LOCUS_06970 8409 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 >Feature sequence058 505 616 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcgacggcggctcggcgg 1111 2811 gene locus_tag LOCUS_06980 1111 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4270 2786 gene locus_tag LOCUS_06990 4270 2786 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940278.1 protein_id gnl|my_center|LOCUS_06990 4479 4291 gene locus_tag LOCUS_07000 4479 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 4418 5869 gene locus_tag LOCUS_07010 4418 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 5869 7320 gene locus_tag LOCUS_07020 5869 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 7341 8414 gene locus_tag LOCUS_07030 7341 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 8704 10311 gene locus_tag LOCUS_07040 8704 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 10549 11241 gene locus_tag LOCUS_07050 10549 11241 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence059 <1 1090 gene locus_tag LOCUS_07060 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925116.1:4Fe-4S binding protein 1557 988 gene locus_tag LOCUS_07070 1557 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1637 4834 gene locus_tag LOCUS_07080 gene carB 1637 4834 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257643.1 protein_id gnl|my_center|LOCUS_07080 4946 6349 gene locus_tag LOCUS_07090 4946 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 8370 6370 gene locus_tag LOCUS_07100 8370 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 8638 10749 gene locus_tag LOCUS_07110 8638 10749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 9501 9575 gene locus_tag LOCUS_t00140 9501 9575 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence060 143 823 gene locus_tag LOCUS_07120 143 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 828 1622 gene locus_tag LOCUS_07130 828 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 1615 3438 gene locus_tag LOCUS_07140 1615 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 4851 3448 gene locus_tag LOCUS_07150 4851 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 4939 7482 gene locus_tag LOCUS_07160 4939 7482 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_07160 7520 8425 gene locus_tag LOCUS_07170 7520 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 8821 8441 gene locus_tag LOCUS_07180 8821 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence061 3 1640 gene locus_tag LOCUS_07190 3 1640 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_07190 2692 1613 gene locus_tag LOCUS_07200 gene flhB 2692 1613 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_07200 3467 2682 gene locus_tag LOCUS_07210 gene fliR 3467 2682 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268436.1 protein_id gnl|my_center|LOCUS_07210 3736 3467 gene locus_tag LOCUS_07220 gene fliQ 3736 3467 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_07220 4512 3745 gene locus_tag LOCUS_07230 gene fliP 4512 3745 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061723562.1 protein_id gnl|my_center|LOCUS_07230 5225 4509 gene locus_tag LOCUS_07240 5225 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 5485 5225 gene locus_tag LOCUS_07250 5485 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 6507 5632 gene locus_tag LOCUS_07260 6507 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 7045 6518 gene locus_tag LOCUS_07270 7045 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 7790 7038 gene locus_tag LOCUS_07280 7790 7038 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870067.1 protein_id gnl|my_center|LOCUS_07280 8555 7791 gene locus_tag LOCUS_07290 8555 7791 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_07290 10019 8658 gene locus_tag LOCUS_07300 10019 8658 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545614.1 protein_id gnl|my_center|LOCUS_07300 9979 10284 gene locus_tag LOCUS_07310 9979 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 10586 10173 gene locus_tag LOCUS_07320 10586 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 11271 10588 gene locus_tag LOCUS_07330 11271 10588 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839909.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence062 1133 390 gene locus_tag LOCUS_07340 1133 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1875 1126 gene locus_tag LOCUS_07350 1875 1126 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_07350 2953 1898 gene locus_tag LOCUS_07360 gene bpsA 2953 1898 CDS product type III polyketide synthase BpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230750.1 protein_id gnl|my_center|LOCUS_07360 3673 2975 gene locus_tag LOCUS_07370 3673 2975 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804111.1 protein_id gnl|my_center|LOCUS_07370 3724 4482 gene locus_tag LOCUS_07380 3724 4482 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324308.1 protein_id gnl|my_center|LOCUS_07380 4479 4784 gene locus_tag LOCUS_07390 4479 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 4796 5767 gene locus_tag LOCUS_07400 4796 5767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144194.1 protein_id gnl|my_center|LOCUS_07400 5764 6531 gene locus_tag LOCUS_07410 5764 6531 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_07410 6528 7589 gene locus_tag LOCUS_07420 6528 7589 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_07420 7586 8431 gene locus_tag LOCUS_07430 7586 8431 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_07430 10513 8459 gene locus_tag LOCUS_07440 10513 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence063 <1 1046 gene locus_tag LOCUS_07450 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454869.1:Hsp70 family protein 1461 1946 gene locus_tag LOCUS_07460 1461 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2214 2630 gene locus_tag LOCUS_07470 2214 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 2649 5609 gene locus_tag LOCUS_07480 2649 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 5807 7609 gene locus_tag LOCUS_07490 5807 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 7741 9831 gene locus_tag LOCUS_07500 7741 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 <11418 9836 gene locus_tag LOCUS_07510 <11418 9836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870015.1:dynamin family protein >Feature sequence064 697 50 gene locus_tag LOCUS_07520 697 50 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 protein_id gnl|my_center|LOCUS_07520 809 1741 gene locus_tag LOCUS_07530 809 1741 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390592.1 protein_id gnl|my_center|LOCUS_07530 1854 1627 gene locus_tag LOCUS_07540 1854 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3308 1851 gene locus_tag LOCUS_07550 3308 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3833 3312 gene locus_tag LOCUS_07560 3833 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 4035 5348 gene locus_tag LOCUS_07570 4035 5348 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_07570 6224 5358 gene locus_tag LOCUS_07580 6224 5358 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105018.1 protein_id gnl|my_center|LOCUS_07580 6486 9254 gene locus_tag LOCUS_07590 6486 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 9251 9949 gene locus_tag LOCUS_07600 9251 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 9946 10779 gene locus_tag LOCUS_07610 9946 10779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 11296 10727 gene locus_tag LOCUS_07620 11296 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence065 733 89 gene locus_tag LOCUS_07630 733 89 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530139.1 protein_id gnl|my_center|LOCUS_07630 868 1788 gene locus_tag LOCUS_07640 gene argF 868 1788 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_07640 1859 2788 gene locus_tag LOCUS_07650 1859 2788 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389693.1 protein_id gnl|my_center|LOCUS_07650 2788 3531 gene locus_tag LOCUS_07660 2788 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3586 4770 gene locus_tag LOCUS_07670 3586 4770 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082214.1 protein_id gnl|my_center|LOCUS_07670 5484 4774 gene locus_tag LOCUS_07680 5484 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07680 5756 5490 gene locus_tag LOCUS_07690 5756 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 7446 5758 gene locus_tag LOCUS_07700 7446 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 8393 7461 gene locus_tag LOCUS_07710 8393 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 10206 8503 gene locus_tag LOCUS_07720 10206 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence066 2008 1229 gene locus_tag LOCUS_07730 2008 1229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_07730 2778 2005 gene locus_tag LOCUS_07740 2778 2005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976385.1 protein_id gnl|my_center|LOCUS_07740 2864 3247 gene locus_tag LOCUS_07750 2864 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 3777 3259 gene locus_tag LOCUS_07760 3777 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 4204 5028 gene locus_tag LOCUS_07770 4204 5028 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_07770 5089 5637 gene locus_tag LOCUS_07780 5089 5637 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140681.1 protein_id gnl|my_center|LOCUS_07780 6730 5645 gene locus_tag LOCUS_07790 6730 5645 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_07790 8231 6753 gene locus_tag LOCUS_07800 gene hpnJ 8231 6753 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_07800 8382 9275 gene locus_tag LOCUS_07810 8382 9275 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174253.1 protein_id gnl|my_center|LOCUS_07810 9296 9742 gene locus_tag LOCUS_07820 9296 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 9828 10514 gene locus_tag LOCUS_07830 9828 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 10655 11167 gene locus_tag LOCUS_07840 10655 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence067 <1 2818 gene locus_tag LOCUS_07850 <1 2818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255990.1:Ig-like domain-containing protein 4372 2828 gene locus_tag LOCUS_07860 4372 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 6396 4336 gene locus_tag LOCUS_07870 6396 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 7512 6406 gene locus_tag LOCUS_07880 7512 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 7511 8089 gene locus_tag LOCUS_07890 7511 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 8216 8644 gene locus_tag LOCUS_07900 8216 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 8632 9960 gene locus_tag LOCUS_07910 8632 9960 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_07910 10343 9972 gene locus_tag LOCUS_07920 10343 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence068 1618 593 gene locus_tag LOCUS_07930 gene fliG 1618 593 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_07930 3277 1640 gene locus_tag LOCUS_07940 gene fliF 3277 1640 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_07940 3782 3474 gene locus_tag LOCUS_07950 3782 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4213 3785 gene locus_tag LOCUS_07960 gene flgC 4213 3785 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_07960 4641 4210 gene locus_tag LOCUS_07970 gene flgB 4641 4210 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884694.1 protein_id gnl|my_center|LOCUS_07970 6979 4802 gene locus_tag LOCUS_07980 6979 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 7685 6981 gene locus_tag LOCUS_07990 7685 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 8051 7737 gene locus_tag LOCUS_08000 8051 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 8416 8048 gene locus_tag LOCUS_08010 gene fliS 8416 8048 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_08010 9789 8458 gene locus_tag LOCUS_08020 gene fliD 9789 8458 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943664.1 protein_id gnl|my_center|LOCUS_08020 10700 9870 gene locus_tag LOCUS_08030 10700 9870 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence069 <1 881 gene locus_tag LOCUS_08040 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000844448.1:M14 family zinc carboxypeptidase 1482 2414 gene locus_tag LOCUS_08050 1482 2414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_08050 2411 3136 gene locus_tag LOCUS_08060 2411 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 3133 5097 gene locus_tag LOCUS_08070 3133 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5094 6275 gene locus_tag LOCUS_08080 5094 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 7073 6312 gene locus_tag LOCUS_08090 7073 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 7141 10650 gene locus_tag LOCUS_08100 7141 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence070 2350 908 gene locus_tag LOCUS_08110 2350 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 2607 2353 gene locus_tag LOCUS_08120 2607 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 3389 2604 gene locus_tag LOCUS_08130 3389 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 4344 3394 gene locus_tag LOCUS_08140 4344 3394 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523363.1 protein_id gnl|my_center|LOCUS_08140 5293 4346 gene locus_tag LOCUS_08150 5293 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 6636 5293 gene locus_tag LOCUS_08160 6636 5293 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537977.1 protein_id gnl|my_center|LOCUS_08160 7838 6657 gene locus_tag LOCUS_08170 7838 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 9249 7849 gene locus_tag LOCUS_08180 9249 7849 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_08180 10263 9271 gene locus_tag LOCUS_08190 10263 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 10821 10360 gene locus_tag LOCUS_08200 10821 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence071 885 46 gene locus_tag LOCUS_08210 885 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 1444 917 gene locus_tag LOCUS_08220 1444 917 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421522.1 protein_id gnl|my_center|LOCUS_08220 1620 1844 gene locus_tag LOCUS_08230 1620 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3180 1855 gene locus_tag LOCUS_08240 3180 1855 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_08240 3342 4979 gene locus_tag LOCUS_08250 3342 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 6172 4973 gene locus_tag LOCUS_08260 6172 4973 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222773.1 protein_id gnl|my_center|LOCUS_08260 7337 6177 gene locus_tag LOCUS_08270 7337 6177 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_08270 8247 7375 gene locus_tag LOCUS_08280 gene deoC 8247 7375 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_08280 8383 9258 gene locus_tag LOCUS_08290 8383 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 9798 9280 gene locus_tag LOCUS_08300 9798 9280 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141641.1 protein_id gnl|my_center|LOCUS_08300 9917 10390 gene locus_tag LOCUS_08310 9917 10390 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772321.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence072 1314 2204 gene locus_tag LOCUS_08320 1314 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 4715 2244 gene locus_tag LOCUS_08330 gene lon 4715 2244 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_08330 5983 4853 gene locus_tag LOCUS_08340 5983 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6115 8688 gene locus_tag LOCUS_08350 6115 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 9099 8707 gene locus_tag LOCUS_08360 9099 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 10789 9197 gene locus_tag LOCUS_08370 10789 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence073 2619 502 gene locus_tag LOCUS_08380 2619 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 4109 2616 gene locus_tag LOCUS_08390 4109 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5391 4111 gene locus_tag LOCUS_08400 5391 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 6223 5384 gene locus_tag LOCUS_08410 6223 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 7290 6334 gene locus_tag LOCUS_08420 7290 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 7437 7361 gene locus_tag LOCUS_t00150 7437 7361 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8722 7541 gene locus_tag LOCUS_08430 8722 7541 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_08430 9375 8743 gene locus_tag LOCUS_08440 9375 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 9694 9620 gene locus_tag LOCUS_t00160 9694 9620 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 984 460 gene locus_tag LOCUS_08450 984 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1084 2553 gene locus_tag LOCUS_08460 1084 2553 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_08460 7006 2555 gene locus_tag LOCUS_08470 7006 2555 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200903603.1 protein_id gnl|my_center|LOCUS_08470 7220 8200 gene locus_tag LOCUS_08480 7220 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 8197 9855 gene locus_tag LOCUS_08490 8197 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 9852 10418 gene locus_tag LOCUS_08500 9852 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence075 2042 2521 gene locus_tag LOCUS_08510 2042 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2539 4092 gene locus_tag LOCUS_08520 2539 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4089 5807 gene locus_tag LOCUS_08530 4089 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 5858 7111 gene locus_tag LOCUS_08540 5858 7111 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_08540 7115 8362 gene locus_tag LOCUS_08550 7115 8362 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_08550 8370 9065 gene locus_tag LOCUS_08560 8370 9065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_08560 10220 9075 gene locus_tag LOCUS_08570 10220 9075 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence076 1037 2122 gene locus_tag LOCUS_08580 1037 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 2222 2731 gene locus_tag LOCUS_08590 2222 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2835 4460 gene locus_tag LOCUS_08600 2835 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 4512 5132 gene locus_tag LOCUS_08610 4512 5132 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918072.1 protein_id gnl|my_center|LOCUS_08610 5111 5422 gene locus_tag LOCUS_08620 5111 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 6352 5423 gene locus_tag LOCUS_08630 6352 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 6506 6973 gene locus_tag LOCUS_08640 6506 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 8434 7004 gene locus_tag LOCUS_08650 8434 7004 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_08650 10302 8476 gene locus_tag LOCUS_08660 10302 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence077 91 384 gene locus_tag LOCUS_08670 91 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 460 1155 gene locus_tag LOCUS_08680 460 1155 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583790.1 protein_id gnl|my_center|LOCUS_08680 1872 1177 gene locus_tag LOCUS_08690 1872 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2995 1952 gene locus_tag LOCUS_08700 2995 1952 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036329.1 protein_id gnl|my_center|LOCUS_08700 4050 3103 gene locus_tag LOCUS_08710 4050 3103 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878600.1 protein_id gnl|my_center|LOCUS_08710 4114 5418 gene locus_tag LOCUS_08720 4114 5418 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706839.1 protein_id gnl|my_center|LOCUS_08720 5415 9161 gene locus_tag LOCUS_08730 5415 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 9770 9171 gene locus_tag LOCUS_08740 gene recR 9770 9171 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940773.1 protein_id gnl|my_center|LOCUS_08740 10402 9821 gene locus_tag LOCUS_08750 10402 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence078 106 1446 gene locus_tag LOCUS_08760 106 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1443 3110 gene locus_tag LOCUS_08770 1443 3110 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019218195.1 protein_id gnl|my_center|LOCUS_08770 4610 3129 gene locus_tag LOCUS_08780 4610 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 4715 5698 gene locus_tag LOCUS_08790 4715 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5765 6790 gene locus_tag LOCUS_08800 5765 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 6851 7618 gene locus_tag LOCUS_08810 6851 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 7626 8621 gene locus_tag LOCUS_08820 7626 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 10005 8632 gene locus_tag LOCUS_08830 10005 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence079 256 453 gene locus_tag LOCUS_08840 256 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 450 863 gene locus_tag LOCUS_08850 450 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1571 906 gene locus_tag LOCUS_08860 gene msrA 1571 906 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338316.1 protein_id gnl|my_center|LOCUS_08860 1669 3474 gene locus_tag LOCUS_08870 1669 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 3485 3613 gene locus_tag LOCUS_08880 3485 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 3832 7374 gene locus_tag LOCUS_08890 gene nifJ 3832 7374 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_08890 7384 8367 gene locus_tag LOCUS_08900 7384 8367 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_08900 8458 9540 gene locus_tag LOCUS_08910 8458 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 9923 9555 gene locus_tag LOCUS_08920 9923 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence080 886 224 gene locus_tag LOCUS_08930 886 224 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792492.1 protein_id gnl|my_center|LOCUS_08930 1043 2317 gene locus_tag LOCUS_08940 gene ssnA 1043 2317 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706028.1 protein_id gnl|my_center|LOCUS_08940 3823 2327 gene locus_tag LOCUS_08950 3823 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4640 3912 gene locus_tag LOCUS_08960 4640 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 5685 6782 gene locus_tag LOCUS_08970 5685 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 6779 9046 gene locus_tag LOCUS_08980 6779 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 9235 9071 gene locus_tag LOCUS_08990 9235 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 <10351 9241 gene locus_tag LOCUS_09000 <10351 9241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947081.1:aldehyde dehydrogenase family protein >Feature sequence081 1263 82 gene locus_tag LOCUS_09010 gene sufD 1263 82 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_09010 2008 1265 gene locus_tag LOCUS_09020 gene sufC 2008 1265 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771014.1 protein_id gnl|my_center|LOCUS_09020 3452 2025 gene locus_tag LOCUS_09030 gene sufB 3452 2025 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_09030 4579 3563 gene locus_tag LOCUS_09040 4579 3563 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259366.1 protein_id gnl|my_center|LOCUS_09040 4692 5294 gene locus_tag LOCUS_09050 4692 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 5318 5953 gene locus_tag LOCUS_09060 5318 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 6008 9706 gene locus_tag LOCUS_09070 6008 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence082 <1 647 gene locus_tag LOCUS_09080 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335040.1:MoxR family ATPase 644 1579 gene locus_tag LOCUS_09090 644 1579 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120923.1 protein_id gnl|my_center|LOCUS_09090 1583 3664 gene locus_tag LOCUS_09100 1583 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3654 4421 gene locus_tag LOCUS_09110 3654 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 4418 6937 gene locus_tag LOCUS_09120 4418 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence083 373 1452 gene locus_tag LOCUS_09130 373 1452 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870053.1 protein_id gnl|my_center|LOCUS_09130 1449 2285 gene locus_tag LOCUS_09140 gene cheR 1449 2285 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_09140 2282 3151 gene locus_tag LOCUS_09150 2282 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 3474 3169 gene locus_tag LOCUS_09160 3474 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3721 4320 gene locus_tag LOCUS_09170 3721 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 5103 4327 gene locus_tag LOCUS_09180 5103 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 6194 5100 gene locus_tag LOCUS_09190 6194 5100 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_09190 6619 6203 gene locus_tag LOCUS_09200 6619 6203 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_09200 8299 6746 gene locus_tag LOCUS_09210 8299 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 10135 8381 gene locus_tag LOCUS_09220 10135 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence084 46 2712 gene locus_tag LOCUS_09230 gene ppdK 46 2712 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_09230 2721 3068 gene locus_tag LOCUS_09240 2721 3068 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144028.1 protein_id gnl|my_center|LOCUS_09240 3097 3840 gene locus_tag LOCUS_09250 3097 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 3958 7332 gene locus_tag LOCUS_09260 3958 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 7314 9236 gene locus_tag LOCUS_09270 7314 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence085 2641 980 gene locus_tag LOCUS_09280 gene oleC 2641 980 CDS product olefin beta-lactone synthetase OleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035474.1 protein_id gnl|my_center|LOCUS_09280 3567 2638 gene locus_tag LOCUS_09290 3567 2638 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_09290 3818 4576 gene locus_tag LOCUS_09300 3818 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4573 5262 gene locus_tag LOCUS_09310 4573 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 5259 5981 gene locus_tag LOCUS_09320 gene ccsA 5259 5981 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_09320 5978 6109 gene locus_tag LOCUS_09330 5978 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 6106 6555 gene locus_tag LOCUS_09340 6106 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 6552 8552 gene locus_tag LOCUS_09350 6552 8552 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_09350 8562 9077 gene locus_tag LOCUS_09360 8562 9077 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886990.1 protein_id gnl|my_center|LOCUS_09360 9074 9643 gene locus_tag LOCUS_09370 9074 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence086 990 196 gene locus_tag LOCUS_09380 990 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 4565 1047 gene locus_tag LOCUS_09390 4565 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 4977 4609 gene locus_tag LOCUS_09400 4977 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 6372 5023 gene locus_tag LOCUS_09410 6372 5023 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777771.1 protein_id gnl|my_center|LOCUS_09410 7466 6459 gene locus_tag LOCUS_09420 7466 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 <10013 7793 gene locus_tag LOCUS_09430 <10013 7793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037394238.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence087 1795 236 gene locus_tag LOCUS_09440 1795 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 3458 1857 gene locus_tag LOCUS_09450 3458 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3556 4329 gene locus_tag LOCUS_09460 3556 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 6303 4348 gene locus_tag LOCUS_09470 6303 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 8490 6472 gene locus_tag LOCUS_09480 8490 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence088 <1 1446 gene locus_tag LOCUS_09490 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104467.1:VRR-NUC domain-containing protein 2063 1485 gene locus_tag LOCUS_09500 gene slmA 2063 1485 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918350.1 protein_id gnl|my_center|LOCUS_09500 6579 2125 gene locus_tag LOCUS_09510 6579 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 7625 6576 gene locus_tag LOCUS_09520 7625 6576 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967657.1 protein_id gnl|my_center|LOCUS_09520 7809 8060 gene locus_tag LOCUS_09530 7809 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 9536 8118 gene locus_tag LOCUS_09540 9536 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence089 174 764 gene locus_tag LOCUS_09550 174 764 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140655.1 protein_id gnl|my_center|LOCUS_09550 761 1084 gene locus_tag LOCUS_09560 gene nuoK 761 1084 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_09560 1098 2891 gene locus_tag LOCUS_09570 gene nuoL 1098 2891 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_09570 2894 4483 gene locus_tag LOCUS_09580 2894 4483 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_09580 4480 5949 gene locus_tag LOCUS_09590 4480 5949 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_09590 6555 6013 gene locus_tag LOCUS_09600 6555 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 8837 6552 gene locus_tag LOCUS_09610 8837 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 8975 9631 gene locus_tag LOCUS_09620 8975 9631 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840180.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence090 233 1099 gene locus_tag LOCUS_09630 233 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1087 3663 gene locus_tag LOCUS_09640 1087 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 3718 7389 gene locus_tag LOCUS_09650 3718 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 7386 8072 gene locus_tag LOCUS_09660 7386 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 8109 8687 gene locus_tag LOCUS_09670 8109 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 9704 8688 gene locus_tag LOCUS_09680 9704 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence091 1127 3826 gene locus_tag LOCUS_09690 1127 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2864 2951 gene locus_tag LOCUS_t00170 2864 2951 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3823 5163 gene locus_tag LOCUS_09700 3823 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5358 6683 gene locus_tag LOCUS_09710 5358 6683 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_09710 6865 8871 gene locus_tag LOCUS_09720 6865 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 8917 9738 gene locus_tag LOCUS_09730 8917 9738 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence092 415 1884 gene locus_tag LOCUS_09740 415 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09740 1898 2608 gene locus_tag LOCUS_09750 gene ccoO 1898 2608 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_09750 2605 2808 gene locus_tag LOCUS_09760 2605 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2805 3296 gene locus_tag LOCUS_09770 2805 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3304 4677 gene locus_tag LOCUS_09780 gene ccoG 3304 4677 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074321.1 protein_id gnl|my_center|LOCUS_09780 4677 4805 gene locus_tag LOCUS_09790 4677 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 4802 7147 gene locus_tag LOCUS_09800 4802 7147 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120873.1 protein_id gnl|my_center|LOCUS_09800 7144 7362 gene locus_tag LOCUS_09810 7144 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 8008 7385 gene locus_tag LOCUS_09820 8008 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 8618 8097 gene locus_tag LOCUS_09830 8618 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 9093 8620 gene locus_tag LOCUS_09840 9093 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence093 302 1918 gene locus_tag LOCUS_09850 302 1918 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143249.1 protein_id gnl|my_center|LOCUS_09850 1915 5262 gene locus_tag LOCUS_09860 1915 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5274 6920 gene locus_tag LOCUS_09870 5274 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6917 8860 gene locus_tag LOCUS_09880 6917 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 8857 9066 gene locus_tag LOCUS_09890 8857 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 9063 9545 gene locus_tag LOCUS_09900 9063 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence094 24 112 gene locus_tag LOCUS_t00180 24 112 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 170 685 gene locus_tag LOCUS_09910 170 685 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_09910 980 2566 gene locus_tag LOCUS_09920 980 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2596 4173 gene locus_tag LOCUS_09930 2596 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4173 4856 gene locus_tag LOCUS_09940 4173 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 5753 4878 gene locus_tag LOCUS_09950 gene lgt 5753 4878 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126322954.1 protein_id gnl|my_center|LOCUS_09950 7241 5865 gene locus_tag LOCUS_09960 7241 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 7354 9060 gene locus_tag LOCUS_09970 gene recJ 7354 9060 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence095 1728 550 gene locus_tag LOCUS_09980 1728 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2675 1725 gene locus_tag LOCUS_09990 2675 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 3671 2676 gene locus_tag LOCUS_10000 3671 2676 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_10000 7038 3700 gene locus_tag LOCUS_10010 7038 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 9546 7099 gene locus_tag LOCUS_10020 gene gyrB 9546 7099 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence096 1639 317 gene locus_tag LOCUS_10030 1639 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3377 1662 gene locus_tag LOCUS_10040 3377 1662 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_10040 3449 4315 gene locus_tag LOCUS_10050 gene tesB 3449 4315 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706717.1 protein_id gnl|my_center|LOCUS_10050 4846 4325 gene locus_tag LOCUS_10060 4846 4325 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941405.1 protein_id gnl|my_center|LOCUS_10060 4937 5440 gene locus_tag LOCUS_10070 4937 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 5556 6569 gene locus_tag LOCUS_10080 gene fbp 5556 6569 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_10080 6569 7774 gene locus_tag LOCUS_10090 gene lhgO 6569 7774 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_10090 7932 8423 gene locus_tag LOCUS_10100 7932 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 9377 8490 gene locus_tag LOCUS_10110 9377 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence097 <1 582 gene locus_tag LOCUS_10120 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546766.1:NADH-quinone oxidoreductase subunit C 601 1791 gene locus_tag LOCUS_10130 gene nuoD 601 1791 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_10130 1799 2359 gene locus_tag LOCUS_10140 1799 2359 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_10140 2404 3681 gene locus_tag LOCUS_10150 gene nuoF 2404 3681 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_10150 3694 5307 gene locus_tag LOCUS_10160 3694 5307 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_10160 5332 6678 gene locus_tag LOCUS_10170 5332 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 6699 7277 gene locus_tag LOCUS_10180 6699 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 7300 8163 gene locus_tag LOCUS_10190 gene rfbD 7300 8163 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_10190 8395 8144 gene locus_tag LOCUS_10200 8395 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9118 8414 gene locus_tag LOCUS_10210 9118 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence098 2582 456 gene locus_tag LOCUS_10220 2582 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2975 2706 gene locus_tag LOCUS_10230 2975 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2987 4507 gene locus_tag LOCUS_10240 gene rng 2987 4507 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_10240 4570 6741 gene locus_tag LOCUS_10250 4570 6741 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_10250 6788 8041 gene locus_tag LOCUS_10260 6788 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 8043 8798 gene locus_tag LOCUS_10270 8043 8798 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_10270 8804 9193 gene locus_tag LOCUS_10280 8804 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence099 93 1571 gene locus_tag LOCUS_10290 93 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2035 1580 gene locus_tag LOCUS_10300 2035 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 3997 2096 gene locus_tag LOCUS_10310 3997 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 5812 4037 gene locus_tag LOCUS_10320 5812 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 6942 5809 gene locus_tag LOCUS_10330 6942 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 7072 7338 gene locus_tag LOCUS_10340 7072 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 7275 7475 gene locus_tag LOCUS_10350 7275 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 7475 8599 gene locus_tag LOCUS_10360 7475 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence100 <1 990 gene locus_tag LOCUS_10370 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103018905.1:sodium-dependent transporter note possible pseudo, frameshifted 987 1310 gene locus_tag LOCUS_10380 987 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10380 1337 3418 gene locus_tag LOCUS_10390 1337 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 3415 5061 gene locus_tag LOCUS_10400 3415 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 5111 7426 gene locus_tag LOCUS_10410 5111 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 8532 7411 gene locus_tag LOCUS_10420 8532 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 9188 8598 gene locus_tag LOCUS_10430 9188 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence101 1253 3103 gene locus_tag LOCUS_10440 gene mnmG 1253 3103 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_10440 3100 3654 gene locus_tag LOCUS_10450 3100 3654 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938546.1 protein_id gnl|my_center|LOCUS_10450 4449 3661 gene locus_tag LOCUS_10460 4449 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7036 4457 gene locus_tag LOCUS_10470 gene leuS 7036 4457 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403694.1 protein_id gnl|my_center|LOCUS_10470 7588 7118 gene locus_tag LOCUS_10480 7588 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 7812 7585 gene locus_tag LOCUS_10490 7812 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 8019 9119 gene locus_tag LOCUS_10500 8019 9119 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence102 4285 1127 gene locus_tag LOCUS_10510 4285 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4869 4282 gene locus_tag LOCUS_10520 4869 4282 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940563.1 protein_id gnl|my_center|LOCUS_10520 5591 4866 gene locus_tag LOCUS_10530 gene ubiE 5591 4866 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_10530 6676 5588 gene locus_tag LOCUS_10540 6676 5588 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228837.1 protein_id gnl|my_center|LOCUS_10540 6773 7375 gene locus_tag LOCUS_10550 6773 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 7462 8262 gene locus_tag LOCUS_10560 7462 8262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 8428 8255 gene locus_tag LOCUS_10570 8428 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence103 468 2246 gene locus_tag LOCUS_10580 468 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2243 4060 gene locus_tag LOCUS_10590 2243 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4089 4454 gene locus_tag LOCUS_10600 4089 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 4447 5286 gene locus_tag LOCUS_10610 gene csx7 4447 5286 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258158.1 protein_id gnl|my_center|LOCUS_10610 5286 6260 gene locus_tag LOCUS_10620 5286 6260 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258159.1 protein_id gnl|my_center|LOCUS_10620 6260 7114 gene locus_tag LOCUS_10630 6260 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 7111 7623 gene locus_tag LOCUS_10640 7111 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 7637 9241 gene locus_tag LOCUS_10650 7637 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence104 4499 3456 gene locus_tag LOCUS_10660 4499 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5266 4496 gene locus_tag LOCUS_10670 5266 4496 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_10670 5372 5447 gene locus_tag LOCUS_t00190 5372 5447 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5585 6493 gene locus_tag LOCUS_10680 5585 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 6490 9219 gene locus_tag LOCUS_10690 6490 9219 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence105 1066 1662 gene locus_tag LOCUS_10700 1066 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1659 2471 gene locus_tag LOCUS_10710 1659 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2473 3426 gene locus_tag LOCUS_10720 2473 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3426 6419 gene locus_tag LOCUS_10730 3426 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 6502 8757 gene locus_tag LOCUS_10740 6502 8757 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_10740 9144 8770 gene locus_tag LOCUS_10750 9144 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence106 528 55 gene locus_tag LOCUS_10760 528 55 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_10760 602 973 gene locus_tag LOCUS_10770 602 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1087 1659 gene locus_tag LOCUS_10780 1087 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3205 1676 gene locus_tag LOCUS_10790 3205 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 4499 3177 gene locus_tag LOCUS_10800 4499 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4680 6308 gene locus_tag LOCUS_10810 4680 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 9272 6339 gene locus_tag LOCUS_10820 9272 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence107 164 1330 gene locus_tag LOCUS_10830 164 1330 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940226.1 protein_id gnl|my_center|LOCUS_10830 1387 3567 gene locus_tag LOCUS_10840 1387 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3572 6781 gene locus_tag LOCUS_10850 3572 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 6816 9104 gene locus_tag LOCUS_10860 6816 9104 CDS product Rv1355c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728218.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence108 77 676 gene locus_tag LOCUS_10870 77 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1122 703 gene locus_tag LOCUS_10880 1122 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1006 1575 gene locus_tag LOCUS_10890 1006 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1637 2800 gene locus_tag LOCUS_10900 1637 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3741 2842 gene locus_tag LOCUS_10910 3741 2842 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_10910 5396 3738 gene locus_tag LOCUS_10920 5396 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 5578 6033 gene locus_tag LOCUS_10930 5578 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 6698 6090 gene locus_tag LOCUS_10940 6698 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 7964 6804 gene locus_tag LOCUS_10950 7964 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 9231 7957 gene locus_tag LOCUS_10960 9231 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence109 342 416 gene locus_tag LOCUS_t00200 342 416 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 436 512 gene locus_tag LOCUS_t00210 436 512 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 702 783 gene locus_tag LOCUS_t00220 702 783 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 811 2349 gene locus_tag LOCUS_10970 gene tig 811 2349 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_10970 2467 3093 gene locus_tag LOCUS_10980 gene clpP 2467 3093 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_10980 3229 4479 gene locus_tag LOCUS_10990 gene clpX 3229 4479 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_10990 4521 6905 gene locus_tag LOCUS_11000 gene lon 4521 6905 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_11000 7080 7155 gene locus_tag LOCUS_t00230 7080 7155 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7189 7265 gene locus_tag LOCUS_t00240 7189 7265 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7327 7821 gene locus_tag LOCUS_11010 7327 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 7875 8195 gene locus_tag LOCUS_11020 7875 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 8240 9046 gene locus_tag LOCUS_11030 8240 9046 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869232.1 protein_id gnl|my_center|LOCUS_11030 9170 9095 gene locus_tag LOCUS_t00250 9170 9095 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence110 527 1717 gene locus_tag LOCUS_11040 527 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3383 1800 gene locus_tag LOCUS_11050 3383 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4063 3383 gene locus_tag LOCUS_11060 4063 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 5446 4088 gene locus_tag LOCUS_11070 5446 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 5665 6021 gene locus_tag LOCUS_11080 5665 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 6132 7580 gene locus_tag LOCUS_11090 6132 7580 CDS product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119326.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence111 <1 1457 gene locus_tag LOCUS_11100 <1 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860171.1:PGF-pre-PGF domain-containing protein 1520 2470 gene locus_tag LOCUS_11110 1520 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2568 4880 gene locus_tag LOCUS_11120 2568 4880 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929290.1 protein_id gnl|my_center|LOCUS_11120 4877 6043 gene locus_tag LOCUS_11130 4877 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 6062 7033 gene locus_tag LOCUS_11140 6062 7033 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258820.1 protein_id gnl|my_center|LOCUS_11140 7128 8339 gene locus_tag LOCUS_11150 7128 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence112 <1 954 gene locus_tag LOCUS_11160 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286637.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase 1544 960 gene locus_tag LOCUS_11170 gene sodB 1544 960 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380941.1 protein_id gnl|my_center|LOCUS_11170 3415 1661 gene locus_tag LOCUS_11180 3415 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 4404 3412 gene locus_tag LOCUS_11190 4404 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 5108 4524 gene locus_tag LOCUS_11200 5108 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5177 5974 gene locus_tag LOCUS_11210 5177 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6989 5919 gene locus_tag LOCUS_11220 6989 5919 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_11220 8737 6986 gene locus_tag LOCUS_11230 8737 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence113 1621 1088 gene locus_tag LOCUS_11240 1621 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1806 2600 gene locus_tag LOCUS_11250 1806 2600 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_11250 2622 3272 gene locus_tag LOCUS_11260 2622 3272 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926997.1 protein_id gnl|my_center|LOCUS_11260 4367 3282 gene locus_tag LOCUS_11270 4367 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 5929 4364 gene locus_tag LOCUS_11280 5929 4364 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_11280 <8838 6032 gene locus_tag LOCUS_11290 <8838 6032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706924.1:DUF3488 and transglutaminase-like domain-containing protein >Feature sequence114 452 93 gene locus_tag LOCUS_11300 452 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 539 1555 gene locus_tag LOCUS_11310 539 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2566 1565 gene locus_tag LOCUS_11320 2566 1565 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_11320 2717 3781 gene locus_tag LOCUS_11330 2717 3781 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041077419.1 protein_id gnl|my_center|LOCUS_11330 3793 4578 gene locus_tag LOCUS_11340 gene vpsK 3793 4578 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_11340 6086 4563 gene locus_tag LOCUS_11350 6086 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 7240 6083 gene locus_tag LOCUS_11360 gene wecB 7240 6083 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703970.1 protein_id gnl|my_center|LOCUS_11360 <8773 7352 gene locus_tag LOCUS_11370 <8773 7352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha >Feature sequence115 487 2388 gene locus_tag LOCUS_11380 gene dnaK 487 2388 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557108.1 protein_id gnl|my_center|LOCUS_11380 2452 3585 gene locus_tag LOCUS_11390 gene dnaJ 2452 3585 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940501.1 protein_id gnl|my_center|LOCUS_11390 4038 3601 gene locus_tag LOCUS_11400 4038 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 4217 5434 gene locus_tag LOCUS_11410 4217 5434 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_11410 5442 7088 gene locus_tag LOCUS_11420 gene pckA 5442 7088 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_11420 7141 7800 gene locus_tag LOCUS_11430 7141 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 8357 7821 gene locus_tag LOCUS_11440 8357 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence116 2901 2035 gene locus_tag LOCUS_11450 2901 2035 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941846.1 protein_id gnl|my_center|LOCUS_11450 4468 2951 gene locus_tag LOCUS_11460 4468 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4648 5379 gene locus_tag LOCUS_11470 4648 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence117 1215 4 gene locus_tag LOCUS_11480 1215 4 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 protein_id gnl|my_center|LOCUS_11480 2018 1317 gene locus_tag LOCUS_11490 gene narI 2018 1317 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026935.1 protein_id gnl|my_center|LOCUS_11490 2527 2021 gene locus_tag LOCUS_11500 2527 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 4035 2527 gene locus_tag LOCUS_11510 gene narH 4035 2527 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692685.1 protein_id gnl|my_center|LOCUS_11510 7666 4055 gene locus_tag LOCUS_11520 7666 4055 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459023.1 protein_id gnl|my_center|LOCUS_11520 8475 7663 gene locus_tag LOCUS_11530 8475 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence118 37 1488 gene locus_tag LOCUS_11540 gene glnA 37 1488 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257332.1 protein_id gnl|my_center|LOCUS_11540 1528 3465 gene locus_tag LOCUS_11550 gene gatE 1528 3465 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_11550 3462 4877 gene locus_tag LOCUS_11560 gene gatD 3462 4877 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence119 <1 1743 gene locus_tag LOCUS_11570 <1 1743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839780.1:glycoside hydrolase family 13 protein 2174 1758 gene locus_tag LOCUS_11580 2174 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 3666 2179 gene locus_tag LOCUS_11590 gene atpD 3666 2179 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_11590 4566 3694 gene locus_tag LOCUS_11600 4566 3694 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530300.1 protein_id gnl|my_center|LOCUS_11600 6111 4579 gene locus_tag LOCUS_11610 gene atpA 6111 4579 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_11610 6729 6175 gene locus_tag LOCUS_11620 6729 6175 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330038.1 protein_id gnl|my_center|LOCUS_11620 7306 6722 gene locus_tag LOCUS_11630 7306 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 7775 7317 gene locus_tag LOCUS_11640 7775 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence120 87 692 gene locus_tag LOCUS_11650 87 692 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081447059.1 protein_id gnl|my_center|LOCUS_11650 697 1386 gene locus_tag LOCUS_11660 gene pth 697 1386 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804953.1 protein_id gnl|my_center|LOCUS_11660 1379 3493 gene locus_tag LOCUS_11670 1379 3493 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_11670 3505 3939 gene locus_tag LOCUS_11680 3505 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3968 4198 gene locus_tag LOCUS_11690 3968 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4208 4651 gene locus_tag LOCUS_11700 gene rplI 4208 4651 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_11700 4818 4633 gene locus_tag LOCUS_11710 4818 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 4754 6091 gene locus_tag LOCUS_11720 4754 6091 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_11720 6088 6687 gene locus_tag LOCUS_11730 6088 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6853 7968 gene locus_tag LOCUS_11740 6853 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence121 69 905 gene locus_tag LOCUS_11750 gene rpoH 69 905 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087987.1 protein_id gnl|my_center|LOCUS_11750 2760 919 gene locus_tag LOCUS_11760 2760 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2910 4286 gene locus_tag LOCUS_11770 2910 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4283 5647 gene locus_tag LOCUS_11780 4283 5647 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_11780 5723 6574 gene locus_tag LOCUS_11790 5723 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6603 7181 gene locus_tag LOCUS_11800 6603 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 7294 7905 gene locus_tag LOCUS_11810 7294 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 7929 8213 gene locus_tag LOCUS_11820 gene groES 7929 8213 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence122 1495 2025 gene locus_tag LOCUS_11830 1495 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2036 3589 gene locus_tag LOCUS_11840 2036 3589 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_11840 3586 4341 gene locus_tag LOCUS_11850 3586 4341 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057978.1 protein_id gnl|my_center|LOCUS_11850 4426 6966 gene locus_tag LOCUS_11860 4426 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 7004 8077 gene locus_tag LOCUS_11870 gene plsX 7004 8077 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence123 819 2549 gene locus_tag LOCUS_11880 819 2549 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_11880 2716 3030 gene locus_tag LOCUS_11890 gene rplU 2716 3030 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048023.1 protein_id gnl|my_center|LOCUS_11890 3043 3300 gene locus_tag LOCUS_11900 gene rpmA 3043 3300 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081742.1 protein_id gnl|my_center|LOCUS_11900 3354 4370 gene locus_tag LOCUS_11910 3354 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 4367 5161 gene locus_tag LOCUS_11920 4367 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 5186 5623 gene locus_tag LOCUS_11930 5186 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 5630 6094 gene locus_tag LOCUS_11940 5630 6094 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943826.1 protein_id gnl|my_center|LOCUS_11940 6173 6862 gene locus_tag LOCUS_11950 6173 6862 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480036.1 protein_id gnl|my_center|LOCUS_11950 7059 7229 gene locus_tag LOCUS_11960 7059 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence124 1660 269 gene locus_tag LOCUS_11970 1660 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1996 1730 gene locus_tag LOCUS_11980 1996 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2886 2083 gene locus_tag LOCUS_11990 2886 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3011 3655 gene locus_tag LOCUS_12000 3011 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3660 4409 gene locus_tag LOCUS_12010 3660 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 5708 4419 gene locus_tag LOCUS_12020 5708 4419 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_12020 5873 6136 gene locus_tag LOCUS_12030 5873 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 6246 6641 gene locus_tag LOCUS_12040 6246 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6648 7112 gene locus_tag LOCUS_12050 6648 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 7538 7116 gene locus_tag LOCUS_12060 7538 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence125 <1 861 gene locus_tag LOCUS_12070 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229229.1:precorrin-3B C(17)-methyltransferase 858 2012 gene locus_tag LOCUS_12080 858 2012 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229228.1 protein_id gnl|my_center|LOCUS_12080 2009 2569 gene locus_tag LOCUS_12090 gene cobO 2009 2569 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391114.1 protein_id gnl|my_center|LOCUS_12090 2569 3954 gene locus_tag LOCUS_12100 2569 3954 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480393.1 protein_id gnl|my_center|LOCUS_12100 3951 5135 gene locus_tag LOCUS_12110 3951 5135 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289353.1 protein_id gnl|my_center|LOCUS_12110 5155 5532 gene locus_tag LOCUS_12120 5155 5532 CDS product DUF3209 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752159.1 protein_id gnl|my_center|LOCUS_12120 5532 6353 gene locus_tag LOCUS_12130 gene cobA 5532 6353 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142574.1 protein_id gnl|my_center|LOCUS_12130 6350 7168 gene locus_tag LOCUS_12140 6350 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 7165 8088 gene locus_tag LOCUS_12150 7165 8088 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_12150 8085 8300 gene locus_tag LOCUS_12160 8085 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence126 535 2310 gene locus_tag LOCUS_12170 535 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2300 4408 gene locus_tag LOCUS_12180 2300 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 4497 4931 gene locus_tag LOCUS_12190 4497 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 4928 5989 gene locus_tag LOCUS_12200 4928 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 6072 7199 gene locus_tag LOCUS_12210 6072 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 7203 8156 gene locus_tag LOCUS_12220 gene lpxD 7203 8156 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939642.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence127 380 904 gene locus_tag LOCUS_12230 gene hpt 380 904 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817255.1 protein_id gnl|my_center|LOCUS_12230 928 1302 gene locus_tag LOCUS_12240 928 1302 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_12240 2117 1311 gene locus_tag LOCUS_12250 2117 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4074 2161 gene locus_tag LOCUS_12260 4074 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 4735 4112 gene locus_tag LOCUS_12270 4735 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 5416 4856 gene locus_tag LOCUS_12280 5416 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 <8275 5452 gene locus_tag LOCUS_12290 <8275 5452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937936.1:PBP1A family penicillin-binding protein >Feature sequence128 2363 540 gene locus_tag LOCUS_12300 2363 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2526 3809 gene locus_tag LOCUS_12310 2526 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3911 4210 gene locus_tag LOCUS_12320 3911 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 4335 5030 gene locus_tag LOCUS_12330 4335 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 5308 5072 gene locus_tag LOCUS_12340 5308 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 5416 5808 gene locus_tag LOCUS_12350 5416 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 6841 6436 gene locus_tag LOCUS_tm00010 6841 6436 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6865 7197 gene locus_tag LOCUS_12360 6865 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 7131 7670 gene locus_tag LOCUS_12370 7131 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 7672 8226 gene locus_tag LOCUS_12380 7672 8226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence129 664 1959 gene locus_tag LOCUS_12390 664 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2003 3163 gene locus_tag LOCUS_12400 2003 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3682 4554 gene locus_tag LOCUS_12410 3682 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 4551 5330 gene locus_tag LOCUS_12420 4551 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 7502 5337 gene locus_tag LOCUS_12430 7502 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 8032 7496 gene locus_tag LOCUS_12440 8032 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence130 1164 43 gene locus_tag LOCUS_12450 1164 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3033 1174 gene locus_tag LOCUS_12460 3033 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 4193 3030 gene locus_tag LOCUS_12470 4193 3030 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_12470 5643 4261 gene locus_tag LOCUS_12480 gene orpR 5643 4261 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_12480 6534 5653 gene locus_tag LOCUS_12490 6534 5653 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_12490 7370 6531 gene locus_tag LOCUS_12500 7370 6531 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_12500 7731 7384 gene locus_tag LOCUS_12510 7731 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 8116 7718 gene locus_tag LOCUS_12520 8116 7718 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546602.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence131 792 1619 gene locus_tag LOCUS_12530 gene nadC 792 1619 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_12530 3494 1623 gene locus_tag LOCUS_12540 3494 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4267 3494 gene locus_tag LOCUS_12550 4267 3494 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327924.1 protein_id gnl|my_center|LOCUS_12550 6002 4602 gene locus_tag LOCUS_12560 6002 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence132 1607 3 gene locus_tag LOCUS_12570 1607 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1719 2165 gene locus_tag LOCUS_12580 1719 2165 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048129.1 protein_id gnl|my_center|LOCUS_12580 2769 2176 gene locus_tag LOCUS_12590 2769 2176 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_12590 2889 3827 gene locus_tag LOCUS_12600 2889 3827 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 protein_id gnl|my_center|LOCUS_12600 4493 3834 gene locus_tag LOCUS_12610 4493 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 4939 6432 gene locus_tag LOCUS_12620 4939 6432 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_12620 7935 6436 gene locus_tag LOCUS_12630 7935 6436 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence133 397 321 gene locus_tag LOCUS_t00260 397 321 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 895 443 gene locus_tag LOCUS_12640 895 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1236 892 gene locus_tag LOCUS_12650 1236 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1715 1275 gene locus_tag LOCUS_12660 1715 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2077 1712 gene locus_tag LOCUS_12670 gene rplT 2077 1712 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211833.1 protein_id gnl|my_center|LOCUS_12670 2356 2159 gene locus_tag LOCUS_12680 gene rpmI 2356 2159 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869473.1 protein_id gnl|my_center|LOCUS_12680 2696 2622 gene locus_tag LOCUS_t00270 2696 2622 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3435 2761 gene locus_tag LOCUS_12690 gene lipB 3435 2761 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337049.1 protein_id gnl|my_center|LOCUS_12690 4584 3436 gene locus_tag LOCUS_12700 4584 3436 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225205.1 protein_id gnl|my_center|LOCUS_12700 5418 4594 gene locus_tag LOCUS_12710 5418 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 <8154 5450 gene locus_tag LOCUS_12720 <8154 5450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942050.1:DNA polymerase III subunit alpha >Feature sequence134 1894 71 gene locus_tag LOCUS_12730 1894 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1990 3660 gene locus_tag LOCUS_12740 1990 3660 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925779.1 protein_id gnl|my_center|LOCUS_12740 4071 5084 gene locus_tag LOCUS_12750 4071 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 5138 6904 gene locus_tag LOCUS_12760 5138 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 7906 6917 gene locus_tag LOCUS_12770 7906 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 8127 7933 gene locus_tag LOCUS_12780 8127 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence135 1103 486 gene locus_tag LOCUS_12790 1103 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1957 1100 gene locus_tag LOCUS_12800 1957 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2761 1967 gene locus_tag LOCUS_12810 2761 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3093 5213 gene locus_tag LOCUS_12820 3093 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5210 6238 gene locus_tag LOCUS_12830 5210 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence136 <1 1474 gene locus_tag LOCUS_12840 <1 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083514069.1:glycosyltransferase family 39 protein 2789 1620 gene locus_tag LOCUS_12850 gene metK 2789 1620 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_12850 3047 4627 gene locus_tag LOCUS_12860 3047 4627 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940275.1 protein_id gnl|my_center|LOCUS_12860 4627 5874 gene locus_tag LOCUS_12870 4627 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5926 6546 gene locus_tag LOCUS_12880 5926 6546 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582483.1 protein_id gnl|my_center|LOCUS_12880 6536 6919 gene locus_tag LOCUS_12890 6536 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence137 185 997 gene locus_tag LOCUS_12900 185 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1042 1869 gene locus_tag LOCUS_12910 1042 1869 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939259.1 protein_id gnl|my_center|LOCUS_12910 1866 3455 gene locus_tag LOCUS_12920 1866 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3542 3910 gene locus_tag LOCUS_12930 3542 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3901 4617 gene locus_tag LOCUS_12940 3901 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4614 5129 gene locus_tag LOCUS_12950 4614 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5137 6414 gene locus_tag LOCUS_12960 gene nuoD 5137 6414 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396802.1 protein_id gnl|my_center|LOCUS_12960 6411 7400 gene locus_tag LOCUS_12970 gene nuoH 6411 7400 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence138 1 1056 gene locus_tag LOCUS_12980 1 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1063 4125 gene locus_tag LOCUS_12990 1063 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4122 4712 gene locus_tag LOCUS_13000 4122 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 4709 6070 gene locus_tag LOCUS_13010 4709 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6067 6582 gene locus_tag LOCUS_13020 6067 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 7867 6590 gene locus_tag LOCUS_13030 7867 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence139 228 46 gene locus_tag LOCUS_13040 228 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 440 225 gene locus_tag LOCUS_13050 440 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 597 1001 gene locus_tag LOCUS_13060 597 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1467 2816 gene locus_tag LOCUS_13070 1467 2816 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580276.1 protein_id gnl|my_center|LOCUS_13070 4913 2823 gene locus_tag LOCUS_13080 4913 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 6866 4974 gene locus_tag LOCUS_13090 6866 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence140 1488 1964 gene locus_tag LOCUS_13100 1488 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1964 3601 gene locus_tag LOCUS_13110 gene purH 1964 3601 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207145.1 protein_id gnl|my_center|LOCUS_13110 3615 5342 gene locus_tag LOCUS_13120 3615 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5339 6637 gene locus_tag LOCUS_13130 5339 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 6634 7269 gene locus_tag LOCUS_13140 6634 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence141 57 386 gene locus_tag LOCUS_13150 57 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 2484 388 gene locus_tag LOCUS_13160 2484 388 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942572.1 protein_id gnl|my_center|LOCUS_13160 4050 2560 gene locus_tag LOCUS_13170 4050 2560 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_13170 6186 4069 gene locus_tag LOCUS_13180 6186 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence142 956 2323 gene locus_tag LOCUS_13190 956 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 3003 2263 gene locus_tag LOCUS_13200 3003 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 4709 3006 gene locus_tag LOCUS_13210 4709 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 4846 6111 gene locus_tag LOCUS_13220 4846 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 6549 6166 gene locus_tag LOCUS_13230 6549 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 7021 6596 gene locus_tag LOCUS_13240 7021 6596 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173658.1 protein_id gnl|my_center|LOCUS_13240 7911 7174 gene locus_tag LOCUS_13250 7911 7174 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence143 1253 1537 gene locus_tag LOCUS_13260 1253 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1681 3159 gene locus_tag LOCUS_13270 1681 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 4362 3226 gene locus_tag LOCUS_13280 4362 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 4425 7496 gene locus_tag LOCUS_13290 4425 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence144 294 671 gene locus_tag LOCUS_13300 294 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 881 1567 gene locus_tag LOCUS_13310 881 1567 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646584.1 protein_id gnl|my_center|LOCUS_13310 2959 1592 gene locus_tag LOCUS_13320 2959 1592 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838492.1 protein_id gnl|my_center|LOCUS_13320 4319 2985 gene locus_tag LOCUS_13330 gene pyrC 4319 2985 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060972.1 protein_id gnl|my_center|LOCUS_13330 4439 5179 gene locus_tag LOCUS_13340 4439 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5457 7505 gene locus_tag LOCUS_13350 5457 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence145 <1 576 gene locus_tag LOCUS_13360 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086862.1:guanylate kinase 720 2906 gene locus_tag LOCUS_13370 720 2906 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_13370 3560 2922 gene locus_tag LOCUS_13380 gene purN 3560 2922 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_13380 4570 3557 gene locus_tag LOCUS_13390 gene purM 4570 3557 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140722.1 protein_id gnl|my_center|LOCUS_13390 5145 4570 gene locus_tag LOCUS_13400 5145 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 5231 6019 gene locus_tag LOCUS_13410 5231 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 7733 6024 gene locus_tag LOCUS_13420 7733 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence146 1765 674 gene locus_tag LOCUS_13430 1765 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1921 2154 gene locus_tag LOCUS_13440 1921 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 2151 3206 gene locus_tag LOCUS_13450 2151 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3305 4960 gene locus_tag LOCUS_13460 3305 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 7113 4990 gene locus_tag LOCUS_13470 7113 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 7203 7472 gene locus_tag LOCUS_13480 7203 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence147 446 2050 gene locus_tag LOCUS_13490 446 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2151 2594 gene locus_tag LOCUS_13500 2151 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2594 3898 gene locus_tag LOCUS_13510 2594 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3904 5382 gene locus_tag LOCUS_13520 3904 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390741.1 protein_id gnl|my_center|LOCUS_13520 7826 5397 gene locus_tag LOCUS_13530 7826 5397 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792370.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence148 <1 3467 gene locus_tag LOCUS_13540 <1 3467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113821.1:phosphoribosylformylglycinamidine synthase 3555 4295 gene locus_tag LOCUS_13550 3555 4295 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989809.1 protein_id gnl|my_center|LOCUS_13550 4292 5731 gene locus_tag LOCUS_13560 gene purF 4292 5731 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence149 1859 372 gene locus_tag LOCUS_13570 gene dnaA 1859 372 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703901.1 protein_id gnl|my_center|LOCUS_13570 2442 2597 gene locus_tag LOCUS_13580 gene rpmH 2442 2597 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307156.1 protein_id gnl|my_center|LOCUS_13580 2705 3049 gene locus_tag LOCUS_13590 2705 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 3046 3366 gene locus_tag LOCUS_13600 3046 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 3356 5044 gene locus_tag LOCUS_13610 3356 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 5063 5929 gene locus_tag LOCUS_13620 5063 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 5952 7286 gene locus_tag LOCUS_13630 gene mnmE 5952 7286 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence150 810 1388 gene locus_tag LOCUS_13640 810 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4687 1385 gene locus_tag LOCUS_13650 4687 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 4803 7736 gene locus_tag LOCUS_13660 4803 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence151 3374 2073 gene locus_tag LOCUS_13670 3374 2073 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_13670 4156 3371 gene locus_tag LOCUS_13680 4156 3371 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_13680 4989 4156 gene locus_tag LOCUS_13690 4989 4156 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_13690 6074 4986 gene locus_tag LOCUS_13700 6074 4986 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546086.1 protein_id gnl|my_center|LOCUS_13700 6647 6252 gene locus_tag LOCUS_13710 6647 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence152 2556 1882 gene locus_tag LOCUS_13720 2556 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 3758 2556 gene locus_tag LOCUS_13730 3758 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 3982 3836 gene locus_tag LOCUS_13740 3982 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648317.1 protein_id gnl|my_center|LOCUS_13740 4356 3994 gene locus_tag LOCUS_13750 4356 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 protein_id gnl|my_center|LOCUS_13750 4799 4356 gene locus_tag LOCUS_13760 4799 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 6678 4873 gene locus_tag LOCUS_13770 6678 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 7525 6686 gene locus_tag LOCUS_13780 7525 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence153 1 633 gene locus_tag LOCUS_13790 1 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1435 1025 gene locus_tag LOCUS_13800 1435 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2151 1450 gene locus_tag LOCUS_13810 2151 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3165 2269 gene locus_tag LOCUS_13820 3165 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13820 4380 3583 gene locus_tag LOCUS_13830 4380 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 4549 5937 gene locus_tag LOCUS_13840 4549 5937 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_13840 6873 5950 gene locus_tag LOCUS_13850 6873 5950 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249806.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence154 <1 649 gene locus_tag LOCUS_13860 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102831.1:c-type cytochrome 661 2928 gene locus_tag LOCUS_13870 661 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2898 2974 gene locus_tag LOCUS_t00280 2898 2974 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4318 2942 gene locus_tag LOCUS_13880 4318 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 5288 4341 gene locus_tag LOCUS_13890 5288 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6709 5288 gene locus_tag LOCUS_13900 6709 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 7541 6771 gene locus_tag LOCUS_13910 7541 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence155 2 1057 gene locus_tag LOCUS_13920 2 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1167 2132 gene locus_tag LOCUS_13930 1167 2132 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833199.1 protein_id gnl|my_center|LOCUS_13930 2145 3284 gene locus_tag LOCUS_13940 2145 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3342 4688 gene locus_tag LOCUS_13950 3342 4688 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_13950 6362 4677 gene locus_tag LOCUS_13960 6362 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 6346 7002 gene locus_tag LOCUS_13970 6346 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 6999 7223 gene locus_tag LOCUS_13980 6999 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence156 1647 139 gene locus_tag LOCUS_13990 1647 139 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120643659.1 protein_id gnl|my_center|LOCUS_13990 2525 1791 gene locus_tag LOCUS_14000 2525 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3575 2535 gene locus_tag LOCUS_14010 3575 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 4889 3903 gene locus_tag LOCUS_14020 gene trpS 4889 3903 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404409.1 protein_id gnl|my_center|LOCUS_14020 6391 5000 gene locus_tag LOCUS_14030 6391 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 7460 6480 gene locus_tag LOCUS_14040 7460 6480 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776173.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence157 4173 904 gene locus_tag LOCUS_14050 4173 904 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_14050 4686 4234 gene locus_tag LOCUS_14060 4686 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 4917 5663 gene locus_tag LOCUS_14070 4917 5663 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_14070 6364 5672 gene locus_tag LOCUS_14080 6364 5672 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_14080 <7529 6388 gene locus_tag LOCUS_14090 <7529 6388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:ATP-binding protein >Feature sequence158 3665 1467 gene locus_tag LOCUS_14100 3665 1467 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_14100 5368 3968 gene locus_tag LOCUS_14110 5368 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence159 984 214 gene locus_tag LOCUS_14120 gene truA 984 214 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_14120 3440 1032 gene locus_tag LOCUS_14130 3440 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 4601 3588 gene locus_tag LOCUS_14140 4601 3588 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706496.1 protein_id gnl|my_center|LOCUS_14140 5296 4598 gene locus_tag LOCUS_14150 gene tsaB 5296 4598 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_14150 7002 5293 gene locus_tag LOCUS_14160 7002 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence160 814 407 gene locus_tag LOCUS_14170 814 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1684 845 gene locus_tag LOCUS_14180 1684 845 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256676.1 protein_id gnl|my_center|LOCUS_14180 1924 2466 gene locus_tag LOCUS_14190 1924 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3859 2477 gene locus_tag LOCUS_14200 gene pepP 3859 2477 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_14200 3993 5420 gene locus_tag LOCUS_14210 3993 5420 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182976528.1 protein_id gnl|my_center|LOCUS_14210 6194 5424 gene locus_tag LOCUS_14220 6194 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 7123 6203 gene locus_tag LOCUS_14230 7123 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence161 3 401 gene locus_tag LOCUS_14240 3 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1025 402 gene locus_tag LOCUS_14250 1025 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1479 1009 gene locus_tag LOCUS_14260 1479 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1705 3297 gene locus_tag LOCUS_14270 1705 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4472 3300 gene locus_tag LOCUS_14280 gene cruC 4472 3300 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_14280 6127 4469 gene locus_tag LOCUS_14290 6127 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence162 1016 2398 gene locus_tag LOCUS_14300 1016 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2497 4062 gene locus_tag LOCUS_14310 2497 4062 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_14310 4096 5034 gene locus_tag LOCUS_14320 4096 5034 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229923.1 protein_id gnl|my_center|LOCUS_14320 5031 5861 gene locus_tag LOCUS_14330 5031 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 5858 6667 gene locus_tag LOCUS_14340 5858 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence163 <1 959 gene locus_tag LOCUS_14350 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680721.1:DUF4349 domain-containing protein 1132 1401 gene locus_tag LOCUS_14360 gene rpsO 1132 1401 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_14360 1739 3856 gene locus_tag LOCUS_14370 gene pnp 1739 3856 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_14370 3853 4311 gene locus_tag LOCUS_14380 gene dut 3853 4311 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 protein_id gnl|my_center|LOCUS_14380 4800 4318 gene locus_tag LOCUS_14390 4800 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 4934 5428 gene locus_tag LOCUS_14400 4934 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 5593 6567 gene locus_tag LOCUS_14410 5593 6567 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411661.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14410 6564 7301 gene locus_tag LOCUS_14420 6564 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence164 1111 290 gene locus_tag LOCUS_14430 1111 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3216 1111 gene locus_tag LOCUS_14440 3216 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 5620 3299 gene locus_tag LOCUS_14450 5620 3299 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389647.1 protein_id gnl|my_center|LOCUS_14450 5683 6609 gene locus_tag LOCUS_14460 5683 6609 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 protein_id gnl|my_center|LOCUS_14460 6735 7100 gene locus_tag LOCUS_14470 6735 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence165 1468 707 gene locus_tag LOCUS_14480 1468 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 2527 1526 gene locus_tag LOCUS_14490 2527 1526 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_14490 2592 4718 gene locus_tag LOCUS_14500 2592 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 4720 5421 gene locus_tag LOCUS_14510 4720 5421 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403929.1 protein_id gnl|my_center|LOCUS_14510 5425 6237 gene locus_tag LOCUS_14520 5425 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence166 438 1316 gene locus_tag LOCUS_14530 438 1316 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228350.1 protein_id gnl|my_center|LOCUS_14530 1313 3022 gene locus_tag LOCUS_14540 1313 3022 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114865.1 protein_id gnl|my_center|LOCUS_14540 3141 3824 gene locus_tag LOCUS_14550 3141 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 3904 6504 gene locus_tag LOCUS_14560 3904 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence167 2599 269 gene locus_tag LOCUS_14570 2599 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2654 4819 gene locus_tag LOCUS_14580 2654 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4832 6934 gene locus_tag LOCUS_14590 4832 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 7256 6903 gene locus_tag LOCUS_14600 7256 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence168 793 284 gene locus_tag LOCUS_14610 793 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2916 790 gene locus_tag LOCUS_14620 2916 790 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_14620 3133 3876 gene locus_tag LOCUS_14630 3133 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 3879 5330 gene locus_tag LOCUS_14640 3879 5330 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_14640 5334 6818 gene locus_tag LOCUS_14650 gene murJ 5334 6818 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957545.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence169 805 530 gene locus_tag LOCUS_14660 805 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 2336 969 gene locus_tag LOCUS_14670 2336 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3313 2336 gene locus_tag LOCUS_14680 3313 2336 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_14680 4430 3372 gene locus_tag LOCUS_14690 4430 3372 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_14690 5868 4462 gene locus_tag LOCUS_14700 5868 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 6360 5965 gene locus_tag LOCUS_14710 6360 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 6874 6467 gene locus_tag LOCUS_14720 6874 6467 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887363.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence170 129 1166 gene locus_tag LOCUS_14730 129 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1176 1475 gene locus_tag LOCUS_14740 1176 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 2636 1488 gene locus_tag LOCUS_14750 2636 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3552 2758 gene locus_tag LOCUS_14760 3552 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 6257 3618 gene locus_tag LOCUS_14770 gene alaS 6257 3618 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_14770 7289 6357 gene locus_tag LOCUS_14780 7289 6357 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence171 926 219 gene locus_tag LOCUS_14790 926 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1754 945 gene locus_tag LOCUS_14800 1754 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1997 2947 gene locus_tag LOCUS_14810 1997 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 3198 5660 gene locus_tag LOCUS_14820 3198 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence172 17 1288 gene locus_tag LOCUS_14830 gene arcA 17 1288 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129417.1 protein_id gnl|my_center|LOCUS_14830 3121 1295 gene locus_tag LOCUS_14840 3121 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3272 3991 gene locus_tag LOCUS_14850 3272 3991 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886863.1 protein_id gnl|my_center|LOCUS_14850 6572 3996 gene locus_tag LOCUS_14860 6572 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 <7261 6633 gene locus_tag LOCUS_14870 <7261 6633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha >Feature sequence173 1460 645 gene locus_tag LOCUS_14880 1460 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1582 2583 gene locus_tag LOCUS_14890 1582 2583 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_14890 2580 3593 gene locus_tag LOCUS_14900 2580 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3597 4151 gene locus_tag LOCUS_14910 3597 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 5622 4162 gene locus_tag LOCUS_14920 5622 4162 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence174 888 310 gene locus_tag LOCUS_14930 888 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1847 987 gene locus_tag LOCUS_14940 1847 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1982 3070 gene locus_tag LOCUS_14950 1982 3070 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920875.1 protein_id gnl|my_center|LOCUS_14950 5152 3083 gene locus_tag LOCUS_14960 5152 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 5637 5212 gene locus_tag LOCUS_14970 5637 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 7194 5824 gene locus_tag LOCUS_14980 7194 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence175 3498 523 gene locus_tag LOCUS_14990 3498 523 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_14990 3749 5125 gene locus_tag LOCUS_15000 gene gdhA 3749 5125 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_15000 7210 5171 gene locus_tag LOCUS_15010 7210 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence176 1305 628 gene locus_tag LOCUS_15020 1305 628 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 protein_id gnl|my_center|LOCUS_15020 1422 1805 gene locus_tag LOCUS_15030 1422 1805 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_15030 2897 1833 gene locus_tag LOCUS_15040 2897 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3040 4269 gene locus_tag LOCUS_15050 3040 4269 CDS product isopropylmalate/homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331430.1 protein_id gnl|my_center|LOCUS_15050 4656 4273 gene locus_tag LOCUS_15060 4656 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 5492 4653 gene locus_tag LOCUS_15070 gene panC 5492 4653 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266657.1 protein_id gnl|my_center|LOCUS_15070 6331 5495 gene locus_tag LOCUS_15080 gene panB 6331 5495 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence177 943 254 gene locus_tag LOCUS_15090 943 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2238 940 gene locus_tag LOCUS_15100 2238 940 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_15100 2388 2245 gene locus_tag LOCUS_15110 2388 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 3621 2560 gene locus_tag LOCUS_15120 3621 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 4841 3681 gene locus_tag LOCUS_15130 4841 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 5788 4838 gene locus_tag LOCUS_15140 5788 4838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533007.1 protein_id gnl|my_center|LOCUS_15140 6588 5785 gene locus_tag LOCUS_15150 6588 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15150 <7208 6581 gene locus_tag LOCUS_15160 <7208 6581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970011.1:ABC transporter permease >Feature sequence178 <1 792 gene locus_tag LOCUS_15170 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816766.1:lytic transglycosylase domain-containing protein 1413 829 gene locus_tag LOCUS_15180 1413 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 4100 1410 gene locus_tag LOCUS_15190 4100 1410 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_15190 4702 4100 gene locus_tag LOCUS_15200 4702 4100 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930580.1 protein_id gnl|my_center|LOCUS_15200 4864 5679 gene locus_tag LOCUS_15210 4864 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence179 736 53 gene locus_tag LOCUS_15220 736 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1753 791 gene locus_tag LOCUS_15230 1753 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2955 1828 gene locus_tag LOCUS_15240 2955 1828 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_15240 4154 2952 gene locus_tag LOCUS_15250 4154 2952 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222164.1 protein_id gnl|my_center|LOCUS_15250 5251 4151 gene locus_tag LOCUS_15260 5251 4151 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222163.1 protein_id gnl|my_center|LOCUS_15260 6651 5248 gene locus_tag LOCUS_15270 6651 5248 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222162.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence180 1776 2621 gene locus_tag LOCUS_15280 1776 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4105 2606 gene locus_tag LOCUS_15290 4105 2606 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 protein_id gnl|my_center|LOCUS_15290 5033 4221 gene locus_tag LOCUS_15300 5033 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 5384 6457 gene locus_tag LOCUS_15310 5384 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence181 1078 14 gene locus_tag LOCUS_15320 1078 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3207 1075 gene locus_tag LOCUS_15330 3207 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 4229 3204 gene locus_tag LOCUS_15340 4229 3204 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_15340 5203 4226 gene locus_tag LOCUS_15350 5203 4226 CDS product TRAP transporter TatT component family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682338.1 protein_id gnl|my_center|LOCUS_15350 5315 5935 gene locus_tag LOCUS_15360 5315 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence182 <1 627 gene locus_tag LOCUS_15370 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783789.1:TolC family protein 624 1865 gene locus_tag LOCUS_15380 624 1865 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_15380 1862 5014 gene locus_tag LOCUS_15390 1862 5014 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_15390 5011 6366 gene locus_tag LOCUS_15400 5011 6366 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence183 72 3266 gene locus_tag LOCUS_15410 72 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3266 3745 gene locus_tag LOCUS_15420 3266 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3866 4387 gene locus_tag LOCUS_15430 3866 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4392 5042 gene locus_tag LOCUS_15440 4392 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 5801 5064 gene locus_tag LOCUS_15450 5801 5064 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704963.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence184 1456 149 gene locus_tag LOCUS_15460 1456 149 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_15460 2563 1472 gene locus_tag LOCUS_15470 2563 1472 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869241.1 protein_id gnl|my_center|LOCUS_15470 3459 2560 gene locus_tag LOCUS_15480 3459 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4112 3456 gene locus_tag LOCUS_15490 gene ftsE 4112 3456 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985455.1 protein_id gnl|my_center|LOCUS_15490 4246 4800 gene locus_tag LOCUS_15500 gene nadD 4246 4800 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404800.1 protein_id gnl|my_center|LOCUS_15500 4800 5504 gene locus_tag LOCUS_15510 4800 5504 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence185 41 382 gene locus_tag LOCUS_15520 41 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 389 637 gene locus_tag LOCUS_15530 389 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 647 1216 gene locus_tag LOCUS_15540 647 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1213 1764 gene locus_tag LOCUS_15550 1213 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1766 2128 gene locus_tag LOCUS_15560 1766 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2125 2646 gene locus_tag LOCUS_15570 2125 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2649 2867 gene locus_tag LOCUS_15580 2649 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3001 3564 gene locus_tag LOCUS_15590 3001 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 3561 3866 gene locus_tag LOCUS_15600 3561 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 3863 4066 gene locus_tag LOCUS_15610 3863 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 4036 4308 gene locus_tag LOCUS_15620 4036 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 4305 4736 gene locus_tag LOCUS_15630 4305 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 4870 5913 gene locus_tag LOCUS_15640 4870 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 6519 5923 gene locus_tag LOCUS_15650 6519 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 6630 6929 gene locus_tag LOCUS_15660 6630 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence186 6 869 gene locus_tag LOCUS_15670 6 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3176 1179 gene locus_tag LOCUS_15680 gene ppk1 3176 1179 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036175.1 protein_id gnl|my_center|LOCUS_15680 3394 4149 gene locus_tag LOCUS_15690 3394 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 4163 6733 gene locus_tag LOCUS_15700 4163 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 7024 6734 gene locus_tag LOCUS_15710 7024 6734 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence187 439 2979 gene locus_tag LOCUS_15720 439 2979 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836868.1 protein_id gnl|my_center|LOCUS_15720 2976 4094 gene locus_tag LOCUS_15730 2976 4094 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311516.1 protein_id gnl|my_center|LOCUS_15730 4098 6425 gene locus_tag LOCUS_15740 4098 6425 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence188 2806 1730 gene locus_tag LOCUS_15750 2806 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3176 2835 gene locus_tag LOCUS_15760 3176 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3757 3173 gene locus_tag LOCUS_15770 3757 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4950 3757 gene locus_tag LOCUS_15780 4950 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5825 4950 gene locus_tag LOCUS_15790 5825 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 <7013 5825 gene locus_tag LOCUS_15800 <7013 5825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124143.1:multiheme c-type cytochrome >Feature sequence189 304 639 gene locus_tag LOCUS_15810 304 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 775 1251 gene locus_tag LOCUS_15820 775 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1248 2444 gene locus_tag LOCUS_15830 1248 2444 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870216.1 protein_id gnl|my_center|LOCUS_15830 2465 2713 gene locus_tag LOCUS_15840 2465 2713 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065850.1 protein_id gnl|my_center|LOCUS_15840 3798 3118 gene locus_tag LOCUS_15850 3798 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4445 3822 gene locus_tag LOCUS_15860 4445 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4531 5496 gene locus_tag LOCUS_15870 4531 5496 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193905664.1 protein_id gnl|my_center|LOCUS_15870 5548 6042 gene locus_tag LOCUS_15880 5548 6042 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387781.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence190 2208 988 gene locus_tag LOCUS_15890 gene larC 2208 988 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_15890 2957 2205 gene locus_tag LOCUS_15900 gene larB 2957 2205 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_15900 3040 5655 gene locus_tag LOCUS_15910 3040 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence191 727 3282 gene locus_tag LOCUS_15920 727 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3313 4110 gene locus_tag LOCUS_15930 3313 4110 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082680.1 protein_id gnl|my_center|LOCUS_15930 6260 4134 gene locus_tag LOCUS_15940 6260 4134 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878688.1 protein_id gnl|my_center|LOCUS_15940 6978 6328 gene locus_tag LOCUS_15950 6978 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence192 4062 2644 gene locus_tag LOCUS_15960 gene boxB 4062 2644 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230333.1 protein_id gnl|my_center|LOCUS_15960 5706 4075 gene locus_tag LOCUS_15970 gene boxC 5706 4075 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230334.1 protein_id gnl|my_center|LOCUS_15970 5794 6621 gene locus_tag LOCUS_15980 5794 6621 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083896.1 protein_id gnl|my_center|LOCUS_15980 6618 6818 gene locus_tag LOCUS_15990 6618 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence193 1188 2114 gene locus_tag LOCUS_16000 1188 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 <6978 2127 gene locus_tag LOCUS_16010 <6978 2127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123734.1:tetratricopeptide repeat protein >Feature sequence194 517 984 gene locus_tag LOCUS_16020 517 984 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_16020 1014 1877 gene locus_tag LOCUS_16030 1014 1877 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_16030 1932 2246 gene locus_tag LOCUS_16040 1932 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 3983 2337 gene locus_tag LOCUS_16050 3983 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4750 3983 gene locus_tag LOCUS_16060 4750 3983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_16060 5646 4747 gene locus_tag LOCUS_16070 5646 4747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence195 703 1392 gene locus_tag LOCUS_16080 703 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1678 1370 gene locus_tag LOCUS_16090 1678 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1873 1682 gene locus_tag LOCUS_16100 1873 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2006 2533 gene locus_tag LOCUS_16110 2006 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 2538 3167 gene locus_tag LOCUS_16120 2538 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3164 3361 gene locus_tag LOCUS_16130 3164 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3358 4899 gene locus_tag LOCUS_16140 3358 4899 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_16140 4973 6460 gene locus_tag LOCUS_16150 4973 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence196 <1 942 gene locus_tag LOCUS_16160 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479917.1:orotidine-5'-phosphate decarboxylase 1013 1834 gene locus_tag LOCUS_16170 1013 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2240 1863 gene locus_tag LOCUS_16180 2240 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3043 2261 gene locus_tag LOCUS_16190 3043 2261 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067764.1 protein_id gnl|my_center|LOCUS_16190 3731 3135 gene locus_tag LOCUS_16200 3731 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4493 3780 gene locus_tag LOCUS_16210 4493 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 4447 4956 gene locus_tag LOCUS_16220 4447 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 4953 5246 gene locus_tag LOCUS_16230 4953 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence197 <1 2711 gene locus_tag LOCUS_16240 <1 2711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224245890.1:serine/threonine-protein kinase 2815 3135 gene locus_tag LOCUS_16250 2815 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3923 3213 gene locus_tag LOCUS_16260 3923 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 4651 3935 gene locus_tag LOCUS_16270 4651 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 5335 4664 gene locus_tag LOCUS_16280 5335 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 5781 6929 gene locus_tag LOCUS_16290 5781 6929 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539776.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence198 1837 821 gene locus_tag LOCUS_16300 gene cydB 1837 821 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037378.1 protein_id gnl|my_center|LOCUS_16300 3177 1834 gene locus_tag LOCUS_16310 3177 1834 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_16310 3633 3181 gene locus_tag LOCUS_16320 3633 3181 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_16320 3863 4636 gene locus_tag LOCUS_16330 3863 4636 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403590.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16330 4633 6021 gene locus_tag LOCUS_16340 4633 6021 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence199 99 2153 gene locus_tag LOCUS_16350 99 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2150 2803 gene locus_tag LOCUS_16360 2150 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 3604 2858 gene locus_tag LOCUS_16370 3604 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 4642 3800 gene locus_tag LOCUS_16380 gene proC 4642 3800 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_16380 6572 4692 gene locus_tag LOCUS_16390 6572 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence200 171 896 gene locus_tag LOCUS_16400 gene aat 171 896 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_16400 1378 893 gene locus_tag LOCUS_16410 1378 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1495 2283 gene locus_tag LOCUS_16420 1495 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2280 2897 gene locus_tag LOCUS_16430 gene trmH 2280 2897 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369142.1 protein_id gnl|my_center|LOCUS_16430 4196 2901 gene locus_tag LOCUS_16440 4196 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4715 4200 gene locus_tag LOCUS_16450 gene def 4715 4200 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_16450 4809 5072 gene locus_tag LOCUS_16460 4809 5072 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_16460 5175 5840 gene locus_tag LOCUS_16470 5175 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence201 1907 522 gene locus_tag LOCUS_16480 1907 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3502 1904 gene locus_tag LOCUS_16490 3502 1904 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003302.1 protein_id gnl|my_center|LOCUS_16490 4232 3516 gene locus_tag LOCUS_16500 4232 3516 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_16500 5489 4314 gene locus_tag LOCUS_16510 5489 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 6803 5550 gene locus_tag LOCUS_16520 gene per 6803 5550 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918896.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence202 <1 1297 gene locus_tag LOCUS_16530 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940703.1:Tol-Pal system beta propeller repeat protein TolB 1315 2244 gene locus_tag LOCUS_16540 1315 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 2341 4962 gene locus_tag LOCUS_16550 2341 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 6732 4987 gene locus_tag LOCUS_16560 6732 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence203 78 782 gene locus_tag LOCUS_16570 78 782 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_16570 779 1990 gene locus_tag LOCUS_16580 779 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2050 3138 gene locus_tag LOCUS_16590 2050 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3162 4166 gene locus_tag LOCUS_16600 3162 4166 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_16600 4163 5077 gene locus_tag LOCUS_16610 gene pstC 4163 5077 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_16610 5074 5955 gene locus_tag LOCUS_16620 gene pstA 5074 5955 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256173.1 protein_id gnl|my_center|LOCUS_16620 5962 6765 gene locus_tag LOCUS_16630 gene pstB 5962 6765 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889420.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence204 266 1702 gene locus_tag LOCUS_16640 266 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1736 2230 gene locus_tag LOCUS_16650 1736 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2892 2218 gene locus_tag LOCUS_16660 gene nth 2892 2218 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_16660 3030 4007 gene locus_tag LOCUS_16670 3030 4007 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227687.1 protein_id gnl|my_center|LOCUS_16670 4048 4416 gene locus_tag LOCUS_16680 gene clpS 4048 4416 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479522.1 protein_id gnl|my_center|LOCUS_16680 4427 6721 gene locus_tag LOCUS_16690 gene clpA 4427 6721 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence205 2037 547 gene locus_tag LOCUS_16700 2037 547 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530049.1 protein_id gnl|my_center|LOCUS_16700 3095 2046 gene locus_tag LOCUS_16710 3095 2046 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_16710 6007 3182 gene locus_tag LOCUS_16720 6007 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 6206 6667 gene locus_tag LOCUS_16730 6206 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence206 1374 505 gene locus_tag LOCUS_16740 1374 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1494 2423 gene locus_tag LOCUS_16750 1494 2423 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_16750 2420 3208 gene locus_tag LOCUS_16760 2420 3208 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_16760 3269 4501 gene locus_tag LOCUS_16770 3269 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4590 5678 gene locus_tag LOCUS_16780 4590 5678 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_16780 5687 5941 gene locus_tag LOCUS_16790 5687 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence207 493 1482 gene locus_tag LOCUS_16800 493 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1539 2810 gene locus_tag LOCUS_16810 1539 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 2893 4398 gene locus_tag LOCUS_16820 2893 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4538 5227 gene locus_tag LOCUS_16830 4538 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 <6709 5237 gene locus_tag LOCUS_16840 <6709 5237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941701.1:sigma-54 dependent transcriptional regulator >Feature sequence208 1002 154 gene locus_tag LOCUS_16850 1002 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1250 999 gene locus_tag LOCUS_16860 1250 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1803 1237 gene locus_tag LOCUS_16870 1803 1237 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284396.1 protein_id gnl|my_center|LOCUS_16870 3371 1812 gene locus_tag LOCUS_16880 3371 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3819 3463 gene locus_tag LOCUS_16890 3819 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 5550 3832 gene locus_tag LOCUS_16900 5550 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 6656 5577 gene locus_tag LOCUS_16910 6656 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence209 <1 643 gene locus_tag LOCUS_16920 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942949.1:sulfate permease 757 903 gene locus_tag LOCUS_16930 757 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 990 2567 gene locus_tag LOCUS_16940 990 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4014 2605 gene locus_tag LOCUS_16950 4014 2605 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_16950 4153 5490 gene locus_tag LOCUS_16960 4153 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence210 <1 2646 gene locus_tag LOCUS_16970 <1 2646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014625869.1:alpha-2-macroglobulin 2657 4969 gene locus_tag LOCUS_16980 gene pbpC 2657 4969 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014751.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence211 463 74 gene locus_tag LOCUS_16990 463 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2613 577 gene locus_tag LOCUS_17000 2613 577 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_17000 3182 2730 gene locus_tag LOCUS_17010 3182 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 4552 3209 gene locus_tag LOCUS_17020 4552 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 <6657 4656 gene locus_tag LOCUS_17030 <6657 4656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196955152.1:hybrid sensor histidine kinase/response regulator transcription factor >Feature sequence212 3862 1223 gene locus_tag LOCUS_17040 3862 1223 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_17040 4649 3906 gene locus_tag LOCUS_17050 4649 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 5463 4657 gene locus_tag LOCUS_17060 5463 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 5537 6118 gene locus_tag LOCUS_17070 5537 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence213 1535 786 gene locus_tag LOCUS_17080 gene cobI 1535 786 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_17080 2758 1532 gene locus_tag LOCUS_17090 2758 1532 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_17090 3450 2755 gene locus_tag LOCUS_17100 gene cbiC 3450 2755 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 protein_id gnl|my_center|LOCUS_17100 4676 3447 gene locus_tag LOCUS_17110 4676 3447 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145958.1 protein_id gnl|my_center|LOCUS_17110 5545 5000 gene locus_tag LOCUS_17120 5545 5000 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096509.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence214 2380 950 gene locus_tag LOCUS_17130 2380 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 5478 2377 gene locus_tag LOCUS_17140 5478 2377 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_17140 <6623 5475 gene locus_tag LOCUS_17150 <6623 5475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072023.1:efflux RND transporter permease subunit >Feature sequence215 <1 1909 gene locus_tag LOCUS_17160 <1 1909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000482297.1:M36 family metallopeptidase 1912 2406 gene locus_tag LOCUS_17170 1912 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2406 3914 gene locus_tag LOCUS_17180 2406 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 3924 4517 gene locus_tag LOCUS_17190 3924 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 4535 4870 gene locus_tag LOCUS_17200 4535 4870 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 protein_id gnl|my_center|LOCUS_17200 5905 4892 gene locus_tag LOCUS_17210 5905 4892 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence216 <1 988 gene locus_tag LOCUS_17220 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227564.1:FAD binding domain-containing protein 1189 1680 gene locus_tag LOCUS_17230 1189 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3513 1690 gene locus_tag LOCUS_17240 3513 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 3767 5905 gene locus_tag LOCUS_17250 gene fusA 3767 5905 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102023.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence217 100 1089 gene locus_tag LOCUS_17260 100 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1105 1938 gene locus_tag LOCUS_17270 1105 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2883 1957 gene locus_tag LOCUS_17280 2883 1957 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_17280 3451 3047 gene locus_tag LOCUS_17290 3451 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 4819 3455 gene locus_tag LOCUS_17300 4819 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 5142 5699 gene locus_tag LOCUS_17310 5142 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence218 2782 1601 gene locus_tag LOCUS_17320 2782 1601 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 protein_id gnl|my_center|LOCUS_17320 3008 3574 gene locus_tag LOCUS_17330 3008 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 3985 3584 gene locus_tag LOCUS_17340 3985 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 5161 4097 gene locus_tag LOCUS_17350 5161 4097 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_17350 5667 5158 gene locus_tag LOCUS_17360 gene trmL 5667 5158 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_17360 6263 5664 gene locus_tag LOCUS_17370 6263 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence219 2446 1121 gene locus_tag LOCUS_17380 2446 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2837 2484 gene locus_tag LOCUS_17390 2837 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2893 3192 gene locus_tag LOCUS_17400 2893 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3330 3255 gene locus_tag LOCUS_t00290 3330 3255 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3517 4914 gene locus_tag LOCUS_17410 3517 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 6308 4926 gene locus_tag LOCUS_17420 6308 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence220 598 1545 gene locus_tag LOCUS_17430 598 1545 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_17430 1542 2225 gene locus_tag LOCUS_17440 1542 2225 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_17440 3874 2279 gene locus_tag LOCUS_17450 3874 2279 CDS product integrin alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928870.1 protein_id gnl|my_center|LOCUS_17450 5325 4075 gene locus_tag LOCUS_17460 5325 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 6309 5383 gene locus_tag LOCUS_17470 6309 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence221 225 1694 gene locus_tag LOCUS_17480 gene guaB 225 1694 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_17480 2433 1777 gene locus_tag LOCUS_17490 gene rplC 2433 1777 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814493.1 protein_id gnl|my_center|LOCUS_17490 3691 2525 gene locus_tag LOCUS_17500 3691 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 4502 3756 gene locus_tag LOCUS_17510 4502 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence222 2312 282 gene locus_tag LOCUS_17520 2312 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 3407 2391 gene locus_tag LOCUS_17530 3407 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 4341 3478 gene locus_tag LOCUS_17540 4341 3478 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_17540 5233 4358 gene locus_tag LOCUS_17550 5233 4358 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257037.1 protein_id gnl|my_center|LOCUS_17550 6077 5244 gene locus_tag LOCUS_17560 6077 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence223 1807 23 gene locus_tag LOCUS_17570 1807 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2973 1864 gene locus_tag LOCUS_17580 2973 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 3069 5300 gene locus_tag LOCUS_17590 3069 5300 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_17590 5297 6043 gene locus_tag LOCUS_17600 5297 6043 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence224 2767 542 gene locus_tag LOCUS_17610 2767 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 4520 2826 gene locus_tag LOCUS_17620 4520 2826 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_17620 6492 4867 gene locus_tag LOCUS_17630 gene pruA 6492 4867 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence225 724 2847 gene locus_tag LOCUS_17640 724 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 4382 2826 gene locus_tag LOCUS_17650 4382 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 6377 4830 gene locus_tag LOCUS_17660 6377 4830 CDS product peptide ligase PGM1-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence226 2 349 gene locus_tag LOCUS_17670 2 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 358 1470 gene locus_tag LOCUS_17680 358 1470 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_17680 1463 2248 gene locus_tag LOCUS_17690 1463 2248 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_17690 2258 2794 gene locus_tag LOCUS_17700 2258 2794 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942504.1 protein_id gnl|my_center|LOCUS_17700 2844 4349 gene locus_tag LOCUS_17710 2844 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 5590 4358 gene locus_tag LOCUS_17720 5590 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence227 1074 2966 gene locus_tag LOCUS_17730 gene speA 1074 2966 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_17730 3893 2967 gene locus_tag LOCUS_17740 3893 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 5345 4038 gene locus_tag LOCUS_17750 5345 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 6497 5436 gene locus_tag LOCUS_17760 6497 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence228 927 358 gene locus_tag LOCUS_17770 927 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2150 1164 gene locus_tag LOCUS_17780 2150 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2209 3780 gene locus_tag LOCUS_17790 2209 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 4819 3707 gene locus_tag LOCUS_17800 4819 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 4891 6093 gene locus_tag LOCUS_17810 4891 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence229 112 774 gene locus_tag LOCUS_17820 112 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1915 821 gene locus_tag LOCUS_17830 1915 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3305 2034 gene locus_tag LOCUS_17840 3305 2034 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_17840 3591 3391 gene locus_tag LOCUS_17850 3591 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4524 3679 gene locus_tag LOCUS_17860 4524 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 4645 6315 gene locus_tag LOCUS_17870 gene ettA 4645 6315 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence230 173 919 gene locus_tag LOCUS_17880 173 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1008 2846 gene locus_tag LOCUS_17890 1008 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2874 3167 gene locus_tag LOCUS_17900 2874 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3437 4594 gene locus_tag LOCUS_17910 3437 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 4626 5054 gene locus_tag LOCUS_17920 4626 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 5955 5074 gene locus_tag LOCUS_17930 5955 5074 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225689.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence231 663 118 gene locus_tag LOCUS_17940 663 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2195 660 gene locus_tag LOCUS_17950 2195 660 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_17950 2287 3216 gene locus_tag LOCUS_17960 2287 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 3213 3767 gene locus_tag LOCUS_17970 3213 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 3879 4760 gene locus_tag LOCUS_17980 3879 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 4757 5365 gene locus_tag LOCUS_17990 4757 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 5431 5988 gene locus_tag LOCUS_18000 5431 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence232 74 682 gene locus_tag LOCUS_18010 74 682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339269.1 protein_id gnl|my_center|LOCUS_18010 679 1875 gene locus_tag LOCUS_18020 679 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2061 2621 gene locus_tag LOCUS_18030 gene lspA 2061 2621 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_18030 2651 2998 gene locus_tag LOCUS_18040 2651 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 3040 4563 gene locus_tag LOCUS_18050 3040 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 4597 5823 gene locus_tag LOCUS_18060 4597 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence233 58 2100 gene locus_tag LOCUS_18070 58 2100 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449670.1 protein_id gnl|my_center|LOCUS_18070 2125 3213 gene locus_tag LOCUS_18080 2125 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3315 4829 gene locus_tag LOCUS_18090 3315 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 5970 4885 gene locus_tag LOCUS_18100 5970 4885 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence234 1001 462 gene locus_tag LOCUS_18110 1001 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2312 1077 gene locus_tag LOCUS_18120 2312 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 3341 2508 gene locus_tag LOCUS_18130 3341 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 5187 3448 gene locus_tag LOCUS_18140 5187 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 5918 5184 gene locus_tag LOCUS_18150 5918 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence235 618 1487 gene locus_tag LOCUS_18160 618 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1665 2078 gene locus_tag LOCUS_18170 1665 2078 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081299.1 protein_id gnl|my_center|LOCUS_18170 2174 4399 gene locus_tag LOCUS_18180 2174 4399 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444167.1 protein_id gnl|my_center|LOCUS_18180 5248 4469 gene locus_tag LOCUS_18190 5248 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence236 3663 832 gene locus_tag LOCUS_18200 3663 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 3810 4583 gene locus_tag LOCUS_18210 gene xth 3810 4583 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_18210 4606 5529 gene locus_tag LOCUS_18220 4606 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence237 806 2164 gene locus_tag LOCUS_18230 806 2164 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_18230 3503 2178 gene locus_tag LOCUS_18240 3503 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 4596 3604 gene locus_tag LOCUS_18250 4596 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence238 116 1537 gene locus_tag LOCUS_18260 116 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1534 3831 gene locus_tag LOCUS_18270 1534 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4699 3863 gene locus_tag LOCUS_18280 gene lpxC 4699 3863 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640382.1 protein_id gnl|my_center|LOCUS_18280 5124 4696 gene locus_tag LOCUS_18290 5124 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 6143 5121 gene locus_tag LOCUS_18300 gene ruvB 6143 5121 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence239 <1 687 gene locus_tag LOCUS_18310 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969887.1:glutathione S-transferase family protein 1295 708 gene locus_tag LOCUS_18320 1295 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1273 2067 gene locus_tag LOCUS_18330 1273 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18330 3558 2080 gene locus_tag LOCUS_18340 3558 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 3663 5702 gene locus_tag LOCUS_18350 3663 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence240 316 840 gene locus_tag LOCUS_18360 316 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 901 1647 gene locus_tag LOCUS_18370 901 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4860 1690 gene locus_tag LOCUS_18380 4860 1690 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615874.1 protein_id gnl|my_center|LOCUS_18380 6049 4850 gene locus_tag LOCUS_18390 6049 4850 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929017.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence241 <1 1139 gene locus_tag LOCUS_18400 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000246120.1:alpha/beta fold hydrolase 1194 2924 gene locus_tag LOCUS_18410 gene sppA 1194 2924 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_18410 3786 2935 gene locus_tag LOCUS_18420 3786 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3923 4096 gene locus_tag LOCUS_18430 3923 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 4942 4103 gene locus_tag LOCUS_18440 4942 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 6003 4939 gene locus_tag LOCUS_18450 gene holB 6003 4939 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence242 1649 588 gene locus_tag LOCUS_18460 gene lpxB 1649 588 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_18460 1775 2908 gene locus_tag LOCUS_18470 1775 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 3293 2919 gene locus_tag LOCUS_18480 3293 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 5529 3307 gene locus_tag LOCUS_18490 5529 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 5478 5771 gene locus_tag LOCUS_18500 5478 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence243 164 2203 gene locus_tag LOCUS_18510 164 2203 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 protein_id gnl|my_center|LOCUS_18510 2247 3410 gene locus_tag LOCUS_18520 2247 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3410 5014 gene locus_tag LOCUS_18530 3410 5014 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932618.1 protein_id gnl|my_center|LOCUS_18530 5011 6021 gene locus_tag LOCUS_18540 gene cbiB 5011 6021 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351275.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence244 291 1364 gene locus_tag LOCUS_18550 gene pdhA 291 1364 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980946.1 protein_id gnl|my_center|LOCUS_18550 1366 2349 gene locus_tag LOCUS_18560 1366 2349 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_18560 2349 3674 gene locus_tag LOCUS_18570 2349 3674 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087547.1 protein_id gnl|my_center|LOCUS_18570 4711 3701 gene locus_tag LOCUS_18580 4711 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 5543 4716 gene locus_tag LOCUS_18590 5543 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 6160 5540 gene locus_tag LOCUS_18600 6160 5540 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173662.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence245 932 1141 gene locus_tag LOCUS_18610 932 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2048 1143 gene locus_tag LOCUS_18620 2048 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2097 2180 gene locus_tag LOCUS_t00300 2097 2180 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2272 4068 gene locus_tag LOCUS_18630 gene dnaK 2272 4068 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_18630 6249 4102 gene locus_tag LOCUS_18640 6249 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence246 456 899 gene locus_tag LOCUS_18650 456 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1025 1477 gene locus_tag LOCUS_18660 1025 1477 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532258.1 protein_id gnl|my_center|LOCUS_18660 1474 2139 gene locus_tag LOCUS_18670 1474 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2896 2342 gene locus_tag LOCUS_18680 2896 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 4407 2893 gene locus_tag LOCUS_18690 gene hflX 4407 2893 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_18690 4348 4680 gene locus_tag LOCUS_18700 4348 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 6227 4584 gene locus_tag LOCUS_18710 6227 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence247 62 1207 gene locus_tag LOCUS_18720 62 1207 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_18720 1331 2188 gene locus_tag LOCUS_18730 1331 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2199 3281 gene locus_tag LOCUS_18740 2199 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 3772 5454 gene locus_tag LOCUS_18750 3772 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 6205 5543 gene locus_tag LOCUS_18760 6205 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence248 215 577 gene locus_tag LOCUS_18770 215 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 595 2229 gene locus_tag LOCUS_18780 595 2229 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523287.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence249 125 2851 gene locus_tag LOCUS_18790 125 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2855 3688 gene locus_tag LOCUS_18800 2855 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3678 4688 gene locus_tag LOCUS_18810 3678 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence250 2778 814 gene locus_tag LOCUS_18820 2778 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2927 4507 gene locus_tag LOCUS_18830 2927 4507 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_18830 4978 4571 gene locus_tag LOCUS_18840 4978 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 6086 5205 gene locus_tag LOCUS_18850 6086 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence251 89 343 gene locus_tag LOCUS_18860 89 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1352 876 gene locus_tag LOCUS_18870 1352 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1475 2152 gene locus_tag LOCUS_18880 1475 2152 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973594.1 protein_id gnl|my_center|LOCUS_18880 2149 3315 gene locus_tag LOCUS_18890 2149 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 3368 5140 gene locus_tag LOCUS_18900 gene aspS 3368 5140 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_18900 <6131 5168 gene locus_tag LOCUS_18910 <6131 5168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013061282.1:universal stress protein >Feature sequence252 27 1343 gene locus_tag LOCUS_18920 27 1343 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460239.1 protein_id gnl|my_center|LOCUS_18920 1340 2608 gene locus_tag LOCUS_18930 1340 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2610 3473 gene locus_tag LOCUS_18940 2610 3473 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_18940 4163 3480 gene locus_tag LOCUS_18950 4163 3480 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880279.1 protein_id gnl|my_center|LOCUS_18950 4263 5732 gene locus_tag LOCUS_18960 4263 5732 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence253 2353 113 gene locus_tag LOCUS_18970 2353 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 3323 2427 gene locus_tag LOCUS_18980 3323 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 4386 3382 gene locus_tag LOCUS_18990 gene moaA 4386 3382 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257065.1 protein_id gnl|my_center|LOCUS_18990 5501 4383 gene locus_tag LOCUS_19000 5501 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence254 3401 1578 gene locus_tag LOCUS_19010 3401 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3449 5191 gene locus_tag LOCUS_19020 3449 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence255 10 1488 gene locus_tag LOCUS_19030 10 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 1485 2579 gene locus_tag LOCUS_19040 1485 2579 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_19040 2576 2809 gene locus_tag LOCUS_19050 2576 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2806 3288 gene locus_tag LOCUS_19060 2806 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 3394 3957 gene locus_tag LOCUS_19070 3394 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3954 4724 gene locus_tag LOCUS_19080 3954 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence256 63 2654 gene locus_tag LOCUS_19090 63 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3957 2662 gene locus_tag LOCUS_19100 3957 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 <6113 3957 gene locus_tag LOCUS_19110 <6113 3957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956752.1:MMPL family transporter >Feature sequence257 109 873 gene locus_tag LOCUS_19120 109 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 881 1915 gene locus_tag LOCUS_19130 881 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19130 2017 4827 gene locus_tag LOCUS_19140 gene secA 2017 4827 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_19140 5400 4834 gene locus_tag LOCUS_19150 5400 4834 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence258 750 598 gene locus_tag LOCUS_19160 750 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2249 747 gene locus_tag LOCUS_19170 2249 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 3718 2246 gene locus_tag LOCUS_19180 3718 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 4448 3735 gene locus_tag LOCUS_19190 4448 3735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_19190 5389 4445 gene locus_tag LOCUS_19200 5389 4445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence259 2876 882 gene locus_tag LOCUS_19210 2876 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 3044 3232 gene locus_tag LOCUS_19220 gene rpmG 3044 3232 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057895.1 protein_id gnl|my_center|LOCUS_19220 4024 3410 gene locus_tag LOCUS_19230 gene rpsD 4024 3410 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056002.1 protein_id gnl|my_center|LOCUS_19230 4304 5014 gene locus_tag LOCUS_19240 4304 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence260 40 1398 gene locus_tag LOCUS_19250 40 1398 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_19250 2712 1402 gene locus_tag LOCUS_19260 2712 1402 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_19260 2937 3989 gene locus_tag LOCUS_19270 2937 3989 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_19270 4083 4835 gene locus_tag LOCUS_19280 4083 4835 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902271.1 protein_id gnl|my_center|LOCUS_19280 4835 6040 gene locus_tag LOCUS_19290 4835 6040 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392956.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence261 1522 1004 gene locus_tag LOCUS_19300 1522 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1610 2719 gene locus_tag LOCUS_19310 1610 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 5260 2723 gene locus_tag LOCUS_19320 5260 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 5829 5257 gene locus_tag LOCUS_19330 5829 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence262 1261 35 gene locus_tag LOCUS_19340 1261 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1355 2299 gene locus_tag LOCUS_19350 1355 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2303 3286 gene locus_tag LOCUS_19360 2303 3286 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_19360 4538 3300 gene locus_tag LOCUS_19370 4538 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 5017 4862 gene locus_tag LOCUS_19380 5017 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 <6015 5119 gene locus_tag LOCUS_19390 <6015 5119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807822.1:hydroxymethylglutaryl-CoA lyase >Feature sequence263 2397 4736 gene locus_tag LOCUS_19400 gene lon 2397 4736 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938487.1 protein_id gnl|my_center|LOCUS_19400 5867 4743 gene locus_tag LOCUS_19410 5867 4743 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920613.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence264 316 666 gene locus_tag LOCUS_19420 316 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 663 1499 gene locus_tag LOCUS_19430 663 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2042 1506 gene locus_tag LOCUS_19440 2042 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 5506 2042 gene locus_tag LOCUS_19450 gene metH 5506 2042 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence265 1761 529 gene locus_tag LOCUS_19460 1761 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2551 1751 gene locus_tag LOCUS_19470 2551 1751 CDS product 5'-methylthioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404886.1 protein_id gnl|my_center|LOCUS_19470 2940 2548 gene locus_tag LOCUS_19480 2940 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 3331 2876 gene locus_tag LOCUS_19490 gene nusB 3331 2876 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_19490 3813 3334 gene locus_tag LOCUS_19500 gene ribE 3813 3334 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_19500 5080 3851 gene locus_tag LOCUS_19510 5080 3851 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_19510 5813 5103 gene locus_tag LOCUS_19520 5813 5103 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence266 116 988 gene locus_tag LOCUS_19530 116 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19530 985 2883 gene locus_tag LOCUS_19540 gene recD 985 2883 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900979.1 protein_id gnl|my_center|LOCUS_19540 3588 2917 gene locus_tag LOCUS_19550 3588 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 4532 3717 gene locus_tag LOCUS_19560 4532 3717 CDS product ATP adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125113.1 protein_id gnl|my_center|LOCUS_19560 5008 4529 gene locus_tag LOCUS_19570 5008 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence267 612 1259 gene locus_tag LOCUS_19580 612 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 3452 1272 gene locus_tag LOCUS_19590 3452 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 <5984 3514 gene locus_tag LOCUS_19600 <5984 3514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136932681.1:VCBS repeat-containing protein >Feature sequence268 351 2867 gene locus_tag LOCUS_19610 351 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2864 3472 gene locus_tag LOCUS_19620 2864 3472 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_19620 <5973 3482 gene locus_tag LOCUS_19630 <5973 3482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496538.1:intein-containing phosphoenolpyruvate synthase >Feature sequence269 802 2553 gene locus_tag LOCUS_19640 802 2553 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_19640 2563 2955 gene locus_tag LOCUS_19650 2563 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2952 5120 gene locus_tag LOCUS_19660 2952 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 5117 5833 gene locus_tag LOCUS_19670 5117 5833 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence270 <1 2632 gene locus_tag LOCUS_19680 <1 2632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918962.1:cell cycle histidine kinase CckA 3239 2610 gene locus_tag LOCUS_19690 3239 2610 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975730.1 protein_id gnl|my_center|LOCUS_19690 4440 3232 gene locus_tag LOCUS_19700 4440 3232 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040369.1 protein_id gnl|my_center|LOCUS_19700 4549 5847 gene locus_tag LOCUS_19710 4549 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence271 242 1309 gene locus_tag LOCUS_19720 gene gcvT 242 1309 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479785.1 protein_id gnl|my_center|LOCUS_19720 1311 4007 gene locus_tag LOCUS_19730 1311 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 4173 4718 gene locus_tag LOCUS_19740 4173 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 4726 5403 gene locus_tag LOCUS_19750 4726 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 <5906 5393 gene locus_tag LOCUS_19760 <5906 5393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037392600.1:L,D-transpeptidase family protein >Feature sequence272 <1 946 gene locus_tag LOCUS_19770 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542276.1:alanine racemase 1686 910 gene locus_tag LOCUS_19780 1686 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2491 1700 gene locus_tag LOCUS_19790 2491 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890599.1 protein_id gnl|my_center|LOCUS_19790 2556 3722 gene locus_tag LOCUS_19800 2556 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 <5904 3735 gene locus_tag LOCUS_19810 <5904 3735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003693.1:ATP-binding protein >Feature sequence273 998 2071 gene locus_tag LOCUS_19820 998 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2468 2082 gene locus_tag LOCUS_19830 2468 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2628 3416 gene locus_tag LOCUS_19840 2628 3416 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_19840 5043 3418 gene locus_tag LOCUS_19850 5043 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence274 1066 2478 gene locus_tag LOCUS_19860 1066 2478 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900628.1 protein_id gnl|my_center|LOCUS_19860 2568 3461 gene locus_tag LOCUS_19870 2568 3461 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038682.1 protein_id gnl|my_center|LOCUS_19870 3472 4977 gene locus_tag LOCUS_19880 3472 4977 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence275 2272 1214 gene locus_tag LOCUS_19890 2272 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4338 2329 gene locus_tag LOCUS_19900 4338 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 4904 4335 gene locus_tag LOCUS_19910 4904 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19910 5695 4850 gene locus_tag LOCUS_19920 5695 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19920 >Feature sequence276 1041 214 gene locus_tag LOCUS_19930 gene rutD 1041 214 CDS product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165691080.1 protein_id gnl|my_center|LOCUS_19930 1091 1516 gene locus_tag LOCUS_19940 1091 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 1513 1899 gene locus_tag LOCUS_19950 1513 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2346 1912 gene locus_tag LOCUS_19960 2346 1912 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080643.1 protein_id gnl|my_center|LOCUS_19960 2531 4585 gene locus_tag LOCUS_19970 gene fusA 2531 4585 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228848.1 protein_id gnl|my_center|LOCUS_19970 4603 5757 gene locus_tag LOCUS_19980 4603 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence277 2609 1284 gene locus_tag LOCUS_19990 2609 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 2982 2788 gene locus_tag LOCUS_20000 2982 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 3790 3035 gene locus_tag LOCUS_20010 3790 3035 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence278 374 1306 gene locus_tag LOCUS_20020 374 1306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 protein_id gnl|my_center|LOCUS_20020 1303 3351 gene locus_tag LOCUS_20030 1303 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 4037 3354 gene locus_tag LOCUS_20040 4037 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence279 2034 97 gene locus_tag LOCUS_20050 2034 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3140 2034 gene locus_tag LOCUS_20060 3140 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3868 3140 gene locus_tag LOCUS_20070 3868 3140 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_20070 4750 3971 gene locus_tag LOCUS_20080 4750 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 <5832 4864 gene locus_tag LOCUS_20090 <5832 4864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704706.1:enterobactin non-ribosomal peptide synthetase EntF >Feature sequence280 133 1818 gene locus_tag LOCUS_20100 133 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 3247 1829 gene locus_tag LOCUS_20110 3247 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 4091 3390 gene locus_tag LOCUS_20120 4091 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 4777 4091 gene locus_tag LOCUS_20130 4777 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 5403 4774 gene locus_tag LOCUS_20140 5403 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 5630 5400 gene locus_tag LOCUS_20150 5630 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence281 1424 2491 gene locus_tag LOCUS_20160 1424 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2513 3748 gene locus_tag LOCUS_20170 2513 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 5663 5184 gene locus_tag LOCUS_20180 5663 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence282 261 551 gene locus_tag LOCUS_20190 gene groES 261 551 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171493.1 protein_id gnl|my_center|LOCUS_20190 633 2285 gene locus_tag LOCUS_20200 gene groL 633 2285 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_20200 2400 3200 gene locus_tag LOCUS_20210 2400 3200 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029956.1 protein_id gnl|my_center|LOCUS_20210 3210 4547 gene locus_tag LOCUS_20220 gene mgtE 3210 4547 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362548.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence283 443 1537 gene locus_tag LOCUS_20230 443 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1591 2766 gene locus_tag LOCUS_20240 1591 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 4913 2784 gene locus_tag LOCUS_20250 4913 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence284 5541 2092 gene locus_tag LOCUS_20260 gene recC 5541 2092 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence285 747 10 gene locus_tag LOCUS_20270 747 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2300 747 gene locus_tag LOCUS_20280 2300 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2798 2460 gene locus_tag LOCUS_20290 2798 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3887 2856 gene locus_tag LOCUS_20300 3887 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 4798 3848 gene locus_tag LOCUS_20310 4798 3848 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_20310 <5750 4810 gene locus_tag LOCUS_20320 <5750 4810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858299.1:NAD-dependent epimerase/dehydratase >Feature sequence286 <1 921 gene locus_tag LOCUS_20330 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707078.1:phosphoglucosamine mutase 1153 1890 gene locus_tag LOCUS_20340 gene pdxJ 1153 1890 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192885.1 protein_id gnl|my_center|LOCUS_20340 1887 3326 gene locus_tag LOCUS_20350 1887 3326 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403284.1 protein_id gnl|my_center|LOCUS_20350 5186 3678 gene locus_tag LOCUS_20360 5186 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence287 2896 1409 gene locus_tag LOCUS_20370 2896 1409 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_20370 4378 3023 gene locus_tag LOCUS_20380 4378 3023 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938380.1 protein_id gnl|my_center|LOCUS_20380 4710 4375 gene locus_tag LOCUS_20390 4710 4375 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790218.1 protein_id gnl|my_center|LOCUS_20390 <5720 4812 gene locus_tag LOCUS_20400 <5720 4812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031412.1:NADPH-dependent 2,4-dienoyl-CoA reductase >Feature sequence288 833 1933 gene locus_tag LOCUS_20410 833 1933 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468451.1 protein_id gnl|my_center|LOCUS_20410 1930 3816 gene locus_tag LOCUS_20420 1930 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 3921 4646 gene locus_tag LOCUS_20430 3921 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 <5707 5181 gene locus_tag LOCUS_20440 <5707 5181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000199879.1:HNH endonuclease >Feature sequence289 1136 831 gene locus_tag LOCUS_20450 1136 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2906 1140 gene locus_tag LOCUS_20460 2906 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 3002 5245 gene locus_tag LOCUS_20470 3002 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence290 2860 1154 gene locus_tag LOCUS_20480 2860 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 3561 2869 gene locus_tag LOCUS_20490 3561 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 3764 4075 gene locus_tag LOCUS_20500 3764 4075 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084574.1 protein_id gnl|my_center|LOCUS_20500 5102 4068 gene locus_tag LOCUS_20510 5102 4068 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence291 100 1821 gene locus_tag LOCUS_20520 gene rpoD 100 1821 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_20520 1838 1913 gene locus_tag LOCUS_t00310 1838 1913 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1969 2697 gene locus_tag LOCUS_20530 1969 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence292 585 3113 gene locus_tag LOCUS_20540 585 3113 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 protein_id gnl|my_center|LOCUS_20540 4812 3130 gene locus_tag LOCUS_20550 4812 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 5601 4840 gene locus_tag LOCUS_20560 5601 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence293 77 1954 gene locus_tag LOCUS_20570 77 1954 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_20570 1983 4835 gene locus_tag LOCUS_20580 1983 4835 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_20580 4832 5635 gene locus_tag LOCUS_20590 4832 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence294 112 390 gene locus_tag LOCUS_20600 112 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 387 1415 gene locus_tag LOCUS_20610 387 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 1440 2096 gene locus_tag LOCUS_20620 1440 2096 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140026.1 protein_id gnl|my_center|LOCUS_20620 2167 3399 gene locus_tag LOCUS_20630 2167 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 4284 3409 gene locus_tag LOCUS_20640 4284 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 4420 4938 gene locus_tag LOCUS_20650 4420 4938 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339035.1 protein_id gnl|my_center|LOCUS_20650 4935 5378 gene locus_tag LOCUS_20660 4935 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence295 77 1009 gene locus_tag LOCUS_20670 gene thiL 77 1009 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_20670 1006 2355 gene locus_tag LOCUS_20680 1006 2355 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_20680 2352 3566 gene locus_tag LOCUS_20690 2352 3566 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_20690 3569 5032 gene locus_tag LOCUS_20700 3569 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence296 553 2256 gene locus_tag LOCUS_20710 553 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2253 3170 gene locus_tag LOCUS_20720 2253 3170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_20720 3167 3967 gene locus_tag LOCUS_20730 3167 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4069 5019 gene locus_tag LOCUS_20740 4069 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 <5633 5071 gene locus_tag LOCUS_20750 <5633 5071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840191.1:M20/M25/M40 family metallo-hydrolase >Feature sequence297 29 394 gene locus_tag LOCUS_20760 29 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 642 854 gene locus_tag LOCUS_20770 642 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 950 2518 gene locus_tag LOCUS_20780 950 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2567 4006 gene locus_tag LOCUS_20790 2567 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 5539 4016 gene locus_tag LOCUS_20800 5539 4016 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350815.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence298 <1 1340 gene locus_tag LOCUS_20810 <1 1340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228902.1:PEGA domain-containing protein 1371 2582 gene locus_tag LOCUS_20820 1371 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2617 3438 gene locus_tag LOCUS_20830 2617 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 3435 4616 gene locus_tag LOCUS_20840 3435 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4616 5020 gene locus_tag LOCUS_20850 4616 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence299 918 352 gene locus_tag LOCUS_20860 918 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2001 922 gene locus_tag LOCUS_20870 2001 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2510 2001 gene locus_tag LOCUS_20880 2510 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3241 2507 gene locus_tag LOCUS_20890 3241 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3932 3369 gene locus_tag LOCUS_20900 3932 3369 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_20900 5334 4000 gene locus_tag LOCUS_20910 gene pduS 5334 4000 CDS product cobalamin reductase PduS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058762.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence300 1639 773 gene locus_tag LOCUS_20920 1639 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 3067 1664 gene locus_tag LOCUS_20930 gene asnS 3067 1664 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036745.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence301 289 1722 gene locus_tag LOCUS_20940 289 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 1755 2153 gene locus_tag LOCUS_20950 1755 2153 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942234.1 protein_id gnl|my_center|LOCUS_20950 2150 3115 gene locus_tag LOCUS_20960 gene truB 2150 3115 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_20960 3725 3141 gene locus_tag LOCUS_20970 3725 3141 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395055.1 protein_id gnl|my_center|LOCUS_20970 5571 4660 gene locus_tag LOCUS_20980 5571 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence302 448 2601 gene locus_tag LOCUS_20990 448 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2779 4149 gene locus_tag LOCUS_21000 2779 4149 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 protein_id gnl|my_center|LOCUS_21000 <5552 4130 gene locus_tag LOCUS_21010 <5552 4130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063907.1:DUF3604 domain-containing protein >Feature sequence303 1541 750 gene locus_tag LOCUS_21020 1541 750 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108275.1 protein_id gnl|my_center|LOCUS_21020 2431 1607 gene locus_tag LOCUS_21030 2431 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 4079 2526 gene locus_tag LOCUS_21040 4079 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 5033 4152 gene locus_tag LOCUS_21050 5033 4152 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence304 1355 3679 gene locus_tag LOCUS_21060 1355 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence305 453 220 gene locus_tag LOCUS_21070 453 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 385 1623 gene locus_tag LOCUS_21080 385 1623 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_21080 2061 1986 gene locus_tag LOCUS_t00320 2061 1986 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2307 3989 gene locus_tag LOCUS_21090 2307 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 4574 4005 gene locus_tag LOCUS_21100 4574 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 5368 4574 gene locus_tag LOCUS_21110 5368 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence306 324 73 gene locus_tag LOCUS_21120 324 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 663 397 gene locus_tag LOCUS_21130 663 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1442 660 gene locus_tag LOCUS_21140 1442 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1792 1439 gene locus_tag LOCUS_21150 1792 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2122 3018 gene locus_tag LOCUS_21160 2122 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 3084 4073 gene locus_tag LOCUS_21170 3084 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence307 1006 284 gene locus_tag LOCUS_21180 gene tpiA 1006 284 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_21180 2242 1043 gene locus_tag LOCUS_21190 2242 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21190 3263 2256 gene locus_tag LOCUS_21200 gene gap 3263 2256 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 protein_id gnl|my_center|LOCUS_21200 3363 4982 gene locus_tag LOCUS_21210 3363 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence308 109 1218 gene locus_tag LOCUS_21220 gene mraY 109 1218 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_21220 1218 2564 gene locus_tag LOCUS_21230 gene murD 1218 2564 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_21230 2561 3706 gene locus_tag LOCUS_21240 gene spoVE 2561 3706 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_21240 3716 5107 gene locus_tag LOCUS_21250 gene murC 3716 5107 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence309 1490 126 gene locus_tag LOCUS_21260 gene nusA 1490 126 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_21260 2067 1480 gene locus_tag LOCUS_21270 2067 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 3020 2190 gene locus_tag LOCUS_21280 3020 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 4317 2998 gene locus_tag LOCUS_21290 4317 2998 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_21290 5246 4314 gene locus_tag LOCUS_21300 5246 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence310 1667 51 gene locus_tag LOCUS_21310 1667 51 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_21310 2434 1700 gene locus_tag LOCUS_21320 gene kdsB 2434 1700 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931124.1 protein_id gnl|my_center|LOCUS_21320 2836 2441 gene locus_tag LOCUS_21330 gene rpsI 2836 2441 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035728.1 protein_id gnl|my_center|LOCUS_21330 3282 2848 gene locus_tag LOCUS_21340 gene rplM 3282 2848 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_21340 5329 3464 gene locus_tag LOCUS_21350 5329 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence311 1498 632 gene locus_tag LOCUS_21360 gene prmA 1498 632 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_21360 2787 1507 gene locus_tag LOCUS_21370 2787 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 3472 2969 gene locus_tag LOCUS_21380 gene smpB 3472 2969 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125925.1 protein_id gnl|my_center|LOCUS_21380 3973 4461 gene locus_tag LOCUS_21390 gene mraZ 3973 4461 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence312 834 1640 gene locus_tag LOCUS_21400 834 1640 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_21400 1637 2203 gene locus_tag LOCUS_21410 1637 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2200 3588 gene locus_tag LOCUS_21420 2200 3588 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_21420 5289 3601 gene locus_tag LOCUS_21430 gene nadB 5289 3601 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence313 >Feature sequence314 1218 2096 gene locus_tag LOCUS_21440 1218 2096 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_21440 2702 2103 gene locus_tag LOCUS_21450 2702 2103 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_21450 4971 3280 gene locus_tag LOCUS_21460 4971 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 5298 5026 gene locus_tag LOCUS_21470 5298 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence315 2021 1155 gene locus_tag LOCUS_21480 2021 1155 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 protein_id gnl|my_center|LOCUS_21480 4276 2060 gene locus_tag LOCUS_21490 4276 2060 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_21490 5317 4298 gene locus_tag LOCUS_21500 5317 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence316 3455 354 gene locus_tag LOCUS_21510 3455 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence317 782 2776 gene locus_tag LOCUS_21520 782 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2835 3875 gene locus_tag LOCUS_21530 2835 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 <5318 3909 gene locus_tag LOCUS_21540 <5318 3909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941639.1:ATP-binding protein >Feature sequence318 722 432 gene locus_tag LOCUS_21550 722 432 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_21550 2002 761 gene locus_tag LOCUS_21560 2002 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 3798 2011 gene locus_tag LOCUS_21570 gene secD 3798 2011 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_21570 4167 3802 gene locus_tag LOCUS_21580 4167 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 <5317 4172 gene locus_tag LOCUS_21590 <5317 4172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897970.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence319 334 1404 gene locus_tag LOCUS_21600 334 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2991 1477 gene locus_tag LOCUS_21610 gene cysS 2991 1477 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_21610 4354 3041 gene locus_tag LOCUS_21620 gene gltX 4354 3041 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810213.1 protein_id gnl|my_center|LOCUS_21620 4876 4391 gene locus_tag LOCUS_21630 4876 4391 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence320 379 1683 gene locus_tag LOCUS_21640 gene aroA 379 1683 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_21640 1680 2429 gene locus_tag LOCUS_21650 gene cmk 1680 2429 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_21650 2666 4423 gene locus_tag LOCUS_21660 2666 4423 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_21660 4522 4782 gene locus_tag LOCUS_21670 4522 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence321 1016 3 gene locus_tag LOCUS_21680 1016 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2731 1013 gene locus_tag LOCUS_21690 2731 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3167 2790 gene locus_tag LOCUS_21700 3167 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 3342 4553 gene locus_tag LOCUS_21710 3342 4553 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence322 314 1375 gene locus_tag LOCUS_21720 314 1375 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_21720 1746 2021 gene locus_tag LOCUS_21730 1746 2021 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940232.1 protein_id gnl|my_center|LOCUS_21730 2197 2823 gene locus_tag LOCUS_21740 2197 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2963 5155 gene locus_tag LOCUS_21750 2963 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence323 282 1220 gene locus_tag LOCUS_21760 282 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 1284 2153 gene locus_tag LOCUS_21770 1284 2153 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841164.1 protein_id gnl|my_center|LOCUS_21770 2218 4584 gene locus_tag LOCUS_21780 2218 4584 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_21780 5098 4592 gene locus_tag LOCUS_21790 5098 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence324 >Feature sequence325 33 983 gene locus_tag LOCUS_21800 33 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 996 2216 gene locus_tag LOCUS_21810 gene nrfD 996 2216 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541886.1 protein_id gnl|my_center|LOCUS_21810 2268 2918 gene locus_tag LOCUS_21820 2268 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 4113 2926 gene locus_tag LOCUS_21830 gene xseA 4113 2926 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958100.1 protein_id gnl|my_center|LOCUS_21830 <5219 4083 gene locus_tag LOCUS_21840 <5219 4083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797373.1:YfhO family protein >Feature sequence326 2856 2032 gene locus_tag LOCUS_21850 2856 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 4862 2856 gene locus_tag LOCUS_21860 4862 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence327 657 2189 gene locus_tag LOCUS_21870 657 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 4359 2167 gene locus_tag LOCUS_21880 4359 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 4607 4356 gene locus_tag LOCUS_21890 4607 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence328 4785 1660 gene locus_tag LOCUS_21900 4785 1660 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence329 133 513 gene locus_tag LOCUS_21910 133 513 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392679.1 protein_id gnl|my_center|LOCUS_21910 510 1229 gene locus_tag LOCUS_21920 510 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1226 2575 gene locus_tag LOCUS_21930 1226 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2701 3222 gene locus_tag LOCUS_21940 2701 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 3264 3998 gene locus_tag LOCUS_21950 3264 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 4761 3979 gene locus_tag LOCUS_21960 4761 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence330 1489 3537 gene locus_tag LOCUS_21970 1489 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 4569 3550 gene locus_tag LOCUS_21980 4569 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 4732 5028 gene locus_tag LOCUS_21990 4732 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence331 1796 750 gene locus_tag LOCUS_22000 1796 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 4851 1834 gene locus_tag LOCUS_22010 4851 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence332 807 1046 gene locus_tag LOCUS_22020 807 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1043 2308 gene locus_tag LOCUS_22030 1043 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2385 2870 gene locus_tag LOCUS_22040 2385 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2919 3365 gene locus_tag LOCUS_22050 2919 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 3379 4803 gene locus_tag LOCUS_22060 gene purB 3379 4803 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085600.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence333 1122 2876 gene locus_tag LOCUS_22070 1122 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 4397 2886 gene locus_tag LOCUS_22080 4397 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144206.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence334 1155 1343 gene locus_tag LOCUS_22090 1155 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 1948 1277 gene locus_tag LOCUS_22100 1948 1277 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_22100 3530 2424 gene locus_tag LOCUS_22110 3530 2424 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_22110 5020 3683 gene locus_tag LOCUS_22120 5020 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence335 2365 242 gene locus_tag LOCUS_22130 2365 242 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421549.1 protein_id gnl|my_center|LOCUS_22130 3481 2405 gene locus_tag LOCUS_22140 gene bcd 3481 2405 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_22140 5050 3557 gene locus_tag LOCUS_22150 5050 3557 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence336 143 793 gene locus_tag LOCUS_22160 143 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 913 1482 gene locus_tag LOCUS_22170 913 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 3253 1490 gene locus_tag LOCUS_22180 gene argS 3253 1490 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016438.1 protein_id gnl|my_center|LOCUS_22180 3807 3364 gene locus_tag LOCUS_22190 3807 3364 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_22190 <5113 4020 gene locus_tag LOCUS_22200 <5113 4020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944609.1:acyl-CoA dehydrogenase family protein >Feature sequence337 86 625 gene locus_tag LOCUS_22210 86 625 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_22210 1459 635 gene locus_tag LOCUS_22220 1459 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1537 2856 gene locus_tag LOCUS_22230 1537 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2853 4025 gene locus_tag LOCUS_22240 2853 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 5107 4004 gene locus_tag LOCUS_22250 5107 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence338 1370 189 gene locus_tag LOCUS_22260 1370 189 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228574.1 protein_id gnl|my_center|LOCUS_22260 3785 1398 gene locus_tag LOCUS_22270 3785 1398 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272544.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence339 2517 1135 gene locus_tag LOCUS_22280 2517 1135 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_22280 4909 2687 gene locus_tag LOCUS_22290 4909 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence340 1669 1484 gene locus_tag LOCUS_22300 1669 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 3177 1786 gene locus_tag LOCUS_22310 3177 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence341 871 1689 gene locus_tag LOCUS_22320 871 1689 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_22320 1740 2756 gene locus_tag LOCUS_22330 1740 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 3198 2776 gene locus_tag LOCUS_22340 gene ruvX 3198 2776 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171591.1 protein_id gnl|my_center|LOCUS_22340 3267 4511 gene locus_tag LOCUS_22350 3267 4511 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070644.1 protein_id gnl|my_center|LOCUS_22350 4851 4537 gene locus_tag LOCUS_22360 4851 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence342 507 133 gene locus_tag LOCUS_22370 507 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1253 504 gene locus_tag LOCUS_22380 1253 504 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_22380 2134 1271 gene locus_tag LOCUS_22390 2134 1271 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245492.1 protein_id gnl|my_center|LOCUS_22390 2204 2935 gene locus_tag LOCUS_22400 2204 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3423 2932 gene locus_tag LOCUS_22410 3423 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3813 3433 gene locus_tag LOCUS_22420 gene tolR 3813 3433 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_22420 4569 3889 gene locus_tag LOCUS_22430 4569 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence343 147 1325 gene locus_tag LOCUS_22440 147 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2208 1303 gene locus_tag LOCUS_22450 2208 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3073 2222 gene locus_tag LOCUS_22460 3073 2222 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_22460 4340 3126 gene locus_tag LOCUS_22470 4340 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 <5005 4384 gene locus_tag LOCUS_22480 <5005 4384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052279209.1:multiheme c-type cytochrome >Feature sequence344 1561 68 gene locus_tag LOCUS_22490 1561 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1935 1558 gene locus_tag LOCUS_22500 1935 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2724 2038 gene locus_tag LOCUS_22510 2724 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 4433 2913 gene locus_tag LOCUS_22520 4433 2913 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943547.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence345 473 1138 gene locus_tag LOCUS_22530 473 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 1235 1648 gene locus_tag LOCUS_22540 1235 1648 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256140.1 protein_id gnl|my_center|LOCUS_22540 2485 1667 gene locus_tag LOCUS_22550 2485 1667 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_22550 3300 2482 gene locus_tag LOCUS_22560 3300 2482 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_22560 3805 3323 gene locus_tag LOCUS_22570 3805 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3940 4269 gene locus_tag LOCUS_22580 3940 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 4436 4263 gene locus_tag LOCUS_22590 4436 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence346 <1 1018 gene locus_tag LOCUS_22600 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980496.1:PTO1314 family radical SAM protein 1429 2232 gene locus_tag LOCUS_22610 1429 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2894 2244 gene locus_tag LOCUS_22620 2894 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3769 2891 gene locus_tag LOCUS_22630 3769 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence347 824 1093 gene locus_tag LOCUS_22640 824 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2025 1105 gene locus_tag LOCUS_22650 gene lgt 2025 1105 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_22650 2103 2942 gene locus_tag LOCUS_22660 gene asd 2103 2942 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063853.1 protein_id gnl|my_center|LOCUS_22660 3061 3912 gene locus_tag LOCUS_22670 3061 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4980 3931 gene locus_tag LOCUS_22680 gene aspC 4980 3931 CDS product aspartate/prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227669.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence348 23 574 gene locus_tag LOCUS_22690 23 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 619 1083 gene locus_tag LOCUS_22700 619 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 1202 3562 gene locus_tag LOCUS_22710 1202 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3559 4233 gene locus_tag LOCUS_22720 3559 4233 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_22720 4427 4849 gene locus_tag LOCUS_22730 4427 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence349 833 1984 gene locus_tag LOCUS_22740 833 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 <4970 1996 gene locus_tag LOCUS_22750 <4970 1996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000482288.1:M36 family metallopeptidase >Feature sequence350 1383 850 gene locus_tag LOCUS_22760 gene nrdR 1383 850 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_22760 2636 1380 gene locus_tag LOCUS_22770 2636 1380 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035930.1 protein_id gnl|my_center|LOCUS_22770 3142 2696 gene locus_tag LOCUS_22780 gene rpiB 3142 2696 CDS product bifunctional allose-6-phosphate isomerase/ribose-5-phosphate isomerase RpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716792.1 protein_id gnl|my_center|LOCUS_22780 4401 3139 gene locus_tag LOCUS_22790 gene fabF 4401 3139 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_22790 4679 4422 gene locus_tag LOCUS_22800 gene acpP 4679 4422 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381096.1 protein_id gnl|my_center|LOCUS_22800 4952 4770 gene locus_tag LOCUS_22810 gene rpmF 4952 4770 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence351 1235 447 gene locus_tag LOCUS_22820 1235 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2149 1232 gene locus_tag LOCUS_22830 2149 1232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_22830 2267 4087 gene locus_tag LOCUS_22840 2267 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence352 165 1604 gene locus_tag LOCUS_22850 165 1604 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930810.1 protein_id gnl|my_center|LOCUS_22850 2220 1624 gene locus_tag LOCUS_22860 2220 1624 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640290.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22860 2343 4385 gene locus_tag LOCUS_22870 2343 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 <4943 4402 gene locus_tag LOCUS_22880 <4943 4402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943641.1:ribosome biogenesis GTP-binding protein YihA/YsxC >Feature sequence353 <1 700 gene locus_tag LOCUS_22890 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha 1594 710 gene locus_tag LOCUS_22900 1594 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2337 1597 gene locus_tag LOCUS_22910 2337 1597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_22910 3862 2372 gene locus_tag LOCUS_22920 3862 2372 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943972.1 protein_id gnl|my_center|LOCUS_22920 4750 3902 gene locus_tag LOCUS_22930 gene lepB 4750 3902 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence354 1024 122 gene locus_tag LOCUS_22940 1024 122 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_22940 1901 1029 gene locus_tag LOCUS_22950 1901 1029 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_22950 1963 2439 gene locus_tag LOCUS_22960 1963 2439 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 protein_id gnl|my_center|LOCUS_22960 2432 2998 gene locus_tag LOCUS_22970 2432 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 3884 2985 gene locus_tag LOCUS_22980 3884 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 <4942 3964 gene locus_tag LOCUS_22990 <4942 3964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803854.1:glycosyltransferase family 4 protein >Feature sequence355 726 130 gene locus_tag LOCUS_23000 726 130 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943304.1 protein_id gnl|my_center|LOCUS_23000 3051 1378 gene locus_tag LOCUS_23010 3051 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3140 4732 gene locus_tag LOCUS_23020 3140 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence356 1142 3 gene locus_tag LOCUS_23030 1142 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1348 2556 gene locus_tag LOCUS_23040 1348 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2558 3661 gene locus_tag LOCUS_23050 gene serC 2558 3661 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_23050 4513 3686 gene locus_tag LOCUS_23060 4513 3686 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262214.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence357 <1 746 gene locus_tag LOCUS_23070 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339612.1:phage portal protein 743 1951 gene locus_tag LOCUS_23080 743 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 1953 2330 gene locus_tag LOCUS_23090 1953 2330 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339610.1 protein_id gnl|my_center|LOCUS_23090 2333 3340 gene locus_tag LOCUS_23100 2333 3340 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339609.1 protein_id gnl|my_center|LOCUS_23100 3345 3632 gene locus_tag LOCUS_23110 3345 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 3640 4083 gene locus_tag LOCUS_23120 3640 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 4089 4253 gene locus_tag LOCUS_23130 4089 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence358 74 514 gene locus_tag LOCUS_23140 74 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 759 2423 gene locus_tag LOCUS_23150 759 2423 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942841.1 protein_id gnl|my_center|LOCUS_23150 3866 2514 gene locus_tag LOCUS_23160 3866 2514 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence359 1011 3515 gene locus_tag LOCUS_23170 gene xcpQ 1011 3515 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence360 225 1484 gene locus_tag LOCUS_23180 225 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2379 1492 gene locus_tag LOCUS_23190 2379 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_23190 3256 2426 gene locus_tag LOCUS_23200 3256 2426 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421551.1 protein_id gnl|my_center|LOCUS_23200 3406 4419 gene locus_tag LOCUS_23210 3406 4419 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939306.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence361 125 1906 gene locus_tag LOCUS_23220 125 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 1964 2362 gene locus_tag LOCUS_23230 1964 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence362 <4890 3411 gene locus_tag LOCUS_23240 <4890 3411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012843245.1:TrkH family potassium uptake protein >Feature sequence363 117 893 gene locus_tag LOCUS_23250 117 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1524 904 gene locus_tag LOCUS_23260 1524 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1644 2513 gene locus_tag LOCUS_23270 1644 2513 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_23270 4520 2709 gene locus_tag LOCUS_23280 4520 2709 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389868.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence364 75 710 gene locus_tag LOCUS_23290 75 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 935 1408 gene locus_tag LOCUS_23300 935 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2083 1379 gene locus_tag LOCUS_23310 2083 1379 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_23310 4763 2142 gene locus_tag LOCUS_23320 gene clpB 4763 2142 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence365 971 2272 gene locus_tag LOCUS_23330 971 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2316 2714 gene locus_tag LOCUS_23340 gene mutT 2316 2714 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_23340 4116 2725 gene locus_tag LOCUS_23350 4116 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 <4847 4126 gene locus_tag LOCUS_23360 <4847 4126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339275.1:carbon-nitrogen hydrolase family protein >Feature sequence366 1017 208 gene locus_tag LOCUS_23370 1017 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2242 1010 gene locus_tag LOCUS_23380 gene fabF 2242 1010 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 protein_id gnl|my_center|LOCUS_23380 4334 2256 gene locus_tag LOCUS_23390 4334 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 4662 4381 gene locus_tag LOCUS_23400 4662 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence367 2013 100 gene locus_tag LOCUS_23410 2013 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 4502 2010 gene locus_tag LOCUS_23420 4502 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence368 526 735 gene locus_tag LOCUS_23430 526 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 736 1557 gene locus_tag LOCUS_23440 736 1557 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_23440 1560 3122 gene locus_tag LOCUS_23450 gene dnaK 1560 3122 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_23450 4013 3132 gene locus_tag LOCUS_23460 4013 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 4713 4006 gene locus_tag LOCUS_23470 4713 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence369 1430 330 gene locus_tag LOCUS_23480 1430 330 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914065.1 protein_id gnl|my_center|LOCUS_23480 2197 1526 gene locus_tag LOCUS_23490 2197 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2632 2252 gene locus_tag LOCUS_23500 2632 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 <4804 2636 gene locus_tag LOCUS_23510 <4804 2636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541506.1:translation initiation factor IF-2 >Feature sequence370 860 1333 gene locus_tag LOCUS_23520 860 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2601 1492 gene locus_tag LOCUS_23530 2601 1492 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389856.1 protein_id gnl|my_center|LOCUS_23530 2662 3483 gene locus_tag LOCUS_23540 2662 3483 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869807.1 protein_id gnl|my_center|LOCUS_23540 3563 4741 gene locus_tag LOCUS_23550 3563 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence371 16 1464 gene locus_tag LOCUS_23560 16 1464 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_23560 1467 1775 gene locus_tag LOCUS_23570 1467 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1967 2905 gene locus_tag LOCUS_23580 1967 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 4241 2931 gene locus_tag LOCUS_23590 4241 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 <4791 4238 gene locus_tag LOCUS_23600 <4791 4238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383077.1:glutathione synthase >Feature sequence372 1590 403 gene locus_tag LOCUS_23610 1590 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 1733 3169 gene locus_tag LOCUS_23620 1733 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 3166 4542 gene locus_tag LOCUS_23630 3166 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence373 1171 350 gene locus_tag LOCUS_23640 1171 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2127 1333 gene locus_tag LOCUS_23650 2127 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 2765 2235 gene locus_tag LOCUS_23660 2765 2235 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339035.1 protein_id gnl|my_center|LOCUS_23660 4462 2762 gene locus_tag LOCUS_23670 4462 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence374 3849 394 gene locus_tag LOCUS_23680 3849 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence375 >Feature sequence376 14 1264 gene locus_tag LOCUS_23690 14 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 1276 2331 gene locus_tag LOCUS_23700 1276 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2943 2344 gene locus_tag LOCUS_23710 2943 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 3013 4029 gene locus_tag LOCUS_23720 3013 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence377 3494 4576 gene locus_tag LOCUS_23730 gene amrS 3494 4576 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence378 293 1168 gene locus_tag LOCUS_23740 293 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2324 1173 gene locus_tag LOCUS_23750 2324 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2530 2955 gene locus_tag LOCUS_23760 2530 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2952 3560 gene locus_tag LOCUS_23770 2952 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence379 2271 1138 gene locus_tag LOCUS_23780 2271 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2945 2268 gene locus_tag LOCUS_23790 2945 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3559 2942 gene locus_tag LOCUS_23800 3559 2942 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028140.1 protein_id gnl|my_center|LOCUS_23800 4292 3645 gene locus_tag LOCUS_23810 4292 3645 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024137.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence380 1054 119 gene locus_tag LOCUS_23820 1054 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1242 2726 gene locus_tag LOCUS_23830 1242 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2805 3119 gene locus_tag LOCUS_23840 2805 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3119 4225 gene locus_tag LOCUS_23850 3119 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 4222 4560 gene locus_tag LOCUS_23860 4222 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence381 1071 3413 gene locus_tag LOCUS_23870 1071 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 3445 3996 gene locus_tag LOCUS_23880 3445 3996 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence382 1565 183 gene locus_tag LOCUS_23890 1565 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2405 1608 gene locus_tag LOCUS_23900 2405 1608 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_23900 3631 2402 gene locus_tag LOCUS_23910 3631 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence383 1097 2770 gene locus_tag LOCUS_23920 1097 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence384 512 2425 gene locus_tag LOCUS_23930 512 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2529 4616 gene locus_tag LOCUS_23940 2529 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence385 >Feature sequence386 <1 3835 gene locus_tag LOCUS_23950 <1 3835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484145.1:type I polyketide synthase >Feature sequence387 544 341 gene locus_tag LOCUS_23960 544 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 1662 541 gene locus_tag LOCUS_23970 1662 541 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947729.1 protein_id gnl|my_center|LOCUS_23970 3346 1784 gene locus_tag LOCUS_23980 3346 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 4654 3500 gene locus_tag LOCUS_23990 4654 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence388 3 773 gene locus_tag LOCUS_24000 3 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 1751 804 gene locus_tag LOCUS_24010 1751 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 1918 3747 gene locus_tag LOCUS_24020 1918 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence389 331 1896 gene locus_tag LOCUS_24030 331 1896 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720404.1 protein_id gnl|my_center|LOCUS_24030 1906 3366 gene locus_tag LOCUS_24040 1906 3366 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720403.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence390 <1 2796 gene locus_tag LOCUS_24050 <1 2796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202237.1:insulinase family protein 3705 2785 gene locus_tag LOCUS_24060 3705 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 3844 4533 gene locus_tag LOCUS_24070 3844 4533 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence391 62 982 gene locus_tag LOCUS_24080 62 982 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_24080 2297 996 gene locus_tag LOCUS_24090 2297 996 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_24090 3714 2287 gene locus_tag LOCUS_24100 3714 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 4344 3739 gene locus_tag LOCUS_24110 4344 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence392 <1 2162 gene locus_tag LOCUS_24120 <1 2162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889498.1:adenosylcobinamide-GDP ribazoletransferase 2159 3946 gene locus_tag LOCUS_24130 2159 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence393 2266 656 gene locus_tag LOCUS_24140 2266 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 3594 2263 gene locus_tag LOCUS_24150 3594 2263 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460239.1 protein_id gnl|my_center|LOCUS_24150 <4611 3591 gene locus_tag LOCUS_24160 <4611 3591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392522.1:2-hydroxyacyl-CoA dehydratase family protein >Feature sequence394 331 2109 gene locus_tag LOCUS_24170 331 2109 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_24170 2109 2594 gene locus_tag LOCUS_24180 2109 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2591 3211 gene locus_tag LOCUS_24190 gene coaE 2591 3211 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_24190 3723 3205 gene locus_tag LOCUS_24200 3723 3205 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_24200 4547 3768 gene locus_tag LOCUS_24210 gene surE 4547 3768 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence395 2149 1277 gene locus_tag LOCUS_24220 gene ttcA 2149 1277 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706151.1 protein_id gnl|my_center|LOCUS_24220 2199 3146 gene locus_tag LOCUS_24230 2199 3146 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence396 2825 1848 gene locus_tag LOCUS_24240 gene amrS 2825 1848 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870318.1 protein_id gnl|my_center|LOCUS_24240 2916 3818 gene locus_tag LOCUS_24250 2916 3818 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_24250 4279 3791 gene locus_tag LOCUS_24260 gene greB 4279 3791 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174758.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence397 887 2719 gene locus_tag LOCUS_24270 887 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence398 3800 189 gene locus_tag LOCUS_24280 3800 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence399 <1 752 gene locus_tag LOCUS_24290 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530110.1:acyl-CoA dehydrogenase family protein 749 2041 gene locus_tag LOCUS_24300 749 2041 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940922.1 protein_id gnl|my_center|LOCUS_24300 2077 3819 gene locus_tag LOCUS_24310 2077 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 4560 3856 gene locus_tag LOCUS_24320 4560 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence400 <1 1087 gene locus_tag LOCUS_24330 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940947.1:cytochrome c3 family protein 1101 2057 gene locus_tag LOCUS_24340 1101 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2061 4112 gene locus_tag LOCUS_24350 2061 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence401 774 94 gene locus_tag LOCUS_24360 774 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 896 1582 gene locus_tag LOCUS_24370 896 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 1579 2223 gene locus_tag LOCUS_24380 1579 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 3010 2231 gene locus_tag LOCUS_24390 3010 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 4515 3025 gene locus_tag LOCUS_24400 gene proS 4515 3025 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence402 1686 2402 gene locus_tag LOCUS_24410 1686 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2489 3397 gene locus_tag LOCUS_24420 2489 3397 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_24420 4372 3443 gene locus_tag LOCUS_24430 4372 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence403 2656 1433 gene locus_tag LOCUS_24440 2656 1433 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_24440 4507 2792 gene locus_tag LOCUS_24450 gene pilB 4507 2792 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence404 2314 488 gene locus_tag LOCUS_24460 2314 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 4414 2324 gene locus_tag LOCUS_24470 4414 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence405 92 1837 gene locus_tag LOCUS_24480 92 1837 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_24480 1897 2289 gene locus_tag LOCUS_24490 1897 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 2371 2607 gene locus_tag LOCUS_24500 2371 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence406 1141 1965 gene locus_tag LOCUS_24510 1141 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence407 585 1433 gene locus_tag LOCUS_24520 585 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1430 2401 gene locus_tag LOCUS_24530 1430 2401 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_24530 2458 3243 gene locus_tag LOCUS_24540 2458 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 4339 3296 gene locus_tag LOCUS_24550 4339 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence408 1348 143 gene locus_tag LOCUS_24560 1348 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 3531 1444 gene locus_tag LOCUS_24570 gene fusA 3531 1444 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_24570 4473 3676 gene locus_tag LOCUS_24580 4473 3676 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence409 1686 424 gene locus_tag LOCUS_24590 1686 424 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_24590 3246 1705 gene locus_tag LOCUS_24600 3246 1705 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280517.1 protein_id gnl|my_center|LOCUS_24600 4355 3243 gene locus_tag LOCUS_24610 gene ygeW 4355 3243 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978544.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence410 1424 1864 gene locus_tag LOCUS_24620 1424 1864 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326238.1 protein_id gnl|my_center|LOCUS_24620 1861 2289 gene locus_tag LOCUS_24630 1861 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 3084 2296 gene locus_tag LOCUS_24640 3084 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 3665 3081 gene locus_tag LOCUS_24650 3665 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 3840 4406 gene locus_tag LOCUS_24660 3840 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence411 <1 1908 gene locus_tag LOCUS_24670 <1 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114402.1:type I restriction endonuclease subunit R 2215 3405 gene locus_tag LOCUS_24680 gene megL 2215 3405 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence412 4 321 gene locus_tag LOCUS_24690 4 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1470 343 gene locus_tag LOCUS_24700 1470 343 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_24700 2237 1515 gene locus_tag LOCUS_24710 2237 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 3235 2243 gene locus_tag LOCUS_24720 3235 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 3789 3490 gene locus_tag LOCUS_24730 3789 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 4482 3865 gene locus_tag LOCUS_24740 4482 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence413 1009 680 gene locus_tag LOCUS_24750 1009 680 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144365.1 protein_id gnl|my_center|LOCUS_24750 1421 1035 gene locus_tag LOCUS_24760 gene iscU 1421 1035 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299770.1 protein_id gnl|my_center|LOCUS_24760 2687 1464 gene locus_tag LOCUS_24770 2687 1464 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_24770 3216 2722 gene locus_tag LOCUS_24780 3216 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence414 970 1980 gene locus_tag LOCUS_24790 970 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1984 2979 gene locus_tag LOCUS_24800 1984 2979 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397825.1 protein_id gnl|my_center|LOCUS_24800 2976 3419 gene locus_tag LOCUS_24810 2976 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3416 4036 gene locus_tag LOCUS_24820 3416 4036 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence415 635 1474 gene locus_tag LOCUS_24830 635 1474 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939306.1 protein_id gnl|my_center|LOCUS_24830 1474 1995 gene locus_tag LOCUS_24840 1474 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038870.1 protein_id gnl|my_center|LOCUS_24840 4381 2057 gene locus_tag LOCUS_24850 4381 2057 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804532.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence416 349 264 gene locus_tag LOCUS_t00330 349 264 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2457 541 gene locus_tag LOCUS_24860 2457 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence417 321 1301 gene locus_tag LOCUS_24870 321 1301 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388866.1 protein_id gnl|my_center|LOCUS_24870 2401 1352 gene locus_tag LOCUS_24880 2401 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 2808 2515 gene locus_tag LOCUS_24890 2808 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 4315 2930 gene locus_tag LOCUS_24900 4315 2930 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791400.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence418 <1 1554 gene locus_tag LOCUS_24910 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258358.1:TlpA disulfide reductase family protein 1587 3851 gene locus_tag LOCUS_24920 1587 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence419 <1 1159 gene locus_tag LOCUS_24930 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258379.1:glycosyltransferase family 4 protein 1169 2545 gene locus_tag LOCUS_24940 1169 2545 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_24940 2618 3247 gene locus_tag LOCUS_24950 2618 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence420 515 3412 gene locus_tag LOCUS_24960 515 3412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037703.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence421 169 786 gene locus_tag LOCUS_24970 169 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 786 2135 gene locus_tag LOCUS_24980 786 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence422 <1 1578 gene locus_tag LOCUS_24990 <1 1578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha 1643 2455 gene locus_tag LOCUS_25000 1643 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2452 3471 gene locus_tag LOCUS_25010 2452 3471 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence423 989 2782 gene locus_tag LOCUS_25020 989 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2779 3345 gene locus_tag LOCUS_25030 gene coaC 2779 3345 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287045.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence424 439 23 gene locus_tag LOCUS_25040 439 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1444 530 gene locus_tag LOCUS_25050 1444 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2154 1546 gene locus_tag LOCUS_25060 2154 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2351 3784 gene locus_tag LOCUS_25070 2351 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence425 3098 1164 gene locus_tag LOCUS_25080 3098 1164 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_25080 <4405 3132 gene locus_tag LOCUS_25090 <4405 3132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002354922.1:Stp1/IreP family PP2C-type Ser/Thr phosphatase >Feature sequence426 240 1586 gene locus_tag LOCUS_25100 240 1586 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403007.1 protein_id gnl|my_center|LOCUS_25100 2070 1597 gene locus_tag LOCUS_25110 2070 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2576 2067 gene locus_tag LOCUS_25120 2576 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 4105 2573 gene locus_tag LOCUS_25130 4105 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence427 167 781 gene locus_tag LOCUS_25140 167 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_25140 867 1160 gene locus_tag LOCUS_25150 gene eutM 867 1160 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_25150 1167 1490 gene locus_tag LOCUS_25160 1167 1490 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_25160 1490 2905 gene locus_tag LOCUS_25170 1490 2905 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075682.1 protein_id gnl|my_center|LOCUS_25170 2909 3502 gene locus_tag LOCUS_25180 2909 3502 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810294.1 protein_id gnl|my_center|LOCUS_25180 3502 3798 gene locus_tag LOCUS_25190 3502 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 3795 4112 gene locus_tag LOCUS_25200 3795 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence428 613 1674 gene locus_tag LOCUS_25210 613 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 3933 1684 gene locus_tag LOCUS_25220 3933 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence429 565 2139 gene locus_tag LOCUS_25230 565 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2142 3104 gene locus_tag LOCUS_25240 2142 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 3240 4241 gene locus_tag LOCUS_25250 3240 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence430 624 28 gene locus_tag LOCUS_25260 624 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 914 2053 gene locus_tag LOCUS_25270 914 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 2050 2886 gene locus_tag LOCUS_25280 2050 2886 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772902.1 protein_id gnl|my_center|LOCUS_25280 2985 3497 gene locus_tag LOCUS_25290 2985 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 3772 3545 gene locus_tag LOCUS_25300 3772 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 4179 3775 gene locus_tag LOCUS_25310 4179 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence431 2434 2000 gene locus_tag LOCUS_25320 2434 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2662 3834 gene locus_tag LOCUS_25330 2662 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence432 2225 1422 gene locus_tag LOCUS_25340 2225 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 4210 2423 gene locus_tag LOCUS_25350 4210 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence433 1782 28 gene locus_tag LOCUS_25360 1782 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2780 1824 gene locus_tag LOCUS_25370 2780 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 <4313 2830 gene locus_tag LOCUS_25380 <4313 2830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922487.1:sulfatase >Feature sequence434 88 678 gene locus_tag LOCUS_25390 88 678 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729980.1 protein_id gnl|my_center|LOCUS_25390 1236 694 gene locus_tag LOCUS_25400 1236 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 1340 2836 gene locus_tag LOCUS_25410 1340 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 3499 2855 gene locus_tag LOCUS_25420 3499 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071652.1 protein_id gnl|my_center|LOCUS_25420 4269 3496 gene locus_tag LOCUS_25430 4269 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence435 220 1218 gene locus_tag LOCUS_25440 220 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 1215 1826 gene locus_tag LOCUS_25450 1215 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1847 2353 gene locus_tag LOCUS_25460 gene greA 1847 2353 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_25460 2350 2997 gene locus_tag LOCUS_25470 gene tmk 2350 2997 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039005.1 protein_id gnl|my_center|LOCUS_25470 3914 3003 gene locus_tag LOCUS_25480 3914 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence436 1948 524 gene locus_tag LOCUS_25490 1948 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3399 1918 gene locus_tag LOCUS_25500 3399 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 4059 3433 gene locus_tag LOCUS_25510 gene lexA 4059 3433 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940718.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence437 785 710 gene locus_tag LOCUS_t00340 785 710 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 870 795 gene locus_tag LOCUS_t00350 870 795 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1741 944 gene locus_tag LOCUS_25520 1741 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2836 1751 gene locus_tag LOCUS_25530 2836 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25530 2987 3916 gene locus_tag LOCUS_25540 2987 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence438 819 2351 gene locus_tag LOCUS_25550 819 2351 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258512.1 protein_id gnl|my_center|LOCUS_25550 2892 2365 gene locus_tag LOCUS_25560 2892 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2986 4236 gene locus_tag LOCUS_25570 2986 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 >Feature sequence439 <1 738 gene locus_tag LOCUS_25580 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545517.1:phosphate signaling complex protein PhoU 970 1665 gene locus_tag LOCUS_25590 970 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 2215 1640 gene locus_tag LOCUS_25600 2215 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 <4276 2245 gene locus_tag LOCUS_25610 <4276 2245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083434862.1:VCBS repeat-containing protein >Feature sequence440 <1 961 gene locus_tag LOCUS_25620 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903126.1:site-specific DNA-methyltransferase 1837 1427 gene locus_tag LOCUS_25630 1837 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3260 1992 gene locus_tag LOCUS_25640 gene guaD 3260 1992 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920470.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence441 <1 1202 gene locus_tag LOCUS_25650 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928646.1:FG-GAP-like repeat-containing protein >Feature sequence442 977 288 gene locus_tag LOCUS_25660 977 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2352 988 gene locus_tag LOCUS_25670 2352 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 <4263 2353 gene locus_tag LOCUS_25680 <4263 2353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921441.1:cadherin domain-containing protein >Feature sequence443 942 1379 gene locus_tag LOCUS_25690 942 1379 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 protein_id gnl|my_center|LOCUS_25690 2831 1389 gene locus_tag LOCUS_25700 2831 1389 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108522916.1 protein_id gnl|my_center|LOCUS_25700 3274 2828 gene locus_tag LOCUS_25710 3274 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 4101 3271 gene locus_tag LOCUS_25720 4101 3271 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223811.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence444 107 1132 gene locus_tag LOCUS_25730 gene mvaD 107 1132 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_25730 1125 2021 gene locus_tag LOCUS_25740 1125 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2031 3110 gene locus_tag LOCUS_25750 gene fni 2031 3110 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904022.1 protein_id gnl|my_center|LOCUS_25750 3127 3654 gene locus_tag LOCUS_25760 gene bcp 3127 3654 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence445 1014 2087 gene locus_tag LOCUS_25770 1014 2087 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_25770 3971 2160 gene locus_tag LOCUS_25780 gene thrS 3971 2160 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869471.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence446 1739 381 gene locus_tag LOCUS_25790 gene glrR 1739 381 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 protein_id gnl|my_center|LOCUS_25790 3288 1771 gene locus_tag LOCUS_25800 3288 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 4139 3285 gene locus_tag LOCUS_25810 gene rsmA 4139 3285 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence447 <1 670 gene locus_tag LOCUS_25820 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043629133.1:carbamoyltransferase HypF 674 949 gene locus_tag LOCUS_25830 674 949 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_25830 946 2028 gene locus_tag LOCUS_25840 gene hypD 946 2028 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_25840 2025 3020 gene locus_tag LOCUS_25850 gene hypE 2025 3020 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_25850 3020 3364 gene locus_tag LOCUS_25860 3020 3364 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889575.1 protein_id gnl|my_center|LOCUS_25860 3428 4150 gene locus_tag LOCUS_25870 gene hypB 3428 4150 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_25870 >Feature sequence448 203 961 gene locus_tag LOCUS_25880 203 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 978 2114 gene locus_tag LOCUS_25890 978 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 2205 3731 gene locus_tag LOCUS_25900 2205 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence449 356 2137 gene locus_tag LOCUS_25910 356 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 2134 3447 gene locus_tag LOCUS_25920 2134 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 <4226 3455 gene locus_tag LOCUS_25930 <4226 3455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein >Feature sequence450 2635 71 gene locus_tag LOCUS_25940 gene mutS 2635 71 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_25940 3829 2645 gene locus_tag LOCUS_25950 3829 2645 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence451 1487 342 gene locus_tag LOCUS_25960 1487 342 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891441.1 protein_id gnl|my_center|LOCUS_25960 3299 1551 gene locus_tag LOCUS_25970 3299 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence452 707 1111 gene locus_tag LOCUS_25980 gene queD 707 1111 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008576903.1 protein_id gnl|my_center|LOCUS_25980 3074 1122 gene locus_tag LOCUS_25990 3074 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 <4201 3086 gene locus_tag LOCUS_26000 <4201 3086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728358.1:acyl-CoA dehydrogenase family protein >Feature sequence453 145 927 gene locus_tag LOCUS_26010 145 927 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489429.1 protein_id gnl|my_center|LOCUS_26010 946 1593 gene locus_tag LOCUS_26020 946 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1600 2178 gene locus_tag LOCUS_26030 gene thpR 1600 2178 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_26030 3093 2314 gene locus_tag LOCUS_26040 3093 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 4133 3093 gene locus_tag LOCUS_26050 4133 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence454 155 1915 gene locus_tag LOCUS_26060 155 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence455 <1 3246 gene locus_tag LOCUS_26070 <1 3246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940252.1:glycosyltransferase 3781 3248 gene locus_tag LOCUS_26080 3781 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence456 575 2110 gene locus_tag LOCUS_26090 575 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2174 3610 gene locus_tag LOCUS_26100 2174 3610 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence457 <1 1871 gene locus_tag LOCUS_26110 <1 1871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200580.1:beta-prism lectin domain-containing protein 1926 3929 gene locus_tag LOCUS_26120 1926 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 4146 3934 gene locus_tag LOCUS_26130 4146 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence458 3438 1723 gene locus_tag LOCUS_26140 3438 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence459 3747 1993 gene locus_tag LOCUS_26150 3747 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence460 416 1309 gene locus_tag LOCUS_26160 gene larE 416 1309 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_26160 1315 2043 gene locus_tag LOCUS_26170 1315 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 2575 2063 gene locus_tag LOCUS_26180 2575 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2802 3779 gene locus_tag LOCUS_26190 2802 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence461 826 26 gene locus_tag LOCUS_26200 826 26 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_26200 1596 826 gene locus_tag LOCUS_26210 1596 826 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_26210 2159 1596 gene locus_tag LOCUS_26220 gene frr 2159 1596 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_26220 2925 2185 gene locus_tag LOCUS_26230 gene pyrH 2925 2185 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_26230 3622 2975 gene locus_tag LOCUS_26240 gene tsf 3622 2975 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence462 120 677 gene locus_tag LOCUS_26250 120 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26250 688 1989 gene locus_tag LOCUS_26260 688 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2770 2003 gene locus_tag LOCUS_26270 2770 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 3273 2773 gene locus_tag LOCUS_26280 3273 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence463 1683 844 gene locus_tag LOCUS_26290 1683 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 <4133 1680 gene locus_tag LOCUS_26300 <4133 1680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403520.1:TonB-dependent receptor >Feature sequence464 116 1135 gene locus_tag LOCUS_26310 116 1135 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257805.1 protein_id gnl|my_center|LOCUS_26310 4001 1149 gene locus_tag LOCUS_26320 4001 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence465 3807 2887 gene locus_tag LOCUS_26330 3807 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence466 2560 3111 gene locus_tag LOCUS_26340 2560 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 3122 3808 gene locus_tag LOCUS_26350 3122 3808 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence467 1266 2660 gene locus_tag LOCUS_26360 1266 2660 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_26360 2647 3468 gene locus_tag LOCUS_26370 2647 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence468 1700 564 gene locus_tag LOCUS_26380 1700 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 <4111 1716 gene locus_tag LOCUS_26390 <4111 1716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114252.1:TonB-dependent receptor >Feature sequence469 <1 1188 gene locus_tag LOCUS_26400 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036372.1:ATP-binding protein 1335 3617 gene locus_tag LOCUS_26410 1335 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence470 <1 2861 gene locus_tag LOCUS_26420 <1 2861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391799.1:excinuclease ABC subunit UvrA 3581 2874 gene locus_tag LOCUS_26430 3581 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence471 3 1370 gene locus_tag LOCUS_26440 3 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2085 1417 gene locus_tag LOCUS_26450 2085 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 3091 2090 gene locus_tag LOCUS_26460 3091 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence472 713 1132 gene locus_tag LOCUS_26470 713 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 1245 3773 gene locus_tag LOCUS_26480 1245 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence473 602 1762 gene locus_tag LOCUS_26490 602 1762 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405266.1 protein_id gnl|my_center|LOCUS_26490 1887 2453 gene locus_tag LOCUS_26500 1887 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 <4078 2511 gene locus_tag LOCUS_26510 <4078 2511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902969.1:sulfatase-like hydrolase/transferase >Feature sequence474 1590 112 gene locus_tag LOCUS_26520 gene glpK 1590 112 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_26520 1755 2864 gene locus_tag LOCUS_26530 1755 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2998 3621 gene locus_tag LOCUS_26540 2998 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 3606 3995 gene locus_tag LOCUS_26550 3606 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence475 1707 1039 gene locus_tag LOCUS_26560 1707 1039 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938174.1 protein_id gnl|my_center|LOCUS_26560 2512 1700 gene locus_tag LOCUS_26570 2512 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3562 2564 gene locus_tag LOCUS_26580 3562 2564 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339822.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence476 171 1397 gene locus_tag LOCUS_26590 171 1397 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_26590 1401 2576 gene locus_tag LOCUS_26600 1401 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 <4073 2592 gene locus_tag LOCUS_26610 <4073 2592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017271271.1:GGDEF domain-containing protein >Feature sequence477 1259 2194 gene locus_tag LOCUS_26620 1259 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2268 2591 gene locus_tag LOCUS_26630 2268 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2625 3557 gene locus_tag LOCUS_26640 2625 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence478 <1 1304 gene locus_tag LOCUS_26650 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294691.1:O-antigen ligase family protein 1375 2520 gene locus_tag LOCUS_26660 1375 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2578 3246 gene locus_tag LOCUS_26670 2578 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 3573 3298 gene locus_tag LOCUS_26680 3573 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence479 251 457 gene locus_tag LOCUS_26690 251 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 457 1296 gene locus_tag LOCUS_26700 457 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 1296 2327 gene locus_tag LOCUS_26710 gene coxB 1296 2327 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404828.1 protein_id gnl|my_center|LOCUS_26710 2337 3974 gene locus_tag LOCUS_26720 gene ctaD 2337 3974 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404827.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence480 1562 2086 gene locus_tag LOCUS_26730 1562 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3590 2055 gene locus_tag LOCUS_26740 3590 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence481 1520 855 gene locus_tag LOCUS_26750 1520 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 2442 1528 gene locus_tag LOCUS_26760 2442 1528 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_26760 2582 3358 gene locus_tag LOCUS_26770 2582 3358 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence482 978 2039 gene locus_tag LOCUS_26780 978 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2057 3025 gene locus_tag LOCUS_26790 2057 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 <4045 3035 gene locus_tag LOCUS_26800 <4045 3035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928630.1:FG-GAP-like repeat-containing protein >Feature sequence483 263 1780 gene locus_tag LOCUS_26810 263 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3799 1793 gene locus_tag LOCUS_26820 3799 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 >Feature sequence484 1588 86 gene locus_tag LOCUS_26830 1588 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3181 1682 gene locus_tag LOCUS_26840 3181 1682 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_26840 <4039 3263 gene locus_tag LOCUS_26850 <4039 3263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963826.1:M48 family metallopeptidase >Feature sequence485 292 2154 gene locus_tag LOCUS_26860 gene glmS 292 2154 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229190.1 protein_id gnl|my_center|LOCUS_26860 3588 2167 gene locus_tag LOCUS_26870 3588 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence486 121 1734 gene locus_tag LOCUS_26880 121 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3072 1939 gene locus_tag LOCUS_26890 3072 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence487 66 2123 gene locus_tag LOCUS_26900 66 2123 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_26900 2647 2168 gene locus_tag LOCUS_26910 2647 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2703 3911 gene locus_tag LOCUS_26920 2703 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence488 1960 575 gene locus_tag LOCUS_26930 gene thrC 1960 575 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_26930 3122 1950 gene locus_tag LOCUS_26940 3122 1950 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902843.1 protein_id gnl|my_center|LOCUS_26940 <4009 3249 gene locus_tag LOCUS_26950 <4009 3249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198630.1:amidase family protein >Feature sequence489 23 499 gene locus_tag LOCUS_26960 23 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 496 2124 gene locus_tag LOCUS_26970 496 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2129 2869 gene locus_tag LOCUS_26980 2129 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence490 80 1921 gene locus_tag LOCUS_26990 80 1921 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_26990 1949 3244 gene locus_tag LOCUS_27000 1949 3244 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256145.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence491 1055 93 gene locus_tag LOCUS_27010 1055 93 CDS product recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229073.1 protein_id gnl|my_center|LOCUS_27010 1224 2390 gene locus_tag LOCUS_27020 gene dnaN 1224 2390 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227630.1 protein_id gnl|my_center|LOCUS_27020 2411 2734 gene locus_tag LOCUS_27030 2411 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 2752 3156 gene locus_tag LOCUS_27040 2752 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 3990 3190 gene locus_tag LOCUS_27050 3990 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence492 89 1987 gene locus_tag LOCUS_27060 89 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2090 3352 gene locus_tag LOCUS_27070 2090 3352 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124897.1 protein_id gnl|my_center|LOCUS_27070 >Feature sequence493 147 1997 gene locus_tag LOCUS_27080 147 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 1994 3814 gene locus_tag LOCUS_27090 1994 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence494 1046 2218 gene locus_tag LOCUS_27100 1046 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 <3974 2276 gene locus_tag LOCUS_27110 <3974 2276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257229.1:sulfatase >Feature sequence495 576 217 gene locus_tag LOCUS_27120 576 217 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807906.1 protein_id gnl|my_center|LOCUS_27120 680 1501 gene locus_tag LOCUS_27130 680 1501 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574643.1 protein_id gnl|my_center|LOCUS_27130 3039 1513 gene locus_tag LOCUS_27140 3039 1513 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943517.1 protein_id gnl|my_center|LOCUS_27140 <3969 3067 gene locus_tag LOCUS_27150 <3969 3067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005056110.1:class I SAM-dependent methyltransferase >Feature sequence496 2260 2571 gene locus_tag LOCUS_27160 2260 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2626 3894 gene locus_tag LOCUS_27170 2626 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence497 1749 187 gene locus_tag LOCUS_27180 1749 187 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_27180 2498 1749 gene locus_tag LOCUS_27190 2498 1749 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056496.1 protein_id gnl|my_center|LOCUS_27190 2867 2505 gene locus_tag LOCUS_27200 2867 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 2960 3607 gene locus_tag LOCUS_27210 2960 3607 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_27210 3690 3929 gene locus_tag LOCUS_27220 3690 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence498 87 1652 gene locus_tag LOCUS_27230 gene thiC 87 1652 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230295.1 protein_id gnl|my_center|LOCUS_27230 2534 1674 gene locus_tag LOCUS_27240 2534 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 3637 2579 gene locus_tag LOCUS_27250 3637 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence499 250 1305 gene locus_tag LOCUS_27260 250 1305 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404946.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence500 <3933 1635 gene locus_tag LOCUS_27270 <3933 1635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026868.1:type I polyketide synthase >Feature sequence501 999 1523 gene locus_tag LOCUS_27280 999 1523 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_27280 1520 2398 gene locus_tag LOCUS_27290 1520 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 2510 3706 gene locus_tag LOCUS_27300 2510 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence502 3022 788 gene locus_tag LOCUS_27310 3022 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence503 <1 3109 gene locus_tag LOCUS_27320 <1 3109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033447772.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence504 84 851 gene locus_tag LOCUS_27330 84 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 848 2248 gene locus_tag LOCUS_27340 848 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2800 2255 gene locus_tag LOCUS_27350 2800 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 >Feature sequence505 256 447 gene locus_tag LOCUS_27360 256 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 440 811 gene locus_tag LOCUS_27370 440 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 811 1362 gene locus_tag LOCUS_27380 811 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 1359 1511 gene locus_tag LOCUS_27390 1359 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 1508 1690 gene locus_tag LOCUS_27400 1508 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1687 1920 gene locus_tag LOCUS_27410 1687 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 1896 2399 gene locus_tag LOCUS_27420 1896 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 2461 3279 gene locus_tag LOCUS_27430 2461 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 3288 3557 gene locus_tag LOCUS_27440 3288 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence506 962 381 gene locus_tag LOCUS_27450 962 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 1702 959 gene locus_tag LOCUS_27460 1702 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 2196 1699 gene locus_tag LOCUS_27470 gene purE 2196 1699 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_27470 3470 2193 gene locus_tag LOCUS_27480 gene purD 3470 2193 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence507 106 1032 gene locus_tag LOCUS_27490 106 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 2781 1060 gene locus_tag LOCUS_27500 2781 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 2897 3685 gene locus_tag LOCUS_27510 gene mazG 2897 3685 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337840.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence508 1 438 gene locus_tag LOCUS_27520 1 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1022 411 gene locus_tag LOCUS_27530 1022 411 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_27530 1106 1561 gene locus_tag LOCUS_27540 1106 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence509 2152 476 gene locus_tag LOCUS_27550 gene glpD 2152 476 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_27550 2646 2221 gene locus_tag LOCUS_27560 2646 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2767 3627 gene locus_tag LOCUS_27570 2767 3627 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939802.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence510 670 3123 gene locus_tag LOCUS_27580 670 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence511 65 529 gene locus_tag LOCUS_27590 65 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 1423 1238 gene locus_tag LOCUS_27600 1423 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 3405 1591 gene locus_tag LOCUS_27610 3405 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 >Feature sequence512 1456 35 gene locus_tag LOCUS_27620 1456 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1508 2254 gene locus_tag LOCUS_27630 1508 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence513 1344 142 gene locus_tag LOCUS_27640 1344 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 3053 1407 gene locus_tag LOCUS_27650 3053 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence514 729 172 gene locus_tag LOCUS_27660 729 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence515 268 1902 gene locus_tag LOCUS_27670 268 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 1899 2654 gene locus_tag LOCUS_27680 1899 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence516 144 1319 gene locus_tag LOCUS_27690 144 1319 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_27690 1989 1306 gene locus_tag LOCUS_27700 1989 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 2146 2706 gene locus_tag LOCUS_27710 2146 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence517 <1 810 gene locus_tag LOCUS_27720 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085794.1:aminobacteriohopanetriol synthase HpnO 894 2372 gene locus_tag LOCUS_27730 894 2372 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950408.1 protein_id gnl|my_center|LOCUS_27730 2409 2594 gene locus_tag LOCUS_27740 2409 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2661 3263 gene locus_tag LOCUS_27750 2661 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 3260 3748 gene locus_tag LOCUS_27760 3260 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence518 78 431 gene locus_tag LOCUS_27770 78 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 678 2327 gene locus_tag LOCUS_27780 678 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2735 2331 gene locus_tag LOCUS_27790 2735 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence519 18 1847 gene locus_tag LOCUS_27800 18 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 <3787 1841 gene locus_tag LOCUS_27810 <3787 1841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943843.1:cytochrome c3 family protein >Feature sequence520 449 1942 gene locus_tag LOCUS_27820 449 1942 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775406.1 protein_id gnl|my_center|LOCUS_27820 2613 1915 gene locus_tag LOCUS_27830 2613 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence521 1660 797 gene locus_tag LOCUS_27840 1660 797 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_27840 3290 1725 gene locus_tag LOCUS_27850 gene ffh 3290 1725 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence522 70 1329 gene locus_tag LOCUS_27860 70 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 1301 1699 gene locus_tag LOCUS_27870 1301 1699 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937569.1 protein_id gnl|my_center|LOCUS_27870 1703 2593 gene locus_tag LOCUS_27880 1703 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3154 2597 gene locus_tag LOCUS_27890 3154 2597 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328411.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence523 21 1355 gene locus_tag LOCUS_27900 21 1355 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338651.1 protein_id gnl|my_center|LOCUS_27900 1381 2529 gene locus_tag LOCUS_27910 1381 2529 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_27910 2637 3440 gene locus_tag LOCUS_27920 gene lpxA 2637 3440 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence524 1954 887 gene locus_tag LOCUS_27930 1954 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 2996 2031 gene locus_tag LOCUS_27940 2996 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 3572 3108 gene locus_tag LOCUS_27950 3572 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence525 146 238 gene locus_tag LOCUS_t00360 146 238 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <3742 1542 gene locus_tag LOCUS_27960 <3742 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928630.1:FG-GAP-like repeat-containing protein >Feature sequence526 <1 1940 gene locus_tag LOCUS_27970 <1 1940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037676.1:NAD(P)-binding domain-containing protein 2010 3143 gene locus_tag LOCUS_27980 2010 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 <3737 3189 gene locus_tag LOCUS_27990 <3737 3189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977030.1:DNA-3-methyladenine glycosylase >Feature sequence527 1579 1064 gene locus_tag LOCUS_28000 1579 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 3594 1576 gene locus_tag LOCUS_28010 3594 1576 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963795.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence528 1091 90 gene locus_tag LOCUS_28020 1091 90 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 protein_id gnl|my_center|LOCUS_28020 1519 1088 gene locus_tag LOCUS_28030 1519 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1560 2015 gene locus_tag LOCUS_28040 1560 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2053 3291 gene locus_tag LOCUS_28050 2053 3291 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877762.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence529 2103 259 gene locus_tag LOCUS_28060 gene pheT 2103 259 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876408.1 protein_id gnl|my_center|LOCUS_28060 3671 2094 gene locus_tag LOCUS_28070 3671 2094 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 protein_id gnl|my_center|LOCUS_28070 >Feature sequence530 474 962 gene locus_tag LOCUS_28080 474 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 959 1444 gene locus_tag LOCUS_28090 959 1444 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941174.1 protein_id gnl|my_center|LOCUS_28090 1444 2289 gene locus_tag LOCUS_28100 1444 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2303 2701 gene locus_tag LOCUS_28110 2303 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence531 499 1512 gene locus_tag LOCUS_28120 499 1512 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_28120 1512 2498 gene locus_tag LOCUS_28130 1512 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 2504 3436 gene locus_tag LOCUS_28140 gene pdxA 2504 3436 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337833.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence532 <3668 2203 gene locus_tag LOCUS_28150 <3668 2203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026866.1:PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein >Feature sequence533 1177 2370 gene locus_tag LOCUS_28160 1177 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 3296 2406 gene locus_tag LOCUS_28170 3296 2406 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence534 16 375 gene locus_tag LOCUS_28180 16 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 1534 380 gene locus_tag LOCUS_28190 1534 380 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_28190 1666 2748 gene locus_tag LOCUS_28200 1666 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 <3646 2736 gene locus_tag LOCUS_28210 <3646 2736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928617.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence535 537 1397 gene locus_tag LOCUS_28220 537 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2195 1404 gene locus_tag LOCUS_28230 2195 1404 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225717.1 protein_id gnl|my_center|LOCUS_28230 2973 2290 gene locus_tag LOCUS_28240 2973 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence536 <1 1976 gene locus_tag LOCUS_28250 <1 1976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089686.1:TonB-dependent receptor >Feature sequence537 1416 2861 gene locus_tag LOCUS_28260 1416 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 <3633 2869 gene locus_tag LOCUS_28270 <3633 2869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244531.1:beta-glucanase >Feature sequence538 305 964 gene locus_tag LOCUS_28280 305 964 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_28280 1519 977 gene locus_tag LOCUS_28290 1519 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 2433 1552 gene locus_tag LOCUS_28300 2433 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2644 2444 gene locus_tag LOCUS_28310 2644 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 <3629 2680 gene locus_tag LOCUS_28320 <3629 2680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257227.1:alkaline phosphatase family protein >Feature sequence539 <1 2719 gene locus_tag LOCUS_28330 <1 2719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679721.1:adenylate/guanylate cyclase domain-containing protein 3497 2736 gene locus_tag LOCUS_28340 3497 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence540 <1 2407 gene locus_tag LOCUS_28350 <1 2407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037525.1:metallophosphoesterase family protein 3196 2456 gene locus_tag LOCUS_28360 3196 2456 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507867.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence541 1440 4 gene locus_tag LOCUS_28370 gene rlmD 1440 4 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869710.1 protein_id gnl|my_center|LOCUS_28370 1901 1497 gene locus_tag LOCUS_28380 1901 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 2292 2047 gene locus_tag LOCUS_28390 2292 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence542 <1 1000 gene locus_tag LOCUS_28400 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228504.1:septum site-determining protein MinC 1028 1846 gene locus_tag LOCUS_28410 gene minD 1028 1846 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_28410 1843 2118 gene locus_tag LOCUS_28420 1843 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2857 2231 gene locus_tag LOCUS_28430 2857 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 <3615 2854 gene locus_tag LOCUS_28440 <3615 2854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015777109.1:aminodeoxychorismate synthase component I >Feature sequence543 178 2961 gene locus_tag LOCUS_28450 178 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 >Feature sequence544 1485 355 gene locus_tag LOCUS_28460 1485 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 1510 1587 gene locus_tag LOCUS_t00370 1510 1587 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1787 2419 gene locus_tag LOCUS_28470 1787 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 <3610 2496 gene locus_tag LOCUS_28480 <3610 2496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256119.1:tRNA dihydrouridine synthase DusB >Feature sequence545 <1 1192 gene locus_tag LOCUS_28490 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941701.1:sigma-54 dependent transcriptional regulator 1348 2601 gene locus_tag LOCUS_28500 1348 2601 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_28500 2605 3570 gene locus_tag LOCUS_28510 2605 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence546 4 1722 gene locus_tag LOCUS_28520 4 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 3603 2209 gene locus_tag LOCUS_28530 3603 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 >Feature sequence547 922 1425 gene locus_tag LOCUS_28540 922 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3028 3441 gene locus_tag LOCUS_28550 3028 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence548 153 944 gene locus_tag LOCUS_28560 153 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 2139 952 gene locus_tag LOCUS_28570 gene waaF 2139 952 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_28570 2238 3584 gene locus_tag LOCUS_28580 2238 3584 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence549 851 447 gene locus_tag LOCUS_28590 851 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 1417 848 gene locus_tag LOCUS_28600 1417 848 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836767.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence550 1238 1459 gene locus_tag LOCUS_28610 1238 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2720 1467 gene locus_tag LOCUS_28620 2720 1467 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_28620 3428 2865 gene locus_tag LOCUS_28630 3428 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence551 1078 1974 gene locus_tag LOCUS_28640 1078 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 1977 2138 gene locus_tag LOCUS_28650 1977 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 2257 2907 gene locus_tag LOCUS_28660 2257 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence552 356 922 gene locus_tag LOCUS_28670 356 922 CDS product copper chaperone Copz family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057722.1 protein_id gnl|my_center|LOCUS_28670 2854 929 gene locus_tag LOCUS_28680 2854 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 3390 2926 gene locus_tag LOCUS_28690 3390 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence553 1070 468 gene locus_tag LOCUS_28700 1070 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 1157 3364 gene locus_tag LOCUS_28710 1157 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence554 1030 206 gene locus_tag LOCUS_28720 1030 206 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271588.1 protein_id gnl|my_center|LOCUS_28720 1098 2327 gene locus_tag LOCUS_28730 1098 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3412 2321 gene locus_tag LOCUS_28740 3412 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 >Feature sequence555 1345 2 gene locus_tag LOCUS_28750 gene trkA 1345 2 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_28750 2593 1346 gene locus_tag LOCUS_28760 2593 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 3269 2736 gene locus_tag LOCUS_28770 3269 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence556 <1 3207 gene locus_tag LOCUS_28780 <1 3207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941727.1:PilC/PilY family type IV pilus protein >Feature sequence557 70 2346 gene locus_tag LOCUS_28790 70 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence558 972 4 gene locus_tag LOCUS_28800 972 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 1669 1001 gene locus_tag LOCUS_28810 1669 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence559 982 71 gene locus_tag LOCUS_28820 982 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 1085 3118 gene locus_tag LOCUS_28830 gene metG 1085 3118 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_28830 >Feature sequence560 3422 2424 gene locus_tag LOCUS_28840 3422 2424 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence561 508 1284 gene locus_tag LOCUS_28850 508 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 >Feature sequence562 <1 1170 gene locus_tag LOCUS_28860 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha 1170 1850 gene locus_tag LOCUS_28870 1170 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 3378 1888 gene locus_tag LOCUS_28880 3378 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 >Feature sequence563 1201 758 gene locus_tag LOCUS_28890 1201 758 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583242.1 protein_id gnl|my_center|LOCUS_28890 1888 1454 gene locus_tag LOCUS_28900 1888 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 3392 1962 gene locus_tag LOCUS_28910 3392 1962 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_28910 >Feature sequence564 <1 677 gene locus_tag LOCUS_28920 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202073.1:cofactor-independent phosphoglycerate mutase 757 1815 gene locus_tag LOCUS_28930 757 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence565 <1 2288 gene locus_tag LOCUS_28940 <1 2288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113850.1:phosphoenolpyruvate carboxylase 2464 2910 gene locus_tag LOCUS_28950 2464 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence566 698 327 gene locus_tag LOCUS_28960 gene trxA 698 327 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_28960 1313 777 gene locus_tag LOCUS_28970 1313 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 1834 1445 gene locus_tag LOCUS_28980 1834 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 2922 1831 gene locus_tag LOCUS_28990 2922 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 3338 2919 gene locus_tag LOCUS_29000 3338 2919 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888655.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence567 628 1272 gene locus_tag LOCUS_29010 628 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_29010 1334 2539 gene locus_tag LOCUS_29020 1334 2539 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_29020 2532 3392 gene locus_tag LOCUS_29030 2532 3392 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083218.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence568 3198 1675 gene locus_tag LOCUS_29040 3198 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence569 57 302 gene locus_tag LOCUS_29050 57 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 369 545 gene locus_tag LOCUS_29060 369 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 2036 564 gene locus_tag LOCUS_29070 2036 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence570 153 1151 gene locus_tag LOCUS_29080 153 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 288 195 gene locus_tag LOCUS_t00380 288 195 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2090 1296 gene locus_tag LOCUS_29090 2090 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 3298 2087 gene locus_tag LOCUS_29100 3298 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence571 <1 3081 gene locus_tag LOCUS_29110 <1 3081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404740.1:AAA family ATPase >Feature sequence572 862 71 gene locus_tag LOCUS_29120 862 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 1253 864 gene locus_tag LOCUS_29130 1253 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 1361 2056 gene locus_tag LOCUS_29140 1361 2056 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244373.1 protein_id gnl|my_center|LOCUS_29140 2067 2723 gene locus_tag LOCUS_29150 2067 2723 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191181.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence573 <1 615 gene locus_tag LOCUS_29160 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:OmpA family protein 961 626 gene locus_tag LOCUS_29170 961 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 2450 1002 gene locus_tag LOCUS_29180 gene rpoN 2450 1002 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_29180 <3418 2648 gene locus_tag LOCUS_29190 <3418 2648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938918.1:LPS export ABC transporter ATP-binding protein >Feature sequence574 46 317 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gattcccccgcgcccgcggggatgggcc 2117 423 gene locus_tag LOCUS_29200 2117 423 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_29200 3165 2362 gene locus_tag LOCUS_29210 3165 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence575 848 2623 gene locus_tag LOCUS_29220 848 2623 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_29220 2607 3278 gene locus_tag LOCUS_29230 2607 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence576 667 2574 gene locus_tag LOCUS_29240 667 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence577 494 1243 gene locus_tag LOCUS_29250 494 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 1889 1302 gene locus_tag LOCUS_29260 gene infC 1889 1302 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_29260 <3401 2060 gene locus_tag LOCUS_29270 <3401 2060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943626.1:aryl-sulfate sulfotransferase >Feature sequence578 647 1672 gene locus_tag LOCUS_29280 647 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 1669 2532 gene locus_tag LOCUS_29290 1669 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3157 2507 gene locus_tag LOCUS_29300 3157 2507 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_29300 >Feature sequence579 3116 822 gene locus_tag LOCUS_29310 3116 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence580 466 1260 gene locus_tag LOCUS_29320 466 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 2616 1267 gene locus_tag LOCUS_29330 2616 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 >Feature sequence581 1324 590 gene locus_tag LOCUS_29340 1324 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 1709 2080 gene locus_tag LOCUS_29350 1709 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 2168 2575 gene locus_tag LOCUS_29360 2168 2575 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943273.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence582 815 1933 gene locus_tag LOCUS_29370 gene hisC 815 1933 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_29370 3130 1943 gene locus_tag LOCUS_29380 3130 1943 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence583 <1 2257 gene locus_tag LOCUS_29390 <1 2257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259387.1:glycosyltransferase 3241 2264 gene locus_tag LOCUS_29400 3241 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence584 2363 978 gene locus_tag LOCUS_29410 gene der 2363 978 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_29410 3372 2407 gene locus_tag LOCUS_29420 gene era 3372 2407 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_29420 >Feature sequence585 97 633 gene locus_tag LOCUS_29430 97 633 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021906.1 protein_id gnl|my_center|LOCUS_29430 630 1562 gene locus_tag LOCUS_29440 gene rfbB 630 1562 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_29440 1553 2530 gene locus_tag LOCUS_29450 1553 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 3235 2540 gene locus_tag LOCUS_29460 3235 2540 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932133.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence586 5 934 gene locus_tag LOCUS_29470 5 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 3281 1008 gene locus_tag LOCUS_29480 3281 1008 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108124.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence587 3187 917 gene locus_tag LOCUS_29490 3187 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence588 1922 1578 gene locus_tag LOCUS_29500 1922 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 2024 3193 gene locus_tag LOCUS_29510 2024 3193 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390553.1 protein_id gnl|my_center|LOCUS_29510 >Feature sequence589 101 613 gene locus_tag LOCUS_29520 101 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 1202 636 gene locus_tag LOCUS_29530 1202 636 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976284.1 protein_id gnl|my_center|LOCUS_29530 1992 1195 gene locus_tag LOCUS_29540 1992 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2552 2133 gene locus_tag LOCUS_29550 gene ndk 2552 2133 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974973.1 protein_id gnl|my_center|LOCUS_29550 2975 2667 gene locus_tag LOCUS_29560 2975 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence590 129 1442 gene locus_tag LOCUS_29570 129 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 1696 2682 gene locus_tag LOCUS_29580 1696 2682 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_29580 >Feature sequence591 115 780 gene locus_tag LOCUS_29590 115 780 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_29590 875 3004 gene locus_tag LOCUS_29600 875 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence592 68 607 gene locus_tag LOCUS_29610 68 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 2524 617 gene locus_tag LOCUS_29620 gene dnaK 2524 617 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_29620 <3327 2596 gene locus_tag LOCUS_29630 <3327 2596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975269.1:nucleotide exchange factor GrpE >Feature sequence593 <1 1505 gene locus_tag LOCUS_29640 <1 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258420.1:histidinol-phosphate transaminase 1502 2056 gene locus_tag LOCUS_29650 gene cobU 1502 2056 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869446.1 protein_id gnl|my_center|LOCUS_29650 2053 3120 gene locus_tag LOCUS_29660 gene cobT 2053 3120 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631396.1 protein_id gnl|my_center|LOCUS_29660 3117 3284 gene locus_tag LOCUS_29670 3117 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence594 835 1785 gene locus_tag LOCUS_29680 835 1785 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925388.1 protein_id gnl|my_center|LOCUS_29680 1830 2453 gene locus_tag LOCUS_29690 1830 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 3276 2602 gene locus_tag LOCUS_29700 3276 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence595 896 2668 gene locus_tag LOCUS_29710 896 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence596 526 1593 gene locus_tag LOCUS_29720 526 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 1650 2885 gene locus_tag LOCUS_29730 1650 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 >Feature sequence597 <1 887 gene locus_tag LOCUS_29740 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256600.1:alpha-amylase family glycosyl hydrolase 1481 942 gene locus_tag LOCUS_29750 1481 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 2975 1524 gene locus_tag LOCUS_29760 2975 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 >Feature sequence598 2352 1939 gene locus_tag LOCUS_29770 2352 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410114.1 protein_id gnl|my_center|LOCUS_29770 3065 2352 gene locus_tag LOCUS_29780 3065 2352 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410108.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence599 1966 2 gene locus_tag LOCUS_29790 1966 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 3063 1963 gene locus_tag LOCUS_29800 gene dnaJ 3063 1963 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118468.1 protein_id gnl|my_center|LOCUS_29800 >Feature sequence600 197 721 gene locus_tag LOCUS_29810 197 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 726 1922 gene locus_tag LOCUS_29820 726 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 1930 2370 gene locus_tag LOCUS_29830 1930 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 2430 2924 gene locus_tag LOCUS_29840 2430 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 3191 2970 gene locus_tag LOCUS_29850 3191 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 >Feature sequence601 >Feature sequence602 60 136 gene locus_tag LOCUS_t00390 60 136 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 322 1146 gene locus_tag LOCUS_29860 322 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 1246 1515 gene locus_tag LOCUS_29870 1246 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 1512 2210 gene locus_tag LOCUS_29880 1512 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence603 1150 1911 gene locus_tag LOCUS_29890 1150 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 >Feature sequence604 994 311 gene locus_tag LOCUS_29900 994 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 2007 991 gene locus_tag LOCUS_29910 2007 991 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_29910 3180 2026 gene locus_tag LOCUS_29920 3180 2026 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393538.1 protein_id gnl|my_center|LOCUS_29920 >Feature sequence605 >Feature sequence606 336 1217 gene locus_tag LOCUS_29930 336 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1296 1781 gene locus_tag LOCUS_29940 gene fabZ 1296 1781 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257317.1 protein_id gnl|my_center|LOCUS_29940 1784 3073 gene locus_tag LOCUS_29950 1784 3073 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence607 72 1457 gene locus_tag LOCUS_29960 72 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 1454 1786 gene locus_tag LOCUS_29970 1454 1786 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_29970 3137 1824 gene locus_tag LOCUS_29980 3137 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 >Feature sequence608 2137 881 gene locus_tag LOCUS_29990 2137 881 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_29990 >Feature sequence609 3176 2223 gene locus_tag LOCUS_30000 3176 2223 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444695.1 protein_id gnl|my_center|LOCUS_30000 >Feature sequence610 <3231 1321 gene locus_tag LOCUS_30010 <3231 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052279190.1:NosD domain-containing protein >Feature sequence611 77 493 gene locus_tag LOCUS_30020 77 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 1724 738 gene locus_tag LOCUS_30030 1724 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 1928 1758 gene locus_tag LOCUS_30040 1928 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3230 2178 gene locus_tag LOCUS_30050 3230 2178 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence612 1172 2395 gene locus_tag LOCUS_30060 1172 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence613 73 762 gene locus_tag LOCUS_30070 73 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 759 1301 gene locus_tag LOCUS_30080 759 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 1298 1564 gene locus_tag LOCUS_30090 1298 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 2390 2803 gene locus_tag LOCUS_30100 2390 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence614 1224 112 gene locus_tag LOCUS_30110 1224 112 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_30110 2108 1221 gene locus_tag LOCUS_30120 2108 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 2685 2218 gene locus_tag LOCUS_30130 2685 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence615 244 459 gene locus_tag LOCUS_30140 gene infA 244 459 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809486.1 protein_id gnl|my_center|LOCUS_30140 932 480 gene locus_tag LOCUS_30150 932 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 1168 1605 gene locus_tag LOCUS_30160 gene tadA 1168 1605 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_30160 1666 1755 gene locus_tag LOCUS_t00400 1666 1755 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1791 1882 gene locus_tag LOCUS_t00410 1791 1882 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence616 337 262 gene locus_tag LOCUS_t00420 337 262 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 426 351 gene locus_tag LOCUS_t00430 426 351 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 562 479 gene locus_tag LOCUS_t00440 562 479 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 708 633 gene locus_tag LOCUS_t00450 708 633 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2027 864 gene locus_tag LOCUS_30170 2027 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 <3209 2138 gene locus_tag LOCUS_30180 <3209 2138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403700.1:site-2 protease family protein >Feature sequence617 <1 1189 gene locus_tag LOCUS_30190 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940804.1:primosomal protein N' 2195 1206 gene locus_tag LOCUS_30200 2195 1206 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836209.1 protein_id gnl|my_center|LOCUS_30200 <3206 2198 gene locus_tag LOCUS_30210 <3206 2198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258380.1:class I SAM-dependent rRNA methyltransferase >Feature sequence618 916 1596 gene locus_tag LOCUS_30220 916 1596 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090346.1 protein_id gnl|my_center|LOCUS_30220 1598 2974 gene locus_tag LOCUS_30230 1598 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence619 1229 2092 gene locus_tag LOCUS_30240 1229 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 2734 2105 gene locus_tag LOCUS_30250 2734 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence620 >Feature sequence621 749 1429 gene locus_tag LOCUS_30260 749 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2083 1469 gene locus_tag LOCUS_30270 gene cysC 2083 1469 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_30270 >Feature sequence622 1376 6 gene locus_tag LOCUS_30280 1376 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 1442 2809 gene locus_tag LOCUS_30290 gene selA 1442 2809 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_30290 >Feature sequence623 55 1971 gene locus_tag LOCUS_30300 55 1971 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404234.1 protein_id gnl|my_center|LOCUS_30300 >Feature sequence624 2772 1312 gene locus_tag LOCUS_30310 2772 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence625 1811 36 gene locus_tag LOCUS_30320 gene dnaG 1811 36 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_30320 3163 1829 gene locus_tag LOCUS_30330 gene murA 3163 1829 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_30330 >Feature sequence626 263 1141 gene locus_tag LOCUS_30340 263 1141 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839709.1 protein_id gnl|my_center|LOCUS_30340 1138 1839 gene locus_tag LOCUS_30350 1138 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 1841 2953 gene locus_tag LOCUS_30360 1841 2953 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027680.1 protein_id gnl|my_center|LOCUS_30360 >Feature sequence627 629 952 gene locus_tag LOCUS_30370 629 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 949 2646 gene locus_tag LOCUS_30380 949 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence628 1704 976 gene locus_tag LOCUS_30390 1704 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 >Feature sequence629 1306 2217 gene locus_tag LOCUS_30400 1306 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 2280 2969 gene locus_tag LOCUS_30410 2280 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 >Feature sequence630 1740 583 gene locus_tag LOCUS_30420 1740 583 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338236.1 protein_id gnl|my_center|LOCUS_30420 2186 1737 gene locus_tag LOCUS_30430 2186 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 2281 2664 gene locus_tag LOCUS_30440 2281 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3088 2705 gene locus_tag LOCUS_30450 3088 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 >Feature sequence631 939 1448 gene locus_tag LOCUS_30460 939 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 1461 2825 gene locus_tag LOCUS_30470 1461 2825 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_30470 >Feature sequence632 1577 666 gene locus_tag LOCUS_30480 gene xerC 1577 666 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence633 16 1419 gene locus_tag LOCUS_30490 16 1419 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_30490 1442 3016 gene locus_tag LOCUS_30500 1442 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence634 2666 1242 gene locus_tag LOCUS_30510 2666 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence635 2288 867 gene locus_tag LOCUS_30520 2288 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3123 2215 gene locus_tag LOCUS_30530 3123 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 >Feature sequence636 332 1735 gene locus_tag LOCUS_30540 332 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence637 <1 2653 gene locus_tag LOCUS_30550 <1 2653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393495.1:selenium-dependent xanthine dehydrogenase >Feature sequence638 >Feature sequence639 635 390 gene locus_tag LOCUS_30560 635 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 707 1297 gene locus_tag LOCUS_30570 707 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 <3095 1310 gene locus_tag LOCUS_30580 <3095 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003640674.1:RNA polymerase sigma factor RpoD >Feature sequence640 136 708 gene locus_tag LOCUS_30590 136 708 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_30590 2000 705 gene locus_tag LOCUS_30600 2000 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence641 >Feature sequence642 <1 672 gene locus_tag LOCUS_30610 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003219244.1:sporulation initiation inhibitor protein Soj 1301 687 gene locus_tag LOCUS_30620 1301 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 2260 1298 gene locus_tag LOCUS_30630 2260 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 >Feature sequence643 2039 741 gene locus_tag LOCUS_30640 gene hisS 2039 741 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142552.1 protein_id gnl|my_center|LOCUS_30640 >Feature sequence644 512 1900 gene locus_tag LOCUS_30650 512 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 1897 2358 gene locus_tag LOCUS_30660 1897 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 >Feature sequence645 1533 679 gene locus_tag LOCUS_30670 1533 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 1715 1966 gene locus_tag LOCUS_30680 1715 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 1974 2825 gene locus_tag LOCUS_30690 gene folD 1974 2825 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence646 2270 1095 gene locus_tag LOCUS_30700 2270 1095 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404943.1 protein_id gnl|my_center|LOCUS_30700 <3067 2258 gene locus_tag LOCUS_30710 <3067 2258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404942.1:N-acetyl-gamma-glutamyl-phosphate reductase >Feature sequence647 <1 631 gene locus_tag LOCUS_30720 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000199631.1:cytochrome c nitrite reductase subunit NrfD 684 1364 gene locus_tag LOCUS_30730 684 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 2966 1374 gene locus_tag LOCUS_30740 2966 1374 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence648 <1 1231 gene locus_tag LOCUS_30750 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha <3063 1233 gene locus_tag LOCUS_30760 <3063 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230569.1:serine/threonine-protein kinase >Feature sequence649 66 905 gene locus_tag LOCUS_30770 66 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 1749 832 gene locus_tag LOCUS_30780 1749 832 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 protein_id gnl|my_center|LOCUS_30780 2770 1805 gene locus_tag LOCUS_30790 2770 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence650 41 247 gene locus_tag LOCUS_30800 41 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 244 996 gene locus_tag LOCUS_30810 244 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 986 1750 gene locus_tag LOCUS_30820 986 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 1747 2691 gene locus_tag LOCUS_30830 1747 2691 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727868.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence651 759 406 gene locus_tag LOCUS_30840 759 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 1142 807 gene locus_tag LOCUS_30850 1142 807 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143495.1 protein_id gnl|my_center|LOCUS_30850 >Feature sequence652 995 264 gene locus_tag LOCUS_30860 995 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 1133 2836 gene locus_tag LOCUS_30870 1133 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence653 >Feature sequence654 267 1385 gene locus_tag LOCUS_30880 267 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 1388 1843 gene locus_tag LOCUS_30890 1388 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 1840 2313 gene locus_tag LOCUS_30900 1840 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 <3041 2283 gene locus_tag LOCUS_30910 <3041 2283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937687.1:sulfatase >Feature sequence655 127 1404 gene locus_tag LOCUS_30920 127 1404 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence656 >Feature sequence657 417 1214 gene locus_tag LOCUS_30930 417 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 1661 1218 gene locus_tag LOCUS_30940 gene dtd 1661 1218 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_30940 2492 1671 gene locus_tag LOCUS_30950 2492 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence658 76 1485 gene locus_tag LOCUS_30960 76 1485 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_30960 >Feature sequence659 <1 1444 gene locus_tag LOCUS_30970 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994007.1:VWA domain-containing protein 1990 1505 gene locus_tag LOCUS_30980 1990 1505 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018517.1 protein_id gnl|my_center|LOCUS_30980 2633 2001 gene locus_tag LOCUS_30990 gene exbB 2633 2001 CDS product tonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965517.1 protein_id gnl|my_center|LOCUS_30990 >Feature sequence660 269 1351 gene locus_tag LOCUS_31000 269 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 2273 1440 gene locus_tag LOCUS_31010 2273 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence661 662 2629 gene locus_tag LOCUS_31020 gene feoB 662 2629 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_31020 2626 2838 gene locus_tag LOCUS_31030 2626 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence662 251 1750 gene locus_tag LOCUS_31040 251 1750 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_31040 >Feature sequence663 1605 85 gene locus_tag LOCUS_31050 1605 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 2743 1853 gene locus_tag LOCUS_31060 2743 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 >Feature sequence664 1575 544 gene locus_tag LOCUS_31070 1575 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 2004 2747 gene locus_tag LOCUS_31080 2004 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 >Feature sequence665 211 801 gene locus_tag LOCUS_31090 211 801 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136732.1 protein_id gnl|my_center|LOCUS_31090 >Feature sequence666 <1 1147 gene locus_tag LOCUS_31100 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339151.1:DegQ family serine endoprotease 1688 1152 gene locus_tag LOCUS_31110 1688 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 1803 2852 gene locus_tag LOCUS_31120 gene pfkA 1803 2852 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838402.1 protein_id gnl|my_center|LOCUS_31120 >Feature sequence667 1951 47 gene locus_tag LOCUS_31130 1951 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 >Feature sequence668 >Feature sequence669 36 1184 gene locus_tag LOCUS_31140 36 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 1220 2803 gene locus_tag LOCUS_31150 1220 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 >Feature sequence670 <1 663 gene locus_tag LOCUS_31160 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275336.1:DUF885 family protein 2875 701 gene locus_tag LOCUS_31170 2875 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence671 <1 1041 gene locus_tag LOCUS_31180 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963926.1:cation diffusion facilitator family transporter 2927 1077 gene locus_tag LOCUS_31190 2927 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence672 915 1406 gene locus_tag LOCUS_31200 915 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 1458 2912 gene locus_tag LOCUS_31210 1458 2912 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence673 172 1752 gene locus_tag LOCUS_31220 172 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 2832 1984 gene locus_tag LOCUS_31230 2832 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 >Feature sequence674 493 2367 gene locus_tag LOCUS_31240 gene uvrC 493 2367 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_31240 >Feature sequence675 <1 713 gene locus_tag LOCUS_31250 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393509.1:NAD-dependent DNA ligase LigA 710 988 gene locus_tag LOCUS_31260 710 988 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_31260 969 1871 gene locus_tag LOCUS_31270 969 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 2618 1875 gene locus_tag LOCUS_31280 gene trmJ 2618 1875 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072273.1 protein_id gnl|my_center|LOCUS_31280 >Feature sequence676 <1 1801 gene locus_tag LOCUS_31290 <1 1801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941209.1:DNA polymerase I 1876 2559 gene locus_tag LOCUS_31300 gene rpoE 1876 2559 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005346.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence677 304 1761 gene locus_tag LOCUS_31310 304 1761 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_31310 2767 1823 gene locus_tag LOCUS_31320 2767 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence678 564 46 gene locus_tag LOCUS_31330 564 46 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459839.1 protein_id gnl|my_center|LOCUS_31330 1353 568 gene locus_tag LOCUS_31340 1353 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 1425 1877 gene locus_tag LOCUS_31350 gene arsC 1425 1877 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675012.1 protein_id gnl|my_center|LOCUS_31350 1874 2269 gene locus_tag LOCUS_31360 1874 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence679 70 411 gene locus_tag LOCUS_31370 70 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 867 424 gene locus_tag LOCUS_31380 867 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 2748 1069 gene locus_tag LOCUS_31390 gene ggt 2748 1069 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595115.1 protein_id gnl|my_center|LOCUS_31390 >Feature sequence680 879 85 gene locus_tag LOCUS_31400 879 85 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_31400 944 2500 gene locus_tag LOCUS_31410 gene guaA 944 2500 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404803.1 protein_id gnl|my_center|LOCUS_31410 >Feature sequence681 <1 969 gene locus_tag LOCUS_31420 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140877.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence682 1593 1024 gene locus_tag LOCUS_31430 1593 1024 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266431.1 protein_id gnl|my_center|LOCUS_31430 2855 1590 gene locus_tag LOCUS_31440 gene clpX 2855 1590 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546526.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence683 190 2379 gene locus_tag LOCUS_31450 190 2379 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933078.1 protein_id gnl|my_center|LOCUS_31450 <2932 2431 gene locus_tag LOCUS_31460 <2932 2431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940363.1:peptidoglycan-associated lipoprotein Pal >Feature sequence684 1536 166 gene locus_tag LOCUS_31470 1536 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 <2930 1560 gene locus_tag LOCUS_31480 <2930 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097341.1:glycosyl hydrolase family 18 protein >Feature sequence685 2656 878 gene locus_tag LOCUS_31490 2656 878 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174683.1 protein_id gnl|my_center|LOCUS_31490 >Feature sequence686 60 2114 gene locus_tag LOCUS_31500 60 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence687 44 1180 gene locus_tag LOCUS_31510 44 1180 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939398.1 protein_id gnl|my_center|LOCUS_31510 >Feature sequence688 123 437 gene locus_tag LOCUS_31520 123 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 2294 459 gene locus_tag LOCUS_31530 2294 459 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039157.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence689 2891 1245 gene locus_tag LOCUS_31540 2891 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 >Feature sequence690 540 1034 gene locus_tag LOCUS_31550 540 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 1031 1789 gene locus_tag LOCUS_31560 1031 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence691 1580 585 gene locus_tag LOCUS_31570 1580 585 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence692 <1 2020 gene locus_tag LOCUS_31580 <1 2020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918053.1:polysaccharide biosynthesis tyrosine autokinase 2020 2823 gene locus_tag LOCUS_31590 2020 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence693 <2888 890 gene locus_tag LOCUS_31600 <2888 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941708.1:methyltransferase domain-containing protein >Feature sequence694 <1 506 gene locus_tag LOCUS_31610 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943839.1:SBBP repeat-containing protein 496 2199 gene locus_tag LOCUS_31620 496 2199 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence695 <1 1620 gene locus_tag LOCUS_31630 <1 1620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390481.1:tetratricopeptide repeat protein 2604 1639 gene locus_tag LOCUS_31640 2604 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence696 643 1167 gene locus_tag LOCUS_31650 643 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 2496 1189 gene locus_tag LOCUS_31660 2496 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence697 2369 1146 gene locus_tag LOCUS_31670 2369 1146 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_31670 >Feature sequence698 235 1113 gene locus_tag LOCUS_31680 gene dapF 235 1113 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_31680 1391 2701 gene locus_tag LOCUS_31690 1391 2701 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_31690 >Feature sequence699 34 798 gene locus_tag LOCUS_31700 34 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 820 1929 gene locus_tag LOCUS_31710 gene metK 820 1929 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388672.1 protein_id gnl|my_center|LOCUS_31710 1992 2468 gene locus_tag LOCUS_31720 1992 2468 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946108.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence700 697 852 gene locus_tag LOCUS_31730 697 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 1746 862 gene locus_tag LOCUS_31740 1746 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 <2856 1850 gene locus_tag LOCUS_31750 <2856 1850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932879.1:alpha/beta hydrolase-fold protein >Feature sequence701 <2855 1392 gene locus_tag LOCUS_31760 <2855 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031187.1:aldehyde dehydrogenase family protein >Feature sequence702 1281 475 gene locus_tag LOCUS_31770 1281 475 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_31770 2066 1335 gene locus_tag LOCUS_31780 2066 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence703 2097 742 gene locus_tag LOCUS_31790 2097 742 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986859.1 protein_id gnl|my_center|LOCUS_31790 2232 2783 gene locus_tag LOCUS_31800 2232 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 >Feature sequence704 2762 30 gene locus_tag LOCUS_31810 2762 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence705 643 1644 gene locus_tag LOCUS_31820 643 1644 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_31820 1648 2760 gene locus_tag LOCUS_31830 1648 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 >Feature sequence706 <2836 717 gene locus_tag LOCUS_31840 <2836 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_203926466.1:D-arabinono-1,4-lactone oxidase >Feature sequence707 230 685 gene locus_tag LOCUS_31850 230 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 2055 694 gene locus_tag LOCUS_31860 2055 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 >Feature sequence708 728 2485 gene locus_tag LOCUS_31870 728 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 >Feature sequence709 59 1591 gene locus_tag LOCUS_31880 59 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 2664 1561 gene locus_tag LOCUS_31890 2664 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 >Feature sequence710 <1 1475 gene locus_tag LOCUS_31900 <1 1475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223462.1:phenylacetic acid degradation bifunctional protein PaaZ 1523 2464 gene locus_tag LOCUS_31910 1523 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 >Feature sequence711 <1 2031 gene locus_tag LOCUS_31920 <1 2031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480716.1:MMPL family transporter >Feature sequence712 162 1136 gene locus_tag LOCUS_31930 162 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 2190 1138 gene locus_tag LOCUS_31940 2190 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 >Feature sequence713 722 315 gene locus_tag LOCUS_31950 722 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 2363 798 gene locus_tag LOCUS_31960 2363 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence714 >Feature sequence715 <1 1480 gene locus_tag LOCUS_31970 <1 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545811.1:peptide-binding protein 1477 2481 gene locus_tag LOCUS_31980 1477 2481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090644.1 protein_id gnl|my_center|LOCUS_31980 >Feature sequence716 <1 1329 gene locus_tag LOCUS_31990 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002485697.1:flavocytochrome c 1911 1336 gene locus_tag LOCUS_32000 1911 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 2611 2042 gene locus_tag LOCUS_32010 2611 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 >Feature sequence717 1338 103 gene locus_tag LOCUS_32020 1338 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 <2786 1655 gene locus_tag LOCUS_32030 <2786 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940636.1:sigma 54-interacting transcriptional regulator >Feature sequence718 614 366 gene locus_tag LOCUS_32040 614 366 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707833.1 protein_id gnl|my_center|LOCUS_32040 1745 630 gene locus_tag LOCUS_32050 1745 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 2740 1742 gene locus_tag LOCUS_32060 2740 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence719 2573 183 gene locus_tag LOCUS_32070 2573 183 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_32070 >Feature sequence720 1672 602 gene locus_tag LOCUS_32080 gene mtnA 1672 602 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337453.1 protein_id gnl|my_center|LOCUS_32080 2737 1700 gene locus_tag LOCUS_32090 2737 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence721 543 1937 gene locus_tag LOCUS_32100 543 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 >Feature sequence722 >Feature sequence723 346 1245 gene locus_tag LOCUS_32110 346 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 >Feature sequence724 <2766 632 gene locus_tag LOCUS_32120 <2766 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein >Feature sequence725 1834 1424 gene locus_tag LOCUS_32130 1834 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 2552 2469 gene locus_tag LOCUS_t00460 2552 2469 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence726 545 2665 gene locus_tag LOCUS_32140 545 2665 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence727 909 361 gene locus_tag LOCUS_32150 909 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 1995 913 gene locus_tag LOCUS_32160 1995 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 2636 2067 gene locus_tag LOCUS_32170 2636 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 >Feature sequence728 199 528 gene locus_tag LOCUS_32180 199 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 533 1147 gene locus_tag LOCUS_32190 533 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 1177 1578 gene locus_tag LOCUS_32200 1177 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965203.1 protein_id gnl|my_center|LOCUS_32200 1583 1852 gene locus_tag LOCUS_32210 1583 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 1849 2151 gene locus_tag LOCUS_32220 1849 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 2148 2423 gene locus_tag LOCUS_32230 2148 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 >Feature sequence729 >Feature sequence730 119 586 gene locus_tag LOCUS_32240 119 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 >Feature sequence731 391 1203 gene locus_tag LOCUS_32250 391 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 >Feature sequence732 576 178 gene locus_tag LOCUS_32260 576 178 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_32260 1721 582 gene locus_tag LOCUS_32270 gene acdA 1721 582 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_32270 2615 1746 gene locus_tag LOCUS_32280 2615 1746 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_32280 >Feature sequence733 425 111 gene locus_tag LOCUS_32290 425 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 1021 1248 gene locus_tag LOCUS_32300 1021 1248 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405518.1 protein_id gnl|my_center|LOCUS_32300 1248 1646 gene locus_tag LOCUS_32310 1248 1646 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_32310 1753 1677 gene locus_tag LOCUS_t00470 1753 1677 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2295 1789 gene locus_tag LOCUS_32320 2295 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 >Feature sequence734 >Feature sequence735 104 1405 gene locus_tag LOCUS_32330 104 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 1405 2655 gene locus_tag LOCUS_32340 1405 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence736 >Feature sequence737 1060 401 gene locus_tag LOCUS_32350 1060 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 >Feature sequence738 28 492 gene locus_tag LOCUS_32360 28 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 1371 499 gene locus_tag LOCUS_32370 1371 499 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence739 1920 1033 gene locus_tag LOCUS_32380 gene xerD 1920 1033 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_32380 <2700 1917 gene locus_tag LOCUS_32390 <2700 1917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545784.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence740 27 1025 gene locus_tag LOCUS_32400 27 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 2415 1054 gene locus_tag LOCUS_32410 2415 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 >Feature sequence741 21 2087 gene locus_tag LOCUS_32420 gene uvrB 21 2087 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_32420 >Feature sequence742 1365 328 gene locus_tag LOCUS_32430 gene galE 1365 328 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967679.1 protein_id gnl|my_center|LOCUS_32430 1364 2515 gene locus_tag LOCUS_32440 1364 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 >Feature sequence743 <1 1988 gene locus_tag LOCUS_32450 <1 1988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928481.1:S9 family peptidase 2520 2122 gene locus_tag LOCUS_32460 2520 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence744 750 1682 gene locus_tag LOCUS_32470 750 1682 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_32470 2259 1690 gene locus_tag LOCUS_32480 gene pgsA 2259 1690 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_32480 >Feature sequence745 <1 1467 gene locus_tag LOCUS_32490 <1 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403684.1:Mur ligase family protein 1574 2605 gene locus_tag LOCUS_32500 gene recA 1574 2605 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088499.1 protein_id gnl|my_center|LOCUS_32500 >Feature sequence746 <1 1507 gene locus_tag LOCUS_32510 <1 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004534035.1:ABC transporter ATP-binding protein >Feature sequence747 207 704 gene locus_tag LOCUS_32520 207 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 1110 715 gene locus_tag LOCUS_32530 1110 715 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227307.1 protein_id gnl|my_center|LOCUS_32530 2003 1107 gene locus_tag LOCUS_32540 2003 1107 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_32540 >Feature sequence748 818 45 gene locus_tag LOCUS_32550 gene folP 818 45 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930173.1 protein_id gnl|my_center|LOCUS_32550 <2674 846 gene locus_tag LOCUS_32560 <2674 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938574.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence749 >Feature sequence750 1793 1074 gene locus_tag LOCUS_32570 gene sfsA 1793 1074 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_32570 2229 1837 gene locus_tag LOCUS_32580 2229 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 >Feature sequence751 481 1092 gene locus_tag LOCUS_32590 481 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence752 602 1558 gene locus_tag LOCUS_32600 602 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 1629 2138 gene locus_tag LOCUS_32610 1629 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence753 310 921 gene locus_tag LOCUS_32620 310 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 923 1864 gene locus_tag LOCUS_32630 923 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 1861 2460 gene locus_tag LOCUS_32640 1861 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 >Feature sequence754 >Feature sequence755 >Feature sequence756 <1 1922 gene locus_tag LOCUS_32650 <1 1922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532354.1:pitrilysin family protein >Feature sequence757 2576 3 gene locus_tag LOCUS_32660 2576 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 >Feature sequence758 >Feature sequence759 1109 189 gene locus_tag LOCUS_32670 1109 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 2164 1160 gene locus_tag LOCUS_32680 2164 1160 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_32680 2614 2207 gene locus_tag LOCUS_32690 2614 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence760 <1 1077 gene locus_tag LOCUS_32700 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha 1087 1629 gene locus_tag LOCUS_32710 1087 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 1709 2008 gene locus_tag LOCUS_32720 1709 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 2509 2090 gene locus_tag LOCUS_32730 2509 2090 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_32730 >Feature sequence761 >Feature sequence762 370 2454 gene locus_tag LOCUS_32740 370 2454 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_32740 >Feature sequence763 1913 516 gene locus_tag LOCUS_32750 1913 516 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_32750 >Feature sequence764 2517 340 gene locus_tag LOCUS_32760 2517 340 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence765 1473 274 gene locus_tag LOCUS_32770 1473 274 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_32770 1577 2077 gene locus_tag LOCUS_32780 1577 2077 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228998.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32780 >Feature sequence766 1167 433 gene locus_tag LOCUS_32790 1167 433 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_32790 2603 1362 gene locus_tag LOCUS_32800 2603 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 >Feature sequence767 <1 901 gene locus_tag LOCUS_32810 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530099.1:amidohydrolase 898 1875 gene locus_tag LOCUS_32820 gene mltG 898 1875 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_32820 1901 2338 gene locus_tag LOCUS_32830 1901 2338 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174926.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence768 48 1301 gene locus_tag LOCUS_32840 gene sat 48 1301 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_32840 1869 1360 gene locus_tag LOCUS_32850 1869 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence769 2361 1135 gene locus_tag LOCUS_32860 2361 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 >Feature sequence770 95 2575 gene locus_tag LOCUS_32870 95 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 >Feature sequence771 >Feature sequence772 68 1045 gene locus_tag LOCUS_32880 68 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 1049 2515 gene locus_tag LOCUS_32890 1049 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence773 2050 1331 gene locus_tag LOCUS_32900 2050 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 >Feature sequence774 <2570 618 gene locus_tag LOCUS_32910 <2570 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083688.1:DISARM system helicase DrmA >Feature sequence775 39 857 gene locus_tag LOCUS_32920 gene tatC 39 857 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461250.1 protein_id gnl|my_center|LOCUS_32920 2502 868 gene locus_tag LOCUS_32930 2502 868 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_32930 >Feature sequence776 1462 578 gene locus_tag LOCUS_32940 1462 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence777 <1 785 gene locus_tag LOCUS_32950 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972373.1:dipeptidase 1844 795 gene locus_tag LOCUS_32960 1844 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 >Feature sequence778 522 1718 gene locus_tag LOCUS_32970 522 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 >Feature sequence779 4 1359 gene locus_tag LOCUS_32980 4 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 <2563 1433 gene locus_tag LOCUS_32990 <2563 1433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907984.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence780 <1 728 gene locus_tag LOCUS_33000 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004539133.1:Hsp70 family protein >Feature sequence781 >Feature sequence782 1046 87 gene locus_tag LOCUS_33010 1046 87 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065910.1 protein_id gnl|my_center|LOCUS_33010 2164 1100 gene locus_tag LOCUS_33020 2164 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence783 80 556 gene locus_tag LOCUS_33030 gene tsaA 80 556 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041917352.1 protein_id gnl|my_center|LOCUS_33030 622 810 gene locus_tag LOCUS_33040 622 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 2440 878 gene locus_tag LOCUS_33050 gene ppx 2440 878 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_33050 >Feature sequence784 <1 1061 gene locus_tag LOCUS_33060 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532998.1:acetolactate synthase large subunit 1074 2534 gene locus_tag LOCUS_33070 1074 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence785 1946 1395 gene locus_tag LOCUS_33080 1946 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 <2545 1966 gene locus_tag LOCUS_33090 <2545 1966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123491.1:SCO family protein >Feature sequence786 <1 1179 gene locus_tag LOCUS_33100 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268603.1:ATP-binding protein >Feature sequence787 151 1254 gene locus_tag LOCUS_33110 151 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 1268 1747 gene locus_tag LOCUS_33120 1268 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence788 <1 1055 gene locus_tag LOCUS_33130 <1 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227145.1:phosphatidylinositol mannoside acyltransferase 1082 1603 gene locus_tag LOCUS_33140 1082 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 <2532 1610 gene locus_tag LOCUS_33150 <2532 1610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057307.1:radical SAM protein >Feature sequence789 <1 762 gene locus_tag LOCUS_33160 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867352.1:TldD/PmbA family protein 771 2393 gene locus_tag LOCUS_33170 771 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 >Feature sequence790 667 128 gene locus_tag LOCUS_33180 667 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 1110 670 gene locus_tag LOCUS_33190 1110 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 2358 1216 gene locus_tag LOCUS_33200 2358 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 >Feature sequence791 1332 364 gene locus_tag LOCUS_33210 1332 364 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918602.1 protein_id gnl|my_center|LOCUS_33210 1606 2040 gene locus_tag LOCUS_33220 gene efp 1606 2040 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33220 >Feature sequence792 >Feature sequence793 <1 2377 gene locus_tag LOCUS_33230 <1 2377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390371.1:S49 family peptidase >Feature sequence794 169 1602 gene locus_tag LOCUS_33240 169 1602 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147298.1 protein_id gnl|my_center|LOCUS_33240 >Feature sequence795 <2506 854 gene locus_tag LOCUS_33250 <2506 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha >Feature sequence796 608 159 gene locus_tag LOCUS_33260 608 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 726 1301 gene locus_tag LOCUS_33270 726 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 >Feature sequence797 <1 1845 gene locus_tag LOCUS_33280 <1 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941675.1:lytic transglycosylase domain-containing protein >Feature sequence798 175 1002 gene locus_tag LOCUS_33290 175 1002 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_33290 2329 1007 gene locus_tag LOCUS_33300 2329 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 >Feature sequence799 749 1699 gene locus_tag LOCUS_33310 749 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 >Feature sequence800 1477 2466 gene locus_tag LOCUS_33320 1477 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 >Feature sequence801 2235 1222 gene locus_tag LOCUS_33330 2235 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence802 29 760 gene locus_tag LOCUS_33340 29 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 2332 884 gene locus_tag LOCUS_33350 2332 884 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889250.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence803 <1 1441 gene locus_tag LOCUS_33360 <1 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083352.1:OmpA family protein note possible pseudo, internal stop codon, frameshifted 2305 1448 gene locus_tag LOCUS_33370 2305 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 >Feature sequence804 167 847 gene locus_tag LOCUS_33380 167 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 2053 857 gene locus_tag LOCUS_33390 2053 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 >Feature sequence805 1265 33 gene locus_tag LOCUS_33400 1265 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 1692 1267 gene locus_tag LOCUS_33410 1692 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence806 17 1858 gene locus_tag LOCUS_33420 gene hscA 17 1858 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 protein_id gnl|my_center|LOCUS_33420 >Feature sequence807 >Feature sequence808 2384 501 gene locus_tag LOCUS_33430 2384 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 >Feature sequence809 788 1009 gene locus_tag LOCUS_33440 788 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 1324 1019 gene locus_tag LOCUS_33450 1324 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 1477 1887 gene locus_tag LOCUS_33460 1477 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence810 314 1423 gene locus_tag LOCUS_33470 314 1423 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390553.1 protein_id gnl|my_center|LOCUS_33470 1416 2432 gene locus_tag LOCUS_33480 1416 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence811 1985 948 gene locus_tag LOCUS_33490 1985 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 >Feature sequence812 <1 1242 gene locus_tag LOCUS_33500 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404940.1:argininosuccinate synthase 1239 2294 gene locus_tag LOCUS_33510 1239 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404941.1 protein_id gnl|my_center|LOCUS_33510 >Feature sequence813 <1 939 gene locus_tag LOCUS_33520 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680113.1:DUF368 domain-containing protein 2403 949 gene locus_tag LOCUS_33530 2403 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence814 1173 4 gene locus_tag LOCUS_33540 gene recF 1173 4 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 protein_id gnl|my_center|LOCUS_33540 2342 1221 gene locus_tag LOCUS_33550 gene dnaN 2342 1221 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_33550 >Feature sequence815 >Feature sequence816 70 519 gene locus_tag LOCUS_33560 70 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 1392 529 gene locus_tag LOCUS_33570 1392 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 <2432 1546 gene locus_tag LOCUS_33580 <2432 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha >Feature sequence817 277 1611 gene locus_tag LOCUS_33590 277 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence818 <1 1191 gene locus_tag LOCUS_33600 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942081.1:ABC transporter permease 1181 2266 gene locus_tag LOCUS_33610 1181 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 >Feature sequence819 <1 1469 gene locus_tag LOCUS_33620 <1 1469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083686.1:DISARM system SNF2-like helicase DrmD >Feature sequence820 2193 700 gene locus_tag LOCUS_33630 2193 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 >Feature sequence821 1212 769 gene locus_tag LOCUS_33640 1212 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1570 2100 gene locus_tag LOCUS_33650 1570 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence822 1542 109 gene locus_tag LOCUS_33660 1542 109 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_33660 >Feature sequence823 1631 588 gene locus_tag LOCUS_33670 1631 588 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_33670 1917 1651 gene locus_tag LOCUS_33680 1917 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence824 1654 371 gene locus_tag LOCUS_33690 1654 371 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939821.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence825 1547 492 gene locus_tag LOCUS_33700 gene cobT 1547 492 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631396.1 protein_id gnl|my_center|LOCUS_33700 <2394 1549 gene locus_tag LOCUS_33710 <2394 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926109.1:cobyric acid synthase >Feature sequence826 >Feature sequence827 1954 923 gene locus_tag LOCUS_33720 1954 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence828 >Feature sequence829 701 543 gene locus_tag LOCUS_33730 701 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 792 1046 gene locus_tag LOCUS_33740 792 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 <2387 1059 gene locus_tag LOCUS_33750 <2387 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767086.1:SpoIID/LytB domain-containing protein >Feature sequence830 821 1996 gene locus_tag LOCUS_33760 821 1996 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533145.1 protein_id gnl|my_center|LOCUS_33760 >Feature sequence831 >Feature sequence832 802 98 gene locus_tag LOCUS_33770 802 98 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972258.1 protein_id gnl|my_center|LOCUS_33770 972 1946 gene locus_tag LOCUS_33780 gene fabD 972 1946 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_33780 >Feature sequence833 186 668 gene locus_tag LOCUS_33790 186 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056178.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence834 23 1966 gene locus_tag LOCUS_33800 23 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 >Feature sequence835 1201 374 gene locus_tag LOCUS_33810 1201 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 1599 2072 gene locus_tag LOCUS_33820 1599 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence836 1171 41 gene locus_tag LOCUS_33830 1171 41 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705342.1 protein_id gnl|my_center|LOCUS_33830 1576 1199 gene locus_tag LOCUS_33840 1576 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 >Feature sequence837 140 814 gene locus_tag LOCUS_33850 140 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 2274 871 gene locus_tag LOCUS_33860 2274 871 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921823.1 protein_id gnl|my_center|LOCUS_33860 >Feature sequence838 2145 226 gene locus_tag LOCUS_33870 2145 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 >Feature sequence839 <1 726 gene locus_tag LOCUS_33880 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha 726 1730 gene locus_tag LOCUS_33890 726 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 >Feature sequence840 <2353 432 gene locus_tag LOCUS_33900 <2353 432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928646.1:FG-GAP-like repeat-containing protein >Feature sequence841 951 1232 gene locus_tag LOCUS_33910 951 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 2303 1281 gene locus_tag LOCUS_33920 gene ychF 2303 1281 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_33920 >Feature sequence842 1780 704 gene locus_tag LOCUS_33930 1780 704 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403047.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33930 >Feature sequence843 >Feature sequence844 71 340 gene locus_tag LOCUS_33940 71 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 355 777 gene locus_tag LOCUS_33950 355 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 1381 782 gene locus_tag LOCUS_33960 1381 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 1493 1702 gene locus_tag LOCUS_33970 1493 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 2135 1689 gene locus_tag LOCUS_33980 2135 1689 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_33980 >Feature sequence845 <1 827 gene locus_tag LOCUS_33990 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000372351.1:ethanolamine ammonia-lyase subunit EutC 824 1480 gene locus_tag LOCUS_34000 gene eutL 824 1480 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462275.1 protein_id gnl|my_center|LOCUS_34000 1783 1487 gene locus_tag LOCUS_34010 1783 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 >Feature sequence846 <1 786 gene locus_tag LOCUS_34020 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938003.1:cytochrome c family protein 851 1324 gene locus_tag LOCUS_34030 851 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 >Feature sequence847 171 1040 gene locus_tag LOCUS_34040 gene accD 171 1040 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141604.1 protein_id gnl|my_center|LOCUS_34040 1037 2296 gene locus_tag LOCUS_34050 1037 2296 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_34050 >Feature sequence848 1799 171 gene locus_tag LOCUS_34060 gene ubiB 1799 171 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_34060 >Feature sequence849 188 361 gene locus_tag LOCUS_34070 188 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 470 1705 gene locus_tag LOCUS_34080 470 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence850 1623 667 gene locus_tag LOCUS_34090 1623 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 2261 1614 gene locus_tag LOCUS_34100 2261 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 >Feature sequence851 1722 1207 gene locus_tag LOCUS_34110 1722 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 >Feature sequence852 <1 835 gene locus_tag LOCUS_34120 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545037.1:diadenylate cyclase CdaA 832 1833 gene locus_tag LOCUS_34130 832 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 >Feature sequence853 1245 394 gene locus_tag LOCUS_34140 1245 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 1476 1961 gene locus_tag LOCUS_34150 1476 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 >Feature sequence854 2035 1070 gene locus_tag LOCUS_34160 2035 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 >Feature sequence855 1342 623 gene locus_tag LOCUS_34170 1342 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 >Feature sequence856 1740 1219 gene locus_tag LOCUS_34180 1740 1219 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217433129.1 protein_id gnl|my_center|LOCUS_34180 >Feature sequence857 871 2091 gene locus_tag LOCUS_34190 871 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 >Feature sequence858 710 24 gene locus_tag LOCUS_34200 710 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 <2273 786 gene locus_tag LOCUS_34210 <2273 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha >Feature sequence859 <1 1777 gene locus_tag LOCUS_34220 <1 1777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093946795.1:amidohydrolase family protein 1821 2141 gene locus_tag LOCUS_34230 1821 2141 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633725.1 protein_id gnl|my_center|LOCUS_34230 >Feature sequence860 <1 1267 gene locus_tag LOCUS_34240 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230569.1:serine/threonine-protein kinase >Feature sequence861 1353 91 gene locus_tag LOCUS_34250 1353 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 2242 1340 gene locus_tag LOCUS_34260 2242 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 >Feature sequence862 1538 813 gene locus_tag LOCUS_34270 1538 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence863 465 2261 gene locus_tag LOCUS_34280 465 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence864 <1 524 gene locus_tag LOCUS_34290 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392690.1:class I SAM-dependent methyltransferase 1694 681 gene locus_tag LOCUS_34300 1694 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 >Feature sequence865 >Feature sequence866 596 201 gene locus_tag LOCUS_34310 596 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 <2254 607 gene locus_tag LOCUS_34320 <2254 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940735.1:CRISPR-associated endonuclease Cas1 >Feature sequence867 <1 1329 gene locus_tag LOCUS_34330 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064751.1:protein-disulfide reductase DsbD 2065 1343 gene locus_tag LOCUS_34340 2065 1343 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_34340 >Feature sequence868 >Feature sequence869 2157 898 gene locus_tag LOCUS_34350 2157 898 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403893.1 protein_id gnl|my_center|LOCUS_34350 >Feature sequence870 <2241 538 gene locus_tag LOCUS_34360 <2241 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389162.1:HAMP domain-containing methyl-accepting chemotaxis protein >Feature sequence871 34 1821 gene locus_tag LOCUS_34370 34 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 >Feature sequence872 <1 674 gene locus_tag LOCUS_34380 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404826.1:cytochrome c oxidase subunit 3 family protein 687 1037 gene locus_tag LOCUS_34390 687 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 1258 2193 gene locus_tag LOCUS_34400 gene mdh 1258 2193 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382961.1 protein_id gnl|my_center|LOCUS_34400 >Feature sequence873 >Feature sequence874 2098 161 gene locus_tag LOCUS_34410 2098 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 >Feature sequence875 >Feature sequence876 1109 1699 gene locus_tag LOCUS_34420 1109 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 >Feature sequence877 97 333 gene locus_tag LOCUS_34430 gene rpmB 97 333 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058293.1 protein_id gnl|my_center|LOCUS_34430 1683 400 gene locus_tag LOCUS_34440 1683 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 2190 1714 gene locus_tag LOCUS_34450 2190 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 >Feature sequence878 <1 1009 gene locus_tag LOCUS_34460 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392357.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence879 1121 1900 gene locus_tag LOCUS_34470 1121 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 >Feature sequence880 180 1991 gene locus_tag LOCUS_34480 180 1991 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_34480 >Feature sequence881 997 257 gene locus_tag LOCUS_34490 997 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 1157 1456 gene locus_tag LOCUS_34500 1157 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 1453 2184 gene locus_tag LOCUS_34510 1453 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 >Feature sequence882 660 22 gene locus_tag LOCUS_34520 660 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 1676 810 gene locus_tag LOCUS_34530 gene miaA 1676 810 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_34530 <2210 1679 gene locus_tag LOCUS_34540 <2210 1679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139982.1:DNA mismatch repair endonuclease MutL >Feature sequence883 1 942 gene locus_tag LOCUS_34550 1 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 956 1031 gene locus_tag LOCUS_t00480 956 1031 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1053 2009 gene locus_tag LOCUS_34560 1053 2009 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_34560 >Feature sequence884 159 1385 gene locus_tag LOCUS_34570 159 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 >Feature sequence885 <1 1498 gene locus_tag LOCUS_34580 <1 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838696.1:Na+/H+ antiporter NhaC family protein >Feature sequence886 >Feature sequence887 647 562 gene locus_tag LOCUS_t00490 647 562 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 827 1729 gene locus_tag LOCUS_34590 827 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence888 1149 529 gene locus_tag LOCUS_34600 1149 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 1357 1770 gene locus_tag LOCUS_34610 1357 1770 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223132.1 protein_id gnl|my_center|LOCUS_34610 >Feature sequence889 >Feature sequence890 933 82 gene locus_tag LOCUS_34620 933 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 >Feature sequence891 58 960 gene locus_tag LOCUS_34630 58 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 957 2036 gene locus_tag LOCUS_34640 957 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 >Feature sequence892 1552 797 gene locus_tag LOCUS_34650 1552 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 1593 2099 gene locus_tag LOCUS_34660 gene folE 1593 2099 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938082.1 protein_id gnl|my_center|LOCUS_34660 >Feature sequence893 2 1093 gene locus_tag LOCUS_34670 gene iolM 2 1093 CDS product scyllo-inosose 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083260.1 protein_id gnl|my_center|LOCUS_34670 1579 1097 gene locus_tag LOCUS_34680 gene tsaA 1579 1097 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_34680 2040 1576 gene locus_tag LOCUS_34690 2040 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 >Feature sequence894 126 1622 gene locus_tag LOCUS_34700 gene accC 126 1622 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_34700 1619 2122 gene locus_tag LOCUS_34710 1619 2122 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence895 835 212 gene locus_tag LOCUS_34720 835 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 1991 840 gene locus_tag LOCUS_34730 1991 840 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_34730 >Feature sequence896 1400 582 gene locus_tag LOCUS_34740 1400 582 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_34740 >Feature sequence897 53 922 gene locus_tag LOCUS_34750 gene hemC 53 922 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939176.1 protein_id gnl|my_center|LOCUS_34750 1735 932 gene locus_tag LOCUS_34760 1735 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 >Feature sequence898 5 946 gene locus_tag LOCUS_34770 5 946 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_34770 >Feature sequence899 373 1215 gene locus_tag LOCUS_34780 373 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 <2167 1222 gene locus_tag LOCUS_34790 <2167 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929963.1:C2 family cysteine protease >Feature sequence900 >Feature sequence901 <2164 992 gene locus_tag LOCUS_34800 <2164 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083435096.1:DUF4347 domain-containing protein >Feature sequence902 >Feature sequence903 320 27 gene locus_tag LOCUS_34810 320 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 1503 322 gene locus_tag LOCUS_34820 1503 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 >Feature sequence904 <1 2066 gene locus_tag LOCUS_34830 <1 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388279.1:chemotaxis protein CheW >Feature sequence905 >Feature sequence906 1073 998 gene locus_tag LOCUS_t00500 1073 998 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1534 1130 gene locus_tag LOCUS_34840 1534 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence907 28 738 gene locus_tag LOCUS_34850 28 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 2150 717 gene locus_tag LOCUS_34860 2150 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence908 >Feature sequence909 771 157 gene locus_tag LOCUS_34870 771 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 2122 944 gene locus_tag LOCUS_34880 2122 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 >Feature sequence910 95 442 gene locus_tag LOCUS_34890 95 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 439 1266 gene locus_tag LOCUS_34900 439 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 1829 2002 gene locus_tag LOCUS_34910 1829 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 >Feature sequence911 520 296 gene locus_tag LOCUS_34920 520 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 966 517 gene locus_tag LOCUS_34930 966 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 >Feature sequence912 <1 802 gene locus_tag LOCUS_34940 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938733.1:ribonuclease III 799 1734 gene locus_tag LOCUS_34950 799 1734 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_34950 >Feature sequence913 <1 1146 gene locus_tag LOCUS_34960 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009873545.1:menaquinone biosynthesis decarboxylase >Feature sequence914 2 481 gene locus_tag LOCUS_34970 2 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 478 1686 gene locus_tag LOCUS_34980 478 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 >Feature sequence915 185 1636 gene locus_tag LOCUS_34990 185 1636 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940888.1 protein_id gnl|my_center|LOCUS_34990 <2130 1605 gene locus_tag LOCUS_35000 <2130 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence916 2019 544 gene locus_tag LOCUS_35010 2019 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 >Feature sequence917 845 3 gene locus_tag LOCUS_35020 845 3 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_35020 <2113 925 gene locus_tag LOCUS_35030 <2113 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009970787.1:succinyldiaminopimelate transaminase >Feature sequence918 359 745 gene locus_tag LOCUS_35040 359 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 750 1064 gene locus_tag LOCUS_35050 750 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 1806 1087 gene locus_tag LOCUS_35060 1806 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 1805 2080 gene locus_tag LOCUS_35070 1805 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 >Feature sequence919 1693 293 gene locus_tag LOCUS_35080 1693 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence920 692 1222 gene locus_tag LOCUS_35090 692 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 1219 1887 gene locus_tag LOCUS_35100 1219 1887 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_35100 >Feature sequence921 >Feature sequence922 >Feature sequence923 1232 390 gene locus_tag LOCUS_35110 1232 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35110 2027 1512 gene locus_tag LOCUS_35120 2027 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence924 767 327 gene locus_tag LOCUS_35130 767 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 >Feature sequence925 <1 1524 gene locus_tag LOCUS_35140 <1 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877386.1:radical SAM protein >Feature sequence926 71 922 gene locus_tag LOCUS_35150 71 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 958 1896 gene locus_tag LOCUS_35160 958 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 >Feature sequence927 110 1210 gene locus_tag LOCUS_35170 110 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 1357 2031 gene locus_tag LOCUS_35180 1357 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 >Feature sequence928 204 497 gene locus_tag LOCUS_35190 204 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 2090 504 gene locus_tag LOCUS_35200 2090 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 >Feature sequence929 226 1608 gene locus_tag LOCUS_35210 226 1608 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_35210 >Feature sequence930 154 945 gene locus_tag LOCUS_35220 gene murQ 154 945 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889472.1 protein_id gnl|my_center|LOCUS_35220 >Feature sequence931 1922 675 gene locus_tag LOCUS_35230 1922 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence932 70 1587 gene locus_tag LOCUS_35240 70 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 >Feature sequence933 214 1902 gene locus_tag LOCUS_35250 214 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 >Feature sequence934 235 741 gene locus_tag LOCUS_35260 235 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 807 1145 gene locus_tag LOCUS_35270 807 1145 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_35270 1205 1504 gene locus_tag LOCUS_35280 1205 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 <2071 1505 gene locus_tag LOCUS_35290 <2071 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890466.1:HD family hydrolase >Feature sequence935 1682 57 gene locus_tag LOCUS_35300 1682 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence936 >Feature sequence937 >Feature sequence938 125 544 gene locus_tag LOCUS_35310 125 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 569 1849 gene locus_tag LOCUS_35320 569 1849 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_35320 1885 1960 gene locus_tag LOCUS_t00510 1885 1960 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1973 2049 gene locus_tag LOCUS_t00520 1973 2049 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence939 379 1680 gene locus_tag LOCUS_35330 379 1680 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 protein_id gnl|my_center|LOCUS_35330 >Feature sequence940 191 889 gene locus_tag LOCUS_35340 191 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 >Feature sequence941 2001 457 gene locus_tag LOCUS_35350 gene murJ 2001 457 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_35350 >Feature sequence942 650 411 gene locus_tag LOCUS_35360 650 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 971 729 gene locus_tag LOCUS_35370 971 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 1983 1027 gene locus_tag LOCUS_35380 1983 1027 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958609.1 protein_id gnl|my_center|LOCUS_35380 >Feature sequence943 >Feature sequence944 >Feature sequence945 98 172 gene locus_tag LOCUS_t00530 98 172 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 830 201 gene locus_tag LOCUS_35390 830 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 1977 925 gene locus_tag LOCUS_35400 1977 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 >Feature sequence946 181 513 gene locus_tag LOCUS_35410 181 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 >Feature sequence947 105 1151 gene locus_tag LOCUS_35420 105 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 <2039 1214 gene locus_tag LOCUS_35430 <2039 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140509.1:universal stress protein >Feature sequence948 1907 276 gene locus_tag LOCUS_35440 1907 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 >Feature sequence949 <1 929 gene locus_tag LOCUS_35450 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224439.1:sigma-70 family RNA polymerase sigma factor 1604 996 gene locus_tag LOCUS_35460 1604 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 >Feature sequence950 <1 906 gene locus_tag LOCUS_35470 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941108.1:putative 4-hydroxybenzoate polyprenyltransferase 997 1566 gene locus_tag LOCUS_35480 997 1566 CDS product heme-binding beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 protein_id gnl|my_center|LOCUS_35480 >Feature sequence951 548 1294 gene locus_tag LOCUS_35490 548 1294 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971554.1 protein_id gnl|my_center|LOCUS_35490 1960 1322 gene locus_tag LOCUS_35500 1960 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 >Feature sequence952 <1 943 gene locus_tag LOCUS_35510 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939506.1:translational GTPase TypA <2029 947 gene locus_tag LOCUS_35520 <2029 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056316.1:chorismate synthase >Feature sequence953 83 967 gene locus_tag LOCUS_35530 83 967 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_35530 <2025 1083 gene locus_tag LOCUS_35540 <2025 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha >Feature sequence954 118 696 gene locus_tag LOCUS_35550 118 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 1522 671 gene locus_tag LOCUS_35560 1522 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence955 442 627 gene locus_tag LOCUS_35570 442 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 >Feature sequence956 <1 1053 gene locus_tag LOCUS_35580 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005057169.1:recombinase RecA >Feature sequence957 571 1146 gene locus_tag LOCUS_35590 571 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 1097 1852 gene locus_tag LOCUS_35600 1097 1852 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 protein_id gnl|my_center|LOCUS_35600 >Feature sequence958 122 574 gene locus_tag LOCUS_35610 122 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 1528 584 gene locus_tag LOCUS_35620 gene trxB 1528 584 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_35620 >Feature sequence959 >Feature sequence960 655 401 gene locus_tag LOCUS_35630 655 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 <2012 722 gene locus_tag LOCUS_35640 <2012 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080616.1:LVIVD repeat-containing protein >Feature sequence961 >Feature sequence962 69 818 gene locus_tag LOCUS_35650 69 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 1443 844 gene locus_tag LOCUS_35660 1443 844 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240066.1 protein_id gnl|my_center|LOCUS_35660 >Feature sequence963 >Feature sequence964 >Feature sequence965 <1 576 gene locus_tag LOCUS_35670 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942393.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD 615 1088 gene locus_tag LOCUS_35680 615 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 1818 1090 gene locus_tag LOCUS_35690 1818 1090 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805196.1 protein_id gnl|my_center|LOCUS_35690 2003 1815 gene locus_tag LOCUS_35700 2003 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700