>Feature sequence001 2434 1955 gene locus_tag LOCUS_00010 2434 1955 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706967.1 protein_id gnl|my_center|LOCUS_00010 3165 2524 gene locus_tag LOCUS_00020 gene pilO 3165 2524 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_00020 3725 3162 gene locus_tag LOCUS_00030 3725 3162 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403038.1 protein_id gnl|my_center|LOCUS_00030 4795 3725 gene locus_tag LOCUS_00040 4795 3725 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_00040 5003 7438 gene locus_tag LOCUS_00050 5003 7438 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_00050 8650 7481 gene locus_tag LOCUS_00060 8650 7481 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400837.1 protein_id gnl|my_center|LOCUS_00060 8752 11655 gene locus_tag LOCUS_00070 gene glnE 8752 11655 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_00070 11870 12799 gene locus_tag LOCUS_00080 gene ilvE 11870 12799 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_00080 12916 13116 gene locus_tag LOCUS_00090 12916 13116 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_00090 13118 13681 gene locus_tag LOCUS_00100 gene gmhA 13118 13681 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942729.1 protein_id gnl|my_center|LOCUS_00100 14458 13712 gene locus_tag LOCUS_00110 14458 13712 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 protein_id gnl|my_center|LOCUS_00110 15817 14684 gene locus_tag LOCUS_00120 15817 14684 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_00120 17707 15881 gene locus_tag LOCUS_00130 gene asnB 17707 15881 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_00130 18856 17714 gene locus_tag LOCUS_00140 18856 17714 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_00140 19213 20334 gene locus_tag LOCUS_00150 19213 20334 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_00150 20335 21300 gene locus_tag LOCUS_00160 20335 21300 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065032.1 protein_id gnl|my_center|LOCUS_00160 21363 22649 gene locus_tag LOCUS_00170 21363 22649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22646 23671 gene locus_tag LOCUS_00180 gene waaF 22646 23671 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_00180 23668 24771 gene locus_tag LOCUS_00190 23668 24771 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925698.1 protein_id gnl|my_center|LOCUS_00190 25012 26082 gene locus_tag LOCUS_00200 25012 26082 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_00200 26161 27576 gene locus_tag LOCUS_00210 gene hldE 26161 27576 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404685.1 protein_id gnl|my_center|LOCUS_00210 27582 28175 gene locus_tag LOCUS_00220 27582 28175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 28233 28601 gene locus_tag LOCUS_00230 28233 28601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 28734 29306 gene locus_tag LOCUS_00240 28734 29306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29310 29915 gene locus_tag LOCUS_00250 29310 29915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29938 31254 gene locus_tag LOCUS_00260 29938 31254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817955.1 protein_id gnl|my_center|LOCUS_00260 31375 32358 gene locus_tag LOCUS_00270 31375 32358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 33044 32595 gene locus_tag LOCUS_00280 33044 32595 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 protein_id gnl|my_center|LOCUS_00280 34255 33056 gene locus_tag LOCUS_00290 34255 33056 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_00290 35957 34488 gene locus_tag LOCUS_00300 gene cetA 35957 34488 CDS product bipartate energy taxis response protein CetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002790076.1 protein_id gnl|my_center|LOCUS_00300 36450 35926 gene locus_tag LOCUS_00310 36450 35926 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_00310 37578 36598 gene locus_tag LOCUS_00320 gene moaA 37578 36598 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092949.1 protein_id gnl|my_center|LOCUS_00320 38671 37697 gene locus_tag LOCUS_00330 38671 37697 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188558.1 protein_id gnl|my_center|LOCUS_00330 39477 38746 gene locus_tag LOCUS_00340 39477 38746 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187972.1 protein_id gnl|my_center|LOCUS_00340 42388 39569 gene locus_tag LOCUS_00350 42388 39569 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 protein_id gnl|my_center|LOCUS_00350 44269 42650 gene locus_tag LOCUS_00360 44269 42650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 44745 44305 gene locus_tag LOCUS_00370 44745 44305 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943168.1 protein_id gnl|my_center|LOCUS_00370 45779 44757 gene locus_tag LOCUS_00380 45779 44757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 46215 47501 gene locus_tag LOCUS_00390 46215 47501 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_00390 47505 49760 gene locus_tag LOCUS_00400 47505 49760 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545086.1 protein_id gnl|my_center|LOCUS_00400 49776 50393 gene locus_tag LOCUS_00410 49776 50393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50408 51313 gene locus_tag LOCUS_00420 50408 51313 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_00420 51658 52941 gene locus_tag LOCUS_00430 gene waaA 51658 52941 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_00430 54092 53169 gene locus_tag LOCUS_00440 54092 53169 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_00440 54271 55305 gene locus_tag LOCUS_00450 54271 55305 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_00450 56749 55418 gene locus_tag LOCUS_00460 gene tolC 56749 55418 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944694.1 protein_id gnl|my_center|LOCUS_00460 57526 56867 gene locus_tag LOCUS_00470 57526 56867 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_00470 58863 57643 gene locus_tag LOCUS_00480 58863 57643 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_00480 60950 59205 gene locus_tag LOCUS_00490 gene lpdA 60950 59205 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086503.1 protein_id gnl|my_center|LOCUS_00490 62246 60963 gene locus_tag LOCUS_00500 62246 60963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00500 64920 62260 gene locus_tag LOCUS_00510 gene aceE 64920 62260 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811941.1 protein_id gnl|my_center|LOCUS_00510 65865 65239 gene locus_tag LOCUS_00520 65865 65239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 66708 65959 gene locus_tag LOCUS_00530 66708 65959 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_00530 67338 69881 gene locus_tag LOCUS_00540 67338 69881 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_00540 69914 70144 gene locus_tag LOCUS_00550 69914 70144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 70243 71301 gene locus_tag LOCUS_00560 gene pyrC 70243 71301 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_00560 71362 72027 gene locus_tag LOCUS_00570 gene rnt 71362 72027 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_00570 72083 73933 gene locus_tag LOCUS_00580 72083 73933 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_00580 74495 74160 gene locus_tag LOCUS_00590 gene grxD 74495 74160 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_00590 76483 74612 gene locus_tag LOCUS_00600 76483 74612 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969278.1 protein_id gnl|my_center|LOCUS_00600 76766 77488 gene locus_tag LOCUS_00610 76766 77488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 78160 77837 gene locus_tag LOCUS_00620 78160 77837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 78707 78093 gene locus_tag LOCUS_00630 78707 78093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 80406 78853 gene locus_tag LOCUS_00640 80406 78853 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_00640 81233 81658 gene locus_tag LOCUS_00650 81233 81658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 82567 81773 gene locus_tag LOCUS_00660 82567 81773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 82851 83810 gene locus_tag LOCUS_00670 gene cysB 82851 83810 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382487.1 protein_id gnl|my_center|LOCUS_00670 84419 83829 gene locus_tag LOCUS_00680 84419 83829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 84484 84687 gene locus_tag LOCUS_00690 84484 84687 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944062.1 protein_id gnl|my_center|LOCUS_00690 84698 85075 gene locus_tag LOCUS_00700 84698 85075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 85076 85555 gene locus_tag LOCUS_00710 85076 85555 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387043.1 protein_id gnl|my_center|LOCUS_00710 86566 85667 gene locus_tag LOCUS_00720 86566 85667 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_00720 88028 86736 gene locus_tag LOCUS_00730 88028 86736 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_00730 89002 88025 gene locus_tag LOCUS_00740 89002 88025 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_00740 89505 88999 gene locus_tag LOCUS_00750 gene pyrR 89505 88999 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_00750 89957 89502 gene locus_tag LOCUS_00760 gene ruvX 89957 89502 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 protein_id gnl|my_center|LOCUS_00760 90520 89954 gene locus_tag LOCUS_00770 90520 89954 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461717.1 protein_id gnl|my_center|LOCUS_00770 91483 90644 gene locus_tag LOCUS_00780 91483 90644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 92501 91614 gene locus_tag LOCUS_00790 92501 91614 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_00790 93052 92504 gene locus_tag LOCUS_00800 gene eetB 93052 92504 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_00800 93558 93187 gene locus_tag LOCUS_00810 93558 93187 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015709088.1 protein_id gnl|my_center|LOCUS_00810 94602 93559 gene locus_tag LOCUS_00820 94602 93559 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_00820 95558 94599 gene locus_tag LOCUS_00830 gene gshB 95558 94599 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100943.1 protein_id gnl|my_center|LOCUS_00830 96021 96428 gene locus_tag LOCUS_00840 gene pilG 96021 96428 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_00840 96489 96857 gene locus_tag LOCUS_00850 gene pilH 96489 96857 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_00850 96873 97412 gene locus_tag LOCUS_00860 96873 97412 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_00860 97536 99560 gene locus_tag LOCUS_00870 gene pilJ 97536 99560 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_00870 99621 100508 gene locus_tag LOCUS_00880 gene pilK 99621 100508 CDS product type 4 fimbrial methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_00880 100534 106851 gene locus_tag LOCUS_00890 100534 106851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 106869 107864 gene locus_tag LOCUS_00900 106869 107864 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118811.1 protein_id gnl|my_center|LOCUS_00900 107916 108419 gene locus_tag LOCUS_00910 107916 108419 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769407.1 protein_id gnl|my_center|LOCUS_00910 109933 108584 gene locus_tag LOCUS_00920 109933 108584 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106128.1 protein_id gnl|my_center|LOCUS_00920 112174 110141 gene locus_tag LOCUS_00930 gene recG 112174 110141 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_00930 112634 112329 gene locus_tag LOCUS_00940 112634 112329 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 protein_id gnl|my_center|LOCUS_00940 113670 112840 gene locus_tag LOCUS_00950 113670 112840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_00950 113941 114339 gene locus_tag LOCUS_00960 113941 114339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 114758 114369 gene locus_tag LOCUS_00970 114758 114369 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_00970 116996 114819 gene locus_tag LOCUS_00980 gene spoT 116996 114819 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_00980 117288 117028 gene locus_tag LOCUS_00990 gene rpoZ 117288 117028 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096602.1 protein_id gnl|my_center|LOCUS_00990 117747 118202 gene locus_tag LOCUS_01000 117747 118202 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261212.1 protein_id gnl|my_center|LOCUS_01000 119010 118285 gene locus_tag LOCUS_01010 119010 118285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 >Feature sequence002 5 2791 gene locus_tag LOCUS_01020 gene topA 5 2791 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295576.1 protein_id gnl|my_center|LOCUS_01020 2808 3215 gene locus_tag LOCUS_01030 2808 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3468 3791 gene locus_tag LOCUS_01040 3468 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 4494 3904 gene locus_tag LOCUS_01050 4494 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 4723 4980 gene locus_tag LOCUS_01060 4723 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 5779 5435 gene locus_tag LOCUS_01070 5779 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01070 6338 5715 gene locus_tag LOCUS_01080 6338 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01080 6549 6370 gene locus_tag LOCUS_01090 6549 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 6570 7562 gene locus_tag LOCUS_01100 6570 7562 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_01100 7598 7834 gene locus_tag LOCUS_01110 7598 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 9131 7962 gene locus_tag LOCUS_01120 9131 7962 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990431.1 protein_id gnl|my_center|LOCUS_01120 10181 9144 gene locus_tag LOCUS_01130 gene pilT 10181 9144 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_01130 10315 11016 gene locus_tag LOCUS_01140 10315 11016 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_01140 11067 11894 gene locus_tag LOCUS_01150 gene proC 11067 11894 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275316.1 protein_id gnl|my_center|LOCUS_01150 11894 12475 gene locus_tag LOCUS_01160 11894 12475 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_01160 12472 12759 gene locus_tag LOCUS_01170 gene yggU 12472 12759 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707385.1 protein_id gnl|my_center|LOCUS_01170 12918 14909 gene locus_tag LOCUS_01180 12918 14909 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_01180 15369 14917 gene locus_tag LOCUS_01190 15369 14917 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948236.1 protein_id gnl|my_center|LOCUS_01190 15621 15989 gene locus_tag LOCUS_01200 15621 15989 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 protein_id gnl|my_center|LOCUS_01200 16150 16986 gene locus_tag LOCUS_01210 16150 16986 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948238.1 protein_id gnl|my_center|LOCUS_01210 17535 17056 gene locus_tag LOCUS_01220 17535 17056 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 protein_id gnl|my_center|LOCUS_01220 18677 17538 gene locus_tag LOCUS_01230 gene dprA 18677 17538 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_01230 19826 18795 gene locus_tag LOCUS_01240 19826 18795 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_01240 20070 20573 gene locus_tag LOCUS_01250 gene def 20070 20573 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401459.1 protein_id gnl|my_center|LOCUS_01250 20618 21562 gene locus_tag LOCUS_01260 gene fmt 20618 21562 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266132.1 protein_id gnl|my_center|LOCUS_01260 21559 22875 gene locus_tag LOCUS_01270 gene rsmB 21559 22875 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_01270 22842 23453 gene locus_tag LOCUS_01280 22842 23453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 23450 25687 gene locus_tag LOCUS_01290 23450 25687 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_01290 25684 27030 gene locus_tag LOCUS_01300 25684 27030 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941477.1 protein_id gnl|my_center|LOCUS_01300 27057 28430 gene locus_tag LOCUS_01310 gene trkA 27057 28430 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_01310 28444 29895 gene locus_tag LOCUS_01320 28444 29895 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465049.1 protein_id gnl|my_center|LOCUS_01320 29908 30558 gene locus_tag LOCUS_01330 29908 30558 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_01330 32319 30550 gene locus_tag LOCUS_01340 32319 30550 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_01340 32470 35208 gene locus_tag LOCUS_01350 32470 35208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 36007 35321 gene locus_tag LOCUS_01360 36007 35321 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_01360 36419 36015 gene locus_tag LOCUS_01370 36419 36015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 37588 36425 gene locus_tag LOCUS_01380 37588 36425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 38036 37650 gene locus_tag LOCUS_01390 38036 37650 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889330.1 protein_id gnl|my_center|LOCUS_01390 39036 38584 gene locus_tag LOCUS_01400 39036 38584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 39376 39041 gene locus_tag LOCUS_01410 39376 39041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 40698 39529 gene locus_tag LOCUS_01420 gene dinB 40698 39529 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 protein_id gnl|my_center|LOCUS_01420 40776 41948 gene locus_tag LOCUS_01430 gene hemW 40776 41948 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_01430 42009 42557 gene locus_tag LOCUS_01440 42009 42557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 42824 42564 gene locus_tag LOCUS_01450 42824 42564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 43161 43529 gene locus_tag LOCUS_01460 43161 43529 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_01460 43540 44295 gene locus_tag LOCUS_01470 43540 44295 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880615.1 protein_id gnl|my_center|LOCUS_01470 45147 44425 gene locus_tag LOCUS_01480 45147 44425 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_01480 45862 45221 gene locus_tag LOCUS_01490 gene pyrE 45862 45221 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094889.1 protein_id gnl|my_center|LOCUS_01490 45978 46775 gene locus_tag LOCUS_01500 45978 46775 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_01500 47478 46804 gene locus_tag LOCUS_01510 gene radC 47478 46804 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_01510 47831 49030 gene locus_tag LOCUS_01520 gene coaBC 47831 49030 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_01520 49922 49083 gene locus_tag LOCUS_01530 49922 49083 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060859.1 protein_id gnl|my_center|LOCUS_01530 50731 49934 gene locus_tag LOCUS_01540 gene fetB 50731 49934 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_01540 51333 50728 gene locus_tag LOCUS_01550 51333 50728 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_01550 51599 51330 gene locus_tag LOCUS_01560 gene cdd1 51599 51330 CDS product protein Cdd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888450.1 protein_id gnl|my_center|LOCUS_01560 51710 52369 gene locus_tag LOCUS_01570 51710 52369 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_01570 52460 55120 gene locus_tag LOCUS_01580 gene pepN 52460 55120 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_01580 55126 55554 gene locus_tag LOCUS_01590 gene gloA 55126 55554 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_01590 56692 55982 gene locus_tag LOCUS_01600 gene bioD 56692 55982 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103336.1 protein_id gnl|my_center|LOCUS_01600 57528 56692 gene locus_tag LOCUS_01610 gene bioC 57528 56692 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_01610 58310 57528 gene locus_tag LOCUS_01620 gene bioH 58310 57528 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208922.1 protein_id gnl|my_center|LOCUS_01620 59461 58307 gene locus_tag LOCUS_01630 gene bioF 59461 58307 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_01630 60498 59473 gene locus_tag LOCUS_01640 gene bioB 60498 59473 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_01640 60648 61298 gene locus_tag LOCUS_01650 60648 61298 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_01650 61889 61311 gene locus_tag LOCUS_01660 61889 61311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 62171 62016 gene locus_tag LOCUS_01670 gene rpmG 62171 62016 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004410866.1 protein_id gnl|my_center|LOCUS_01670 62444 62208 gene locus_tag LOCUS_01680 gene rpmB 62444 62208 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014822.1 protein_id gnl|my_center|LOCUS_01680 62632 63348 gene locus_tag LOCUS_01690 gene rph 62632 63348 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_01690 63715 64329 gene locus_tag LOCUS_01700 63715 64329 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174736.1 protein_id gnl|my_center|LOCUS_01700 64686 64943 gene locus_tag LOCUS_01710 64686 64943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 65206 66684 gene locus_tag LOCUS_01720 gene qseE 65206 66684 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309666.1 protein_id gnl|my_center|LOCUS_01720 66681 67289 gene locus_tag LOCUS_01730 66681 67289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 67286 68647 gene locus_tag LOCUS_01740 gene glrR 67286 68647 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098304.1 protein_id gnl|my_center|LOCUS_01740 69285 69791 gene locus_tag LOCUS_01750 69285 69791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 70303 69923 gene locus_tag LOCUS_01760 70303 69923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 70416 72770 gene locus_tag LOCUS_01770 70416 72770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 72770 73846 gene locus_tag LOCUS_01780 gene mutY 72770 73846 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957904.1 protein_id gnl|my_center|LOCUS_01780 74013 74291 gene locus_tag LOCUS_01790 74013 74291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 74288 74602 gene locus_tag LOCUS_01800 74288 74602 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_01800 74942 74700 gene locus_tag LOCUS_01810 74942 74700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 75033 75404 gene locus_tag LOCUS_01820 75033 75404 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918475.1 protein_id gnl|my_center|LOCUS_01820 76320 75544 gene locus_tag LOCUS_01830 76320 75544 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266523.1 protein_id gnl|my_center|LOCUS_01830 76644 76916 gene locus_tag LOCUS_01840 76644 76916 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_01840 76957 77355 gene locus_tag LOCUS_01850 76957 77355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 77352 77780 gene locus_tag LOCUS_01860 77352 77780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 78143 77784 gene locus_tag LOCUS_01870 78143 77784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 78145 78612 gene locus_tag LOCUS_01880 78145 78612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 78612 79139 gene locus_tag LOCUS_01890 78612 79139 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_01890 79657 79172 gene locus_tag LOCUS_01900 79657 79172 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_01900 80075 79689 gene locus_tag LOCUS_01910 gene msrB 80075 79689 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_01910 81213 80116 gene locus_tag LOCUS_01920 81213 80116 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_01920 82106 81363 gene locus_tag LOCUS_01930 82106 81363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 82312 83895 gene locus_tag LOCUS_01940 gene gshA 82312 83895 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_01940 84283 83969 gene locus_tag LOCUS_01950 84283 83969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 85236 84688 gene locus_tag LOCUS_01960 85236 84688 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400460.1 protein_id gnl|my_center|LOCUS_01960 86249 85422 gene locus_tag LOCUS_01970 86249 85422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 86589 89420 gene locus_tag LOCUS_01980 86589 89420 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103041.1 protein_id gnl|my_center|LOCUS_01980 90192 89395 gene locus_tag LOCUS_01990 90192 89395 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_01990 90988 90209 gene locus_tag LOCUS_02000 gene rsmA 90988 90209 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_02000 92007 90985 gene locus_tag LOCUS_02010 gene pdxA 92007 90985 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241277.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence003 22 975 gene locus_tag LOCUS_02020 gene msrP 22 975 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 protein_id gnl|my_center|LOCUS_02020 1082 1537 gene locus_tag LOCUS_02030 1082 1537 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_02030 1638 2267 gene locus_tag LOCUS_02040 gene msrQ 1638 2267 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527905.1 protein_id gnl|my_center|LOCUS_02040 2337 2966 gene locus_tag LOCUS_02050 2337 2966 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071224.1 protein_id gnl|my_center|LOCUS_02050 3086 4033 gene locus_tag LOCUS_02060 3086 4033 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706514.1 protein_id gnl|my_center|LOCUS_02060 4252 5247 gene locus_tag LOCUS_02070 4252 5247 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_02070 5338 6318 gene locus_tag LOCUS_02080 5338 6318 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 protein_id gnl|my_center|LOCUS_02080 7464 6397 gene locus_tag LOCUS_02090 7464 6397 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083076.1 protein_id gnl|my_center|LOCUS_02090 8324 7479 gene locus_tag LOCUS_02100 8324 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_02100 11787 8593 gene locus_tag LOCUS_02110 11787 8593 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 protein_id gnl|my_center|LOCUS_02110 12801 11800 gene locus_tag LOCUS_02120 12801 11800 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 protein_id gnl|my_center|LOCUS_02120 12953 12798 gene locus_tag LOCUS_02130 12953 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 12895 13275 gene locus_tag LOCUS_02140 12895 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 14614 13385 gene locus_tag LOCUS_02150 14614 13385 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 protein_id gnl|my_center|LOCUS_02150 15004 14696 gene locus_tag LOCUS_02160 15004 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 15943 15068 gene locus_tag LOCUS_02170 15943 15068 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 protein_id gnl|my_center|LOCUS_02170 16042 16731 gene locus_tag LOCUS_02180 16042 16731 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 protein_id gnl|my_center|LOCUS_02180 17499 16846 gene locus_tag LOCUS_02190 17499 16846 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263525.1 protein_id gnl|my_center|LOCUS_02190 17813 17526 gene locus_tag LOCUS_02200 17813 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 18704 18294 gene locus_tag LOCUS_02210 gene zntR 18704 18294 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369432.1 protein_id gnl|my_center|LOCUS_02210 18979 18710 gene locus_tag LOCUS_02220 18979 18710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 20336 19008 gene locus_tag LOCUS_02230 20336 19008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 20617 20333 gene locus_tag LOCUS_02240 20617 20333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 20919 20614 gene locus_tag LOCUS_02250 20919 20614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 21133 21486 gene locus_tag LOCUS_02260 21133 21486 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017131138.1 protein_id gnl|my_center|LOCUS_02260 21517 21954 gene locus_tag LOCUS_02270 gene arsC 21517 21954 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107585880.1 protein_id gnl|my_center|LOCUS_02270 21951 23054 gene locus_tag LOCUS_02280 gene arsB 21951 23054 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440386.1 protein_id gnl|my_center|LOCUS_02280 23173 24417 gene locus_tag LOCUS_02290 23173 24417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 24648 24439 gene locus_tag LOCUS_02300 24648 24439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 25991 24699 gene locus_tag LOCUS_02310 25991 24699 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225119.1 protein_id gnl|my_center|LOCUS_02310 26875 26159 gene locus_tag LOCUS_02320 gene btsR 26875 26159 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388129.1 protein_id gnl|my_center|LOCUS_02320 28599 26872 gene locus_tag LOCUS_02330 28599 26872 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072746.1 protein_id gnl|my_center|LOCUS_02330 28911 29492 gene locus_tag LOCUS_02340 28911 29492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 31564 29888 gene locus_tag LOCUS_02350 gene recN 31564 29888 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 protein_id gnl|my_center|LOCUS_02350 32467 31583 gene locus_tag LOCUS_02360 32467 31583 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382947.1 protein_id gnl|my_center|LOCUS_02360 32754 33797 gene locus_tag LOCUS_02370 gene hrcA 32754 33797 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_02370 33882 34487 gene locus_tag LOCUS_02380 gene grpE 33882 34487 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706782.1 protein_id gnl|my_center|LOCUS_02380 34619 36580 gene locus_tag LOCUS_02390 gene dnaK 34619 36580 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 protein_id gnl|my_center|LOCUS_02390 36709 37839 gene locus_tag LOCUS_02400 gene dnaJ 36709 37839 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_02400 37882 38382 gene locus_tag LOCUS_02410 37882 38382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 38621 39421 gene locus_tag LOCUS_02420 gene dapB 38621 39421 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706537.1 protein_id gnl|my_center|LOCUS_02420 39733 40665 gene locus_tag LOCUS_02430 39733 40665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 40658 43525 gene locus_tag LOCUS_02440 40658 43525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 43529 44497 gene locus_tag LOCUS_02450 43529 44497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 44638 45870 gene locus_tag LOCUS_02460 gene carA 44638 45870 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224759.1 protein_id gnl|my_center|LOCUS_02460 45888 46277 gene locus_tag LOCUS_02470 45888 46277 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_02470 46325 49546 gene locus_tag LOCUS_02480 gene carB 46325 49546 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243709.1 protein_id gnl|my_center|LOCUS_02480 49543 50022 gene locus_tag LOCUS_02490 gene greA 49543 50022 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 protein_id gnl|my_center|LOCUS_02490 50024 50482 gene locus_tag LOCUS_02500 50024 50482 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521823.1 protein_id gnl|my_center|LOCUS_02500 50749 50483 gene locus_tag LOCUS_02510 gene yhbY 50749 50483 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071425.1 protein_id gnl|my_center|LOCUS_02510 50780 51058 gene locus_tag LOCUS_02520 50780 51058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 51039 51665 gene locus_tag LOCUS_02530 gene rlmE 51039 51665 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_02530 51782 53704 gene locus_tag LOCUS_02540 gene ftsH 51782 53704 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_02540 53845 54624 gene locus_tag LOCUS_02550 gene folP 53845 54624 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105022.1 protein_id gnl|my_center|LOCUS_02550 54657 55997 gene locus_tag LOCUS_02560 gene glmM 54657 55997 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_02560 56105 56854 gene locus_tag LOCUS_02570 gene tpiA 56105 56854 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071430.1 protein_id gnl|my_center|LOCUS_02570 56885 57259 gene locus_tag LOCUS_02580 gene secG 56885 57259 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_02580 57275 57359 gene locus_tag LOCUS_t00010 57275 57359 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 57599 57955 gene locus_tag LOCUS_02590 57599 57955 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_02590 57946 58434 gene locus_tag LOCUS_02600 57946 58434 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_02600 58450 59133 gene locus_tag LOCUS_02610 58450 59133 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958234.1 protein_id gnl|my_center|LOCUS_02610 59130 60389 gene locus_tag LOCUS_02620 59130 60389 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_02620 60389 60895 gene locus_tag LOCUS_02630 gene nuoE 60389 60895 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_02630 60900 62177 gene locus_tag LOCUS_02640 gene nuoF 60900 62177 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_02640 62211 64343 gene locus_tag LOCUS_02650 gene nuoG 62211 64343 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948472.1 protein_id gnl|my_center|LOCUS_02650 64371 65447 gene locus_tag LOCUS_02660 gene nuoH 64371 65447 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_02660 65465 65953 gene locus_tag LOCUS_02670 gene nuoI 65465 65953 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_02670 65975 66577 gene locus_tag LOCUS_02680 65975 66577 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944316.1 protein_id gnl|my_center|LOCUS_02680 66643 66948 gene locus_tag LOCUS_02690 gene nuoK 66643 66948 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_02690 66963 68915 gene locus_tag LOCUS_02700 gene nuoL 66963 68915 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_02700 68961 70478 gene locus_tag LOCUS_02710 68961 70478 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_02710 70499 71926 gene locus_tag LOCUS_02720 gene nuoN 70499 71926 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958226.1 protein_id gnl|my_center|LOCUS_02720 73406 72144 gene locus_tag LOCUS_02730 73406 72144 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930370.1 protein_id gnl|my_center|LOCUS_02730 73991 73410 gene locus_tag LOCUS_02740 73991 73410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02740 74593 73973 gene locus_tag LOCUS_02750 gene mobA 74593 73973 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 protein_id gnl|my_center|LOCUS_02750 74944 75543 gene locus_tag LOCUS_02760 74944 75543 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948185.1 protein_id gnl|my_center|LOCUS_02760 75853 78165 gene locus_tag LOCUS_02770 75853 78165 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451094.1 protein_id gnl|my_center|LOCUS_02770 78378 79295 gene locus_tag LOCUS_02780 gene mdh 78378 79295 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153230.1 protein_id gnl|my_center|LOCUS_02780 79307 80599 gene locus_tag LOCUS_02790 gene gltA 79307 80599 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328205.1 protein_id gnl|my_center|LOCUS_02790 80621 81355 gene locus_tag LOCUS_02800 80621 81355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 81648 83696 gene locus_tag LOCUS_02810 81648 83696 CDS product isoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120158.1 protein_id gnl|my_center|LOCUS_02810 83715 84920 gene locus_tag LOCUS_02820 83715 84920 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389221.1 protein_id gnl|my_center|LOCUS_02820 84917 87322 gene locus_tag LOCUS_02830 84917 87322 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_02830 88615 87542 gene locus_tag LOCUS_02840 88615 87542 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_02840 89168 88734 gene locus_tag LOCUS_02850 89168 88734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 >Feature sequence004 1967 687 gene locus_tag LOCUS_02860 1967 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 2419 1985 gene locus_tag LOCUS_02870 2419 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 4567 2480 gene locus_tag LOCUS_02880 4567 2480 CDS product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705822.1 protein_id gnl|my_center|LOCUS_02880 7399 4604 gene locus_tag LOCUS_02890 gene tssH 7399 4604 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941102.1 protein_id gnl|my_center|LOCUS_02890 8507 7467 gene locus_tag LOCUS_02900 gene tssG 8507 7467 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105487.1 protein_id gnl|my_center|LOCUS_02900 10204 8471 gene locus_tag LOCUS_02910 gene tssF 10204 8471 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342476.1 protein_id gnl|my_center|LOCUS_02910 10629 10204 gene locus_tag LOCUS_02920 gene tssE 10629 10204 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211943.1 protein_id gnl|my_center|LOCUS_02920 11179 10694 gene locus_tag LOCUS_02930 gene hcp 11179 10694 CDS product type VI secretion system effector Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366299.1 protein_id gnl|my_center|LOCUS_02930 12902 11370 gene locus_tag LOCUS_02940 gene tssC 12902 11370 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640195.1 protein_id gnl|my_center|LOCUS_02940 13481 12930 gene locus_tag LOCUS_02950 gene tssB 13481 12930 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366297.1 protein_id gnl|my_center|LOCUS_02950 15259 13586 gene locus_tag LOCUS_02960 gene tssA 15259 13586 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211937.1 protein_id gnl|my_center|LOCUS_02960 16194 15259 gene locus_tag LOCUS_02970 16194 15259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 19928 16278 gene locus_tag LOCUS_02980 gene tssM 19928 16278 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525287.1 protein_id gnl|my_center|LOCUS_02980 20665 19928 gene locus_tag LOCUS_02990 gene icmH 20665 19928 CDS product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318805.1 protein_id gnl|my_center|LOCUS_02990 22007 20670 gene locus_tag LOCUS_03000 gene tssK 22007 20670 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343637.1 protein_id gnl|my_center|LOCUS_03000 22420 22031 gene locus_tag LOCUS_03010 22420 22031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 23205 22759 gene locus_tag LOCUS_03020 23205 22759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 25068 24121 gene locus_tag LOCUS_03030 25068 24121 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_03030 25096 25560 gene locus_tag LOCUS_03040 gene trmL 25096 25560 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074146.1 protein_id gnl|my_center|LOCUS_03040 26603 25590 gene locus_tag LOCUS_03050 gene gpsA 26603 25590 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_03050 27117 26623 gene locus_tag LOCUS_03060 gene secB 27117 26623 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621582.1 protein_id gnl|my_center|LOCUS_03060 27653 27219 gene locus_tag LOCUS_03070 gene trxC 27653 27219 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_03070 28562 27684 gene locus_tag LOCUS_03080 28562 27684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 29204 28749 gene locus_tag LOCUS_03090 29204 28749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 29689 29327 gene locus_tag LOCUS_03100 29689 29327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 30137 29826 gene locus_tag LOCUS_03110 30137 29826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 30565 32148 gene locus_tag LOCUS_03120 gene gpmI 30565 32148 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_03120 32219 33400 gene locus_tag LOCUS_03130 32219 33400 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_03130 33587 34918 gene locus_tag LOCUS_03140 gene cptA 33587 34918 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_03140 35000 35824 gene locus_tag LOCUS_03150 35000 35824 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407320.1 protein_id gnl|my_center|LOCUS_03150 35800 36351 gene locus_tag LOCUS_03160 35800 36351 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127205.1 protein_id gnl|my_center|LOCUS_03160 36485 37657 gene locus_tag LOCUS_03170 36485 37657 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931526.1 protein_id gnl|my_center|LOCUS_03170 37686 38588 gene locus_tag LOCUS_03180 gene argF 37686 38588 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_03180 38630 39673 gene locus_tag LOCUS_03190 38630 39673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_03190 40396 39752 gene locus_tag LOCUS_03200 40396 39752 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_03200 40773 41435 gene locus_tag LOCUS_03210 40773 41435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 43519 41669 gene locus_tag LOCUS_03220 gene ilvD 43519 41669 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528037.1 protein_id gnl|my_center|LOCUS_03220 43740 45428 gene locus_tag LOCUS_03230 43740 45428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 45655 46695 gene locus_tag LOCUS_03240 45655 46695 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_03240 46768 47382 gene locus_tag LOCUS_03250 46768 47382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 47386 50445 gene locus_tag LOCUS_03260 47386 50445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 50615 52033 gene locus_tag LOCUS_03270 50615 52033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 53425 52151 gene locus_tag LOCUS_03280 53425 52151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 53590 53931 gene locus_tag LOCUS_03290 gene trxA 53590 53931 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_03290 54293 55549 gene locus_tag LOCUS_03300 gene rho 54293 55549 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_03300 55566 56336 gene locus_tag LOCUS_03310 55566 56336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 57012 56353 gene locus_tag LOCUS_03320 57012 56353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 57655 57032 gene locus_tag LOCUS_03330 57655 57032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 58174 57668 gene locus_tag LOCUS_03340 58174 57668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 58369 58680 gene locus_tag LOCUS_03350 58369 58680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 58689 59603 gene locus_tag LOCUS_03360 58689 59603 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966070.1 protein_id gnl|my_center|LOCUS_03360 59600 60700 gene locus_tag LOCUS_03370 gene thiO 59600 60700 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 protein_id gnl|my_center|LOCUS_03370 60728 61174 gene locus_tag LOCUS_03380 60728 61174 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008131763.1 protein_id gnl|my_center|LOCUS_03380 61273 61348 gene locus_tag LOCUS_t00020 61273 61348 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 61993 61484 gene locus_tag LOCUS_03390 61993 61484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 62837 62286 gene locus_tag LOCUS_03400 62837 62286 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_03400 63478 62864 gene locus_tag LOCUS_03410 63478 62864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124702.1 protein_id gnl|my_center|LOCUS_03410 63985 63743 gene locus_tag LOCUS_03420 63985 63743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 64610 63975 gene locus_tag LOCUS_03430 gene parA 64610 63975 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 protein_id gnl|my_center|LOCUS_03430 64884 64621 gene locus_tag LOCUS_03440 64884 64621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 65370 64894 gene locus_tag LOCUS_03450 65370 64894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 65706 65386 gene locus_tag LOCUS_03460 65706 65386 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_03460 66209 65895 gene locus_tag LOCUS_03470 66209 65895 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_03470 66578 66279 gene locus_tag LOCUS_03480 66578 66279 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_03480 66912 66637 gene locus_tag LOCUS_03490 66912 66637 CDS product carboxysome peptide B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124709.1 protein_id gnl|my_center|LOCUS_03490 67184 66912 gene locus_tag LOCUS_03500 67184 66912 CDS product carboxysome peptide A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124708.1 protein_id gnl|my_center|LOCUS_03500 68587 67181 gene locus_tag LOCUS_03510 68587 67181 CDS product carboxysome shell carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124707.1 protein_id gnl|my_center|LOCUS_03510 70711 68741 gene locus_tag LOCUS_03520 70711 68741 CDS product CsoS2 family carboxysome shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124706.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03520 71601 71257 gene locus_tag LOCUS_03530 71601 71257 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_03530 73061 71649 gene locus_tag LOCUS_03540 73061 71649 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_03540 73419 74336 gene locus_tag LOCUS_03550 73419 74336 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_03550 74742 74440 gene locus_tag LOCUS_03560 74742 74440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306985.1 protein_id gnl|my_center|LOCUS_03560 75709 74750 gene locus_tag LOCUS_03570 75709 74750 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306982.1 protein_id gnl|my_center|LOCUS_03570 76187 77179 gene locus_tag LOCUS_03580 76187 77179 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_03580 77247 77423 gene locus_tag LOCUS_03590 77247 77423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 77480 78700 gene locus_tag LOCUS_03600 77480 78700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence005 400 1503 gene locus_tag LOCUS_03610 gene dctP 400 1503 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_03610 1615 2100 gene locus_tag LOCUS_03620 1615 2100 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_03620 2251 2772 gene locus_tag LOCUS_03630 2251 2772 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_03630 2772 4085 gene locus_tag LOCUS_03640 2772 4085 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_03640 4157 5365 gene locus_tag LOCUS_03650 4157 5365 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_03650 5571 5774 gene locus_tag LOCUS_03660 5571 5774 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941244.1 protein_id gnl|my_center|LOCUS_03660 6675 5860 gene locus_tag LOCUS_03670 gene mutM 6675 5860 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_03670 7537 6668 gene locus_tag LOCUS_03680 7537 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 8954 7602 gene locus_tag LOCUS_03690 8954 7602 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_03690 9320 8964 gene locus_tag LOCUS_03700 9320 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 10087 9335 gene locus_tag LOCUS_03710 10087 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 11067 10084 gene locus_tag LOCUS_03720 11067 10084 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_03720 11144 12196 gene locus_tag LOCUS_03730 11144 12196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 12215 14188 gene locus_tag LOCUS_03740 12215 14188 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_03740 15188 14634 gene locus_tag LOCUS_03750 15188 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 17066 15240 gene locus_tag LOCUS_03760 gene recD 17066 15240 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215834.1 protein_id gnl|my_center|LOCUS_03760 20628 17059 gene locus_tag LOCUS_03770 gene recB 20628 17059 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703321.1 protein_id gnl|my_center|LOCUS_03770 23813 20625 gene locus_tag LOCUS_03780 gene recC 23813 20625 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_03780 23952 24992 gene locus_tag LOCUS_03790 gene rfbB 23952 24992 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_03790 25106 25181 gene locus_tag LOCUS_t00030 25106 25181 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 25270 25677 gene locus_tag LOCUS_03800 25270 25677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 26654 25767 gene locus_tag LOCUS_03810 26654 25767 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_03810 27872 26814 gene locus_tag LOCUS_03820 27872 26814 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 protein_id gnl|my_center|LOCUS_03820 27925 27999 gene locus_tag LOCUS_t00040 27925 27999 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 28060 29124 gene locus_tag LOCUS_03830 28060 29124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 29170 29595 gene locus_tag LOCUS_03840 29170 29595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 29610 30044 gene locus_tag LOCUS_03850 29610 30044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224933.1 protein_id gnl|my_center|LOCUS_03850 31036 30332 gene locus_tag LOCUS_03860 31036 30332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_03860 34358 31083 gene locus_tag LOCUS_03870 34358 31083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 34768 35211 gene locus_tag LOCUS_03880 34768 35211 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_03880 36573 35323 gene locus_tag LOCUS_03890 gene lysA 36573 35323 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_03890 36900 36613 gene locus_tag LOCUS_03900 36900 36613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 36853 37179 gene locus_tag LOCUS_03910 gene cyaY 36853 37179 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005953.1 protein_id gnl|my_center|LOCUS_03910 37185 37844 gene locus_tag LOCUS_03920 37185 37844 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_03920 39224 38187 gene locus_tag LOCUS_03930 gene fba 39224 38187 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071213.1 protein_id gnl|my_center|LOCUS_03930 40718 39258 gene locus_tag LOCUS_03940 gene pyk 40718 39258 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958436.1 protein_id gnl|my_center|LOCUS_03940 41926 40745 gene locus_tag LOCUS_03950 41926 40745 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_03950 43057 42056 gene locus_tag LOCUS_03960 gene gap 43057 42056 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_03960 45163 43175 gene locus_tag LOCUS_03970 gene tkt 45163 43175 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706909.1 protein_id gnl|my_center|LOCUS_03970 46113 45553 gene locus_tag LOCUS_03980 46113 45553 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_03980 46845 46198 gene locus_tag LOCUS_03990 gene gmk 46845 46198 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_03990 47704 46838 gene locus_tag LOCUS_04000 47704 46838 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640567.1 protein_id gnl|my_center|LOCUS_04000 47994 48932 gene locus_tag LOCUS_04010 47994 48932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 48941 49771 gene locus_tag LOCUS_04020 48941 49771 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_04020 49919 51628 gene locus_tag LOCUS_04030 49919 51628 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707374.1 protein_id gnl|my_center|LOCUS_04030 51702 52259 gene locus_tag LOCUS_04040 51702 52259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 52288 52728 gene locus_tag LOCUS_04050 52288 52728 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534270.1 protein_id gnl|my_center|LOCUS_04050 54559 52895 gene locus_tag LOCUS_04060 gene ubiB 54559 52895 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_04060 55206 54556 gene locus_tag LOCUS_04070 55206 54556 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_04070 55699 55232 gene locus_tag LOCUS_04080 55699 55232 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_04080 56457 55699 gene locus_tag LOCUS_04090 gene ubiE 56457 55699 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 protein_id gnl|my_center|LOCUS_04090 57061 56699 gene locus_tag LOCUS_04100 57061 56699 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_04100 58415 57078 gene locus_tag LOCUS_04110 gene hslU 58415 57078 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707776.1 protein_id gnl|my_center|LOCUS_04110 58963 58421 gene locus_tag LOCUS_04120 gene hslV 58963 58421 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_04120 60072 59158 gene locus_tag LOCUS_04130 gene xerC 60072 59158 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459099.1 protein_id gnl|my_center|LOCUS_04130 60780 60085 gene locus_tag LOCUS_04140 60780 60085 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_04140 61607 60777 gene locus_tag LOCUS_04150 gene dapF 61607 60777 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103038.1 protein_id gnl|my_center|LOCUS_04150 61702 62013 gene locus_tag LOCUS_04160 61702 62013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 62557 61982 gene locus_tag LOCUS_04170 62557 61982 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_04170 63237 62554 gene locus_tag LOCUS_04180 63237 62554 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177082959.1 protein_id gnl|my_center|LOCUS_04180 63629 63258 gene locus_tag LOCUS_04190 63629 63258 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 protein_id gnl|my_center|LOCUS_04190 64110 63676 gene locus_tag LOCUS_04200 64110 63676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 64693 64220 gene locus_tag LOCUS_04210 gene moaC 64693 64220 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_04210 64753 64992 gene locus_tag LOCUS_04220 64753 64992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 64989 65426 gene locus_tag LOCUS_04230 gene moaE 64989 65426 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093025.1 protein_id gnl|my_center|LOCUS_04230 65867 65442 gene locus_tag LOCUS_04240 65867 65442 CDS product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 protein_id gnl|my_center|LOCUS_04240 65966 67204 gene locus_tag LOCUS_04250 65966 67204 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_04250 67303 69360 gene locus_tag LOCUS_04260 67303 69360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 69517 70185 gene locus_tag LOCUS_04270 69517 70185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 70341 71588 gene locus_tag LOCUS_04280 70341 71588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 72188 71823 gene locus_tag LOCUS_04290 72188 71823 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811007.1 protein_id gnl|my_center|LOCUS_04290 73733 72249 gene locus_tag LOCUS_04300 gene lnt 73733 72249 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071408.1 protein_id gnl|my_center|LOCUS_04300 74431 73739 gene locus_tag LOCUS_04310 74431 73739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 75101 74544 gene locus_tag LOCUS_04320 75101 74544 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024085.1 protein_id gnl|my_center|LOCUS_04320 75717 75169 gene locus_tag LOCUS_04330 gene ppa 75717 75169 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948454.1 protein_id gnl|my_center|LOCUS_04330 76205 76351 gene locus_tag LOCUS_04340 76205 76351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 77621 76344 gene locus_tag LOCUS_04350 77621 76344 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence006 2028 976 gene locus_tag LOCUS_04360 gene argC 2028 976 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_04360 2906 2025 gene locus_tag LOCUS_04370 gene ilvE 2906 2025 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_04370 3125 4540 gene locus_tag LOCUS_04380 3125 4540 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_04380 5961 4603 gene locus_tag LOCUS_04390 gene ffh 5961 4603 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 protein_id gnl|my_center|LOCUS_04390 6824 6060 gene locus_tag LOCUS_04400 6824 6060 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_04400 7230 8051 gene locus_tag LOCUS_04410 7230 8051 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_04410 8138 9439 gene locus_tag LOCUS_04420 8138 9439 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_04420 9436 10491 gene locus_tag LOCUS_04430 9436 10491 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_04430 10642 11535 gene locus_tag LOCUS_04440 10642 11535 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_04440 11791 11564 gene locus_tag LOCUS_04450 gene cspD 11791 11564 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 protein_id gnl|my_center|LOCUS_04450 12279 12055 gene locus_tag LOCUS_04460 12279 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 12622 15423 gene locus_tag LOCUS_04470 gene ppc 12622 15423 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_04470 15512 16159 gene locus_tag LOCUS_04480 15512 16159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 17129 16197 gene locus_tag LOCUS_04490 17129 16197 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_04490 17708 17136 gene locus_tag LOCUS_04500 17708 17136 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_04500 18157 17945 gene locus_tag LOCUS_04510 18157 17945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 18292 19212 gene locus_tag LOCUS_04520 18292 19212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 19280 22201 gene locus_tag LOCUS_04530 19280 22201 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_04530 25869 22342 gene locus_tag LOCUS_04540 25869 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 26115 27113 gene locus_tag LOCUS_04550 gene galE 26115 27113 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_04550 27967 27212 gene locus_tag LOCUS_04560 27967 27212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 28088 29233 gene locus_tag LOCUS_04570 28088 29233 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_04570 29538 29320 gene locus_tag LOCUS_04580 29538 29320 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_04580 30667 29867 gene locus_tag LOCUS_04590 30667 29867 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444530.1 protein_id gnl|my_center|LOCUS_04590 31084 30737 gene locus_tag LOCUS_04600 31084 30737 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_04600 32096 31110 gene locus_tag LOCUS_04610 32096 31110 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_04610 32737 32093 gene locus_tag LOCUS_04620 gene tmk 32737 32093 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_04620 34034 32979 gene locus_tag LOCUS_04630 gene mltG 34034 32979 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430993.1 protein_id gnl|my_center|LOCUS_04630 34863 34027 gene locus_tag LOCUS_04640 gene pabC 34863 34027 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_04640 35845 35006 gene locus_tag LOCUS_04650 35845 35006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 36464 35961 gene locus_tag LOCUS_04660 36464 35961 CDS product DUF3106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044963.1 protein_id gnl|my_center|LOCUS_04660 36699 36454 gene locus_tag LOCUS_04670 36699 36454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 37048 36692 gene locus_tag LOCUS_04680 37048 36692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 37578 37045 gene locus_tag LOCUS_04690 37578 37045 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_04690 37767 38174 gene locus_tag LOCUS_04700 37767 38174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 38867 38271 gene locus_tag LOCUS_04710 38867 38271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 40725 38917 gene locus_tag LOCUS_04720 40725 38917 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_04720 40951 41352 gene locus_tag LOCUS_04730 40951 41352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 41417 43048 gene locus_tag LOCUS_04740 41417 43048 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109962.1 protein_id gnl|my_center|LOCUS_04740 43179 44198 gene locus_tag LOCUS_04750 43179 44198 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_04750 44221 44571 gene locus_tag LOCUS_04760 44221 44571 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908409.1 protein_id gnl|my_center|LOCUS_04760 44568 45221 gene locus_tag LOCUS_04770 44568 45221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 46437 45262 gene locus_tag LOCUS_04780 46437 45262 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_04780 47239 46673 gene locus_tag LOCUS_04790 gene yeiP 47239 46673 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365690.1 protein_id gnl|my_center|LOCUS_04790 49251 47401 gene locus_tag LOCUS_04800 49251 47401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_04800 51166 49262 gene locus_tag LOCUS_04810 gene mutL 51166 49262 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105240.1 protein_id gnl|my_center|LOCUS_04810 52706 51357 gene locus_tag LOCUS_04820 gene amiB 52706 51357 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_04820 53315 52851 gene locus_tag LOCUS_04830 gene tsaE 53315 52851 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106408.1 protein_id gnl|my_center|LOCUS_04830 54796 53312 gene locus_tag LOCUS_04840 54796 53312 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_04840 54815 55900 gene locus_tag LOCUS_04850 gene queG 54815 55900 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_04850 57951 56128 gene locus_tag LOCUS_04860 gene recQ 57951 56128 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_04860 58111 59550 gene locus_tag LOCUS_04870 gene cls 58111 59550 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191365.1 protein_id gnl|my_center|LOCUS_04870 59550 60020 gene locus_tag LOCUS_04880 59550 60020 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_04880 60133 61083 gene locus_tag LOCUS_04890 60133 61083 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083947.1 protein_id gnl|my_center|LOCUS_04890 62021 61125 gene locus_tag LOCUS_04900 62021 61125 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_04900 63241 62348 gene locus_tag LOCUS_04910 63241 62348 CDS product DUF3943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450944.1 protein_id gnl|my_center|LOCUS_04910 63816 63241 gene locus_tag LOCUS_04920 gene orn 63816 63241 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_04920 63952 64116 gene locus_tag LOCUS_04930 63952 64116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 64153 65163 gene locus_tag LOCUS_04940 gene rsgA 64153 65163 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763005.1 protein_id gnl|my_center|LOCUS_04940 65477 65181 gene locus_tag LOCUS_04950 65477 65181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 66944 65724 gene locus_tag LOCUS_04960 66944 65724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 67665 66994 gene locus_tag LOCUS_04970 gene tsaB 67665 66994 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111661.1 protein_id gnl|my_center|LOCUS_04970 69792 67855 gene locus_tag LOCUS_04980 69792 67855 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_04980 70301 69813 gene locus_tag LOCUS_04990 70301 69813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 70797 70402 gene locus_tag LOCUS_05000 70797 70402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 70969 71985 gene locus_tag LOCUS_05010 70969 71985 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646584.1 protein_id gnl|my_center|LOCUS_05010 72087 72659 gene locus_tag LOCUS_05020 72087 72659 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390063.1 protein_id gnl|my_center|LOCUS_05020 73707 72679 gene locus_tag LOCUS_05030 73707 72679 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478421.1 protein_id gnl|my_center|LOCUS_05030 75902 73704 gene locus_tag LOCUS_05040 gene mrcB 75902 73704 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence007 288 671 gene locus_tag LOCUS_05050 288 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 773 1543 gene locus_tag LOCUS_05060 773 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_05060 1556 3343 gene locus_tag LOCUS_05070 1556 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3594 4085 gene locus_tag LOCUS_05080 3594 4085 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114374.1 protein_id gnl|my_center|LOCUS_05080 4085 4960 gene locus_tag LOCUS_05090 gene ubiA 4085 4960 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704199.1 protein_id gnl|my_center|LOCUS_05090 4945 5937 gene locus_tag LOCUS_05100 4945 5937 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_05100 5970 6833 gene locus_tag LOCUS_05110 5970 6833 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 protein_id gnl|my_center|LOCUS_05110 6971 7945 gene locus_tag LOCUS_05120 6971 7945 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_05120 7995 8519 gene locus_tag LOCUS_05130 gene kdsC 7995 8519 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707616.1 protein_id gnl|my_center|LOCUS_05130 8549 9127 gene locus_tag LOCUS_05140 gene lptC 8549 9127 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766512.1 protein_id gnl|my_center|LOCUS_05140 9111 9632 gene locus_tag LOCUS_05150 9111 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 9645 10400 gene locus_tag LOCUS_05160 gene lptB 9645 10400 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_05160 10514 11998 gene locus_tag LOCUS_05170 10514 11998 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_05170 12072 12404 gene locus_tag LOCUS_05180 gene raiA 12072 12404 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_05180 12492 12956 gene locus_tag LOCUS_05190 gene ptsN 12492 12956 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 protein_id gnl|my_center|LOCUS_05190 12953 13903 gene locus_tag LOCUS_05200 gene hprK 12953 13903 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993219.1 protein_id gnl|my_center|LOCUS_05200 13900 14760 gene locus_tag LOCUS_05210 gene rapZ 13900 14760 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377550.1 protein_id gnl|my_center|LOCUS_05210 14780 15181 gene locus_tag LOCUS_05220 14780 15181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_05220 15178 15447 gene locus_tag LOCUS_05230 15178 15447 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_05230 15539 16897 gene locus_tag LOCUS_05240 gene mgtE 15539 16897 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478833.1 protein_id gnl|my_center|LOCUS_05240 16900 17334 gene locus_tag LOCUS_05250 16900 17334 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_05250 17483 18868 gene locus_tag LOCUS_05260 17483 18868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 20092 18956 gene locus_tag LOCUS_05270 20092 18956 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822678.1 protein_id gnl|my_center|LOCUS_05270 20940 20092 gene locus_tag LOCUS_05280 gene serB 20940 20092 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_05280 21871 20999 gene locus_tag LOCUS_05290 21871 20999 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_05290 22657 22343 gene locus_tag LOCUS_05300 gene nirM 22657 22343 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_05300 23278 22910 gene locus_tag LOCUS_05310 23278 22910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 23326 26034 gene locus_tag LOCUS_05320 gene polA 23326 26034 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114123.1 protein_id gnl|my_center|LOCUS_05320 26924 26277 gene locus_tag LOCUS_05330 gene yihA 26924 26277 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945886.1 protein_id gnl|my_center|LOCUS_05330 27229 27519 gene locus_tag LOCUS_05340 27229 27519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 27635 28234 gene locus_tag LOCUS_05350 27635 28234 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_05350 28820 28335 gene locus_tag LOCUS_05360 28820 28335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 29186 29899 gene locus_tag LOCUS_05370 29186 29899 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403888.1 protein_id gnl|my_center|LOCUS_05370 29947 31578 gene locus_tag LOCUS_05380 29947 31578 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_05380 31597 32406 gene locus_tag LOCUS_05390 31597 32406 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613805.1 protein_id gnl|my_center|LOCUS_05390 32412 34013 gene locus_tag LOCUS_05400 32412 34013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 34013 34429 gene locus_tag LOCUS_05410 34013 34429 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068915.1 protein_id gnl|my_center|LOCUS_05410 34675 34469 gene locus_tag LOCUS_05420 34675 34469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140188.1 protein_id gnl|my_center|LOCUS_05420 35211 34747 gene locus_tag LOCUS_05430 35211 34747 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974701.1 protein_id gnl|my_center|LOCUS_05430 35668 36426 gene locus_tag LOCUS_05440 35668 36426 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478264.1 protein_id gnl|my_center|LOCUS_05440 36596 37192 gene locus_tag LOCUS_05450 36596 37192 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_05450 37520 37242 gene locus_tag LOCUS_05460 37520 37242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 40350 37507 gene locus_tag LOCUS_05470 40350 37507 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_05470 42329 40350 gene locus_tag LOCUS_05480 42329 40350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 43029 42346 gene locus_tag LOCUS_05490 43029 42346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 44249 43044 gene locus_tag LOCUS_05500 44249 43044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 44445 44200 gene locus_tag LOCUS_05510 44445 44200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 44945 44442 gene locus_tag LOCUS_05520 44945 44442 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_05520 45638 44979 gene locus_tag LOCUS_05530 45638 44979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 46318 45608 gene locus_tag LOCUS_05540 46318 45608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 49311 46597 gene locus_tag LOCUS_05550 49311 46597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 49793 50899 gene locus_tag LOCUS_05560 gene gcvT 49793 50899 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_05560 50945 51340 gene locus_tag LOCUS_05570 gene gcvH 50945 51340 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173499.1 protein_id gnl|my_center|LOCUS_05570 51379 52710 gene locus_tag LOCUS_05580 gene gcvPA 51379 52710 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770511.1 protein_id gnl|my_center|LOCUS_05580 52746 54212 gene locus_tag LOCUS_05590 gene gcvPB 52746 54212 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_05590 54216 54575 gene locus_tag LOCUS_05600 54216 54575 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261207.1 protein_id gnl|my_center|LOCUS_05600 54757 55689 gene locus_tag LOCUS_05610 54757 55689 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_05610 55892 55707 gene locus_tag LOCUS_05620 55892 55707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 57264 56074 gene locus_tag LOCUS_05630 57264 56074 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194129.1 protein_id gnl|my_center|LOCUS_05630 60092 57288 gene locus_tag LOCUS_05640 60092 57288 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082358.1 protein_id gnl|my_center|LOCUS_05640 60624 62546 gene locus_tag LOCUS_05650 60624 62546 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168667914.1 protein_id gnl|my_center|LOCUS_05650 62630 63208 gene locus_tag LOCUS_05660 62630 63208 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_05660 65766 63262 gene locus_tag LOCUS_05670 65766 63262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 66433 65984 gene locus_tag LOCUS_05680 66433 65984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence008 308 2209 gene locus_tag LOCUS_05690 gene mnmG 308 2209 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817477.1 protein_id gnl|my_center|LOCUS_05690 2216 2866 gene locus_tag LOCUS_05700 gene rsmG 2216 2866 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100242.1 protein_id gnl|my_center|LOCUS_05700 2893 3675 gene locus_tag LOCUS_05710 gene soj 2893 3675 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_05710 3702 4571 gene locus_tag LOCUS_05720 3702 4571 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958544.1 protein_id gnl|my_center|LOCUS_05720 4707 4913 gene locus_tag LOCUS_05730 4707 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 4910 5317 gene locus_tag LOCUS_05740 4910 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 5402 6163 gene locus_tag LOCUS_05750 gene atpB 5402 6163 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 protein_id gnl|my_center|LOCUS_05750 6220 6507 gene locus_tag LOCUS_05760 gene atpE 6220 6507 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002540812.1 protein_id gnl|my_center|LOCUS_05760 6581 7051 gene locus_tag LOCUS_05770 gene atpF 6581 7051 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074334.1 protein_id gnl|my_center|LOCUS_05770 7062 7598 gene locus_tag LOCUS_05780 gene atpH 7062 7598 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481164.1 protein_id gnl|my_center|LOCUS_05780 7626 9167 gene locus_tag LOCUS_05790 gene atpA 7626 9167 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_05790 9207 10067 gene locus_tag LOCUS_05800 gene atpG 9207 10067 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707909.1 protein_id gnl|my_center|LOCUS_05800 10131 11510 gene locus_tag LOCUS_05810 gene atpD 10131 11510 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948666.1 protein_id gnl|my_center|LOCUS_05810 11534 11959 gene locus_tag LOCUS_05820 11534 11959 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 protein_id gnl|my_center|LOCUS_05820 12448 13821 gene locus_tag LOCUS_05830 gene glmU 12448 13821 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694502.1 protein_id gnl|my_center|LOCUS_05830 14065 15792 gene locus_tag LOCUS_05840 gene glmS 14065 15792 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114654.1 protein_id gnl|my_center|LOCUS_05840 15804 16532 gene locus_tag LOCUS_05850 15804 16532 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_05850 16603 17397 gene locus_tag LOCUS_05860 16603 17397 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_05860 17397 18191 gene locus_tag LOCUS_05870 17397 18191 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_05870 18842 18342 gene locus_tag LOCUS_05880 gene folA 18842 18342 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_05880 19633 18839 gene locus_tag LOCUS_05890 19633 18839 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_05890 20521 19634 gene locus_tag LOCUS_05900 gene lgt 20521 19634 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772080.1 protein_id gnl|my_center|LOCUS_05900 21055 20549 gene locus_tag LOCUS_05910 21055 20549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 22985 21135 gene locus_tag LOCUS_05920 22985 21135 CDS product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 protein_id gnl|my_center|LOCUS_05920 25079 23250 gene locus_tag LOCUS_05930 25079 23250 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_05930 25987 25172 gene locus_tag LOCUS_05940 25987 25172 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_05940 27485 26085 gene locus_tag LOCUS_05950 gene norB 27485 26085 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_05950 27932 27498 gene locus_tag LOCUS_05960 gene norC 27932 27498 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_05960 29046 28303 gene locus_tag LOCUS_05970 29046 28303 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_05970 29355 30119 gene locus_tag LOCUS_05980 29355 30119 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390592.1 protein_id gnl|my_center|LOCUS_05980 31522 30323 gene locus_tag LOCUS_05990 31522 30323 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_05990 32504 31560 gene locus_tag LOCUS_06000 32504 31560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 33005 32673 gene locus_tag LOCUS_06010 33005 32673 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931769.1 protein_id gnl|my_center|LOCUS_06010 34194 33424 gene locus_tag LOCUS_06020 34194 33424 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207926.1 protein_id gnl|my_center|LOCUS_06020 34451 34651 gene locus_tag LOCUS_06030 gene thiS 34451 34651 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432400.1 protein_id gnl|my_center|LOCUS_06030 34759 35559 gene locus_tag LOCUS_06040 34759 35559 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 protein_id gnl|my_center|LOCUS_06040 35742 36482 gene locus_tag LOCUS_06050 gene trmB 35742 36482 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_06050 36631 38595 gene locus_tag LOCUS_06060 36631 38595 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_06060 38665 40071 gene locus_tag LOCUS_06070 gene nhaD 38665 40071 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_06070 40122 41933 gene locus_tag LOCUS_06080 40122 41933 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_06080 42219 42566 gene locus_tag LOCUS_06090 42219 42566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 43257 42688 gene locus_tag LOCUS_06100 43257 42688 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_06100 43897 43388 gene locus_tag LOCUS_06110 43897 43388 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918920.1 protein_id gnl|my_center|LOCUS_06110 45767 43971 gene locus_tag LOCUS_06120 45767 43971 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 protein_id gnl|my_center|LOCUS_06120 47730 46138 gene locus_tag LOCUS_06130 47730 46138 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_06130 48526 47750 gene locus_tag LOCUS_06140 gene xth 48526 47750 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862491.1 protein_id gnl|my_center|LOCUS_06140 49431 48625 gene locus_tag LOCUS_06150 49431 48625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 51478 49445 gene locus_tag LOCUS_06160 gene prlC 51478 49445 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_06160 51573 52577 gene locus_tag LOCUS_06170 51573 52577 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_06170 52671 53339 gene locus_tag LOCUS_06180 52671 53339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 53442 54791 gene locus_tag LOCUS_06190 gene gorA 53442 54791 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703747.1 protein_id gnl|my_center|LOCUS_06190 54798 55328 gene locus_tag LOCUS_06200 54798 55328 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057644910.1 protein_id gnl|my_center|LOCUS_06200 55341 56774 gene locus_tag LOCUS_06210 gene mltF 55341 56774 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705651.1 protein_id gnl|my_center|LOCUS_06210 56861 58456 gene locus_tag LOCUS_06220 56861 58456 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084107.1 protein_id gnl|my_center|LOCUS_06220 59122 58700 gene locus_tag LOCUS_06230 59122 58700 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 protein_id gnl|my_center|LOCUS_06230 59938 59126 gene locus_tag LOCUS_06240 gene aroE 59938 59126 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266136.1 protein_id gnl|my_center|LOCUS_06240 61236 59983 gene locus_tag LOCUS_06250 61236 59983 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073547.1 protein_id gnl|my_center|LOCUS_06250 61940 61263 gene locus_tag LOCUS_06260 61940 61263 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_06260 62986 61958 gene locus_tag LOCUS_06270 gene hemB 62986 61958 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 protein_id gnl|my_center|LOCUS_06270 64341 63124 gene locus_tag LOCUS_06280 64341 63124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence009 152 679 gene locus_tag LOCUS_06290 152 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 669 1454 gene locus_tag LOCUS_06300 669 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06300 1496 1774 gene locus_tag LOCUS_06310 1496 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06310 2601 1789 gene locus_tag LOCUS_06320 gene rhdA 2601 1789 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_06320 3750 2638 gene locus_tag LOCUS_06330 gene tapW 3750 2638 CDS product type IVa pilus ATPase TapW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_06330 4137 3892 gene locus_tag LOCUS_06340 4137 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5010 4210 gene locus_tag LOCUS_06350 5010 4210 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_06350 5159 5884 gene locus_tag LOCUS_06360 gene trmJ 5159 5884 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113799.1 protein_id gnl|my_center|LOCUS_06360 5994 6803 gene locus_tag LOCUS_06370 gene cysE 5994 6803 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_06370 6958 7413 gene locus_tag LOCUS_06380 gene iscR 6958 7413 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_06380 7430 8581 gene locus_tag LOCUS_06390 7430 8581 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388823.1 protein_id gnl|my_center|LOCUS_06390 8629 9855 gene locus_tag LOCUS_06400 gene iscS 8629 9855 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 protein_id gnl|my_center|LOCUS_06400 9897 10301 gene locus_tag LOCUS_06410 gene iscU 9897 10301 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331707.1 protein_id gnl|my_center|LOCUS_06410 10316 10639 gene locus_tag LOCUS_06420 gene iscA 10316 10639 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417916.1 protein_id gnl|my_center|LOCUS_06420 10639 11184 gene locus_tag LOCUS_06430 gene hscB 10639 11184 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072279.1 protein_id gnl|my_center|LOCUS_06430 11223 13094 gene locus_tag LOCUS_06440 gene hscA 11223 13094 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100622.1 protein_id gnl|my_center|LOCUS_06440 13109 13474 gene locus_tag LOCUS_06450 gene fdx 13109 13474 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124474.1 protein_id gnl|my_center|LOCUS_06450 14282 13485 gene locus_tag LOCUS_06460 14282 13485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 14494 14925 gene locus_tag LOCUS_06470 gene ndk 14494 14925 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020029.1 protein_id gnl|my_center|LOCUS_06470 14960 16048 gene locus_tag LOCUS_06480 gene rlmN 14960 16048 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092809.1 protein_id gnl|my_center|LOCUS_06480 16050 16805 gene locus_tag LOCUS_06490 gene pilW 16050 16805 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073190.1 protein_id gnl|my_center|LOCUS_06490 16802 17818 gene locus_tag LOCUS_06500 16802 17818 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941776.1 protein_id gnl|my_center|LOCUS_06500 17824 18915 gene locus_tag LOCUS_06510 gene ispG 17824 18915 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_06510 19161 20417 gene locus_tag LOCUS_06520 gene hisS 19161 20417 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107147.1 protein_id gnl|my_center|LOCUS_06520 20455 21105 gene locus_tag LOCUS_06530 20455 21105 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_06530 21108 22322 gene locus_tag LOCUS_06540 gene bamB 21108 22322 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428301.1 protein_id gnl|my_center|LOCUS_06540 22319 23719 gene locus_tag LOCUS_06550 gene der 22319 23719 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208345.1 protein_id gnl|my_center|LOCUS_06550 23957 23730 gene locus_tag LOCUS_06560 23957 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 24693 25007 gene locus_tag LOCUS_06570 24693 25007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 26421 25285 gene locus_tag LOCUS_06580 gene dapE 26421 25285 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 protein_id gnl|my_center|LOCUS_06580 26779 26426 gene locus_tag LOCUS_06590 26779 26426 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533673.1 protein_id gnl|my_center|LOCUS_06590 27727 26906 gene locus_tag LOCUS_06600 gene dapD 27727 26906 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095650.1 protein_id gnl|my_center|LOCUS_06600 28939 27749 gene locus_tag LOCUS_06610 gene dapC 28939 27749 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103591.1 protein_id gnl|my_center|LOCUS_06610 29091 29948 gene locus_tag LOCUS_06620 29091 29948 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_06620 29950 30336 gene locus_tag LOCUS_06630 29950 30336 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_06630 30509 30742 gene locus_tag LOCUS_06640 30509 30742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 33579 30913 gene locus_tag LOCUS_06650 33579 30913 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_06650 34366 33599 gene locus_tag LOCUS_06660 gene map 34366 33599 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_06660 34636 35445 gene locus_tag LOCUS_06670 gene rpsB 34636 35445 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615972.1 protein_id gnl|my_center|LOCUS_06670 35674 36555 gene locus_tag LOCUS_06680 gene tsf 35674 36555 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_06680 36552 37295 gene locus_tag LOCUS_06690 gene pyrH 36552 37295 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554728.1 protein_id gnl|my_center|LOCUS_06690 37352 37909 gene locus_tag LOCUS_06700 gene frr 37352 37909 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_06700 38010 38786 gene locus_tag LOCUS_06710 38010 38786 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420551.1 protein_id gnl|my_center|LOCUS_06710 38779 39609 gene locus_tag LOCUS_06720 38779 39609 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103592.1 protein_id gnl|my_center|LOCUS_06720 39609 40832 gene locus_tag LOCUS_06730 gene ispC 39609 40832 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266975.1 protein_id gnl|my_center|LOCUS_06730 40829 42196 gene locus_tag LOCUS_06740 gene rseP 40829 42196 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406254.1 protein_id gnl|my_center|LOCUS_06740 42228 44492 gene locus_tag LOCUS_06750 gene bamA 42228 44492 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266976.1 protein_id gnl|my_center|LOCUS_06750 44616 45149 gene locus_tag LOCUS_06760 44616 45149 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_06760 45153 46184 gene locus_tag LOCUS_06770 gene lpxD 45153 46184 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_06770 46165 46632 gene locus_tag LOCUS_06780 gene fabZ 46165 46632 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027757.1 protein_id gnl|my_center|LOCUS_06780 46635 47402 gene locus_tag LOCUS_06790 gene lpxA 46635 47402 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811774.1 protein_id gnl|my_center|LOCUS_06790 47402 48535 gene locus_tag LOCUS_06800 gene lpxB 47402 48535 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 protein_id gnl|my_center|LOCUS_06800 48532 49146 gene locus_tag LOCUS_06810 gene rnhB 48532 49146 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_06810 49357 50334 gene locus_tag LOCUS_06820 49357 50334 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_06820 50424 52868 gene locus_tag LOCUS_06830 50424 52868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 52865 53074 gene locus_tag LOCUS_06840 52865 53074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 53150 53359 gene locus_tag LOCUS_06850 53150 53359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 53344 55548 gene locus_tag LOCUS_06860 53344 55548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 55578 56531 gene locus_tag LOCUS_06870 55578 56531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 56536 58071 gene locus_tag LOCUS_06880 56536 58071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 58077 58439 gene locus_tag LOCUS_06890 58077 58439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 58834 59637 gene locus_tag LOCUS_06900 58834 59637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 59754 61403 gene locus_tag LOCUS_06910 gene cas1 59754 61403 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_06910 61412 61702 gene locus_tag LOCUS_06920 gene cas2 61412 61702 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940736.1 protein_id gnl|my_center|LOCUS_06920 61960 62792 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttatccgtggcaaaacgccacggcctcattgaagc >Feature sequence010 1116 568 gene locus_tag LOCUS_06930 1116 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1393 1103 gene locus_tag LOCUS_06940 1393 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1528 2439 gene locus_tag LOCUS_06950 1528 2439 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 protein_id gnl|my_center|LOCUS_06950 2450 4693 gene locus_tag LOCUS_06960 2450 4693 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 protein_id gnl|my_center|LOCUS_06960 4969 5295 gene locus_tag LOCUS_06970 4969 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 5360 5848 gene locus_tag LOCUS_06980 5360 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 6240 5926 gene locus_tag LOCUS_06990 6240 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 7429 6953 gene locus_tag LOCUS_07000 7429 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 9495 7426 gene locus_tag LOCUS_07010 gene speA 9495 7426 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071982.1 protein_id gnl|my_center|LOCUS_07010 9742 10593 gene locus_tag LOCUS_07020 gene speE 9742 10593 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 protein_id gnl|my_center|LOCUS_07020 11157 10597 gene locus_tag LOCUS_07030 11157 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 12490 11222 gene locus_tag LOCUS_07040 12490 11222 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_07040 12850 12512 gene locus_tag LOCUS_07050 gene glnK 12850 12512 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_07050 13187 13426 gene locus_tag LOCUS_07060 13187 13426 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369643.1 protein_id gnl|my_center|LOCUS_07060 13505 15019 gene locus_tag LOCUS_07070 13505 15019 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_07070 15118 15564 gene locus_tag LOCUS_07080 15118 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 15565 16623 gene locus_tag LOCUS_07090 15565 16623 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_07090 16627 19668 gene locus_tag LOCUS_07100 16627 19668 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_07100 19769 20428 gene locus_tag LOCUS_07110 19769 20428 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_07110 20555 20770 gene locus_tag LOCUS_07120 20555 20770 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_07120 22032 20902 gene locus_tag LOCUS_07130 22032 20902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 22549 22019 gene locus_tag LOCUS_07140 22549 22019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 22865 22542 gene locus_tag LOCUS_07150 22865 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 23306 22884 gene locus_tag LOCUS_07160 23306 22884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 23619 24080 gene locus_tag LOCUS_07170 23619 24080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 24157 25311 gene locus_tag LOCUS_07180 24157 25311 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_07180 25369 25737 gene locus_tag LOCUS_07190 25369 25737 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_07190 25907 26371 gene locus_tag LOCUS_07200 25907 26371 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_07200 26466 27749 gene locus_tag LOCUS_07210 26466 27749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 27921 29312 gene locus_tag LOCUS_07220 gene miaB 27921 29312 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771098.1 protein_id gnl|my_center|LOCUS_07220 29358 30398 gene locus_tag LOCUS_07230 29358 30398 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268976.1 protein_id gnl|my_center|LOCUS_07230 30395 30877 gene locus_tag LOCUS_07240 gene ybeY 30395 30877 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084469.1 protein_id gnl|my_center|LOCUS_07240 30885 31859 gene locus_tag LOCUS_07250 30885 31859 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_07250 31864 33372 gene locus_tag LOCUS_07260 gene lnt 31864 33372 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089648.1 protein_id gnl|my_center|LOCUS_07260 33446 34867 gene locus_tag LOCUS_07270 33446 34867 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338202.1 protein_id gnl|my_center|LOCUS_07270 35483 34962 gene locus_tag LOCUS_07280 35483 34962 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298255.1 protein_id gnl|my_center|LOCUS_07280 38816 35565 gene locus_tag LOCUS_07290 38816 35565 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946472.1 protein_id gnl|my_center|LOCUS_07290 38944 41460 gene locus_tag LOCUS_07300 gene leuS 38944 41460 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021076.1 protein_id gnl|my_center|LOCUS_07300 41744 42271 gene locus_tag LOCUS_07310 gene lptE 41744 42271 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037748.1 protein_id gnl|my_center|LOCUS_07310 42268 43287 gene locus_tag LOCUS_07320 gene holA 42268 43287 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_07320 43505 44761 gene locus_tag LOCUS_07330 43505 44761 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_07330 44762 45424 gene locus_tag LOCUS_07340 gene nadD 44762 45424 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_07340 45414 45767 gene locus_tag LOCUS_07350 gene rsfS 45414 45767 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_07350 45777 46244 gene locus_tag LOCUS_07360 gene rlmH 45777 46244 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456129.1 protein_id gnl|my_center|LOCUS_07360 46245 46910 gene locus_tag LOCUS_07370 46245 46910 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_07370 47198 48652 gene locus_tag LOCUS_07380 gene rng 47198 48652 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_07380 48679 52551 gene locus_tag LOCUS_07390 48679 52551 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268867.1 protein_id gnl|my_center|LOCUS_07390 52697 53521 gene locus_tag LOCUS_07400 52697 53521 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522140.1 protein_id gnl|my_center|LOCUS_07400 53742 53557 gene locus_tag LOCUS_07410 53742 53557 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070919.1 protein_id gnl|my_center|LOCUS_07410 53926 54390 gene locus_tag LOCUS_07420 gene bfr 53926 54390 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 protein_id gnl|my_center|LOCUS_07420 54423 54890 gene locus_tag LOCUS_07430 gene bfr 54423 54890 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 protein_id gnl|my_center|LOCUS_07430 55679 55515 gene locus_tag LOCUS_07440 55679 55515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 55941 58211 gene locus_tag LOCUS_07450 55941 58211 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_07450 58285 58953 gene locus_tag LOCUS_07460 58285 58953 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_07460 58943 59341 gene locus_tag LOCUS_07470 58943 59341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence011 943 1188 gene locus_tag LOCUS_07480 943 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1264 2415 gene locus_tag LOCUS_07490 1264 2415 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_07490 2426 3322 gene locus_tag LOCUS_07500 2426 3322 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_07500 3319 4083 gene locus_tag LOCUS_07510 3319 4083 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_07510 4613 4065 gene locus_tag LOCUS_07520 gene ampD 4613 4065 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 protein_id gnl|my_center|LOCUS_07520 4803 4615 gene locus_tag LOCUS_07530 4803 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4885 5109 gene locus_tag LOCUS_07540 4885 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 5148 5513 gene locus_tag LOCUS_07550 5148 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 5878 5573 gene locus_tag LOCUS_07560 5878 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 7473 5941 gene locus_tag LOCUS_07570 7473 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 7766 8308 gene locus_tag LOCUS_07580 7766 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 8308 9729 gene locus_tag LOCUS_07590 8308 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 9730 12561 gene locus_tag LOCUS_07600 9730 12561 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_07600 12609 13193 gene locus_tag LOCUS_07610 12609 13193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 13205 13468 gene locus_tag LOCUS_07620 13205 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 13781 14392 gene locus_tag LOCUS_07630 13781 14392 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_07630 14426 14905 gene locus_tag LOCUS_07640 14426 14905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 14902 15417 gene locus_tag LOCUS_07650 14902 15417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 15425 16396 gene locus_tag LOCUS_07660 15425 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 16700 16476 gene locus_tag LOCUS_07670 16700 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 17321 16773 gene locus_tag LOCUS_07680 17321 16773 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_07680 18317 17586 gene locus_tag LOCUS_07690 18317 17586 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 protein_id gnl|my_center|LOCUS_07690 18919 18314 gene locus_tag LOCUS_07700 18919 18314 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_07700 20106 18916 gene locus_tag LOCUS_07710 gene cobT 20106 18916 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112354.1 protein_id gnl|my_center|LOCUS_07710 20668 20147 gene locus_tag LOCUS_07720 gene cobU 20668 20147 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_07720 20713 21597 gene locus_tag LOCUS_07730 20713 21597 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_07730 22450 21614 gene locus_tag LOCUS_07740 22450 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 24400 22454 gene locus_tag LOCUS_07750 24400 22454 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071109.1 protein_id gnl|my_center|LOCUS_07750 25611 24838 gene locus_tag LOCUS_07760 25611 24838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 protein_id gnl|my_center|LOCUS_07760 26773 25808 gene locus_tag LOCUS_07770 26773 25808 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_07770 28989 26773 gene locus_tag LOCUS_07780 gene plpD 28989 26773 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_07780 29820 29149 gene locus_tag LOCUS_07790 29820 29149 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_07790 29973 30452 gene locus_tag LOCUS_07800 29973 30452 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567255.1 protein_id gnl|my_center|LOCUS_07800 30555 32831 gene locus_tag LOCUS_07810 gene ptsP 30555 32831 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_07810 33737 32904 gene locus_tag LOCUS_07820 33737 32904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07820 34237 33737 gene locus_tag LOCUS_07830 34237 33737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 37106 34263 gene locus_tag LOCUS_07840 37106 34263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 38029 37157 gene locus_tag LOCUS_07850 38029 37157 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266954.1 protein_id gnl|my_center|LOCUS_07850 39897 38032 gene locus_tag LOCUS_07860 39897 38032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 40643 40134 gene locus_tag LOCUS_07870 40643 40134 CDS product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094783.1 protein_id gnl|my_center|LOCUS_07870 41177 40695 gene locus_tag LOCUS_07880 41177 40695 CDS product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094862.1 protein_id gnl|my_center|LOCUS_07880 44378 41268 gene locus_tag LOCUS_07890 44378 41268 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_07890 45516 44470 gene locus_tag LOCUS_07900 45516 44470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 46851 45571 gene locus_tag LOCUS_07910 gene hemL 46851 45571 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_07910 47157 47984 gene locus_tag LOCUS_07920 gene nei 47157 47984 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113989.1 protein_id gnl|my_center|LOCUS_07920 48298 49224 gene locus_tag LOCUS_07930 48298 49224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 49988 49332 gene locus_tag LOCUS_07940 gene thiE 49988 49332 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_07940 50784 49981 gene locus_tag LOCUS_07950 50784 49981 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427216.1 protein_id gnl|my_center|LOCUS_07950 51074 51601 gene locus_tag LOCUS_07960 51074 51601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 52049 51630 gene locus_tag LOCUS_07970 gene hemJ 52049 51630 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377457.1 protein_id gnl|my_center|LOCUS_07970 53907 52222 gene locus_tag LOCUS_07980 53907 52222 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_07980 55600 54254 gene locus_tag LOCUS_07990 gene argA 55600 54254 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096265.1 protein_id gnl|my_center|LOCUS_07990 55936 56730 gene locus_tag LOCUS_08000 gene djlA 55936 56730 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 protein_id gnl|my_center|LOCUS_08000 57436 56708 gene locus_tag LOCUS_08010 57436 56708 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence012 250 564 gene locus_tag LOCUS_08020 gene rpsJ 250 564 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_08020 627 1271 gene locus_tag LOCUS_08030 gene rplC 627 1271 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103877.1 protein_id gnl|my_center|LOCUS_08030 1283 1903 gene locus_tag LOCUS_08040 gene rplD 1283 1903 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422344.1 protein_id gnl|my_center|LOCUS_08040 1900 2196 gene locus_tag LOCUS_08050 gene rplW 1900 2196 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307955.1 protein_id gnl|my_center|LOCUS_08050 2216 3043 gene locus_tag LOCUS_08060 gene rplB 2216 3043 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397049.1 protein_id gnl|my_center|LOCUS_08060 3122 3334 gene locus_tag LOCUS_08070 gene rpsS 3122 3334 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 protein_id gnl|my_center|LOCUS_08070 3346 3678 gene locus_tag LOCUS_08080 gene rplV 3346 3678 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_08080 3690 4370 gene locus_tag LOCUS_08090 gene rpsC 3690 4370 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_08090 4382 4795 gene locus_tag LOCUS_08100 gene rplP 4382 4795 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_08100 4795 4992 gene locus_tag LOCUS_08110 gene rpmC 4795 4992 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 protein_id gnl|my_center|LOCUS_08110 4989 5246 gene locus_tag LOCUS_08120 gene rpsQ 4989 5246 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555480.1 protein_id gnl|my_center|LOCUS_08120 5412 5780 gene locus_tag LOCUS_08130 gene rplN 5412 5780 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806916.1 protein_id gnl|my_center|LOCUS_08130 5798 6115 gene locus_tag LOCUS_08140 gene rplX 5798 6115 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 protein_id gnl|my_center|LOCUS_08140 6130 6669 gene locus_tag LOCUS_08150 gene rplE 6130 6669 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946090.1 protein_id gnl|my_center|LOCUS_08150 6682 6987 gene locus_tag LOCUS_08160 gene rpsN 6682 6987 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093701.1 protein_id gnl|my_center|LOCUS_08160 7030 7425 gene locus_tag LOCUS_08170 gene rpsH 7030 7425 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644434.1 protein_id gnl|my_center|LOCUS_08170 7438 7971 gene locus_tag LOCUS_08180 gene rplF 7438 7971 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_08180 7984 8337 gene locus_tag LOCUS_08190 gene rplR 7984 8337 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049741.1 protein_id gnl|my_center|LOCUS_08190 8354 8860 gene locus_tag LOCUS_08200 gene rpsE 8354 8860 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317099.1 protein_id gnl|my_center|LOCUS_08200 8868 9050 gene locus_tag LOCUS_08210 gene rpmD 8868 9050 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417257.1 protein_id gnl|my_center|LOCUS_08210 9052 9486 gene locus_tag LOCUS_08220 gene rplO 9052 9486 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391411.1 protein_id gnl|my_center|LOCUS_08220 9508 10833 gene locus_tag LOCUS_08230 gene secY 9508 10833 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417263.1 protein_id gnl|my_center|LOCUS_08230 11058 11414 gene locus_tag LOCUS_08240 gene rpsM 11058 11414 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307991.1 protein_id gnl|my_center|LOCUS_08240 11448 11831 gene locus_tag LOCUS_08250 gene rpsK 11448 11831 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543603.1 protein_id gnl|my_center|LOCUS_08250 11846 12472 gene locus_tag LOCUS_08260 gene rpsD 11846 12472 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 protein_id gnl|my_center|LOCUS_08260 12526 13521 gene locus_tag LOCUS_08270 gene rpoA 12526 13521 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_08270 13625 13981 gene locus_tag LOCUS_08280 gene rplQ 13625 13981 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036134.1 protein_id gnl|my_center|LOCUS_08280 14076 14276 gene locus_tag LOCUS_08290 14076 14276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 14534 15796 gene locus_tag LOCUS_08300 14534 15796 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 protein_id gnl|my_center|LOCUS_08300 15916 15991 gene locus_tag LOCUS_t00050 15916 15991 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16031 17611 gene locus_tag LOCUS_08310 16031 17611 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946608.1 protein_id gnl|my_center|LOCUS_08310 18039 18980 gene locus_tag LOCUS_08320 gene gspC 18039 18980 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262834.1 protein_id gnl|my_center|LOCUS_08320 19149 21092 gene locus_tag LOCUS_08330 gene gspD 19149 21092 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086028586.1 protein_id gnl|my_center|LOCUS_08330 19416 19340 gene locus_tag LOCUS_t00060 19416 19340 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 21096 22631 gene locus_tag LOCUS_08340 gene xcpR 21096 22631 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_08340 22728 23939 gene locus_tag LOCUS_08350 gene gspF 22728 23939 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_08350 25729 24293 gene locus_tag LOCUS_08360 25729 24293 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 protein_id gnl|my_center|LOCUS_08360 26511 25726 gene locus_tag LOCUS_08370 gene pmrA 26511 25726 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_08370 26861 28207 gene locus_tag LOCUS_08380 26861 28207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 28281 28778 gene locus_tag LOCUS_08390 gene pncC 28281 28778 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478554.1 protein_id gnl|my_center|LOCUS_08390 28765 29319 gene locus_tag LOCUS_08400 gene thpR 28765 29319 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820023.1 protein_id gnl|my_center|LOCUS_08400 30214 29324 gene locus_tag LOCUS_08410 30214 29324 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_08410 30423 31478 gene locus_tag LOCUS_08420 gene recA 30423 31478 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_08420 31535 32038 gene locus_tag LOCUS_08430 gene recX 31535 32038 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766020.1 protein_id gnl|my_center|LOCUS_08430 32106 34730 gene locus_tag LOCUS_08440 gene alaS 32106 34730 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_08440 34840 36072 gene locus_tag LOCUS_08450 34840 36072 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731386.1 protein_id gnl|my_center|LOCUS_08450 36246 36434 gene locus_tag LOCUS_08460 gene csrA 36246 36434 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085981.1 protein_id gnl|my_center|LOCUS_08460 36646 36735 gene locus_tag LOCUS_t00070 36646 36735 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 36851 36927 gene locus_tag LOCUS_t00080 36851 36927 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 38206 37013 gene locus_tag LOCUS_08470 38206 37013 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_08470 38724 39734 gene locus_tag LOCUS_08480 38724 39734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391744.1 protein_id gnl|my_center|LOCUS_08480 39731 40018 gene locus_tag LOCUS_08490 39731 40018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 41136 40471 gene locus_tag LOCUS_08500 41136 40471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 42158 41262 gene locus_tag LOCUS_08510 gene cyoE 42158 41262 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880042.1 protein_id gnl|my_center|LOCUS_08510 43842 42268 gene locus_tag LOCUS_08520 43842 42268 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 protein_id gnl|my_center|LOCUS_08520 45251 44046 gene locus_tag LOCUS_08530 gene nirJ 45251 44046 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_08530 45749 45264 gene locus_tag LOCUS_08540 45749 45264 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_08540 46726 45746 gene locus_tag LOCUS_08550 46726 45746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 47166 46717 gene locus_tag LOCUS_08560 47166 46717 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 protein_id gnl|my_center|LOCUS_08560 48367 47168 gene locus_tag LOCUS_08570 gene nirF 48367 47168 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_08570 48665 48357 gene locus_tag LOCUS_08580 gene nirC 48665 48357 CDS product cytochrome c55X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084870.1 protein_id gnl|my_center|LOCUS_08580 49531 48713 gene locus_tag LOCUS_08590 49531 48713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 51289 49673 gene locus_tag LOCUS_08600 gene nirS 51289 49673 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_08600 52831 51503 gene locus_tag LOCUS_08610 52831 51503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_08610 53257 52994 gene locus_tag LOCUS_08620 53257 52994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 53712 53236 gene locus_tag LOCUS_08630 53712 53236 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_08630 53964 54323 gene locus_tag LOCUS_08640 53964 54323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 54590 55549 gene locus_tag LOCUS_08650 54590 55549 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_08650 55910 55725 gene locus_tag LOCUS_08660 55910 55725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence013 354 121 gene locus_tag LOCUS_08670 354 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 4289 351 gene locus_tag LOCUS_08680 4289 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 7596 4276 gene locus_tag LOCUS_08690 7596 4276 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_08690 8717 7659 gene locus_tag LOCUS_08700 8717 7659 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_08700 9419 9156 gene locus_tag LOCUS_08710 9419 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 10258 9416 gene locus_tag LOCUS_08720 10258 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 10551 10255 gene locus_tag LOCUS_08730 10551 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 11816 10773 gene locus_tag LOCUS_08740 11816 10773 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 protein_id gnl|my_center|LOCUS_08740 11980 11904 gene locus_tag LOCUS_t00090 11980 11904 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13852 12020 gene locus_tag LOCUS_08750 gene rpoD 13852 12020 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_08750 15689 13947 gene locus_tag LOCUS_08760 gene dnaG 15689 13947 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918827.1 protein_id gnl|my_center|LOCUS_08760 16281 15832 gene locus_tag LOCUS_08770 16281 15832 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_08770 16554 16339 gene locus_tag LOCUS_08780 gene rpsU 16554 16339 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_08780 16697 17722 gene locus_tag LOCUS_08790 gene tsaD 16697 17722 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262666.1 protein_id gnl|my_center|LOCUS_08790 18421 17963 gene locus_tag LOCUS_08800 18421 17963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 18617 19162 gene locus_tag LOCUS_08810 gene nudE 18617 19162 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017765235.1 protein_id gnl|my_center|LOCUS_08810 19159 19992 gene locus_tag LOCUS_08820 gene cysQ 19159 19992 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038007.1 protein_id gnl|my_center|LOCUS_08820 20073 20771 gene locus_tag LOCUS_08830 20073 20771 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_08830 20800 21375 gene locus_tag LOCUS_08840 20800 21375 CDS product DNA-J related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_08840 23691 21466 gene locus_tag LOCUS_08850 23691 21466 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_08850 23909 23694 gene locus_tag LOCUS_08860 23909 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 24239 24724 gene locus_tag LOCUS_08870 24239 24724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 25836 24784 gene locus_tag LOCUS_08880 25836 24784 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620024.1 protein_id gnl|my_center|LOCUS_08880 26138 26557 gene locus_tag LOCUS_08890 26138 26557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 26684 27745 gene locus_tag LOCUS_08900 gene aroG 26684 27745 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705850.1 protein_id gnl|my_center|LOCUS_08900 28250 27780 gene locus_tag LOCUS_08910 28250 27780 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974302.1 protein_id gnl|my_center|LOCUS_08910 29403 28360 gene locus_tag LOCUS_08920 29403 28360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 29558 29830 gene locus_tag LOCUS_08930 29558 29830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 30490 29885 gene locus_tag LOCUS_08940 30490 29885 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705411.1 protein_id gnl|my_center|LOCUS_08940 32936 30660 gene locus_tag LOCUS_08950 gene rlmKL 32936 30660 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_08950 33241 32933 gene locus_tag LOCUS_08960 33241 32933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 33225 33722 gene locus_tag LOCUS_08970 33225 33722 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 protein_id gnl|my_center|LOCUS_08970 33998 33723 gene locus_tag LOCUS_08980 33998 33723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 34452 34045 gene locus_tag LOCUS_08990 34452 34045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 34451 35602 gene locus_tag LOCUS_09000 gene zapE 34451 35602 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_09000 35655 36383 gene locus_tag LOCUS_09010 35655 36383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 36453 37202 gene locus_tag LOCUS_09020 36453 37202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 37621 37271 gene locus_tag LOCUS_09030 37621 37271 CDS product DUF5335 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880739.1 protein_id gnl|my_center|LOCUS_09030 38251 38006 gene locus_tag LOCUS_09040 38251 38006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 38376 38720 gene locus_tag LOCUS_09050 38376 38720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 38778 40613 gene locus_tag LOCUS_09060 38778 40613 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391006.1 protein_id gnl|my_center|LOCUS_09060 42365 40722 gene locus_tag LOCUS_09070 42365 40722 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204917.1 protein_id gnl|my_center|LOCUS_09070 43017 42652 gene locus_tag LOCUS_09080 43017 42652 CDS product DUF6164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 protein_id gnl|my_center|LOCUS_09080 44281 43205 gene locus_tag LOCUS_09090 gene modC 44281 43205 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104308.1 protein_id gnl|my_center|LOCUS_09090 44937 44278 gene locus_tag LOCUS_09100 gene modB 44937 44278 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_09100 45670 44939 gene locus_tag LOCUS_09110 gene modA 45670 44939 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_09110 45781 46140 gene locus_tag LOCUS_09120 45781 46140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 46184 46990 gene locus_tag LOCUS_09130 46184 46990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 47374 47012 gene locus_tag LOCUS_09140 47374 47012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 47547 49076 gene locus_tag LOCUS_09150 47547 49076 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_09150 49217 50800 gene locus_tag LOCUS_09160 49217 50800 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387100.1 protein_id gnl|my_center|LOCUS_09160 51920 52771 gene locus_tag LOCUS_09170 gene nadC 51920 52771 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence014 923 1375 gene locus_tag LOCUS_09180 gene mraZ 923 1375 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103101.1 protein_id gnl|my_center|LOCUS_09180 1399 2322 gene locus_tag LOCUS_09190 gene rsmH 1399 2322 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769446.1 protein_id gnl|my_center|LOCUS_09190 2338 2589 gene locus_tag LOCUS_09200 gene ftsL 2338 2589 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035956.1 protein_id gnl|my_center|LOCUS_09200 2586 4340 gene locus_tag LOCUS_09210 gene ftsI 2586 4340 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_09210 4340 5842 gene locus_tag LOCUS_09220 4340 5842 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994100.1 protein_id gnl|my_center|LOCUS_09220 5839 7203 gene locus_tag LOCUS_09230 5839 7203 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_09230 7203 8285 gene locus_tag LOCUS_09240 gene mraY 7203 8285 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_09240 8290 9651 gene locus_tag LOCUS_09250 gene murD 8290 9651 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268846.1 protein_id gnl|my_center|LOCUS_09250 9648 10895 gene locus_tag LOCUS_09260 gene ftsW 9648 10895 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957396.1 protein_id gnl|my_center|LOCUS_09260 10892 11989 gene locus_tag LOCUS_09270 gene murG 10892 11989 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_09270 11982 13433 gene locus_tag LOCUS_09280 gene murC 11982 13433 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766570.1 protein_id gnl|my_center|LOCUS_09280 13615 14514 gene locus_tag LOCUS_09290 gene murB 13615 14514 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_09290 14696 15616 gene locus_tag LOCUS_09300 14696 15616 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_09300 15616 16434 gene locus_tag LOCUS_09310 15616 16434 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073898.1 protein_id gnl|my_center|LOCUS_09310 16635 17879 gene locus_tag LOCUS_09320 gene ftsA 16635 17879 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_09320 17927 19078 gene locus_tag LOCUS_09330 gene ftsZ 17927 19078 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011997353.1 protein_id gnl|my_center|LOCUS_09330 19239 20150 gene locus_tag LOCUS_09340 gene lpxC 19239 20150 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_09340 20774 20307 gene locus_tag LOCUS_09350 20774 20307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 20924 21805 gene locus_tag LOCUS_09360 20924 21805 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_09360 21923 24631 gene locus_tag LOCUS_09370 gene secA 21923 24631 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073892.1 protein_id gnl|my_center|LOCUS_09370 24772 25989 gene locus_tag LOCUS_09380 gene argJ 24772 25989 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 protein_id gnl|my_center|LOCUS_09380 26017 26982 gene locus_tag LOCUS_09390 26017 26982 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_09390 27394 26999 gene locus_tag LOCUS_09400 gene apaG 27394 26999 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073443.1 protein_id gnl|my_center|LOCUS_09400 28961 27474 gene locus_tag LOCUS_09410 28961 27474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 29855 29073 gene locus_tag LOCUS_09420 29855 29073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 30825 29872 gene locus_tag LOCUS_09430 30825 29872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 31480 32157 gene locus_tag LOCUS_09440 31480 32157 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 protein_id gnl|my_center|LOCUS_09440 32567 33127 gene locus_tag LOCUS_09450 32567 33127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 33127 33657 gene locus_tag LOCUS_09460 33127 33657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 33766 33614 gene locus_tag LOCUS_09470 33766 33614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 33759 34160 gene locus_tag LOCUS_09480 33759 34160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 34163 34615 gene locus_tag LOCUS_09490 34163 34615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 34837 34631 gene locus_tag LOCUS_09500 34837 34631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 35202 35459 gene locus_tag LOCUS_09510 35202 35459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 35659 37065 gene locus_tag LOCUS_09520 gene ccoN 35659 37065 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_09520 37222 38049 gene locus_tag LOCUS_09530 37222 38049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 38061 38684 gene locus_tag LOCUS_09540 38061 38684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 38685 38843 gene locus_tag LOCUS_09550 38685 38843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 38916 39305 gene locus_tag LOCUS_09560 38916 39305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 39315 39599 gene locus_tag LOCUS_09570 39315 39599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 39608 40096 gene locus_tag LOCUS_09580 39608 40096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 40093 40590 gene locus_tag LOCUS_09590 40093 40590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 40592 41653 gene locus_tag LOCUS_09600 40592 41653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 41666 41914 gene locus_tag LOCUS_09610 41666 41914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 41928 42260 gene locus_tag LOCUS_09620 41928 42260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 42273 44990 gene locus_tag LOCUS_09630 42273 44990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 45022 46332 gene locus_tag LOCUS_09640 45022 46332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 46336 46761 gene locus_tag LOCUS_09650 46336 46761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 46785 47063 gene locus_tag LOCUS_09660 46785 47063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 47063 47449 gene locus_tag LOCUS_09670 47063 47449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 47969 47457 gene locus_tag LOCUS_09680 47969 47457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 48496 47966 gene locus_tag LOCUS_09690 48496 47966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 48903 49565 gene locus_tag LOCUS_09700 48903 49565 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_09700 49760 51598 gene locus_tag LOCUS_09710 gene uvrC 49760 51598 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_09710 51751 52329 gene locus_tag LOCUS_09720 gene pgsA 51751 52329 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence015 <1 840 gene locus_tag LOCUS_09730 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088518.1:FAD/NAD(P)-binding oxidoreductase 1253 2575 gene locus_tag LOCUS_09740 1253 2575 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769514.1 protein_id gnl|my_center|LOCUS_09740 3518 2610 gene locus_tag LOCUS_09750 3518 2610 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_09750 4176 3697 gene locus_tag LOCUS_09760 4176 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 4807 4208 gene locus_tag LOCUS_09770 4807 4208 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_09770 6685 5582 gene locus_tag LOCUS_09780 gene amrS 6685 5582 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_09780 6791 7597 gene locus_tag LOCUS_09790 gene amrB 6791 7597 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_09790 7584 8180 gene locus_tag LOCUS_09800 7584 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 9348 8380 gene locus_tag LOCUS_09810 9348 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 9523 10911 gene locus_tag LOCUS_09820 9523 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 10908 11180 gene locus_tag LOCUS_09830 10908 11180 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383046.1 protein_id gnl|my_center|LOCUS_09830 11682 11290 gene locus_tag LOCUS_09840 11682 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 12201 11716 gene locus_tag LOCUS_09850 12201 11716 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 protein_id gnl|my_center|LOCUS_09850 13449 12451 gene locus_tag LOCUS_09860 13449 12451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 14261 13449 gene locus_tag LOCUS_09870 14261 13449 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 protein_id gnl|my_center|LOCUS_09870 15196 14261 gene locus_tag LOCUS_09880 gene motD 15196 14261 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_09880 15950 15210 gene locus_tag LOCUS_09890 15950 15210 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378725.1 protein_id gnl|my_center|LOCUS_09890 17137 16055 gene locus_tag LOCUS_09900 17137 16055 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895569.1 protein_id gnl|my_center|LOCUS_09900 19232 17148 gene locus_tag LOCUS_09910 19232 17148 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103790.1 protein_id gnl|my_center|LOCUS_09910 19997 19242 gene locus_tag LOCUS_09920 19997 19242 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766975.1 protein_id gnl|my_center|LOCUS_09920 20393 20001 gene locus_tag LOCUS_09930 gene cheY 20393 20001 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_09930 21182 20442 gene locus_tag LOCUS_09940 gene fliA 21182 20442 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_09940 22095 21217 gene locus_tag LOCUS_09950 gene fleN 22095 21217 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412391.1 protein_id gnl|my_center|LOCUS_09950 23434 22082 gene locus_tag LOCUS_09960 gene flhF 23434 22082 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705286.1 protein_id gnl|my_center|LOCUS_09960 25558 23477 gene locus_tag LOCUS_09970 gene flhA 25558 23477 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_09970 26697 25561 gene locus_tag LOCUS_09980 gene flhB 26697 25561 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_09980 27475 26699 gene locus_tag LOCUS_09990 gene fliR 27475 26699 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_09990 27756 27487 gene locus_tag LOCUS_10000 gene fliQ 27756 27487 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_10000 28559 27810 gene locus_tag LOCUS_10010 gene fliP 28559 27810 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073102.1 protein_id gnl|my_center|LOCUS_10010 29047 28559 gene locus_tag LOCUS_10020 29047 28559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 29535 29044 gene locus_tag LOCUS_10030 gene fliN 29535 29044 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083049.1 protein_id gnl|my_center|LOCUS_10030 30621 29554 gene locus_tag LOCUS_10040 gene fliM 30621 29554 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083045.1 protein_id gnl|my_center|LOCUS_10040 31173 30640 gene locus_tag LOCUS_10050 gene fliL 31173 30640 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_10050 31542 32573 gene locus_tag LOCUS_10060 31542 32573 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941134.1 protein_id gnl|my_center|LOCUS_10060 32921 32619 gene locus_tag LOCUS_10070 32921 32619 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616835.1 protein_id gnl|my_center|LOCUS_10070 34114 33038 gene locus_tag LOCUS_10080 34114 33038 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_10080 34774 34127 gene locus_tag LOCUS_10090 gene cheD 34774 34127 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_10090 35651 34785 gene locus_tag LOCUS_10100 35651 34785 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832274.1 protein_id gnl|my_center|LOCUS_10100 38185 35681 gene locus_tag LOCUS_10110 38185 35681 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896388.1 protein_id gnl|my_center|LOCUS_10110 38121 38285 gene locus_tag LOCUS_10120 38121 38285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 39228 38449 gene locus_tag LOCUS_10130 39228 38449 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_10130 39730 39209 gene locus_tag LOCUS_10140 gene cheW 39730 39209 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_10140 41862 39772 gene locus_tag LOCUS_10150 41862 39772 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_10150 42371 41928 gene locus_tag LOCUS_10160 42371 41928 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087637.1 protein_id gnl|my_center|LOCUS_10160 42797 42435 gene locus_tag LOCUS_10170 42797 42435 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_10170 43132 42815 gene locus_tag LOCUS_10180 43132 42815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 44745 43351 gene locus_tag LOCUS_10190 44745 43351 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204243.1 protein_id gnl|my_center|LOCUS_10190 45266 44841 gene locus_tag LOCUS_10200 45266 44841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 48230 45333 gene locus_tag LOCUS_10210 48230 45333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 48366 49034 gene locus_tag LOCUS_10220 48366 49034 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 protein_id gnl|my_center|LOCUS_10220 49050 50162 gene locus_tag LOCUS_10230 gene mnmA 49050 50162 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097080.1 protein_id gnl|my_center|LOCUS_10230 50204 50857 gene locus_tag LOCUS_10240 gene hflD 50204 50857 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072581.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence016 1843 599 gene locus_tag LOCUS_10250 1843 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3076 1919 gene locus_tag LOCUS_10260 3076 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3387 3073 gene locus_tag LOCUS_10270 3387 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 4960 3698 gene locus_tag LOCUS_10280 gene ccmI 4960 3698 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_10280 5451 4957 gene locus_tag LOCUS_10290 5451 4957 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_10290 6011 5442 gene locus_tag LOCUS_10300 6011 5442 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_10300 8030 6015 gene locus_tag LOCUS_10310 8030 6015 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_10310 8613 8149 gene locus_tag LOCUS_10320 gene ccmE 8613 8149 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_10320 8798 8610 gene locus_tag LOCUS_10330 8798 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 9558 8791 gene locus_tag LOCUS_10340 gene ccmC 9558 8791 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_10340 10314 9616 gene locus_tag LOCUS_10350 gene ccmB 10314 9616 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 protein_id gnl|my_center|LOCUS_10350 10943 10311 gene locus_tag LOCUS_10360 gene ccmA 10943 10311 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 protein_id gnl|my_center|LOCUS_10360 11431 10997 gene locus_tag LOCUS_10370 11431 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 12261 11509 gene locus_tag LOCUS_10380 12261 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 13123 12275 gene locus_tag LOCUS_10390 gene ccsB 13123 12275 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944563.1 protein_id gnl|my_center|LOCUS_10390 14127 13120 gene locus_tag LOCUS_10400 14127 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 14257 15516 gene locus_tag LOCUS_10410 14257 15516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 15519 16241 gene locus_tag LOCUS_10420 15519 16241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 18351 16204 gene locus_tag LOCUS_10430 18351 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 21015 18400 gene locus_tag LOCUS_10440 21015 18400 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_10440 23334 21196 gene locus_tag LOCUS_10450 23334 21196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 26075 23400 gene locus_tag LOCUS_10460 26075 23400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 27178 26141 gene locus_tag LOCUS_10470 27178 26141 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_10470 27998 27204 gene locus_tag LOCUS_10480 27998 27204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 28819 28277 gene locus_tag LOCUS_10490 28819 28277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 30143 28956 gene locus_tag LOCUS_10500 30143 28956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 30226 30537 gene locus_tag LOCUS_10510 30226 30537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 31169 30678 gene locus_tag LOCUS_10520 31169 30678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 31765 31364 gene locus_tag LOCUS_10530 31765 31364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 32269 31847 gene locus_tag LOCUS_10540 32269 31847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 34882 33899 gene locus_tag LOCUS_10550 34882 33899 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_10550 35877 35023 gene locus_tag LOCUS_10560 35877 35023 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_10560 37375 36281 gene locus_tag LOCUS_10570 37375 36281 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941279.1 protein_id gnl|my_center|LOCUS_10570 38433 37447 gene locus_tag LOCUS_10580 38433 37447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 38730 38657 gene locus_tag LOCUS_t00100 38730 38657 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 39213 38821 gene locus_tag LOCUS_10590 gene rpsI 39213 38821 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829824.1 protein_id gnl|my_center|LOCUS_10590 39666 39238 gene locus_tag LOCUS_10600 gene rplM 39666 39238 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098967.1 protein_id gnl|my_center|LOCUS_10600 40563 39955 gene locus_tag LOCUS_10610 gene coxH3 40563 39955 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_10610 41016 40705 gene locus_tag LOCUS_10620 41016 40705 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_10620 41172 42383 gene locus_tag LOCUS_10630 41172 42383 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_10630 45228 42394 gene locus_tag LOCUS_10640 45228 42394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 45374 46018 gene locus_tag LOCUS_10650 gene coq7 45374 46018 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085224.1 protein_id gnl|my_center|LOCUS_10650 47056 46256 gene locus_tag LOCUS_10660 gene speD 47056 46256 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101641.1 protein_id gnl|my_center|LOCUS_10660 47462 47070 gene locus_tag LOCUS_10670 47462 47070 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_10670 48102 47686 gene locus_tag LOCUS_10680 48102 47686 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_10680 48345 48980 gene locus_tag LOCUS_10690 gene crp 48345 48980 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070954.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence017 4401 1813 gene locus_tag LOCUS_10700 4401 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 5377 4676 gene locus_tag LOCUS_10710 5377 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 5826 6509 gene locus_tag LOCUS_10720 5826 6509 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965346.1 protein_id gnl|my_center|LOCUS_10720 6529 8418 gene locus_tag LOCUS_10730 6529 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 9042 9863 gene locus_tag LOCUS_10740 9042 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 9908 11809 gene locus_tag LOCUS_10750 9908 11809 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_10750 12651 11872 gene locus_tag LOCUS_10760 12651 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 12863 13474 gene locus_tag LOCUS_10770 gene lexA 12863 13474 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646079.1 protein_id gnl|my_center|LOCUS_10770 13471 13902 gene locus_tag LOCUS_10780 13471 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 14354 14019 gene locus_tag LOCUS_10790 14354 14019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 14645 14397 gene locus_tag LOCUS_10800 14645 14397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 14945 14670 gene locus_tag LOCUS_10810 14945 14670 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_10810 15183 15446 gene locus_tag LOCUS_10820 15183 15446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 15535 15459 gene locus_tag LOCUS_t00110 15535 15459 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15689 15614 gene locus_tag LOCUS_t00120 15689 15614 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16356 15880 gene locus_tag LOCUS_10830 16356 15880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 17161 16883 gene locus_tag LOCUS_10840 17161 16883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 17766 17158 gene locus_tag LOCUS_10850 17766 17158 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_10850 17924 18898 gene locus_tag LOCUS_10860 gene arsS 17924 18898 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_10860 18935 19609 gene locus_tag LOCUS_10870 18935 19609 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_10870 19614 20309 gene locus_tag LOCUS_10880 19614 20309 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 protein_id gnl|my_center|LOCUS_10880 21090 20350 gene locus_tag LOCUS_10890 21090 20350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 21647 21153 gene locus_tag LOCUS_10900 21647 21153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 21952 21644 gene locus_tag LOCUS_10910 21952 21644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 22891 22091 gene locus_tag LOCUS_10920 gene flgA 22891 22091 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 protein_id gnl|my_center|LOCUS_10920 23079 24014 gene locus_tag LOCUS_10930 23079 24014 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_10930 24051 24878 gene locus_tag LOCUS_10940 gene cheR 24051 24878 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_10940 25082 25498 gene locus_tag LOCUS_10950 gene flgB 25082 25498 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_10950 25537 25950 gene locus_tag LOCUS_10960 gene flgC 25537 25950 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 protein_id gnl|my_center|LOCUS_10960 25964 26644 gene locus_tag LOCUS_10970 gene flgD 25964 26644 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946950.1 protein_id gnl|my_center|LOCUS_10970 26663 27883 gene locus_tag LOCUS_10980 gene flgE 26663 27883 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_10980 27940 28680 gene locus_tag LOCUS_10990 27940 28680 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316785.1 protein_id gnl|my_center|LOCUS_10990 28713 29498 gene locus_tag LOCUS_11000 gene flgG 28713 29498 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 protein_id gnl|my_center|LOCUS_11000 29533 30222 gene locus_tag LOCUS_11010 gene flgH 29533 30222 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082166.1 protein_id gnl|my_center|LOCUS_11010 30234 31373 gene locus_tag LOCUS_11020 30234 31373 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_11020 31378 32349 gene locus_tag LOCUS_11030 gene flgJ 31378 32349 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454015.1 protein_id gnl|my_center|LOCUS_11030 32461 34122 gene locus_tag LOCUS_11040 gene flgK 32461 34122 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704937.1 protein_id gnl|my_center|LOCUS_11040 34264 35184 gene locus_tag LOCUS_11050 gene flgL 34264 35184 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212790.1 protein_id gnl|my_center|LOCUS_11050 36205 35255 gene locus_tag LOCUS_11060 36205 35255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 37485 36439 gene locus_tag LOCUS_11070 gene purM 37485 36439 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262407.1 protein_id gnl|my_center|LOCUS_11070 37986 37570 gene locus_tag LOCUS_11080 37986 37570 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704327.1 protein_id gnl|my_center|LOCUS_11080 38570 39808 gene locus_tag LOCUS_11090 38570 39808 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_11090 40033 41079 gene locus_tag LOCUS_11100 40033 41079 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706622.1 protein_id gnl|my_center|LOCUS_11100 41106 41657 gene locus_tag LOCUS_11110 41106 41657 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_11110 41674 42732 gene locus_tag LOCUS_11120 41674 42732 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_11120 42750 43466 gene locus_tag LOCUS_11130 gene hda 42750 43466 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958403.1 protein_id gnl|my_center|LOCUS_11130 44078 43485 gene locus_tag LOCUS_11140 gene wrbA 44078 43485 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958310.1 protein_id gnl|my_center|LOCUS_11140 44427 44080 gene locus_tag LOCUS_11150 gene arsC 44427 44080 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 protein_id gnl|my_center|LOCUS_11150 44589 44912 gene locus_tag LOCUS_11160 44589 44912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 45339 46112 gene locus_tag LOCUS_11170 45339 46112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence018 2080 221 gene locus_tag LOCUS_11180 2080 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2819 3871 gene locus_tag LOCUS_11190 2819 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 4610 4188 gene locus_tag LOCUS_11200 gene fur 4610 4188 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_11200 4761 5063 gene locus_tag LOCUS_11210 4761 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 5479 5060 gene locus_tag LOCUS_11220 5479 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5933 5496 gene locus_tag LOCUS_11230 5933 5496 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946119.1 protein_id gnl|my_center|LOCUS_11230 7517 5976 gene locus_tag LOCUS_11240 7517 5976 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_11240 7854 7636 gene locus_tag LOCUS_11250 7854 7636 CDS product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337004.1 protein_id gnl|my_center|LOCUS_11250 10232 7851 gene locus_tag LOCUS_11260 gene feoB 10232 7851 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337005.1 protein_id gnl|my_center|LOCUS_11260 10478 10233 gene locus_tag LOCUS_11270 10478 10233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 10875 11354 gene locus_tag LOCUS_11280 gene smpB 10875 11354 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120348.1 protein_id gnl|my_center|LOCUS_11280 11403 11765 gene locus_tag LOCUS_tm00010 11403 11765 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 12418 12948 gene locus_tag LOCUS_11290 12418 12948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 13293 12991 gene locus_tag LOCUS_11300 13293 12991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 16390 13295 gene locus_tag LOCUS_11310 16390 13295 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_11310 17538 16390 gene locus_tag LOCUS_11320 17538 16390 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405528.1 protein_id gnl|my_center|LOCUS_11320 18890 17679 gene locus_tag LOCUS_11330 18890 17679 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 protein_id gnl|my_center|LOCUS_11330 19688 19062 gene locus_tag LOCUS_11340 19688 19062 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096362.1 protein_id gnl|my_center|LOCUS_11340 20539 19685 gene locus_tag LOCUS_11350 20539 19685 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_11350 20809 21363 gene locus_tag LOCUS_11360 20809 21363 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957880.1 protein_id gnl|my_center|LOCUS_11360 21371 21673 gene locus_tag LOCUS_11370 21371 21673 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404138.1 protein_id gnl|my_center|LOCUS_11370 21670 21930 gene locus_tag LOCUS_11380 21670 21930 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_11380 21970 22791 gene locus_tag LOCUS_11390 21970 22791 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813874.1 protein_id gnl|my_center|LOCUS_11390 25554 22810 gene locus_tag LOCUS_11400 25554 22810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 26525 25551 gene locus_tag LOCUS_11410 26525 25551 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176666.1 protein_id gnl|my_center|LOCUS_11410 28579 26531 gene locus_tag LOCUS_11420 gene ligA 28579 26531 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705145.1 protein_id gnl|my_center|LOCUS_11420 29122 28583 gene locus_tag LOCUS_11430 gene def 29122 28583 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_11430 29153 30097 gene locus_tag LOCUS_11440 29153 30097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 30273 30758 gene locus_tag LOCUS_11450 30273 30758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 33717 30838 gene locus_tag LOCUS_11460 33717 30838 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_11460 34540 33842 gene locus_tag LOCUS_11470 34540 33842 CDS product DUF2459 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404966.1 protein_id gnl|my_center|LOCUS_11470 35285 34563 gene locus_tag LOCUS_11480 35285 34563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 36194 35703 gene locus_tag LOCUS_11490 36194 35703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 36507 36220 gene locus_tag LOCUS_11500 36507 36220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 37031 36504 gene locus_tag LOCUS_11510 37031 36504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 37902 37042 gene locus_tag LOCUS_11520 37902 37042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 38936 38025 gene locus_tag LOCUS_11530 38936 38025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 39063 40349 gene locus_tag LOCUS_11540 39063 40349 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_11540 40346 40894 gene locus_tag LOCUS_11550 40346 40894 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_11550 40897 41472 gene locus_tag LOCUS_11560 40897 41472 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 protein_id gnl|my_center|LOCUS_11560 41552 42355 gene locus_tag LOCUS_11570 41552 42355 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 protein_id gnl|my_center|LOCUS_11570 42924 42655 gene locus_tag LOCUS_11580 42924 42655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 42811 44754 gene locus_tag LOCUS_11590 42811 44754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 44984 44814 gene locus_tag LOCUS_11600 44984 44814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence019 3813 2815 gene locus_tag LOCUS_11610 3813 2815 CDS product DUF3187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943756.1 protein_id gnl|my_center|LOCUS_11610 5230 3839 gene locus_tag LOCUS_11620 gene argH 5230 3839 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_11620 5308 6402 gene locus_tag LOCUS_11630 gene algZ 5308 6402 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_11630 6399 7148 gene locus_tag LOCUS_11640 gene algR 6399 7148 CDS product alginate biosynthesis regulator AlgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096397.1 protein_id gnl|my_center|LOCUS_11640 7774 7247 gene locus_tag LOCUS_11650 7774 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 10928 7911 gene locus_tag LOCUS_11660 10928 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 12333 10969 gene locus_tag LOCUS_11670 12333 10969 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037479.1 protein_id gnl|my_center|LOCUS_11670 12451 13407 gene locus_tag LOCUS_11680 12451 13407 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927008.1 protein_id gnl|my_center|LOCUS_11680 13753 13463 gene locus_tag LOCUS_11690 13753 13463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 14965 13895 gene locus_tag LOCUS_11700 14965 13895 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_11700 14983 16224 gene locus_tag LOCUS_11710 14983 16224 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 protein_id gnl|my_center|LOCUS_11710 17024 16302 gene locus_tag LOCUS_11720 17024 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 17337 17095 gene locus_tag LOCUS_11730 17337 17095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 18231 17782 gene locus_tag LOCUS_11740 gene dtd 18231 17782 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266358.1 protein_id gnl|my_center|LOCUS_11740 19178 18228 gene locus_tag LOCUS_11750 gene pip 19178 18228 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_11750 19878 19327 gene locus_tag LOCUS_11760 19878 19327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 21870 20047 gene locus_tag LOCUS_11770 gene typA 21870 20047 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456840.1 protein_id gnl|my_center|LOCUS_11770 22074 22358 gene locus_tag LOCUS_11780 22074 22358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 22576 23133 gene locus_tag LOCUS_11790 22576 23133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 24090 23566 gene locus_tag LOCUS_11800 24090 23566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 25806 24148 gene locus_tag LOCUS_11810 25806 24148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 26866 25796 gene locus_tag LOCUS_11820 26866 25796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 27214 28104 gene locus_tag LOCUS_11830 27214 28104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 28101 29861 gene locus_tag LOCUS_11840 28101 29861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 29942 31420 gene locus_tag LOCUS_11850 29942 31420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 31438 31995 gene locus_tag LOCUS_11860 31438 31995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 32051 32719 gene locus_tag LOCUS_11870 32051 32719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 33152 32751 gene locus_tag LOCUS_11880 33152 32751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 33448 34437 gene locus_tag LOCUS_11890 gene ispH 33448 34437 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_11890 34580 35464 gene locus_tag LOCUS_11900 34580 35464 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_11900 35461 36498 gene locus_tag LOCUS_11910 35461 36498 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_11910 36564 37559 gene locus_tag LOCUS_11920 36564 37559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 37788 38084 gene locus_tag LOCUS_11930 37788 38084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 38147 38485 gene locus_tag LOCUS_11940 38147 38485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 38578 39072 gene locus_tag LOCUS_11950 38578 39072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 39645 39304 gene locus_tag LOCUS_11960 39645 39304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 41974 39749 gene locus_tag LOCUS_11970 41974 39749 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_11970 42440 42066 gene locus_tag LOCUS_11980 42440 42066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 42974 42480 gene locus_tag LOCUS_11990 42974 42480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 43171 42971 gene locus_tag LOCUS_12000 43171 42971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 44143 43307 gene locus_tag LOCUS_12010 44143 43307 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704877.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence020 722 1633 gene locus_tag LOCUS_12020 gene prfB 722 1633 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12020 1992 3509 gene locus_tag LOCUS_12030 gene lysS 1992 3509 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 protein_id gnl|my_center|LOCUS_12030 4666 3617 gene locus_tag LOCUS_12040 4666 3617 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 protein_id gnl|my_center|LOCUS_12040 4814 5194 gene locus_tag LOCUS_12050 4814 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 5191 5535 gene locus_tag LOCUS_12060 5191 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 5532 7292 gene locus_tag LOCUS_12070 gene sdhA 5532 7292 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946277.1 protein_id gnl|my_center|LOCUS_12070 7458 8156 gene locus_tag LOCUS_12080 7458 8156 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187935.1 protein_id gnl|my_center|LOCUS_12080 8149 8394 gene locus_tag LOCUS_12090 8149 8394 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507842.1 protein_id gnl|my_center|LOCUS_12090 8357 8821 gene locus_tag LOCUS_12100 8357 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 10496 8856 gene locus_tag LOCUS_12110 gene nadB 10496 8856 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_12110 10811 11392 gene locus_tag LOCUS_12120 gene rpoE 10811 11392 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_12120 11453 12154 gene locus_tag LOCUS_12130 11453 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 12151 13131 gene locus_tag LOCUS_12140 12151 13131 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_12140 13124 13597 gene locus_tag LOCUS_12150 13124 13597 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071554.1 protein_id gnl|my_center|LOCUS_12150 13629 15062 gene locus_tag LOCUS_12160 gene mucD 13629 15062 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_12160 15301 17100 gene locus_tag LOCUS_12170 gene lepA 15301 17100 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172749.1 protein_id gnl|my_center|LOCUS_12170 17125 17955 gene locus_tag LOCUS_12180 gene lepB 17125 17955 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363711.1 protein_id gnl|my_center|LOCUS_12180 17981 18355 gene locus_tag LOCUS_12190 17981 18355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 18382 19029 gene locus_tag LOCUS_12200 gene rnc 18382 19029 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882136.1 protein_id gnl|my_center|LOCUS_12200 19098 20015 gene locus_tag LOCUS_12210 gene era 19098 20015 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104911.1 protein_id gnl|my_center|LOCUS_12210 20214 20957 gene locus_tag LOCUS_12220 gene recO 20214 20957 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772032.1 protein_id gnl|my_center|LOCUS_12220 21299 22045 gene locus_tag LOCUS_12230 gene pdxJ 21299 22045 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001571773.1 protein_id gnl|my_center|LOCUS_12230 22042 22425 gene locus_tag LOCUS_12240 gene acpS 22042 22425 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635063.1 protein_id gnl|my_center|LOCUS_12240 22506 22582 gene locus_tag LOCUS_t00130 22506 22582 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 22935 23390 gene locus_tag LOCUS_12250 gene rimP 22935 23390 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_12250 23534 25066 gene locus_tag LOCUS_12260 gene nusA 23534 25066 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620402.1 protein_id gnl|my_center|LOCUS_12260 25084 27609 gene locus_tag LOCUS_12270 25084 27609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 27628 27999 gene locus_tag LOCUS_12280 gene rbfA 27628 27999 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_12280 28199 29119 gene locus_tag LOCUS_12290 gene truB 28199 29119 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209256.1 protein_id gnl|my_center|LOCUS_12290 29261 29533 gene locus_tag LOCUS_12300 gene rpsO 29261 29533 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456110.1 protein_id gnl|my_center|LOCUS_12300 29758 31848 gene locus_tag LOCUS_12310 gene pnp 29758 31848 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456067.1 protein_id gnl|my_center|LOCUS_12310 31938 32822 gene locus_tag LOCUS_12320 gene galU 31938 32822 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_12320 35942 33219 gene locus_tag LOCUS_12330 gene gacS 35942 33219 CDS product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 protein_id gnl|my_center|LOCUS_12330 36862 35939 gene locus_tag LOCUS_12340 36862 35939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 39006 36967 gene locus_tag LOCUS_12350 39006 36967 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_12350 39410 40300 gene locus_tag LOCUS_12360 gene cysM 39410 40300 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_12360 40690 42030 gene locus_tag LOCUS_12370 gene rlmD 40690 42030 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 protein_id gnl|my_center|LOCUS_12370 42136 42429 gene locus_tag LOCUS_12380 42136 42429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 42996 42442 gene locus_tag LOCUS_12390 gene mog 42996 42442 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707146.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence021 230 847 gene locus_tag LOCUS_12400 230 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1923 1168 gene locus_tag LOCUS_12410 gene cysZ 1923 1168 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408742.1 protein_id gnl|my_center|LOCUS_12410 3230 1920 gene locus_tag LOCUS_12420 3230 1920 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173812.1 protein_id gnl|my_center|LOCUS_12420 3757 3368 gene locus_tag LOCUS_12430 gene queF 3757 3368 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_12430 3911 7417 gene locus_tag LOCUS_12440 gene smc 3911 7417 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_12440 7933 7436 gene locus_tag LOCUS_12450 7933 7436 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194993.1 protein_id gnl|my_center|LOCUS_12450 8047 8754 gene locus_tag LOCUS_12460 8047 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 9185 10804 gene locus_tag LOCUS_12470 9185 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 10885 11823 gene locus_tag LOCUS_12480 gene prmB 10885 11823 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_12480 11896 13296 gene locus_tag LOCUS_12490 gene hemN 11896 13296 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_12490 13622 14314 gene locus_tag LOCUS_12500 13622 14314 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545458.1 protein_id gnl|my_center|LOCUS_12500 15303 14461 gene locus_tag LOCUS_12510 15303 14461 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_12510 17147 15429 gene locus_tag LOCUS_12520 17147 15429 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_12520 17261 18388 gene locus_tag LOCUS_12530 17261 18388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 19882 18413 gene locus_tag LOCUS_12540 19882 18413 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_12540 20340 22778 gene locus_tag LOCUS_12550 gene nirB 20340 22778 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_12550 23003 23317 gene locus_tag LOCUS_12560 gene nirD 23003 23317 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_12560 23540 25729 gene locus_tag LOCUS_12570 23540 25729 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393409.1 protein_id gnl|my_center|LOCUS_12570 25830 27656 gene locus_tag LOCUS_12580 25830 27656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 27909 29447 gene locus_tag LOCUS_12590 27909 29447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 29685 31538 gene locus_tag LOCUS_12600 29685 31538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 31885 33888 gene locus_tag LOCUS_12610 31885 33888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 33898 34359 gene locus_tag LOCUS_12620 33898 34359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 34361 35731 gene locus_tag LOCUS_12630 34361 35731 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113845.1 protein_id gnl|my_center|LOCUS_12630 35728 36408 gene locus_tag LOCUS_12640 35728 36408 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525366.1 protein_id gnl|my_center|LOCUS_12640 36428 38698 gene locus_tag LOCUS_12650 gene wspE 36428 38698 CDS product Wsp signal transduction system sensor histidine kinase WspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103736.1 protein_id gnl|my_center|LOCUS_12650 38695 39738 gene locus_tag LOCUS_12660 gene wspF 38695 39738 CDS product Wsp signal transduction system protein-glutamate methylesterase WspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092534.1 protein_id gnl|my_center|LOCUS_12660 39735 40760 gene locus_tag LOCUS_12670 39735 40760 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406328.1 protein_id gnl|my_center|LOCUS_12670 41292 41726 gene locus_tag LOCUS_12680 41292 41726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 41733 42989 gene locus_tag LOCUS_12690 41733 42989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence022 1001 432 gene locus_tag LOCUS_12700 1001 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1375 1013 gene locus_tag LOCUS_12710 1375 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2472 3461 gene locus_tag LOCUS_12720 2472 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3458 4474 gene locus_tag LOCUS_12730 3458 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4766 5734 gene locus_tag LOCUS_12740 4766 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 7554 5974 gene locus_tag LOCUS_12750 gene guaA 7554 5974 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266918.1 protein_id gnl|my_center|LOCUS_12750 9091 7631 gene locus_tag LOCUS_12760 gene guaB 9091 7631 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380633.1 protein_id gnl|my_center|LOCUS_12760 9506 9826 gene locus_tag LOCUS_12770 9506 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 9913 11259 gene locus_tag LOCUS_12780 gene xseA 9913 11259 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_12780 11426 12295 gene locus_tag LOCUS_12790 11426 12295 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818638.1 protein_id gnl|my_center|LOCUS_12790 12684 12343 gene locus_tag LOCUS_12800 12684 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 13770 12703 gene locus_tag LOCUS_12810 gene hemH 13770 12703 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_12810 13987 14643 gene locus_tag LOCUS_12820 gene senC 13987 14643 CDS product cytochrome c oxidase copper chaperone SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_12820 14682 15206 gene locus_tag LOCUS_12830 14682 15206 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807278.1 protein_id gnl|my_center|LOCUS_12830 15207 16091 gene locus_tag LOCUS_12840 15207 16091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 16547 16179 gene locus_tag LOCUS_12850 16547 16179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 17833 16835 gene locus_tag LOCUS_12860 gene epmA 17833 16835 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 protein_id gnl|my_center|LOCUS_12860 18413 17844 gene locus_tag LOCUS_12870 gene efp 18413 17844 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_12870 18483 19499 gene locus_tag LOCUS_12880 gene epmB 18483 19499 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_12880 19675 21531 gene locus_tag LOCUS_12890 gene fimW 19675 21531 CDS product cyclic-di-GMP receptor FimW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113922.1 protein_id gnl|my_center|LOCUS_12890 21611 23689 gene locus_tag LOCUS_12900 gene fimX 21611 23689 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_12900 24732 23848 gene locus_tag LOCUS_12910 gene htpX 24732 23848 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397849.1 protein_id gnl|my_center|LOCUS_12910 26676 24823 gene locus_tag LOCUS_12920 26676 24823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 28996 26741 gene locus_tag LOCUS_12930 gene parC 28996 26741 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_12930 29677 29144 gene locus_tag LOCUS_12940 29677 29144 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_12940 31681 29795 gene locus_tag LOCUS_12950 gene parE 31681 29795 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_12950 32436 31720 gene locus_tag LOCUS_12960 32436 31720 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_12960 32855 32436 gene locus_tag LOCUS_12970 32855 32436 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_12970 33159 33428 gene locus_tag LOCUS_12980 33159 33428 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379121.1 protein_id gnl|my_center|LOCUS_12980 33425 34315 gene locus_tag LOCUS_12990 33425 34315 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_12990 34418 36304 gene locus_tag LOCUS_13000 gene dxs 34418 36304 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103240.1 protein_id gnl|my_center|LOCUS_13000 36325 36705 gene locus_tag LOCUS_13010 gene queD 36325 36705 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_13010 36929 37729 gene locus_tag LOCUS_13020 gene folE2 36929 37729 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_13020 39010 37760 gene locus_tag LOCUS_13030 39010 37760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 39518 39108 gene locus_tag LOCUS_13040 39518 39108 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_13040 40611 39493 gene locus_tag LOCUS_13050 40611 39493 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_13050 41486 40839 gene locus_tag LOCUS_13060 41486 40839 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence023 1460 789 gene locus_tag LOCUS_13070 1460 789 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_13070 2579 1563 gene locus_tag LOCUS_13080 gene ilvC 2579 1563 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_13080 3125 2631 gene locus_tag LOCUS_13090 gene ilvN 3125 2631 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_13090 4816 3122 gene locus_tag LOCUS_13100 4816 3122 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_13100 5209 5490 gene locus_tag LOCUS_13110 5209 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5515 5859 gene locus_tag LOCUS_13120 5515 5859 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 protein_id gnl|my_center|LOCUS_13120 5884 6351 gene locus_tag LOCUS_13130 5884 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 6375 7097 gene locus_tag LOCUS_13140 6375 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 7167 7907 gene locus_tag LOCUS_13150 7167 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 10698 8206 gene locus_tag LOCUS_13160 10698 8206 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_13160 11402 10698 gene locus_tag LOCUS_13170 11402 10698 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_13170 11353 12021 gene locus_tag LOCUS_13180 11353 12021 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 protein_id gnl|my_center|LOCUS_13180 12866 12126 gene locus_tag LOCUS_13190 12866 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 13783 13064 gene locus_tag LOCUS_13200 gene ispD 13783 13064 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 protein_id gnl|my_center|LOCUS_13200 14078 13809 gene locus_tag LOCUS_13210 14078 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13210 15376 14093 gene locus_tag LOCUS_13220 gene eno 15376 14093 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065136.1 protein_id gnl|my_center|LOCUS_13220 16377 15544 gene locus_tag LOCUS_13230 gene kdsA 16377 15544 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_13230 17957 16374 gene locus_tag LOCUS_13240 17957 16374 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_13240 19538 18426 gene locus_tag LOCUS_13250 19538 18426 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869322.1 protein_id gnl|my_center|LOCUS_13250 20049 19549 gene locus_tag LOCUS_13260 20049 19549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 20319 22631 gene locus_tag LOCUS_13270 20319 22631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 22668 24362 gene locus_tag LOCUS_13280 22668 24362 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103766.1 protein_id gnl|my_center|LOCUS_13280 24359 25051 gene locus_tag LOCUS_13290 24359 25051 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_13290 25569 25069 gene locus_tag LOCUS_13300 25569 25069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 27718 26291 gene locus_tag LOCUS_13310 27718 26291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 27939 28784 gene locus_tag LOCUS_13320 27939 28784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 29326 28874 gene locus_tag LOCUS_13330 gene fxsA 29326 28874 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 protein_id gnl|my_center|LOCUS_13330 29757 30086 gene locus_tag LOCUS_13340 29757 30086 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819377.1 protein_id gnl|my_center|LOCUS_13340 30087 32369 gene locus_tag LOCUS_13350 gene dsbD 30087 32369 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_13350 32381 32929 gene locus_tag LOCUS_13360 32381 32929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 33145 33588 gene locus_tag LOCUS_13370 gene aroQ 33145 33588 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_13370 33617 34066 gene locus_tag LOCUS_13380 gene accB 33617 34066 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262775.1 protein_id gnl|my_center|LOCUS_13380 34184 35524 gene locus_tag LOCUS_13390 gene accC 34184 35524 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884639.1 protein_id gnl|my_center|LOCUS_13390 35562 36443 gene locus_tag LOCUS_13400 gene prmA 35562 36443 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_13400 36532 38322 gene locus_tag LOCUS_13410 36532 38322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence024 1161 160 gene locus_tag LOCUS_13420 1161 160 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724106.1 protein_id gnl|my_center|LOCUS_13420 1559 1158 gene locus_tag LOCUS_13430 1559 1158 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095326.1 protein_id gnl|my_center|LOCUS_13430 2287 1556 gene locus_tag LOCUS_13440 2287 1556 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_13440 3843 2284 gene locus_tag LOCUS_13450 3843 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533628.1 protein_id gnl|my_center|LOCUS_13450 4379 3930 gene locus_tag LOCUS_13460 4379 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 4500 4351 gene locus_tag LOCUS_13470 4500 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 6383 4752 gene locus_tag LOCUS_13480 6383 4752 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_13480 8042 6645 gene locus_tag LOCUS_13490 8042 6645 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943437.1 protein_id gnl|my_center|LOCUS_13490 8247 9548 gene locus_tag LOCUS_13500 gene purD 8247 9548 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_13500 9590 10147 gene locus_tag LOCUS_13510 9590 10147 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704272.1 protein_id gnl|my_center|LOCUS_13510 10243 10689 gene locus_tag LOCUS_13520 10243 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 10796 11722 gene locus_tag LOCUS_13530 gene hemF 10796 11722 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703138.1 protein_id gnl|my_center|LOCUS_13530 11723 12307 gene locus_tag LOCUS_13540 gene rsmD 11723 12307 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704347.1 protein_id gnl|my_center|LOCUS_13540 12353 12832 gene locus_tag LOCUS_13550 gene coaD 12353 12832 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_13550 12876 13130 gene locus_tag LOCUS_13560 12876 13130 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_13560 13194 14894 gene locus_tag LOCUS_13570 gene ggt 13194 14894 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 protein_id gnl|my_center|LOCUS_13570 15229 15906 gene locus_tag LOCUS_13580 gene purN 15229 15906 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_13580 15903 16307 gene locus_tag LOCUS_13590 15903 16307 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 protein_id gnl|my_center|LOCUS_13590 16297 17058 gene locus_tag LOCUS_13600 16297 17058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 18811 17243 gene locus_tag LOCUS_13610 18811 17243 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_13610 19038 19970 gene locus_tag LOCUS_13620 19038 19970 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527322.1 protein_id gnl|my_center|LOCUS_13620 20016 20840 gene locus_tag LOCUS_13630 20016 20840 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_13630 21462 20896 gene locus_tag LOCUS_13640 gene dcd 21462 20896 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_13640 22787 21696 gene locus_tag LOCUS_13650 gene apbC 22787 21696 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_13650 22977 25064 gene locus_tag LOCUS_13660 gene metG 22977 25064 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 protein_id gnl|my_center|LOCUS_13660 25348 25929 gene locus_tag LOCUS_13670 gene rsxA 25348 25929 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_13670 25929 26522 gene locus_tag LOCUS_13680 gene rsxB 25929 26522 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480813.1 protein_id gnl|my_center|LOCUS_13680 26522 28201 gene locus_tag LOCUS_13690 gene rsxC 26522 28201 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144393375.1 protein_id gnl|my_center|LOCUS_13690 28198 29241 gene locus_tag LOCUS_13700 gene rsxD 28198 29241 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061001934.1 protein_id gnl|my_center|LOCUS_13700 29241 29897 gene locus_tag LOCUS_13710 gene rsxG 29241 29897 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_13710 29924 30625 gene locus_tag LOCUS_13720 29924 30625 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480817.1 protein_id gnl|my_center|LOCUS_13720 30762 31349 gene locus_tag LOCUS_13730 gene tppE 30762 31349 CDS product type IVa pilus pseudopilin TppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704647.1 protein_id gnl|my_center|LOCUS_13730 31358 31879 gene locus_tag LOCUS_13740 gene pilV 31358 31879 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103292.1 protein_id gnl|my_center|LOCUS_13740 31876 32943 gene locus_tag LOCUS_13750 31876 32943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 32960 33514 gene locus_tag LOCUS_13760 32960 33514 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704650.1 protein_id gnl|my_center|LOCUS_13760 33557 37309 gene locus_tag LOCUS_13770 33557 37309 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_13770 37349 37753 gene locus_tag LOCUS_13780 37349 37753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 37811 38293 gene locus_tag LOCUS_13790 37811 38293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence025 2456 129 gene locus_tag LOCUS_13800 2456 129 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_13800 3100 2453 gene locus_tag LOCUS_13810 3100 2453 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206451.1 protein_id gnl|my_center|LOCUS_13810 3304 4044 gene locus_tag LOCUS_13820 3304 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4095 4859 gene locus_tag LOCUS_13830 4095 4859 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120080.1 protein_id gnl|my_center|LOCUS_13830 5019 4837 gene locus_tag LOCUS_13840 5019 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4967 5659 gene locus_tag LOCUS_13850 4967 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 5883 8732 gene locus_tag LOCUS_13860 gene sucA 5883 8732 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210726.1 protein_id gnl|my_center|LOCUS_13860 8729 10000 gene locus_tag LOCUS_13870 gene odhB 8729 10000 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 protein_id gnl|my_center|LOCUS_13870 10226 11644 gene locus_tag LOCUS_13880 gene lpdA 10226 11644 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_13880 12926 11646 gene locus_tag LOCUS_13890 12926 11646 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_13890 13286 12975 gene locus_tag LOCUS_13900 13286 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 13629 13829 gene locus_tag LOCUS_13910 13629 13829 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 protein_id gnl|my_center|LOCUS_13910 15805 14102 gene locus_tag LOCUS_13920 15805 14102 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_13920 15997 17493 gene locus_tag LOCUS_13930 gene pap 15997 17493 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_13930 17789 19864 gene locus_tag LOCUS_13940 gene ppk1 17789 19864 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036175.1 protein_id gnl|my_center|LOCUS_13940 20020 20346 gene locus_tag LOCUS_13950 20020 20346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 20333 20908 gene locus_tag LOCUS_13960 20333 20908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 21912 21028 gene locus_tag LOCUS_13970 21912 21028 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_13970 23429 21927 gene locus_tag LOCUS_13980 gene ppx 23429 21927 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120380.1 protein_id gnl|my_center|LOCUS_13980 23532 23981 gene locus_tag LOCUS_13990 23532 23981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 23978 25252 gene locus_tag LOCUS_14000 23978 25252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_14000 25302 27677 gene locus_tag LOCUS_14010 25302 27677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 27995 28774 gene locus_tag LOCUS_14020 27995 28774 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130802.1 protein_id gnl|my_center|LOCUS_14020 28812 29171 gene locus_tag LOCUS_14030 28812 29171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 29270 29737 gene locus_tag LOCUS_14040 29270 29737 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_14040 29799 31202 gene locus_tag LOCUS_14050 29799 31202 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538266.1 protein_id gnl|my_center|LOCUS_14050 31312 31845 gene locus_tag LOCUS_14060 31312 31845 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_14060 31910 32803 gene locus_tag LOCUS_14070 31910 32803 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_14070 32912 33988 gene locus_tag LOCUS_14080 32912 33988 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_14080 33975 36752 gene locus_tag LOCUS_14090 33975 36752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence026 279 911 gene locus_tag LOCUS_14100 279 911 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_14100 908 1327 gene locus_tag LOCUS_14110 908 1327 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_14110 1349 3151 gene locus_tag LOCUS_14120 gene msbA 1349 3151 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957851.1 protein_id gnl|my_center|LOCUS_14120 3172 4152 gene locus_tag LOCUS_14130 gene lpxK 3172 4152 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091159.1 protein_id gnl|my_center|LOCUS_14130 4145 4327 gene locus_tag LOCUS_14140 4145 4327 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_14140 4551 5315 gene locus_tag LOCUS_14150 gene kdsB 4551 5315 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706580.1 protein_id gnl|my_center|LOCUS_14150 5406 5825 gene locus_tag LOCUS_14160 5406 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 5973 6611 gene locus_tag LOCUS_14170 5973 6611 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_14170 7517 6621 gene locus_tag LOCUS_14180 7517 6621 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_14180 7959 8969 gene locus_tag LOCUS_14190 7959 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 10921 8975 gene locus_tag LOCUS_14200 10921 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 11346 11272 gene locus_tag LOCUS_t00140 11346 11272 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11512 12915 gene locus_tag LOCUS_14210 gene gltX 11512 12915 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695655.1 protein_id gnl|my_center|LOCUS_14210 12925 14619 gene locus_tag LOCUS_14220 12925 14619 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_14220 14677 14752 gene locus_tag LOCUS_t00150 14677 14752 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14785 14861 gene locus_tag LOCUS_t00160 14785 14861 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14919 15239 gene locus_tag LOCUS_14230 14919 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 15952 16086 gene locus_tag LOCUS_14240 15952 16086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 16091 16345 gene locus_tag LOCUS_14250 16091 16345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 16345 16686 gene locus_tag LOCUS_14260 gene hypA 16345 16686 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_14260 16687 17490 gene locus_tag LOCUS_14270 gene hypB 16687 17490 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388924.1 protein_id gnl|my_center|LOCUS_14270 17492 17728 gene locus_tag LOCUS_14280 17492 17728 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_14280 17725 18873 gene locus_tag LOCUS_14290 gene hypD 17725 18873 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_14290 18870 19919 gene locus_tag LOCUS_14300 gene hypE 18870 19919 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_14300 19919 20338 gene locus_tag LOCUS_14310 19919 20338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 20338 22659 gene locus_tag LOCUS_14320 gene hypF 20338 22659 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338264.1 protein_id gnl|my_center|LOCUS_14320 23018 24535 gene locus_tag LOCUS_14330 23018 24535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 25184 24666 gene locus_tag LOCUS_14340 25184 24666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 25325 26416 gene locus_tag LOCUS_14350 25325 26416 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_14350 26443 26811 gene locus_tag LOCUS_14360 26443 26811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 26867 27433 gene locus_tag LOCUS_14370 26867 27433 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_14370 27438 28169 gene locus_tag LOCUS_14380 27438 28169 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268329.1 protein_id gnl|my_center|LOCUS_14380 28294 31017 gene locus_tag LOCUS_14390 28294 31017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 34009 31136 gene locus_tag LOCUS_14400 gene rapA 34009 31136 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117001.1 protein_id gnl|my_center|LOCUS_14400 34153 35286 gene locus_tag LOCUS_14410 34153 35286 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880477.1 protein_id gnl|my_center|LOCUS_14410 35294 35545 gene locus_tag LOCUS_14420 35294 35545 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 protein_id gnl|my_center|LOCUS_14420 35757 36038 gene locus_tag LOCUS_14430 35757 36038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 36040 36300 gene locus_tag LOCUS_14440 36040 36300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence027 353 1471 gene locus_tag LOCUS_14450 353 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2419 1538 gene locus_tag LOCUS_14460 2419 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2844 3155 gene locus_tag LOCUS_14470 2844 3155 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258292.1 protein_id gnl|my_center|LOCUS_14470 3158 3829 gene locus_tag LOCUS_14480 gene yrfG 3158 3829 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769873.1 protein_id gnl|my_center|LOCUS_14480 5634 3952 gene locus_tag LOCUS_14490 5634 3952 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105343.1 protein_id gnl|my_center|LOCUS_14490 5865 6611 gene locus_tag LOCUS_14500 gene surE 5865 6611 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770587.1 protein_id gnl|my_center|LOCUS_14500 6608 7267 gene locus_tag LOCUS_14510 6608 7267 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_14510 7476 8048 gene locus_tag LOCUS_14520 7476 8048 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_14520 8105 8836 gene locus_tag LOCUS_14530 8105 8836 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 protein_id gnl|my_center|LOCUS_14530 8864 9916 gene locus_tag LOCUS_14540 gene rpoS 8864 9916 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_14540 10374 9928 gene locus_tag LOCUS_14550 10374 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 11272 10853 gene locus_tag LOCUS_14560 11272 10853 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957854.1 protein_id gnl|my_center|LOCUS_14560 11368 12555 gene locus_tag LOCUS_14570 gene alaC 11368 12555 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739631.1 protein_id gnl|my_center|LOCUS_14570 12771 14084 gene locus_tag LOCUS_14580 12771 14084 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_14580 14202 15287 gene locus_tag LOCUS_14590 gene thrC 14202 15287 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048893.1 protein_id gnl|my_center|LOCUS_14590 15596 16693 gene locus_tag LOCUS_14600 gene tgt 15596 16693 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 protein_id gnl|my_center|LOCUS_14600 16847 17191 gene locus_tag LOCUS_14610 gene yajC 16847 17191 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_14610 17242 19128 gene locus_tag LOCUS_14620 gene secD 17242 19128 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482962.1 protein_id gnl|my_center|LOCUS_14620 19138 20082 gene locus_tag LOCUS_14630 gene secF 19138 20082 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 protein_id gnl|my_center|LOCUS_14630 20129 21382 gene locus_tag LOCUS_14640 gene glyA 20129 21382 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919159.1 protein_id gnl|my_center|LOCUS_14640 21564 22070 gene locus_tag LOCUS_14650 gene nrdR 21564 22070 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_14650 22063 23184 gene locus_tag LOCUS_14660 gene ribD 22063 23184 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035932.1 protein_id gnl|my_center|LOCUS_14660 23272 24828 gene locus_tag LOCUS_14670 23272 24828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 25401 25099 gene locus_tag LOCUS_14680 25401 25099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 25400 25582 gene locus_tag LOCUS_14690 25400 25582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 26097 25933 gene locus_tag LOCUS_14700 26097 25933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 26384 26172 gene locus_tag LOCUS_14710 26384 26172 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_14710 26592 27248 gene locus_tag LOCUS_14720 26592 27248 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_14720 27321 28448 gene locus_tag LOCUS_14730 gene ribBA 27321 28448 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_14730 28697 29167 gene locus_tag LOCUS_14740 gene ribE 28697 29167 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_14740 29167 29982 gene locus_tag LOCUS_14750 29167 29982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 30001 30963 gene locus_tag LOCUS_14760 gene thiL 30001 30963 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_14760 30960 31445 gene locus_tag LOCUS_14770 30960 31445 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_14770 32519 31563 gene locus_tag LOCUS_14780 32519 31563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 32815 34044 gene locus_tag LOCUS_14790 32815 34044 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803796.1 protein_id gnl|my_center|LOCUS_14790 34366 34953 gene locus_tag LOCUS_14800 34366 34953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 35802 34963 gene locus_tag LOCUS_14810 35802 34963 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_14810 <36406 35863 gene locus_tag LOCUS_14820 <36406 35863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268952.1:bifunctional aminoglycoside phosphotransferase/ATP-binding protein >Feature sequence028 258 1400 gene locus_tag LOCUS_14830 258 1400 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531072.1 protein_id gnl|my_center|LOCUS_14830 1405 2082 gene locus_tag LOCUS_14840 1405 2082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_14840 2079 3287 gene locus_tag LOCUS_14850 2079 3287 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_14850 3507 4706 gene locus_tag LOCUS_14860 3507 4706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928529.1 protein_id gnl|my_center|LOCUS_14860 4796 6181 gene locus_tag LOCUS_14870 4796 6181 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_14870 7090 6251 gene locus_tag LOCUS_14880 7090 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 7302 7574 gene locus_tag LOCUS_14890 7302 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 7585 8328 gene locus_tag LOCUS_14900 7585 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 9191 8334 gene locus_tag LOCUS_14910 gene panC 9191 8334 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071159.1 protein_id gnl|my_center|LOCUS_14910 10133 9339 gene locus_tag LOCUS_14920 gene panB 10133 9339 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262611.1 protein_id gnl|my_center|LOCUS_14920 10792 10136 gene locus_tag LOCUS_14930 10792 10136 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_14930 11321 10809 gene locus_tag LOCUS_14940 gene folK 11321 10809 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095144.1 protein_id gnl|my_center|LOCUS_14940 12650 11328 gene locus_tag LOCUS_14950 gene pcnB 12650 11328 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095630.1 protein_id gnl|my_center|LOCUS_14950 12788 12862 gene locus_tag LOCUS_t00170 12788 12862 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12965 13261 gene locus_tag LOCUS_14960 gene pilZ 12965 13261 CDS product cyclic di-GMP-binding protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104055.1 protein_id gnl|my_center|LOCUS_14960 14539 13283 gene locus_tag LOCUS_14970 14539 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 14766 15626 gene locus_tag LOCUS_14980 14766 15626 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261581.1 protein_id gnl|my_center|LOCUS_14980 16235 15753 gene locus_tag LOCUS_14990 16235 15753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 17684 16275 gene locus_tag LOCUS_15000 17684 16275 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_15000 17961 20807 gene locus_tag LOCUS_15010 gene uvrA 17961 20807 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_15010 20923 22347 gene locus_tag LOCUS_15020 20923 22347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 22542 22904 gene locus_tag LOCUS_15030 22542 22904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 25879 23279 gene locus_tag LOCUS_15040 gene clpB 25879 23279 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_15040 26268 26041 gene locus_tag LOCUS_15050 26268 26041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 27071 26367 gene locus_tag LOCUS_15060 27071 26367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 27633 27133 gene locus_tag LOCUS_15070 27633 27133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 28131 27724 gene locus_tag LOCUS_15080 28131 27724 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_15080 28478 28128 gene locus_tag LOCUS_15090 28478 28128 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_15090 29465 28668 gene locus_tag LOCUS_15100 29465 28668 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_15100 30199 29465 gene locus_tag LOCUS_15110 30199 29465 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_15110 30445 33228 gene locus_tag LOCUS_15120 30445 33228 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169981.1 protein_id gnl|my_center|LOCUS_15120 33276 34094 gene locus_tag LOCUS_15130 33276 34094 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_15130 34177 34758 gene locus_tag LOCUS_15140 34177 34758 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455144.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence029 2827 254 gene locus_tag LOCUS_15150 2827 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2717 3016 gene locus_tag LOCUS_15160 2717 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 5870 3090 gene locus_tag LOCUS_15170 5870 3090 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 protein_id gnl|my_center|LOCUS_15170 7299 5935 gene locus_tag LOCUS_15180 gene prsR 7299 5935 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_15180 9384 7303 gene locus_tag LOCUS_15190 gene prsK 9384 7303 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_15190 10827 9433 gene locus_tag LOCUS_15200 10827 9433 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_15200 11179 12519 gene locus_tag LOCUS_15210 11179 12519 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_15210 12543 13820 gene locus_tag LOCUS_15220 gene tviB 12543 13820 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607932.1 protein_id gnl|my_center|LOCUS_15220 13952 14959 gene locus_tag LOCUS_15230 13952 14959 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_15230 14968 15435 gene locus_tag LOCUS_15240 14968 15435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 16161 15454 gene locus_tag LOCUS_15250 gene dnaQ 16161 15454 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_15250 16619 16164 gene locus_tag LOCUS_15260 gene rnhA 16619 16164 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368579.1 protein_id gnl|my_center|LOCUS_15260 17485 16622 gene locus_tag LOCUS_15270 17485 16622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 17616 18416 gene locus_tag LOCUS_15280 gene gloB 17616 18416 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927090.1 protein_id gnl|my_center|LOCUS_15280 18474 20156 gene locus_tag LOCUS_15290 18474 20156 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264066.1 protein_id gnl|my_center|LOCUS_15290 20748 20233 gene locus_tag LOCUS_15300 20748 20233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 22908 20878 gene locus_tag LOCUS_15310 22908 20878 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_15310 23032 23166 gene locus_tag LOCUS_15320 23032 23166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 24123 23590 gene locus_tag LOCUS_15330 24123 23590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 24760 24554 gene locus_tag LOCUS_15340 24760 24554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15340 25093 24791 gene locus_tag LOCUS_15350 25093 24791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15350 26718 25243 gene locus_tag LOCUS_15360 26718 25243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_15360 27695 26718 gene locus_tag LOCUS_15370 27695 26718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_15370 29821 27695 gene locus_tag LOCUS_15380 29821 27695 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_15380 30066 30854 gene locus_tag LOCUS_15390 gene fabI 30066 30854 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_15390 31007 31918 gene locus_tag LOCUS_15400 31007 31918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 32208 32444 gene locus_tag LOCUS_15410 32208 32444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 32609 32944 gene locus_tag LOCUS_15420 32609 32944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 32946 33443 gene locus_tag LOCUS_15430 32946 33443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 33852 33532 gene locus_tag LOCUS_15440 33852 33532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041065645.1 protein_id gnl|my_center|LOCUS_15440 33964 33842 gene locus_tag LOCUS_15450 33964 33842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence030 2431 404 gene locus_tag LOCUS_15460 gene uvrB 2431 404 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 protein_id gnl|my_center|LOCUS_15460 2499 3680 gene locus_tag LOCUS_15470 2499 3680 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_15470 3815 3890 gene locus_tag LOCUS_t00180 3815 3890 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4285 4058 gene locus_tag LOCUS_15480 4285 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4329 5066 gene locus_tag LOCUS_15490 4329 5066 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_15490 5093 5815 gene locus_tag LOCUS_15500 gene gph 5093 5815 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_15500 5855 7144 gene locus_tag LOCUS_15510 5855 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 7389 7796 gene locus_tag LOCUS_15520 gene mapZ 7389 7796 CDS product cyclic di-GMP-binding protein MapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094864.1 protein_id gnl|my_center|LOCUS_15520 9196 7829 gene locus_tag LOCUS_15530 gene radA 9196 7829 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001414703.1 protein_id gnl|my_center|LOCUS_15530 10274 9189 gene locus_tag LOCUS_15540 gene alr 10274 9189 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 protein_id gnl|my_center|LOCUS_15540 11702 10299 gene locus_tag LOCUS_15550 gene dnaB 11702 10299 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380723.1 protein_id gnl|my_center|LOCUS_15550 12256 11810 gene locus_tag LOCUS_15560 gene rplI 12256 11810 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421134.1 protein_id gnl|my_center|LOCUS_15560 13234 12314 gene locus_tag LOCUS_15570 13234 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_15570 13528 13301 gene locus_tag LOCUS_15580 gene rpsR 13528 13301 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_15580 13969 13553 gene locus_tag LOCUS_15590 gene rpsF 13969 13553 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 protein_id gnl|my_center|LOCUS_15590 14765 14097 gene locus_tag LOCUS_15600 14765 14097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 14676 14999 gene locus_tag LOCUS_15610 14676 14999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 15098 17392 gene locus_tag LOCUS_15620 gene metE 15098 17392 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 protein_id gnl|my_center|LOCUS_15620 18493 17681 gene locus_tag LOCUS_15630 gene rluB 18493 17681 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706718.1 protein_id gnl|my_center|LOCUS_15630 19308 18490 gene locus_tag LOCUS_15640 19308 18490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 20184 19321 gene locus_tag LOCUS_15650 20184 19321 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396554.1 protein_id gnl|my_center|LOCUS_15650 21371 20184 gene locus_tag LOCUS_15660 21371 20184 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356903.1 protein_id gnl|my_center|LOCUS_15660 22111 21455 gene locus_tag LOCUS_15670 22111 21455 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_15670 22347 25697 gene locus_tag LOCUS_15680 22347 25697 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946472.1 protein_id gnl|my_center|LOCUS_15680 25694 26878 gene locus_tag LOCUS_15690 25694 26878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 27531 26923 gene locus_tag LOCUS_15700 27531 26923 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388998.1 protein_id gnl|my_center|LOCUS_15700 28671 27694 gene locus_tag LOCUS_15710 gene lpxC 28671 27694 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044007993.1 protein_id gnl|my_center|LOCUS_15710 28897 29949 gene locus_tag LOCUS_15720 28897 29949 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 protein_id gnl|my_center|LOCUS_15720 30087 31682 gene locus_tag LOCUS_15730 30087 31682 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_15730 31698 32933 gene locus_tag LOCUS_15740 31698 32933 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence031 303 378 gene locus_tag LOCUS_t00190 303 378 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 458 531 gene locus_tag LOCUS_t00200 458 531 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 649 735 gene locus_tag LOCUS_t00210 649 735 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1024 1320 gene locus_tag LOCUS_15750 1024 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1536 2636 gene locus_tag LOCUS_15760 1536 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2649 5753 gene locus_tag LOCUS_15770 2649 5753 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_15770 5817 6143 gene locus_tag LOCUS_15780 5817 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 7035 6361 gene locus_tag LOCUS_15790 7035 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 7792 7091 gene locus_tag LOCUS_15800 7792 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 8942 7845 gene locus_tag LOCUS_15810 8942 7845 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_15810 10033 8939 gene locus_tag LOCUS_15820 10033 8939 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_15820 12450 10033 gene locus_tag LOCUS_15830 12450 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 12948 12466 gene locus_tag LOCUS_15840 12948 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 13241 15295 gene locus_tag LOCUS_15850 13241 15295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 15427 16161 gene locus_tag LOCUS_15860 15427 16161 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_15860 16268 17707 gene locus_tag LOCUS_15870 gene sbcB 16268 17707 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 protein_id gnl|my_center|LOCUS_15870 18007 18588 gene locus_tag LOCUS_15880 18007 18588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 20489 18666 gene locus_tag LOCUS_15890 gene oadA 20489 18666 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 protein_id gnl|my_center|LOCUS_15890 21934 20516 gene locus_tag LOCUS_15900 21934 20516 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 protein_id gnl|my_center|LOCUS_15900 22161 22688 gene locus_tag LOCUS_15910 22161 22688 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_15910 22719 22901 gene locus_tag LOCUS_15920 gene rpmF 22719 22901 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214744.1 protein_id gnl|my_center|LOCUS_15920 23056 24084 gene locus_tag LOCUS_15930 gene plsX 23056 24084 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_15930 24081 25037 gene locus_tag LOCUS_15940 24081 25037 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_15940 25189 26130 gene locus_tag LOCUS_15950 gene fabD 25189 26130 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191372.1 protein_id gnl|my_center|LOCUS_15950 26130 26885 gene locus_tag LOCUS_15960 gene fabG 26130 26885 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_15960 27048 27287 gene locus_tag LOCUS_15970 gene acpP 27048 27287 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_15970 27458 28714 gene locus_tag LOCUS_15980 gene fabF 27458 28714 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104132.1 protein_id gnl|my_center|LOCUS_15980 28743 30113 gene locus_tag LOCUS_15990 28743 30113 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_15990 30221 32101 gene locus_tag LOCUS_16000 30221 32101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence032 1172 519 gene locus_tag LOCUS_16010 gene hisG 1172 519 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098837.1 protein_id gnl|my_center|LOCUS_16010 2587 1328 gene locus_tag LOCUS_16020 gene murA 2587 1328 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_16020 2917 2672 gene locus_tag LOCUS_16030 2917 2672 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 protein_id gnl|my_center|LOCUS_16030 3759 2986 gene locus_tag LOCUS_16040 3759 2986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_16040 4679 3756 gene locus_tag LOCUS_16050 4679 3756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_16050 5023 4721 gene locus_tag LOCUS_16060 5023 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 5612 5016 gene locus_tag LOCUS_16070 gene mlaC 5612 5016 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476475.1 protein_id gnl|my_center|LOCUS_16070 7021 5654 gene locus_tag LOCUS_16080 7021 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 7484 7023 gene locus_tag LOCUS_16090 gene mlaD 7484 7023 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_16090 8282 7500 gene locus_tag LOCUS_16100 gene mlaE 8282 7500 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_16100 9115 8279 gene locus_tag LOCUS_16110 9115 8279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094343.1 protein_id gnl|my_center|LOCUS_16110 9750 9112 gene locus_tag LOCUS_16120 9750 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 10735 9953 gene locus_tag LOCUS_16130 10735 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 10938 10732 gene locus_tag LOCUS_16140 10938 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 11628 10987 gene locus_tag LOCUS_16150 gene rpiA 11628 10987 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084386.1 protein_id gnl|my_center|LOCUS_16150 11751 13265 gene locus_tag LOCUS_16160 gene ilvA 11751 13265 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_16160 14148 13321 gene locus_tag LOCUS_16170 14148 13321 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258850.1 protein_id gnl|my_center|LOCUS_16170 14950 14213 gene locus_tag LOCUS_16180 14950 14213 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_16180 15735 15064 gene locus_tag LOCUS_16190 15735 15064 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546542.1 protein_id gnl|my_center|LOCUS_16190 16008 16922 gene locus_tag LOCUS_16200 16008 16922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 17486 17025 gene locus_tag LOCUS_16210 17486 17025 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106124.1 protein_id gnl|my_center|LOCUS_16210 17875 19131 gene locus_tag LOCUS_16220 17875 19131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 19216 21858 gene locus_tag LOCUS_16230 19216 21858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 21890 23524 gene locus_tag LOCUS_16240 21890 23524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 23697 23885 gene locus_tag LOCUS_16250 23697 23885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 24094 24420 gene locus_tag LOCUS_16260 24094 24420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 24414 25742 gene locus_tag LOCUS_16270 24414 25742 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_16270 26121 27143 gene locus_tag LOCUS_16280 26121 27143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 27199 28080 gene locus_tag LOCUS_16290 27199 28080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence033 1403 1185 gene locus_tag LOCUS_16300 1403 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1715 1434 gene locus_tag LOCUS_16310 1715 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3678 2368 gene locus_tag LOCUS_16320 3678 2368 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079997984.1 protein_id gnl|my_center|LOCUS_16320 6073 3905 gene locus_tag LOCUS_16330 gene lptD 6073 3905 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_16330 6682 6272 gene locus_tag LOCUS_16340 6682 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 8169 6811 gene locus_tag LOCUS_16350 gene mnmE 8169 6811 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175133.1 protein_id gnl|my_center|LOCUS_16350 9850 8183 gene locus_tag LOCUS_16360 gene yidC 9850 8183 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114648.1 protein_id gnl|my_center|LOCUS_16360 10079 9843 gene locus_tag LOCUS_16370 gene yidD 10079 9843 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551313.1 protein_id gnl|my_center|LOCUS_16370 10620 10486 gene locus_tag LOCUS_16380 gene rpmH 10620 10486 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378825.1 protein_id gnl|my_center|LOCUS_16380 10841 12184 gene locus_tag LOCUS_16390 gene dnaA 10841 12184 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769932.1 protein_id gnl|my_center|LOCUS_16390 12416 13522 gene locus_tag LOCUS_16400 gene dnaN 12416 13522 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_16400 13539 14624 gene locus_tag LOCUS_16410 gene recF 13539 14624 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097265.1 protein_id gnl|my_center|LOCUS_16410 14674 17094 gene locus_tag LOCUS_16420 gene gyrB 14674 17094 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070020.1 protein_id gnl|my_center|LOCUS_16420 18224 17217 gene locus_tag LOCUS_16430 18224 17217 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189384.1 protein_id gnl|my_center|LOCUS_16430 18418 19347 gene locus_tag LOCUS_16440 gene hemC 18418 19347 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211465.1 protein_id gnl|my_center|LOCUS_16440 19401 20195 gene locus_tag LOCUS_16450 gene hemD 19401 20195 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703978.1 protein_id gnl|my_center|LOCUS_16450 20192 21610 gene locus_tag LOCUS_16460 20192 21610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 21607 22899 gene locus_tag LOCUS_16470 21607 22899 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 protein_id gnl|my_center|LOCUS_16470 23988 22957 gene locus_tag LOCUS_16480 23988 22957 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_16480 24055 24936 gene locus_tag LOCUS_16490 24055 24936 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_16490 25813 25040 gene locus_tag LOCUS_16500 25813 25040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 26247 25810 gene locus_tag LOCUS_16510 26247 25810 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720621.1 protein_id gnl|my_center|LOCUS_16510 28261 26351 gene locus_tag LOCUS_16520 28261 26351 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073602.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence034 313 555 gene locus_tag LOCUS_16530 313 555 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_16530 552 965 gene locus_tag LOCUS_16540 552 965 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_16540 1695 1150 gene locus_tag LOCUS_16550 1695 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 3292 1865 gene locus_tag LOCUS_16560 gene fliI 3292 1865 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086458.1 protein_id gnl|my_center|LOCUS_16560 3984 3289 gene locus_tag LOCUS_16570 gene fliH 3984 3289 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705274.1 protein_id gnl|my_center|LOCUS_16570 4996 3977 gene locus_tag LOCUS_16580 gene fliG 4996 3977 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890098.1 protein_id gnl|my_center|LOCUS_16580 6614 4989 gene locus_tag LOCUS_16590 gene fliF 6614 4989 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109118.1 protein_id gnl|my_center|LOCUS_16590 7011 6688 gene locus_tag LOCUS_16600 gene fliE 7011 6688 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705271.1 protein_id gnl|my_center|LOCUS_16600 8639 7221 gene locus_tag LOCUS_16610 8639 7221 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 protein_id gnl|my_center|LOCUS_16610 9792 8677 gene locus_tag LOCUS_16620 9792 8677 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706627.1 protein_id gnl|my_center|LOCUS_16620 11369 9948 gene locus_tag LOCUS_16630 gene fleQ 11369 9948 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382141.1 protein_id gnl|my_center|LOCUS_16630 12431 11844 gene locus_tag LOCUS_16640 12431 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 12554 13711 gene locus_tag LOCUS_16650 12554 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 13727 14716 gene locus_tag LOCUS_16660 13727 14716 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088169.1 protein_id gnl|my_center|LOCUS_16660 14718 15314 gene locus_tag LOCUS_16670 14718 15314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 15307 16878 gene locus_tag LOCUS_16680 15307 16878 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088170.1 protein_id gnl|my_center|LOCUS_16680 16887 17843 gene locus_tag LOCUS_16690 16887 17843 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 protein_id gnl|my_center|LOCUS_16690 17833 18942 gene locus_tag LOCUS_16700 17833 18942 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771829.1 protein_id gnl|my_center|LOCUS_16700 18970 20349 gene locus_tag LOCUS_16710 18970 20349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 20865 20530 gene locus_tag LOCUS_16720 20865 20530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 21265 20846 gene locus_tag LOCUS_16730 gene fliS 21265 20846 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073117.1 protein_id gnl|my_center|LOCUS_16730 22683 21334 gene locus_tag LOCUS_16740 gene fliD 22683 21334 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 protein_id gnl|my_center|LOCUS_16740 23190 22792 gene locus_tag LOCUS_16750 23190 22792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 24083 23250 gene locus_tag LOCUS_16760 24083 23250 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_16760 24402 26924 gene locus_tag LOCUS_16770 24402 26924 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073156.1 protein_id gnl|my_center|LOCUS_16770 26921 27931 gene locus_tag LOCUS_16780 26921 27931 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600889.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence035 585 974 gene locus_tag LOCUS_16790 585 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1431 1045 gene locus_tag LOCUS_16800 1431 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1766 4627 gene locus_tag LOCUS_16810 1766 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4715 4957 gene locus_tag LOCUS_16820 4715 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4967 6229 gene locus_tag LOCUS_16830 4967 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 6226 6828 gene locus_tag LOCUS_16840 6226 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 6825 7802 gene locus_tag LOCUS_16850 6825 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 7802 8671 gene locus_tag LOCUS_16860 7802 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 8679 10880 gene locus_tag LOCUS_16870 8679 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 10877 11650 gene locus_tag LOCUS_16880 10877 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 11656 14091 gene locus_tag LOCUS_16890 11656 14091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 14224 15933 gene locus_tag LOCUS_16900 14224 15933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 15962 16972 gene locus_tag LOCUS_16910 gene gnd 15962 16972 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_16910 16974 17657 gene locus_tag LOCUS_16920 gene pgl 16974 17657 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547427.1 protein_id gnl|my_center|LOCUS_16920 17736 18218 gene locus_tag LOCUS_16930 17736 18218 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_16930 21377 18375 gene locus_tag LOCUS_16940 gene rne 21377 18375 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895645.1 protein_id gnl|my_center|LOCUS_16940 21818 22789 gene locus_tag LOCUS_16950 gene rluC 21818 22789 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619727.1 protein_id gnl|my_center|LOCUS_16950 22786 23448 gene locus_tag LOCUS_16960 22786 23448 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_16960 23512 24588 gene locus_tag LOCUS_16970 gene sppA 23512 24588 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_16970 24761 25702 gene locus_tag LOCUS_16980 24761 25702 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085368.1 protein_id gnl|my_center|LOCUS_16980 26283 25696 gene locus_tag LOCUS_16990 26283 25696 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113992.1 protein_id gnl|my_center|LOCUS_16990 26420 26674 gene locus_tag LOCUS_17000 26420 26674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 26814 27599 gene locus_tag LOCUS_17010 gene mazG 26814 27599 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038006.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence036 <1 654 gene locus_tag LOCUS_17020 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275303.1:alpha/beta hydrolase 1054 851 gene locus_tag LOCUS_17030 1054 851 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_17030 1594 1355 gene locus_tag LOCUS_17040 1594 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1644 2525 gene locus_tag LOCUS_17050 1644 2525 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_17050 2601 3350 gene locus_tag LOCUS_17060 2601 3350 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165984.1 protein_id gnl|my_center|LOCUS_17060 3446 3955 gene locus_tag LOCUS_17070 gene ruvC 3446 3955 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072406.1 protein_id gnl|my_center|LOCUS_17070 3952 4554 gene locus_tag LOCUS_17080 gene ruvA 3952 4554 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 protein_id gnl|my_center|LOCUS_17080 4896 5945 gene locus_tag LOCUS_17090 gene ruvB 4896 5945 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211198.1 protein_id gnl|my_center|LOCUS_17090 6100 6522 gene locus_tag LOCUS_17100 gene ybgC 6100 6522 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091290.1 protein_id gnl|my_center|LOCUS_17100 6512 7189 gene locus_tag LOCUS_17110 gene tolQ 6512 7189 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 protein_id gnl|my_center|LOCUS_17110 7212 7655 gene locus_tag LOCUS_17120 gene tolR 7212 7655 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_17120 7660 8571 gene locus_tag LOCUS_17130 7660 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 8590 9900 gene locus_tag LOCUS_17140 gene tolB 8590 9900 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_17140 9919 10506 gene locus_tag LOCUS_17150 9919 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 10587 11441 gene locus_tag LOCUS_17160 gene ybgF 10587 11441 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_17160 11476 12189 gene locus_tag LOCUS_17170 gene queE 11476 12189 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_17170 12186 12893 gene locus_tag LOCUS_17180 gene queC 12186 12893 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390955.1 protein_id gnl|my_center|LOCUS_17180 12890 13612 gene locus_tag LOCUS_17190 12890 13612 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_17190 13825 15408 gene locus_tag LOCUS_17200 13825 15408 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_17200 15844 17574 gene locus_tag LOCUS_17210 15844 17574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 18053 17790 gene locus_tag LOCUS_17220 18053 17790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 19018 18050 gene locus_tag LOCUS_17230 19018 18050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 20196 19015 gene locus_tag LOCUS_17240 20196 19015 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403536.1 protein_id gnl|my_center|LOCUS_17240 22062 20695 gene locus_tag LOCUS_17250 gene purB 22062 20695 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 protein_id gnl|my_center|LOCUS_17250 22377 24935 gene locus_tag LOCUS_17260 gene acnB 22377 24935 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818886.1 protein_id gnl|my_center|LOCUS_17260 26421 24973 gene locus_tag LOCUS_17270 26421 24973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence037 1413 832 gene locus_tag LOCUS_17280 1413 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905778.1 protein_id gnl|my_center|LOCUS_17280 1626 4442 gene locus_tag LOCUS_17290 1626 4442 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103493.1 protein_id gnl|my_center|LOCUS_17290 5773 4478 gene locus_tag LOCUS_17300 5773 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 7266 5770 gene locus_tag LOCUS_17310 7266 5770 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_17310 8705 7263 gene locus_tag LOCUS_17320 8705 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 9026 8718 gene locus_tag LOCUS_17330 9026 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 9705 9019 gene locus_tag LOCUS_17340 9705 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17340 10003 9698 gene locus_tag LOCUS_17350 10003 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 10266 9991 gene locus_tag LOCUS_17360 10266 9991 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_17360 10552 10277 gene locus_tag LOCUS_17370 10552 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 11524 10553 gene locus_tag LOCUS_17380 11524 10553 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_17380 12077 11526 gene locus_tag LOCUS_17390 12077 11526 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090050.1 protein_id gnl|my_center|LOCUS_17390 13841 12156 gene locus_tag LOCUS_17400 13841 12156 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_17400 14347 15426 gene locus_tag LOCUS_17410 14347 15426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 15465 15995 gene locus_tag LOCUS_17420 15465 15995 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 protein_id gnl|my_center|LOCUS_17420 15999 16448 gene locus_tag LOCUS_17430 15999 16448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 16574 16981 gene locus_tag LOCUS_17440 16574 16981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 18952 17420 gene locus_tag LOCUS_17450 18952 17420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 20622 19039 gene locus_tag LOCUS_17460 20622 19039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266488.1 protein_id gnl|my_center|LOCUS_17460 22194 20869 gene locus_tag LOCUS_17470 22194 20869 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_17470 23237 22191 gene locus_tag LOCUS_17480 gene nagZ 23237 22191 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529284.1 protein_id gnl|my_center|LOCUS_17480 23603 23971 gene locus_tag LOCUS_17490 23603 23971 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317410.1 protein_id gnl|my_center|LOCUS_17490 24118 24375 gene locus_tag LOCUS_17500 24118 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 24372 24653 gene locus_tag LOCUS_17510 24372 24653 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 protein_id gnl|my_center|LOCUS_17510 25052 24813 gene locus_tag LOCUS_17520 25052 24813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 25349 25861 gene locus_tag LOCUS_17530 25349 25861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence038 1590 766 gene locus_tag LOCUS_17540 gene hpnD 1590 766 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_17540 1782 3764 gene locus_tag LOCUS_17550 1782 3764 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_17550 3850 4545 gene locus_tag LOCUS_17560 gene phoB 3850 4545 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 protein_id gnl|my_center|LOCUS_17560 4558 5859 gene locus_tag LOCUS_17570 gene phoR 4558 5859 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_17570 6106 7077 gene locus_tag LOCUS_17580 gene pstS 6106 7077 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_17580 7331 9514 gene locus_tag LOCUS_17590 7331 9514 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895703.1 protein_id gnl|my_center|LOCUS_17590 9529 11181 gene locus_tag LOCUS_17600 gene pstA 9529 11181 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_17600 11206 12042 gene locus_tag LOCUS_17610 gene pstB 11206 12042 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_17610 12058 12771 gene locus_tag LOCUS_17620 gene phoU 12058 12771 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096661.1 protein_id gnl|my_center|LOCUS_17620 13026 13649 gene locus_tag LOCUS_17630 13026 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 16581 14074 gene locus_tag LOCUS_17640 16581 14074 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_17640 19602 17263 gene locus_tag LOCUS_17650 19602 17263 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105404.1 protein_id gnl|my_center|LOCUS_17650 20467 19661 gene locus_tag LOCUS_17660 gene tcdA 20467 19661 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482313.1 protein_id gnl|my_center|LOCUS_17660 21231 20464 gene locus_tag LOCUS_17670 21231 20464 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463568.1 protein_id gnl|my_center|LOCUS_17670 21712 21254 gene locus_tag LOCUS_17680 21712 21254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 23206 21791 gene locus_tag LOCUS_17690 23206 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 <26231 23212 gene locus_tag LOCUS_17700 <26231 23212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210190849.1:FG-GAP-like repeat-containing protein >Feature sequence039 <1 1920 gene locus_tag LOCUS_17710 <1 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034285338.1:Calx-beta domain-containing protein 1997 3292 gene locus_tag LOCUS_17720 gene hisD 1997 3292 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 protein_id gnl|my_center|LOCUS_17720 3495 4568 gene locus_tag LOCUS_17730 gene hisC 3495 4568 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_17730 4607 5200 gene locus_tag LOCUS_17740 gene hisB 4607 5200 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_17740 5204 5854 gene locus_tag LOCUS_17750 gene hisH 5204 5854 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 protein_id gnl|my_center|LOCUS_17750 6045 6791 gene locus_tag LOCUS_17760 gene hisA 6045 6791 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_17760 7005 7772 gene locus_tag LOCUS_17770 gene hisF 7005 7772 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_17770 7993 8376 gene locus_tag LOCUS_17780 gene hisI 7993 8376 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_17780 8373 8693 gene locus_tag LOCUS_17790 8373 8693 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_17790 8690 9028 gene locus_tag LOCUS_17800 8690 9028 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222846.1 protein_id gnl|my_center|LOCUS_17800 9073 9309 gene locus_tag LOCUS_17810 gene tatA 9073 9309 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199902.1 protein_id gnl|my_center|LOCUS_17810 9398 9844 gene locus_tag LOCUS_17820 gene tatB 9398 9844 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266365.1 protein_id gnl|my_center|LOCUS_17820 9828 10910 gene locus_tag LOCUS_17830 9828 10910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 10916 11191 gene locus_tag LOCUS_17840 10916 11191 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_17840 12700 11756 gene locus_tag LOCUS_17850 12700 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 13672 12755 gene locus_tag LOCUS_17860 13672 12755 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545151.1 protein_id gnl|my_center|LOCUS_17860 14137 14985 gene locus_tag LOCUS_17870 14137 14985 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083528.1 protein_id gnl|my_center|LOCUS_17870 14998 17454 gene locus_tag LOCUS_17880 14998 17454 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039380.1 protein_id gnl|my_center|LOCUS_17880 17651 18985 gene locus_tag LOCUS_17890 17651 18985 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810114.1 protein_id gnl|my_center|LOCUS_17890 18990 21032 gene locus_tag LOCUS_17900 18990 21032 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947325.1 protein_id gnl|my_center|LOCUS_17900 21141 22937 gene locus_tag LOCUS_17910 21141 22937 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_17910 22939 23334 gene locus_tag LOCUS_17920 22939 23334 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814554.1 protein_id gnl|my_center|LOCUS_17920 23371 24189 gene locus_tag LOCUS_17930 23371 24189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 24481 25299 gene locus_tag LOCUS_17940 24481 25299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 >Feature sequence040 1662 478 gene locus_tag LOCUS_17950 1662 478 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113459.1 protein_id gnl|my_center|LOCUS_17950 2440 1679 gene locus_tag LOCUS_17960 2440 1679 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_17960 2681 3136 gene locus_tag LOCUS_17970 gene dksA 2681 3136 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_17970 3482 3234 gene locus_tag LOCUS_17980 3482 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 3611 4516 gene locus_tag LOCUS_17990 gene gluQRS 3611 4516 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_17990 4651 6615 gene locus_tag LOCUS_18000 gene acs 4651 6615 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926941.1 protein_id gnl|my_center|LOCUS_18000 7282 6686 gene locus_tag LOCUS_18010 7282 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 8321 7275 gene locus_tag LOCUS_18020 8321 7275 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_18020 9526 8495 gene locus_tag LOCUS_18030 9526 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 10876 9542 gene locus_tag LOCUS_18040 gene tilS 10876 9542 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_18040 11874 10915 gene locus_tag LOCUS_18050 gene accA 11874 10915 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_18050 15670 12218 gene locus_tag LOCUS_18060 gene dnaE 15670 12218 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705106.1 protein_id gnl|my_center|LOCUS_18060 17199 16099 gene locus_tag LOCUS_18070 17199 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 17689 17243 gene locus_tag LOCUS_18080 17689 17243 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228706.1 protein_id gnl|my_center|LOCUS_18080 18115 17765 gene locus_tag LOCUS_18090 gene tusE 18115 17765 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079836.1 protein_id gnl|my_center|LOCUS_18090 19510 18251 gene locus_tag LOCUS_18100 19510 18251 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_18100 19964 20431 gene locus_tag LOCUS_18110 19964 20431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 21877 20519 gene locus_tag LOCUS_18120 21877 20519 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_18120 22476 21874 gene locus_tag LOCUS_18130 22476 21874 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_18130 22709 22921 gene locus_tag LOCUS_18140 22709 22921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 23240 24562 gene locus_tag LOCUS_18150 23240 24562 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence041 93 1352 gene locus_tag LOCUS_18160 93 1352 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754218.1 protein_id gnl|my_center|LOCUS_18160 2510 1419 gene locus_tag LOCUS_18170 gene ychF 2510 1419 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 protein_id gnl|my_center|LOCUS_18170 3258 2677 gene locus_tag LOCUS_18180 gene pth 3258 2677 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_18180 3935 3291 gene locus_tag LOCUS_18190 3935 3291 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948352.1 protein_id gnl|my_center|LOCUS_18190 5165 4212 gene locus_tag LOCUS_18200 5165 4212 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_18200 5311 5237 gene locus_tag LOCUS_t00220 5311 5237 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6152 5322 gene locus_tag LOCUS_18210 gene ispE 6152 5322 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099284.1 protein_id gnl|my_center|LOCUS_18210 6800 6195 gene locus_tag LOCUS_18220 6800 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 8536 6800 gene locus_tag LOCUS_18230 gene lbcA 8536 6800 CDS product proteolytic complex protein LbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352693.1 protein_id gnl|my_center|LOCUS_18230 8898 10160 gene locus_tag LOCUS_18240 gene hemA 8898 10160 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073598.1 protein_id gnl|my_center|LOCUS_18240 10243 11328 gene locus_tag LOCUS_18250 gene prfA 10243 11328 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804703.1 protein_id gnl|my_center|LOCUS_18250 11387 12250 gene locus_tag LOCUS_18260 gene prmC 11387 12250 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036071.1 protein_id gnl|my_center|LOCUS_18260 12281 12697 gene locus_tag LOCUS_18270 12281 12697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 12728 13534 gene locus_tag LOCUS_18280 gene moeB 12728 13534 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807436.1 protein_id gnl|my_center|LOCUS_18280 13531 13938 gene locus_tag LOCUS_18290 gene mec 13531 13938 CDS product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898830.1 protein_id gnl|my_center|LOCUS_18290 13883 14410 gene locus_tag LOCUS_18300 13883 14410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 15989 14517 gene locus_tag LOCUS_18310 gene gatB 15989 14517 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_18310 16366 15986 gene locus_tag LOCUS_18320 16366 15986 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_18320 17833 16382 gene locus_tag LOCUS_18330 gene gatA 17833 16382 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112871.1 protein_id gnl|my_center|LOCUS_18330 18216 17929 gene locus_tag LOCUS_18340 gene gatC 18216 17929 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_18340 18409 19461 gene locus_tag LOCUS_18350 18409 19461 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651015.1 protein_id gnl|my_center|LOCUS_18350 19573 20415 gene locus_tag LOCUS_18360 gene mreC 19573 20415 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18360 20412 20900 gene locus_tag LOCUS_18370 gene mreD 20412 20900 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 protein_id gnl|my_center|LOCUS_18370 20985 22868 gene locus_tag LOCUS_18380 gene mrdA 20985 22868 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_18380 22865 23992 gene locus_tag LOCUS_18390 gene rodA 22865 23992 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_18390 24045 24278 gene locus_tag LOCUS_18400 24045 24278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 >Feature sequence042 94 1167 gene locus_tag LOCUS_18410 gene leuB 94 1167 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_18410 1386 2498 gene locus_tag LOCUS_18420 gene asd 1386 2498 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_18420 3048 3368 gene locus_tag LOCUS_18430 3048 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18430 3719 6679 gene locus_tag LOCUS_18440 3719 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 6782 7489 gene locus_tag LOCUS_18450 6782 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 7534 8316 gene locus_tag LOCUS_18460 gene truA 7534 8316 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768766.1 protein_id gnl|my_center|LOCUS_18460 8350 8985 gene locus_tag LOCUS_18470 8350 8985 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_18470 9164 10381 gene locus_tag LOCUS_18480 gene trpB 9164 10381 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_18480 10634 11443 gene locus_tag LOCUS_18490 gene trpA 10634 11443 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_18490 11466 12335 gene locus_tag LOCUS_18500 gene accD 11466 12335 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118593.1 protein_id gnl|my_center|LOCUS_18500 12592 13830 gene locus_tag LOCUS_18510 gene folC 12592 13830 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039854.1 protein_id gnl|my_center|LOCUS_18510 13896 14522 gene locus_tag LOCUS_18520 13896 14522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 14575 15060 gene locus_tag LOCUS_18530 14575 15060 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_18530 15113 16621 gene locus_tag LOCUS_18540 gene purF 15113 16621 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381064.1 protein_id gnl|my_center|LOCUS_18540 16969 18171 gene locus_tag LOCUS_18550 16969 18171 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_18550 18985 18224 gene locus_tag LOCUS_18560 18985 18224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 22491 19129 gene locus_tag LOCUS_18570 22491 19129 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445472.1 protein_id gnl|my_center|LOCUS_18570 22680 23921 gene locus_tag LOCUS_18580 22680 23921 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_18580 24081 24230 gene locus_tag LOCUS_18590 24081 24230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence043 323 1498 gene locus_tag LOCUS_18600 gene ald 323 1498 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_18600 1682 4033 gene locus_tag LOCUS_18610 gene ftsK 1682 4033 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895627.1 protein_id gnl|my_center|LOCUS_18610 4143 4472 gene locus_tag LOCUS_18620 4143 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4606 5739 gene locus_tag LOCUS_18630 4606 5739 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_18630 5732 6412 gene locus_tag LOCUS_18640 5732 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 6809 6528 gene locus_tag LOCUS_18650 6809 6528 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104336.1 protein_id gnl|my_center|LOCUS_18650 7044 8051 gene locus_tag LOCUS_18660 7044 8051 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_18660 8361 9227 gene locus_tag LOCUS_18670 8361 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 9268 9954 gene locus_tag LOCUS_18680 gene lolA 9268 9954 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162301084.1 protein_id gnl|my_center|LOCUS_18680 9951 11336 gene locus_tag LOCUS_18690 9951 11336 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104507.1 protein_id gnl|my_center|LOCUS_18690 11365 11736 gene locus_tag LOCUS_18700 gene crcB 11365 11736 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_18700 11865 12176 gene locus_tag LOCUS_18710 11865 12176 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957951.1 protein_id gnl|my_center|LOCUS_18710 12290 13570 gene locus_tag LOCUS_18720 gene serS 12290 13570 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104505.1 protein_id gnl|my_center|LOCUS_18720 13736 15139 gene locus_tag LOCUS_18730 gene cysG 13736 15139 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_18730 17760 15388 gene locus_tag LOCUS_18740 17760 15388 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103361.1 protein_id gnl|my_center|LOCUS_18740 18258 18503 gene locus_tag LOCUS_18750 18258 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 18608 19360 gene locus_tag LOCUS_18760 18608 19360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 19368 20024 gene locus_tag LOCUS_18770 19368 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 20184 22577 gene locus_tag LOCUS_18780 20184 22577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 22604 23584 gene locus_tag LOCUS_18790 22604 23584 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_18790 23687 23893 gene locus_tag LOCUS_18800 23687 23893 CDS product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941661.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence044 166 507 gene locus_tag LOCUS_18810 166 507 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_18810 1248 574 gene locus_tag LOCUS_18820 1248 574 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150092553.1 protein_id gnl|my_center|LOCUS_18820 1538 1735 gene locus_tag LOCUS_18830 1538 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2540 2187 gene locus_tag LOCUS_18840 2540 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2670 2948 gene locus_tag LOCUS_18850 2670 2948 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_18850 2948 3244 gene locus_tag LOCUS_18860 2948 3244 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113527.1 protein_id gnl|my_center|LOCUS_18860 3513 3423 gene locus_tag LOCUS_t00230 3513 3423 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3709 4566 gene locus_tag LOCUS_18870 gene motA 3709 4566 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 protein_id gnl|my_center|LOCUS_18870 4600 5871 gene locus_tag LOCUS_18880 4600 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 5926 7029 gene locus_tag LOCUS_18890 gene aroC 5926 7029 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087653.1 protein_id gnl|my_center|LOCUS_18890 7022 8203 gene locus_tag LOCUS_18900 7022 8203 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_18900 8374 8568 gene locus_tag LOCUS_18910 8374 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 9297 8626 gene locus_tag LOCUS_18920 9297 8626 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173676.1 protein_id gnl|my_center|LOCUS_18920 9439 13005 gene locus_tag LOCUS_18930 gene nifJ 9439 13005 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_18930 13665 13231 gene locus_tag LOCUS_18940 13665 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 14175 13669 gene locus_tag LOCUS_18950 14175 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 15482 14172 gene locus_tag LOCUS_18960 15482 14172 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_18960 16261 15479 gene locus_tag LOCUS_18970 16261 15479 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_18970 17094 16258 gene locus_tag LOCUS_18980 17094 16258 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_18980 18179 17091 gene locus_tag LOCUS_18990 18179 17091 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546086.1 protein_id gnl|my_center|LOCUS_18990 19116 18379 gene locus_tag LOCUS_19000 19116 18379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 19371 21527 gene locus_tag LOCUS_19010 19371 21527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 22028 21579 gene locus_tag LOCUS_19020 22028 21579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 22190 22774 gene locus_tag LOCUS_19030 22190 22774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 22940 22761 gene locus_tag LOCUS_19040 22940 22761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 23673 23008 gene locus_tag LOCUS_19050 23673 23008 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494926.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence045 258 794 gene locus_tag LOCUS_19060 258 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 842 1348 gene locus_tag LOCUS_19070 842 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3516 1468 gene locus_tag LOCUS_19080 3516 1468 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943902.1 protein_id gnl|my_center|LOCUS_19080 3723 3538 gene locus_tag LOCUS_19090 3723 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 5216 4233 gene locus_tag LOCUS_19100 gene moaA 5216 4233 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_19100 6711 5248 gene locus_tag LOCUS_19110 6711 5248 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_19110 9302 6708 gene locus_tag LOCUS_19120 9302 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 9550 9299 gene locus_tag LOCUS_19130 9550 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 11183 9765 gene locus_tag LOCUS_19140 gene hemG 11183 9765 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_19140 13229 11205 gene locus_tag LOCUS_19150 13229 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 15441 13234 gene locus_tag LOCUS_19160 15441 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 15766 15638 gene locus_tag LOCUS_19170 15766 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 16669 15875 gene locus_tag LOCUS_19180 16669 15875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 19092 16687 gene locus_tag LOCUS_19190 19092 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 19647 19835 gene locus_tag LOCUS_19200 19647 19835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 19879 20055 gene locus_tag LOCUS_19210 19879 20055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 20286 22142 gene locus_tag LOCUS_19220 20286 22142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 22139 23287 gene locus_tag LOCUS_19230 22139 23287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence046 <1 2294 gene locus_tag LOCUS_19240 <1 2294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:PilC/PilY family type IV pilus protein 2382 2792 gene locus_tag LOCUS_19250 gene pilE 2382 2792 CDS product type 4a pilus minor pilin PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_19250 3813 2866 gene locus_tag LOCUS_19260 gene ispH 3813 2866 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036355.1 protein_id gnl|my_center|LOCUS_19260 4290 3829 gene locus_tag LOCUS_19270 gene fkpB 4290 3829 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 protein_id gnl|my_center|LOCUS_19270 4771 4283 gene locus_tag LOCUS_19280 gene lspA 4771 4283 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_19280 7987 5102 gene locus_tag LOCUS_19290 gene ileS 7987 5102 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417642.1 protein_id gnl|my_center|LOCUS_19290 8998 8069 gene locus_tag LOCUS_19300 gene ribF 8998 8069 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704642.1 protein_id gnl|my_center|LOCUS_19300 9306 9010 gene locus_tag LOCUS_19310 9306 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 11007 9406 gene locus_tag LOCUS_19320 gene murJ 11007 9406 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704641.1 protein_id gnl|my_center|LOCUS_19320 11157 11417 gene locus_tag LOCUS_19330 gene rpsT 11157 11417 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_19330 12860 11736 gene locus_tag LOCUS_19340 gene proB 12860 11736 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_19340 13889 12864 gene locus_tag LOCUS_19350 gene cgtA 13889 12864 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094758.1 protein_id gnl|my_center|LOCUS_19350 14274 14011 gene locus_tag LOCUS_19360 gene rpmA 14274 14011 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940599.1 protein_id gnl|my_center|LOCUS_19360 14614 14300 gene locus_tag LOCUS_19370 gene rplU 14614 14300 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 protein_id gnl|my_center|LOCUS_19370 14756 15757 gene locus_tag LOCUS_19380 gene ispB 14756 15757 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_19380 15775 15851 gene locus_tag LOCUS_t00240 15775 15851 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15981 16526 gene locus_tag LOCUS_19390 15981 16526 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263183.1 protein_id gnl|my_center|LOCUS_19390 16546 17214 gene locus_tag LOCUS_19400 gene nfi 16546 17214 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_19400 18451 17267 gene locus_tag LOCUS_19410 18451 17267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 18684 18911 gene locus_tag LOCUS_19420 18684 18911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 18939 20558 gene locus_tag LOCUS_19430 18939 20558 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_19430 20565 21911 gene locus_tag LOCUS_19440 20565 21911 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183947609.1 protein_id gnl|my_center|LOCUS_19440 22066 23109 gene locus_tag LOCUS_19450 22066 23109 CDS product GSU2403 family nucleotidyltransferase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331292.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence047 187 738 gene locus_tag LOCUS_19460 187 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 824 1510 gene locus_tag LOCUS_19470 824 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1571 2362 gene locus_tag LOCUS_19480 1571 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2674 3822 gene locus_tag LOCUS_19490 2674 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3902 4897 gene locus_tag LOCUS_19500 3902 4897 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958577.1 protein_id gnl|my_center|LOCUS_19500 4894 5586 gene locus_tag LOCUS_19510 gene murU 4894 5586 CDS product N-acetylmuramate alpha-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099549.1 protein_id gnl|my_center|LOCUS_19510 5692 6345 gene locus_tag LOCUS_19520 gene uvrY 5692 6345 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553344.1 protein_id gnl|my_center|LOCUS_19520 6692 7252 gene locus_tag LOCUS_19530 6692 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 7268 7825 gene locus_tag LOCUS_19540 7268 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 7843 9135 gene locus_tag LOCUS_19550 7843 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 9132 9887 gene locus_tag LOCUS_19560 9132 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 9884 10150 gene locus_tag LOCUS_19570 9884 10150 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947603.1 protein_id gnl|my_center|LOCUS_19570 10403 11251 gene locus_tag LOCUS_19580 10403 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 11792 11361 gene locus_tag LOCUS_19590 11792 11361 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083908.1 protein_id gnl|my_center|LOCUS_19590 11930 12622 gene locus_tag LOCUS_19600 11930 12622 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258121.1 protein_id gnl|my_center|LOCUS_19600 13265 12723 gene locus_tag LOCUS_19610 13265 12723 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 protein_id gnl|my_center|LOCUS_19610 14032 13619 gene locus_tag LOCUS_19620 gene arfB 14032 13619 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_19620 14329 14048 gene locus_tag LOCUS_19630 14329 14048 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343080.1 protein_id gnl|my_center|LOCUS_19630 14687 15982 gene locus_tag LOCUS_19640 gene rhlE 14687 15982 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 protein_id gnl|my_center|LOCUS_19640 16160 16846 gene locus_tag LOCUS_19650 16160 16846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 16880 17428 gene locus_tag LOCUS_19660 16880 17428 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_19660 19607 18042 gene locus_tag LOCUS_19670 gene purH 19607 18042 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175670.1 protein_id gnl|my_center|LOCUS_19670 19674 19892 gene locus_tag LOCUS_19680 19674 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 20159 19779 gene locus_tag LOCUS_19690 gene fis 20159 19779 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121116.1 protein_id gnl|my_center|LOCUS_19690 21408 20329 gene locus_tag LOCUS_19700 gene dusB 21408 20329 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence048 1937 270 gene locus_tag LOCUS_19710 gene ettA 1937 270 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_19710 2545 2078 gene locus_tag LOCUS_19720 2545 2078 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012501288.1 protein_id gnl|my_center|LOCUS_19720 3396 2737 gene locus_tag LOCUS_19730 gene narL 3396 2737 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_19730 5076 3397 gene locus_tag LOCUS_19740 5076 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 5425 5087 gene locus_tag LOCUS_19750 5425 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 7031 5604 gene locus_tag LOCUS_19760 gene cobB 7031 5604 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_19760 8053 7052 gene locus_tag LOCUS_19770 8053 7052 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_19770 8287 8153 gene locus_tag LOCUS_19780 8287 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 9540 8323 gene locus_tag LOCUS_19790 gene hmeB 9540 8323 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_19790 10552 9782 gene locus_tag LOCUS_19800 10552 9782 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933894.1 protein_id gnl|my_center|LOCUS_19800 10911 10549 gene locus_tag LOCUS_19810 10911 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 12964 10988 gene locus_tag LOCUS_19820 12964 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 14631 13126 gene locus_tag LOCUS_19830 14631 13126 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_19830 15377 14649 gene locus_tag LOCUS_19840 gene dsrM 15377 14649 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_19840 15892 15560 gene locus_tag LOCUS_19850 15892 15560 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_19850 16255 15950 gene locus_tag LOCUS_19860 gene tusB 16255 15950 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_19860 16677 16270 gene locus_tag LOCUS_19870 gene tusC 16677 16270 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099034.1 protein_id gnl|my_center|LOCUS_19870 17082 16690 gene locus_tag LOCUS_19880 gene tusD 17082 16690 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_19880 18171 17098 gene locus_tag LOCUS_19890 gene dsrB 18171 17098 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_19890 19565 18258 gene locus_tag LOCUS_19900 gene dsrA 19565 18258 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_19900 19973 20866 gene locus_tag LOCUS_19910 19973 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 20886 21113 gene locus_tag LOCUS_19920 20886 21113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 21115 21822 gene locus_tag LOCUS_19930 21115 21822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 21841 22521 gene locus_tag LOCUS_19940 21841 22521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence049 1080 226 gene locus_tag LOCUS_19950 gene rpoH 1080 226 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704351.1 protein_id gnl|my_center|LOCUS_19950 2248 1253 gene locus_tag LOCUS_19960 gene ftsX 2248 1253 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_19960 2931 2245 gene locus_tag LOCUS_19970 gene ftsE 2931 2245 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099140.1 protein_id gnl|my_center|LOCUS_19970 4218 3142 gene locus_tag LOCUS_19980 4218 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 4354 5808 gene locus_tag LOCUS_19990 4354 5808 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_19990 5798 7111 gene locus_tag LOCUS_20000 5798 7111 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_20000 7191 7619 gene locus_tag LOCUS_20010 7191 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 7637 8092 gene locus_tag LOCUS_20020 gene dut 7637 8092 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704179.1 protein_id gnl|my_center|LOCUS_20020 8177 9661 gene locus_tag LOCUS_20030 8177 9661 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869220.1 protein_id gnl|my_center|LOCUS_20030 9878 10864 gene locus_tag LOCUS_20040 gene argB 9878 10864 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_20040 11053 11643 gene locus_tag LOCUS_20050 gene slmA 11053 11643 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704178.1 protein_id gnl|my_center|LOCUS_20050 11729 12484 gene locus_tag LOCUS_20060 11729 12484 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124872.1 protein_id gnl|my_center|LOCUS_20060 15151 12581 gene locus_tag LOCUS_20070 15151 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 15212 16132 gene locus_tag LOCUS_20080 15212 16132 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_20080 16134 17096 gene locus_tag LOCUS_20090 16134 17096 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_20090 17096 19090 gene locus_tag LOCUS_20100 gene tgpA 17096 19090 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_20100 19660 19058 gene locus_tag LOCUS_20110 19660 19058 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096321.1 protein_id gnl|my_center|LOCUS_20110 20007 19720 gene locus_tag LOCUS_20120 20007 19720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 20252 20079 gene locus_tag LOCUS_20130 20252 20079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 20952 20641 gene locus_tag LOCUS_20140 20952 20641 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_20140 21158 20949 gene locus_tag LOCUS_20150 21158 20949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 21269 21844 gene locus_tag LOCUS_20160 21269 21844 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945837.1 protein_id gnl|my_center|LOCUS_20160 21880 22254 gene locus_tag LOCUS_20170 21880 22254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence050 571 263 gene locus_tag LOCUS_20180 571 263 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929235.1 protein_id gnl|my_center|LOCUS_20180 1822 656 gene locus_tag LOCUS_20190 1822 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2259 1837 gene locus_tag LOCUS_20200 2259 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3476 2256 gene locus_tag LOCUS_20210 gene fabB 3476 2256 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_20210 4034 3495 gene locus_tag LOCUS_20220 gene fabA 4034 3495 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706133.1 protein_id gnl|my_center|LOCUS_20220 4415 4143 gene locus_tag LOCUS_20230 4415 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 6583 4412 gene locus_tag LOCUS_20240 gene relA 6583 4412 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268592.1 protein_id gnl|my_center|LOCUS_20240 7112 6591 gene locus_tag LOCUS_20250 7112 6591 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_20250 7774 7127 gene locus_tag LOCUS_20260 gene crp 7774 7127 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070954.1 protein_id gnl|my_center|LOCUS_20260 8190 7951 gene locus_tag LOCUS_20270 8190 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 8083 8670 gene locus_tag LOCUS_20280 8083 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 8774 10075 gene locus_tag LOCUS_20290 8774 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 10072 13203 gene locus_tag LOCUS_20300 10072 13203 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_20300 13603 13250 gene locus_tag LOCUS_20310 13603 13250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 14627 13608 gene locus_tag LOCUS_20320 14627 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 15688 14627 gene locus_tag LOCUS_20330 gene queA 15688 14627 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_20330 15770 15856 gene locus_tag LOCUS_t00250 15770 15856 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16050 19532 gene locus_tag LOCUS_20340 gene mfd 16050 19532 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_20340 19529 20533 gene locus_tag LOCUS_20350 19529 20533 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_20350 20574 >21843 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatgaggccgtggcgttttgccacggataac >Feature sequence051 817 236 gene locus_tag LOCUS_20360 817 236 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_20360 2574 814 gene locus_tag LOCUS_20370 gene argS 2574 814 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_20370 4886 2682 gene locus_tag LOCUS_20380 4886 2682 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_20380 6181 5003 gene locus_tag LOCUS_20390 6181 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 6983 7702 gene locus_tag LOCUS_20400 gene nth 6983 7702 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 protein_id gnl|my_center|LOCUS_20400 7702 8133 gene locus_tag LOCUS_20410 7702 8133 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_20410 10709 8277 gene locus_tag LOCUS_20420 10709 8277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 11031 12914 gene locus_tag LOCUS_20430 gene thiC 11031 12914 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_20430 13425 13222 gene locus_tag LOCUS_20440 13425 13222 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071803.1 protein_id gnl|my_center|LOCUS_20440 13765 14583 gene locus_tag LOCUS_20450 13765 14583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 16183 14687 gene locus_tag LOCUS_20460 16183 14687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 16316 18445 gene locus_tag LOCUS_20470 16316 18445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 18442 19419 gene locus_tag LOCUS_20480 18442 19419 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_20480 19484 20761 gene locus_tag LOCUS_20490 19484 20761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence052 1367 831 gene locus_tag LOCUS_20500 1367 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 3875 2148 gene locus_tag LOCUS_20510 gene polX 3875 2148 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_20510 4004 5515 gene locus_tag LOCUS_20520 gene ubiD 4004 5515 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096332.1 protein_id gnl|my_center|LOCUS_20520 5575 6216 gene locus_tag LOCUS_20530 5575 6216 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390884.1 protein_id gnl|my_center|LOCUS_20530 6444 7202 gene locus_tag LOCUS_20540 6444 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 9382 7208 gene locus_tag LOCUS_20550 gene uvrD 9382 7208 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383406.1 protein_id gnl|my_center|LOCUS_20550 9746 10090 gene locus_tag LOCUS_20560 9746 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 11289 10114 gene locus_tag LOCUS_20570 11289 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 11648 11373 gene locus_tag LOCUS_20580 11648 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 11820 13943 gene locus_tag LOCUS_20590 11820 13943 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_20590 13991 14437 gene locus_tag LOCUS_20600 13991 14437 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460092.1 protein_id gnl|my_center|LOCUS_20600 15135 16553 gene locus_tag LOCUS_20610 gene ccoN 15135 16553 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076726.1 protein_id gnl|my_center|LOCUS_20610 16569 17282 gene locus_tag LOCUS_20620 gene ccoO 16569 17282 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_20620 17275 17481 gene locus_tag LOCUS_20630 17275 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 17478 18335 gene locus_tag LOCUS_20640 gene ccoP 17478 18335 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338422.1 protein_id gnl|my_center|LOCUS_20640 18723 20141 gene locus_tag LOCUS_20650 gene ccoG 18723 20141 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244349.1 protein_id gnl|my_center|LOCUS_20650 20162 20704 gene locus_tag LOCUS_20660 20162 20704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence053 928 188 gene locus_tag LOCUS_20670 gene rlmB 928 188 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073677.1 protein_id gnl|my_center|LOCUS_20670 3411 925 gene locus_tag LOCUS_20680 gene rnr 3411 925 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_20680 3569 3655 gene locus_tag LOCUS_t00260 3569 3655 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4069 4518 gene locus_tag LOCUS_20690 4069 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 4549 6303 gene locus_tag LOCUS_20700 4549 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 6937 6503 gene locus_tag LOCUS_20710 6937 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 10064 6951 gene locus_tag LOCUS_20720 10064 6951 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_20720 11206 10061 gene locus_tag LOCUS_20730 11206 10061 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_20730 11447 11659 gene locus_tag LOCUS_20740 11447 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 11673 13127 gene locus_tag LOCUS_20750 11673 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 13117 13809 gene locus_tag LOCUS_20760 13117 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 15709 13853 gene locus_tag LOCUS_20770 15709 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 16422 15889 gene locus_tag LOCUS_20780 16422 15889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 18551 16467 gene locus_tag LOCUS_20790 18551 16467 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933347.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20790 19153 18548 gene locus_tag LOCUS_20800 19153 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20800 20454 19150 gene locus_tag LOCUS_20810 20454 19150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence054 1033 347 gene locus_tag LOCUS_20820 1033 347 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 protein_id gnl|my_center|LOCUS_20820 3148 1073 gene locus_tag LOCUS_20830 3148 1073 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_20830 3937 3170 gene locus_tag LOCUS_20840 3937 3170 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_20840 4081 5007 gene locus_tag LOCUS_20850 gene cysB 4081 5007 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382487.1 protein_id gnl|my_center|LOCUS_20850 5461 5141 gene locus_tag LOCUS_20860 5461 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 5737 5465 gene locus_tag LOCUS_20870 5737 5465 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086649.1 protein_id gnl|my_center|LOCUS_20870 7284 5974 gene locus_tag LOCUS_20880 7284 5974 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_20880 8501 7287 gene locus_tag LOCUS_20890 8501 7287 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 protein_id gnl|my_center|LOCUS_20890 8692 8504 gene locus_tag LOCUS_20900 8692 8504 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_20900 9630 8776 gene locus_tag LOCUS_20910 gene hflC 9630 8776 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_20910 10841 9630 gene locus_tag LOCUS_20920 gene hflK 10841 9630 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_20920 12402 11128 gene locus_tag LOCUS_20930 gene hflX 12402 11128 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 protein_id gnl|my_center|LOCUS_20930 12674 12426 gene locus_tag LOCUS_20940 gene hfq 12674 12426 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_20940 13774 12818 gene locus_tag LOCUS_20950 gene miaA 13774 12818 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266496.1 protein_id gnl|my_center|LOCUS_20950 14226 13789 gene locus_tag LOCUS_20960 gene rimI 14226 13789 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_20960 15146 14265 gene locus_tag LOCUS_20970 15146 14265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20970 16712 15162 gene locus_tag LOCUS_20980 16712 15162 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_20980 17401 17730 gene locus_tag LOCUS_20990 17401 17730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 17995 17648 gene locus_tag LOCUS_21000 17995 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 18510 17995 gene locus_tag LOCUS_21010 18510 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 19122 18778 gene locus_tag LOCUS_21020 19122 18778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 <19911 19244 gene locus_tag LOCUS_21030 <19911 19244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein >Feature sequence055 1193 45 gene locus_tag LOCUS_21040 gene rnd 1193 45 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971431.1 protein_id gnl|my_center|LOCUS_21040 1322 1831 gene locus_tag LOCUS_21050 1322 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1833 3215 gene locus_tag LOCUS_21060 gene mpl 1833 3215 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 protein_id gnl|my_center|LOCUS_21060 3220 3831 gene locus_tag LOCUS_21070 gene ubiX 3220 3831 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_21070 3828 4415 gene locus_tag LOCUS_21080 3828 4415 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103257.1 protein_id gnl|my_center|LOCUS_21080 5860 4655 gene locus_tag LOCUS_21090 gene tyrS 5860 4655 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_21090 6009 6374 gene locus_tag LOCUS_21100 6009 6374 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205282.1 protein_id gnl|my_center|LOCUS_21100 6371 6982 gene locus_tag LOCUS_21110 6371 6982 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200722.1 protein_id gnl|my_center|LOCUS_21110 7000 7962 gene locus_tag LOCUS_21120 7000 7962 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190237.1 protein_id gnl|my_center|LOCUS_21120 8234 9643 gene locus_tag LOCUS_21130 8234 9643 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_21130 9649 10767 gene locus_tag LOCUS_21140 9649 10767 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_21140 12080 10923 gene locus_tag LOCUS_21150 12080 10923 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143005.1 protein_id gnl|my_center|LOCUS_21150 12531 12175 gene locus_tag LOCUS_21160 gene erpA 12531 12175 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304404.1 protein_id gnl|my_center|LOCUS_21160 13034 12606 gene locus_tag LOCUS_21170 13034 12606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 13801 13064 gene locus_tag LOCUS_21180 13801 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 14836 13808 gene locus_tag LOCUS_21190 gene argC 14836 13808 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767875.1 protein_id gnl|my_center|LOCUS_21190 15828 15067 gene locus_tag LOCUS_21200 15828 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 17297 15999 gene locus_tag LOCUS_21210 17297 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 17588 18388 gene locus_tag LOCUS_21220 17588 18388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 18388 19476 gene locus_tag LOCUS_21230 18388 19476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence056 695 165 gene locus_tag LOCUS_21240 695 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1954 692 gene locus_tag LOCUS_21250 gene pgaC 1954 692 CDS product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212042.1 protein_id gnl|my_center|LOCUS_21250 3894 1957 gene locus_tag LOCUS_21260 gene pgaB 3894 1957 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064163.1 protein_id gnl|my_center|LOCUS_21260 6281 3942 gene locus_tag LOCUS_21270 gene pgaA 6281 3942 CDS product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082816276.1 protein_id gnl|my_center|LOCUS_21270 6699 6935 gene locus_tag LOCUS_21280 6699 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 7422 7640 gene locus_tag LOCUS_21290 gene infA 7422 7640 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_21290 10019 7746 gene locus_tag LOCUS_21300 gene clpA 10019 7746 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_21300 10413 10084 gene locus_tag LOCUS_21310 gene clpS 10413 10084 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 protein_id gnl|my_center|LOCUS_21310 11805 10549 gene locus_tag LOCUS_21320 gene icd 11805 10549 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_21320 12681 11890 gene locus_tag LOCUS_21330 12681 11890 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817146.1 protein_id gnl|my_center|LOCUS_21330 13172 12678 gene locus_tag LOCUS_21340 13172 12678 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004187.1 protein_id gnl|my_center|LOCUS_21340 14446 13169 gene locus_tag LOCUS_21350 gene gspL 14446 13169 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884054.1 protein_id gnl|my_center|LOCUS_21350 15411 14446 gene locus_tag LOCUS_21360 gene gspK 15411 14446 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_21360 16022 15408 gene locus_tag LOCUS_21370 gene xcpW 16022 15408 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_21370 16393 16019 gene locus_tag LOCUS_21380 gene lspI 16393 16019 CDS product GspI family T2SS minor pseudopilin variant LspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947090.1 protein_id gnl|my_center|LOCUS_21380 16952 16380 gene locus_tag LOCUS_21390 16952 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 17454 17002 gene locus_tag LOCUS_21400 gene lspG 17454 17002 CDS product GspG family T2SS major pseudopilin variant LspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947092.1 protein_id gnl|my_center|LOCUS_21400 17902 18477 gene locus_tag LOCUS_21410 gene rrtA 17902 18477 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072468.1 protein_id gnl|my_center|LOCUS_21410 18734 18450 gene locus_tag LOCUS_21420 18734 18450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 18633 18935 gene locus_tag LOCUS_21430 18633 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence057 <1 1002 gene locus_tag LOCUS_21440 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010635049.1:uroporphyrinogen decarboxylase 1928 1191 gene locus_tag LOCUS_21450 1928 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2365 1967 gene locus_tag LOCUS_21460 2365 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 3764 2511 gene locus_tag LOCUS_21470 3764 2511 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_21470 4562 3831 gene locus_tag LOCUS_21480 4562 3831 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105331.1 protein_id gnl|my_center|LOCUS_21480 4918 4715 gene locus_tag LOCUS_21490 gene rpmE 4918 4715 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378857.1 protein_id gnl|my_center|LOCUS_21490 5809 5057 gene locus_tag LOCUS_21500 5809 5057 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_21500 6386 7552 gene locus_tag LOCUS_21510 gene algW 6386 7552 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_21510 7573 8346 gene locus_tag LOCUS_21520 7573 8346 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_21520 10370 8538 gene locus_tag LOCUS_21530 10370 8538 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404295.1 protein_id gnl|my_center|LOCUS_21530 10520 10891 gene locus_tag LOCUS_21540 gene erpA 10520 10891 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534548.1 protein_id gnl|my_center|LOCUS_21540 10921 12501 gene locus_tag LOCUS_21550 10921 12501 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037428.1 protein_id gnl|my_center|LOCUS_21550 13640 12570 gene locus_tag LOCUS_21560 13640 12570 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105529.1 protein_id gnl|my_center|LOCUS_21560 14149 13655 gene locus_tag LOCUS_21570 gene purE 14149 13655 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945979.1 protein_id gnl|my_center|LOCUS_21570 15860 14502 gene locus_tag LOCUS_21580 15860 14502 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 protein_id gnl|my_center|LOCUS_21580 17864 15861 gene locus_tag LOCUS_21590 17864 15861 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_21590 18951 18745 gene locus_tag LOCUS_21600 18951 18745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence058 1094 420 gene locus_tag LOCUS_21610 1094 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1587 1087 gene locus_tag LOCUS_21620 1587 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2002 1589 gene locus_tag LOCUS_21630 2002 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 3071 2064 gene locus_tag LOCUS_21640 3071 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 3126 3341 gene locus_tag LOCUS_21650 3126 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3358 4764 gene locus_tag LOCUS_21660 gene merA 3358 4764 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 protein_id gnl|my_center|LOCUS_21660 5048 5341 gene locus_tag LOCUS_21670 5048 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 5487 6581 gene locus_tag LOCUS_21680 5487 6581 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646058.1 protein_id gnl|my_center|LOCUS_21680 6578 9796 gene locus_tag LOCUS_21690 6578 9796 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711674.1 protein_id gnl|my_center|LOCUS_21690 9965 10873 gene locus_tag LOCUS_21700 9965 10873 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_21700 10877 11299 gene locus_tag LOCUS_21710 10877 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 11296 12360 gene locus_tag LOCUS_21720 11296 12360 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_21720 13083 12511 gene locus_tag LOCUS_21730 13083 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948505.1 protein_id gnl|my_center|LOCUS_21730 13753 13178 gene locus_tag LOCUS_21740 gene plsY 13753 13178 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071503.1 protein_id gnl|my_center|LOCUS_21740 13857 14225 gene locus_tag LOCUS_21750 gene folB 13857 14225 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_21750 14225 14740 gene locus_tag LOCUS_21760 gene folK 14225 14740 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_21760 14741 15925 gene locus_tag LOCUS_21770 14741 15925 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_21770 16524 15922 gene locus_tag LOCUS_21780 16524 15922 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_21780 17365 16598 gene locus_tag LOCUS_21790 17365 16598 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_21790 17424 18638 gene locus_tag LOCUS_21800 17424 18638 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence059 3 209 gene locus_tag LOCUS_21810 3 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 1564 551 gene locus_tag LOCUS_21820 1564 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1776 1937 gene locus_tag LOCUS_21830 1776 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2128 6954 gene locus_tag LOCUS_21840 2128 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 7444 6971 gene locus_tag LOCUS_21850 7444 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 7598 8326 gene locus_tag LOCUS_21860 gene tsaA 7598 8326 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094026.1 protein_id gnl|my_center|LOCUS_21860 8419 10815 gene locus_tag LOCUS_21870 8419 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 10895 13894 gene locus_tag LOCUS_21880 10895 13894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 14765 13944 gene locus_tag LOCUS_21890 14765 13944 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_21890 14995 17001 gene locus_tag LOCUS_21900 gene rep 14995 17001 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045224090.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence060 256 1698 gene locus_tag LOCUS_21910 256 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1695 2303 gene locus_tag LOCUS_21920 1695 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2894 3184 gene locus_tag LOCUS_21930 2894 3184 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650103.1 protein_id gnl|my_center|LOCUS_21930 3244 4896 gene locus_tag LOCUS_21940 gene groL 3244 4896 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_21940 5054 5491 gene locus_tag LOCUS_21950 5054 5491 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958580.1 protein_id gnl|my_center|LOCUS_21950 6363 6872 gene locus_tag LOCUS_21960 6363 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 6939 9116 gene locus_tag LOCUS_21970 6939 9116 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937997.1 protein_id gnl|my_center|LOCUS_21970 9119 9970 gene locus_tag LOCUS_21980 9119 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 10019 11428 gene locus_tag LOCUS_21990 gene nrfD 10019 11428 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228899.1 protein_id gnl|my_center|LOCUS_21990 11429 11956 gene locus_tag LOCUS_22000 11429 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 11953 12489 gene locus_tag LOCUS_22010 11953 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 12532 13566 gene locus_tag LOCUS_22020 12532 13566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 13820 14416 gene locus_tag LOCUS_22030 gene petA 13820 14416 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_22030 14416 15654 gene locus_tag LOCUS_22040 14416 15654 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_22040 15651 16394 gene locus_tag LOCUS_22050 15651 16394 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521940.1 protein_id gnl|my_center|LOCUS_22050 16666 17262 gene locus_tag LOCUS_22060 gene sspA 16666 17262 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257293.1 protein_id gnl|my_center|LOCUS_22060 17289 17699 gene locus_tag LOCUS_22070 17289 17699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence061 4897 989 gene locus_tag LOCUS_22080 gene purL 4897 989 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_22080 7216 5183 gene locus_tag LOCUS_22090 7216 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 8127 7414 gene locus_tag LOCUS_22100 8127 7414 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 protein_id gnl|my_center|LOCUS_22100 9093 8335 gene locus_tag LOCUS_22110 9093 8335 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_22110 10148 9111 gene locus_tag LOCUS_22120 gene bamC 10148 9111 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064176.1 protein_id gnl|my_center|LOCUS_22120 11040 10162 gene locus_tag LOCUS_22130 gene dapA 11040 10162 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_22130 11290 12429 gene locus_tag LOCUS_22140 11290 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 12597 13127 gene locus_tag LOCUS_22150 12597 13127 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_22150 13144 13611 gene locus_tag LOCUS_22160 13144 13611 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_22160 14856 13804 gene locus_tag LOCUS_22170 gene truD 14856 13804 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036881.1 protein_id gnl|my_center|LOCUS_22170 15521 15051 gene locus_tag LOCUS_22180 gene ispF 15521 15051 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766012.1 protein_id gnl|my_center|LOCUS_22180 16166 15657 gene locus_tag LOCUS_22190 gene def 16166 15657 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_22190 16692 16168 gene locus_tag LOCUS_22200 16692 16168 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_22200 17500 16712 gene locus_tag LOCUS_22210 17500 16712 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence062 611 793 gene locus_tag LOCUS_22220 611 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1392 874 gene locus_tag LOCUS_22230 1392 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 1688 1389 gene locus_tag LOCUS_22240 1688 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2182 1697 gene locus_tag LOCUS_22250 2182 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2472 2179 gene locus_tag LOCUS_22260 2472 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2850 2482 gene locus_tag LOCUS_22270 2850 2482 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340715.1 protein_id gnl|my_center|LOCUS_22270 3339 3157 gene locus_tag LOCUS_22280 3339 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 4606 3374 gene locus_tag LOCUS_22290 4606 3374 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_22290 5723 4857 gene locus_tag LOCUS_22300 gene metF 5723 4857 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_22300 6592 5972 gene locus_tag LOCUS_22310 gene cysC 6592 5972 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_22310 8112 6691 gene locus_tag LOCUS_22320 gene ahcY 8112 6691 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931278.1 protein_id gnl|my_center|LOCUS_22320 8672 8298 gene locus_tag LOCUS_22330 8672 8298 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_22330 9868 8708 gene locus_tag LOCUS_22340 gene metK 9868 8708 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_22340 11404 9962 gene locus_tag LOCUS_22350 11404 9962 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529087.1 protein_id gnl|my_center|LOCUS_22350 11872 11597 gene locus_tag LOCUS_22360 11872 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 12657 11941 gene locus_tag LOCUS_22370 gene pyrF 12657 11941 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481650.1 protein_id gnl|my_center|LOCUS_22370 13859 12687 gene locus_tag LOCUS_22380 gene lapB 13859 12687 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_22380 14128 13856 gene locus_tag LOCUS_22390 14128 13856 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947151.1 protein_id gnl|my_center|LOCUS_22390 14590 14291 gene locus_tag LOCUS_22400 gene ihfB 14590 14291 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091441.1 protein_id gnl|my_center|LOCUS_22400 16423 14744 gene locus_tag LOCUS_22410 gene rpsA 16423 14744 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_22410 17420 16701 gene locus_tag LOCUS_22420 gene cmk 17420 16701 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616463.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence063 197 1318 gene locus_tag LOCUS_22430 gene ntrB 197 1318 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_22430 1315 2712 gene locus_tag LOCUS_22440 gene ntrC 1315 2712 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_22440 2922 3878 gene locus_tag LOCUS_22450 2922 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 4996 4010 gene locus_tag LOCUS_22460 4996 4010 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880014.1 protein_id gnl|my_center|LOCUS_22460 6231 5305 gene locus_tag LOCUS_22470 gene mshI 6231 5305 CDS product MSHA fimbrial biogenesis protein MshI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704361.1 protein_id gnl|my_center|LOCUS_22470 6813 6289 gene locus_tag LOCUS_22480 6813 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 7652 6810 gene locus_tag LOCUS_22490 7652 6810 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008487788.1 protein_id gnl|my_center|LOCUS_22490 8182 7652 gene locus_tag LOCUS_22500 8182 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 8634 8179 gene locus_tag LOCUS_22510 8634 8179 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792472.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22510 13100 8631 gene locus_tag LOCUS_22520 13100 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 13636 13187 gene locus_tag LOCUS_22530 13636 13187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 15160 13937 gene locus_tag LOCUS_22540 15160 13937 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_22540 16990 15287 gene locus_tag LOCUS_22550 gene mshE 16990 15287 CDS product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_22550 <17542 16994 gene locus_tag LOCUS_22560 <17542 16994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206819183.1:tetratricopeptide repeat protein >Feature sequence064 2527 620 gene locus_tag LOCUS_22570 gene ppiD 2527 620 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 protein_id gnl|my_center|LOCUS_22570 2695 2619 gene locus_tag LOCUS_t00270 2695 2619 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2787 2712 gene locus_tag LOCUS_t00280 2787 2712 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3073 2801 gene locus_tag LOCUS_22580 3073 2801 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261491.1 protein_id gnl|my_center|LOCUS_22580 5722 3284 gene locus_tag LOCUS_22590 gene lon 5722 3284 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_22590 7289 6006 gene locus_tag LOCUS_22600 gene clpX 7289 6006 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_22600 8057 7419 gene locus_tag LOCUS_22610 gene clpP 8057 7419 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_22610 9395 8130 gene locus_tag LOCUS_22620 gene tig 9395 8130 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198446.1 protein_id gnl|my_center|LOCUS_22620 9604 9520 gene locus_tag LOCUS_t00290 9604 9520 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9952 9877 gene locus_tag LOCUS_t00300 9952 9877 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10119 10044 gene locus_tag LOCUS_t00310 10119 10044 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10305 10229 gene locus_tag LOCUS_t00320 10305 10229 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10455 10379 gene locus_tag LOCUS_t00330 10455 10379 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10618 11481 gene locus_tag LOCUS_22630 gene folD 10618 11481 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087898.1 protein_id gnl|my_center|LOCUS_22630 13117 11672 gene locus_tag LOCUS_22640 gene cysS 13117 11672 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 protein_id gnl|my_center|LOCUS_22640 13283 13879 gene locus_tag LOCUS_22650 13283 13879 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_22650 13914 14414 gene locus_tag LOCUS_22660 13914 14414 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_22660 14508 15254 gene locus_tag LOCUS_22670 gene lpxH 14508 15254 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036171.1 protein_id gnl|my_center|LOCUS_22670 16124 15339 gene locus_tag LOCUS_22680 16124 15339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 16928 16125 gene locus_tag LOCUS_22690 16928 16125 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence065 388 1329 gene locus_tag LOCUS_22700 388 1329 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_22700 1333 1653 gene locus_tag LOCUS_22710 1333 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2176 1880 gene locus_tag LOCUS_22720 2176 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 3442 2276 gene locus_tag LOCUS_22730 3442 2276 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242132.1 protein_id gnl|my_center|LOCUS_22730 3880 3599 gene locus_tag LOCUS_22740 3880 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 4204 4437 gene locus_tag LOCUS_22750 4204 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 5416 4475 gene locus_tag LOCUS_22760 5416 4475 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_22760 5628 7007 gene locus_tag LOCUS_22770 5628 7007 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_22770 7188 8000 gene locus_tag LOCUS_22780 7188 8000 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_22780 8064 10334 gene locus_tag LOCUS_22790 8064 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 10566 10315 gene locus_tag LOCUS_22800 10566 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 10688 11290 gene locus_tag LOCUS_22810 10688 11290 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_22810 11685 11344 gene locus_tag LOCUS_22820 11685 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 12070 11678 gene locus_tag LOCUS_22830 12070 11678 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_22830 13409 12057 gene locus_tag LOCUS_22840 13409 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22840 14200 13406 gene locus_tag LOCUS_22850 14200 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 14294 14743 gene locus_tag LOCUS_22860 14294 14743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 14826 15221 gene locus_tag LOCUS_22870 14826 15221 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_22870 15605 15393 gene locus_tag LOCUS_22880 15605 15393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 15529 16536 gene locus_tag LOCUS_22890 15529 16536 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence066 1830 235 gene locus_tag LOCUS_22900 1830 235 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099178.1 protein_id gnl|my_center|LOCUS_22900 2907 1870 gene locus_tag LOCUS_22910 2907 1870 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928654.1 protein_id gnl|my_center|LOCUS_22910 5227 3002 gene locus_tag LOCUS_22920 5227 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 6086 5208 gene locus_tag LOCUS_22930 6086 5208 CDS product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937431.1 protein_id gnl|my_center|LOCUS_22930 7661 6459 gene locus_tag LOCUS_22940 7661 6459 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957362.1 protein_id gnl|my_center|LOCUS_22940 9567 7855 gene locus_tag LOCUS_22950 9567 7855 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257769.1 protein_id gnl|my_center|LOCUS_22950 11489 10254 gene locus_tag LOCUS_22960 gene ubiH 11489 10254 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703430.1 protein_id gnl|my_center|LOCUS_22960 13007 11646 gene locus_tag LOCUS_22970 gene pepP 13007 11646 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_22970 13605 13081 gene locus_tag LOCUS_22980 13605 13081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 16250 13602 gene locus_tag LOCUS_22990 16250 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence067 553 957 gene locus_tag LOCUS_23000 553 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1112 2470 gene locus_tag LOCUS_23010 1112 2470 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_23010 2463 3965 gene locus_tag LOCUS_23020 2463 3965 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190973259.1 protein_id gnl|my_center|LOCUS_23020 3975 7169 gene locus_tag LOCUS_23030 3975 7169 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_23030 7251 7775 gene locus_tag LOCUS_23040 7251 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 7892 8218 gene locus_tag LOCUS_23050 7892 8218 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631113.1 protein_id gnl|my_center|LOCUS_23050 8271 8957 gene locus_tag LOCUS_23060 8271 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 8966 9397 gene locus_tag LOCUS_23070 8966 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 9515 12079 gene locus_tag LOCUS_23080 9515 12079 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_23080 12183 13493 gene locus_tag LOCUS_23090 gene cfaB 12183 13493 CDS product C17 cyclopropane fatty acid synthase CfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269413.1 protein_id gnl|my_center|LOCUS_23090 13606 13914 gene locus_tag LOCUS_23100 13606 13914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 13982 14542 gene locus_tag LOCUS_23110 gene petA 13982 14542 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_23110 14589 15419 gene locus_tag LOCUS_23120 14589 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 15474 15755 gene locus_tag LOCUS_23130 15474 15755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence068 1148 1258 gene locus_tag LOCUS_r00010 1148 1258 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1398 2396 gene locus_tag LOCUS_23140 gene birA 1398 2396 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262797.1 protein_id gnl|my_center|LOCUS_23140 2458 3141 gene locus_tag LOCUS_23150 2458 3141 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_23150 3138 3968 gene locus_tag LOCUS_23160 3138 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 4011 4086 gene locus_tag LOCUS_t00340 4011 4086 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4210 4710 gene locus_tag LOCUS_23170 4210 4710 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088765.1 protein_id gnl|my_center|LOCUS_23170 4885 5238 gene locus_tag LOCUS_23180 4885 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 5413 7314 gene locus_tag LOCUS_23190 gene htpG 5413 7314 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406139.1 protein_id gnl|my_center|LOCUS_23190 7344 8030 gene locus_tag LOCUS_23200 gene sfsA 7344 8030 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_23200 9939 8071 gene locus_tag LOCUS_23210 9939 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 11713 10337 gene locus_tag LOCUS_23220 11713 10337 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_23220 12282 11713 gene locus_tag LOCUS_23230 12282 11713 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_23230 12664 12299 gene locus_tag LOCUS_23240 12664 12299 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024665649.1 protein_id gnl|my_center|LOCUS_23240 14655 12685 gene locus_tag LOCUS_23250 14655 12685 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_23250 14752 15606 gene locus_tag LOCUS_23260 gene rsmI 14752 15606 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence069 2858 801 gene locus_tag LOCUS_23270 gene slt 2858 801 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_23270 3254 4102 gene locus_tag LOCUS_23280 3254 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 4136 4717 gene locus_tag LOCUS_23290 4136 4717 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 protein_id gnl|my_center|LOCUS_23290 4803 5111 gene locus_tag LOCUS_23300 gene hsbA 4803 5111 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_23300 5181 6911 gene locus_tag LOCUS_23310 gene hsbR 5181 6911 CDS product two-component system response regulator HsbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_23310 6908 7240 gene locus_tag LOCUS_23320 6908 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 7317 7649 gene locus_tag LOCUS_23330 7317 7649 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661705.1 protein_id gnl|my_center|LOCUS_23330 7846 9771 gene locus_tag LOCUS_23340 gene thrS 7846 9771 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443963.1 protein_id gnl|my_center|LOCUS_23340 9793 10293 gene locus_tag LOCUS_23350 gene infC 9793 10293 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367017.1 protein_id gnl|my_center|LOCUS_23350 10413 10610 gene locus_tag LOCUS_23360 gene rpmI 10413 10610 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 protein_id gnl|my_center|LOCUS_23360 10642 11001 gene locus_tag LOCUS_23370 gene rplT 10642 11001 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_23370 11140 12171 gene locus_tag LOCUS_23380 gene pheS 11140 12171 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_23380 12432 14810 gene locus_tag LOCUS_23390 gene pheT 12432 14810 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103972.1 protein_id gnl|my_center|LOCUS_23390 14827 15129 gene locus_tag LOCUS_23400 14827 15129 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811076.1 protein_id gnl|my_center|LOCUS_23400 15107 15463 gene locus_tag LOCUS_23410 15107 15463 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_23410 15582 15658 gene locus_tag LOCUS_t00350 15582 15658 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence070 1218 409 gene locus_tag LOCUS_23420 1218 409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_23420 2141 1215 gene locus_tag LOCUS_23430 2141 1215 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_23430 2452 3576 gene locus_tag LOCUS_23440 2452 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 3573 4514 gene locus_tag LOCUS_23450 3573 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 5716 4727 gene locus_tag LOCUS_23460 5716 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 5904 6791 gene locus_tag LOCUS_23470 5904 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 8474 6987 gene locus_tag LOCUS_23480 gene malQ 8474 6987 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_23480 10230 8509 gene locus_tag LOCUS_23490 10230 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 11505 10255 gene locus_tag LOCUS_23500 gene glgC 11505 10255 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_23500 11677 13848 gene locus_tag LOCUS_23510 gene glgB 11677 13848 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324338.1 protein_id gnl|my_center|LOCUS_23510 13880 15328 gene locus_tag LOCUS_23520 gene glgA 13880 15328 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429230.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence071 309 1004 gene locus_tag LOCUS_23530 309 1004 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_23530 1004 2377 gene locus_tag LOCUS_23540 1004 2377 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_23540 3216 5297 gene locus_tag LOCUS_23550 3216 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 5528 6181 gene locus_tag LOCUS_23560 5528 6181 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_23560 6549 9146 gene locus_tag LOCUS_23570 6549 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 10213 9209 gene locus_tag LOCUS_23580 10213 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 10983 10519 gene locus_tag LOCUS_23590 10983 10519 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080926.1 protein_id gnl|my_center|LOCUS_23590 11720 11004 gene locus_tag LOCUS_23600 11720 11004 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705288.1 protein_id gnl|my_center|LOCUS_23600 12419 11823 gene locus_tag LOCUS_23610 gene recR 12419 11823 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087237.1 protein_id gnl|my_center|LOCUS_23610 12781 12455 gene locus_tag LOCUS_23620 12781 12455 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_23620 13035 13448 gene locus_tag LOCUS_23630 13035 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 13445 15193 gene locus_tag LOCUS_23640 gene recJ 13445 15193 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence072 656 1306 gene locus_tag LOCUS_23650 656 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1832 1470 gene locus_tag LOCUS_23660 1832 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2335 1913 gene locus_tag LOCUS_23670 2335 1913 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 protein_id gnl|my_center|LOCUS_23670 3874 2342 gene locus_tag LOCUS_23680 gene pepA 3874 2342 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_23680 3997 4200 gene locus_tag LOCUS_23690 3997 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 4290 5402 gene locus_tag LOCUS_23700 gene lptF 4290 5402 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375972.1 protein_id gnl|my_center|LOCUS_23700 5405 6469 gene locus_tag LOCUS_23710 gene lptG 5405 6469 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406700.1 protein_id gnl|my_center|LOCUS_23710 8405 6684 gene locus_tag LOCUS_23720 gene soxB 8405 6684 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_23720 9542 8706 gene locus_tag LOCUS_23730 gene soxA 9542 8706 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932698.1 protein_id gnl|my_center|LOCUS_23730 9942 9625 gene locus_tag LOCUS_23740 gene soxZ 9942 9625 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_23740 10453 9989 gene locus_tag LOCUS_23750 gene soxY 10453 9989 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_23750 10878 10504 gene locus_tag LOCUS_23760 gene soxX 10878 10504 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926970.1 protein_id gnl|my_center|LOCUS_23760 12584 11124 gene locus_tag LOCUS_23770 12584 11124 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_23770 13001 13231 gene locus_tag LOCUS_23780 13001 13231 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568544.1 protein_id gnl|my_center|LOCUS_23780 13268 13735 gene locus_tag LOCUS_23790 13268 13735 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_23790 15194 13845 gene locus_tag LOCUS_23800 15194 13845 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence073 1160 189 gene locus_tag LOCUS_23810 1160 189 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056320.1 protein_id gnl|my_center|LOCUS_23810 2390 1347 gene locus_tag LOCUS_23820 2390 1347 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_23820 2784 4118 gene locus_tag LOCUS_23830 gene yegQ 2784 4118 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172489.1 protein_id gnl|my_center|LOCUS_23830 5692 4262 gene locus_tag LOCUS_23840 5692 4262 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_23840 5899 6831 gene locus_tag LOCUS_23850 gene glyQ 5899 6831 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_23850 6906 8993 gene locus_tag LOCUS_23860 gene glyS 6906 8993 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114646.1 protein_id gnl|my_center|LOCUS_23860 9083 9622 gene locus_tag LOCUS_23870 gene gmhB 9083 9622 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120688.1 protein_id gnl|my_center|LOCUS_23870 9622 10368 gene locus_tag LOCUS_23880 9622 10368 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064981.1 protein_id gnl|my_center|LOCUS_23880 12194 10704 gene locus_tag LOCUS_23890 12194 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 12688 12191 gene locus_tag LOCUS_23900 12688 12191 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_23900 14445 12685 gene locus_tag LOCUS_23910 14445 12685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 15010 14447 gene locus_tag LOCUS_23920 15010 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence074 1628 1323 gene locus_tag LOCUS_23930 1628 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2417 1767 gene locus_tag LOCUS_23940 2417 1767 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208084.1 protein_id gnl|my_center|LOCUS_23940 3735 2476 gene locus_tag LOCUS_23950 3735 2476 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057139.1 protein_id gnl|my_center|LOCUS_23950 4727 3747 gene locus_tag LOCUS_23960 4727 3747 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_23960 5782 4727 gene locus_tag LOCUS_23970 gene pdhA 5782 4727 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928801.1 protein_id gnl|my_center|LOCUS_23970 6145 5798 gene locus_tag LOCUS_23980 6145 5798 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250924.1 protein_id gnl|my_center|LOCUS_23980 7086 6304 gene locus_tag LOCUS_23990 7086 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 8509 7121 gene locus_tag LOCUS_24000 8509 7121 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_24000 9497 8547 gene locus_tag LOCUS_24010 9497 8547 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188687.1 protein_id gnl|my_center|LOCUS_24010 10511 9549 gene locus_tag LOCUS_24020 10511 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 11485 10523 gene locus_tag LOCUS_24030 gene pfkB 11485 10523 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640794.1 protein_id gnl|my_center|LOCUS_24030 12510 11482 gene locus_tag LOCUS_24040 12510 11482 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946219.1 protein_id gnl|my_center|LOCUS_24040 13183 12533 gene locus_tag LOCUS_24050 13183 12533 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933408.1 protein_id gnl|my_center|LOCUS_24050 14673 13258 gene locus_tag LOCUS_24060 14673 13258 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933618.1 protein_id gnl|my_center|LOCUS_24060 14828 15241 gene locus_tag LOCUS_24070 14828 15241 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence075 251 484 gene locus_tag LOCUS_24080 251 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 4554 874 gene locus_tag LOCUS_24090 gene metH 4554 874 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729624.1 protein_id gnl|my_center|LOCUS_24090 5052 4627 gene locus_tag LOCUS_24100 5052 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 5333 5073 gene locus_tag LOCUS_24110 5333 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 5446 6207 gene locus_tag LOCUS_24120 gene ttcA 5446 6207 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_24120 6204 7106 gene locus_tag LOCUS_24130 6204 7106 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_24130 7630 7298 gene locus_tag LOCUS_24140 7630 7298 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_24140 7793 8287 gene locus_tag LOCUS_24150 7793 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 9036 8305 gene locus_tag LOCUS_24160 9036 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 9724 9038 gene locus_tag LOCUS_24170 9724 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_24170 10814 9771 gene locus_tag LOCUS_24180 10814 9771 CDS product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479038.1 protein_id gnl|my_center|LOCUS_24180 12572 12135 gene locus_tag LOCUS_24190 12572 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 12483 14315 gene locus_tag LOCUS_24200 12483 14315 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141450.1 protein_id gnl|my_center|LOCUS_24200 14380 15072 gene locus_tag LOCUS_24210 14380 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence076 1065 349 gene locus_tag LOCUS_24220 1065 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 2278 1496 gene locus_tag LOCUS_24230 2278 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 3627 2281 gene locus_tag LOCUS_24240 3627 2281 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_24240 5612 3624 gene locus_tag LOCUS_24250 5612 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24250 6117 7145 gene locus_tag LOCUS_24260 gene mltB 6117 7145 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_24260 7138 8019 gene locus_tag LOCUS_24270 7138 8019 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947237.1 protein_id gnl|my_center|LOCUS_24270 8109 9266 gene locus_tag LOCUS_24280 8109 9266 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_24280 9279 10133 gene locus_tag LOCUS_24290 9279 10133 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_24290 10411 10689 gene locus_tag LOCUS_24300 10411 10689 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189266.1 protein_id gnl|my_center|LOCUS_24300 10697 11305 gene locus_tag LOCUS_24310 gene lipB 10697 11305 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313884.1 protein_id gnl|my_center|LOCUS_24310 12438 11389 gene locus_tag LOCUS_24320 12438 11389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence077 2302 2643 gene locus_tag LOCUS_24330 2302 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2645 3070 gene locus_tag LOCUS_24340 2645 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 3125 4165 gene locus_tag LOCUS_24350 3125 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 4397 4215 gene locus_tag LOCUS_24360 4397 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 4312 5226 gene locus_tag LOCUS_24370 4312 5226 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970702.1 protein_id gnl|my_center|LOCUS_24370 6030 5230 gene locus_tag LOCUS_24380 gene trpC 6030 5230 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_24380 7167 6148 gene locus_tag LOCUS_24390 gene trpD 7167 6148 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103215.1 protein_id gnl|my_center|LOCUS_24390 7941 7363 gene locus_tag LOCUS_24400 7941 7363 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_24400 8276 8001 gene locus_tag LOCUS_24410 8276 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 9970 8414 gene locus_tag LOCUS_24420 gene trpE 9970 8414 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_24420 10709 10041 gene locus_tag LOCUS_24430 10709 10041 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463955.1 protein_id gnl|my_center|LOCUS_24430 11502 10810 gene locus_tag LOCUS_24440 gene rpe 11502 10810 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085122.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence078 647 144 gene locus_tag LOCUS_24450 647 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1182 865 gene locus_tag LOCUS_24460 1182 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1424 1182 gene locus_tag LOCUS_24470 1424 1182 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 protein_id gnl|my_center|LOCUS_24470 1624 2997 gene locus_tag LOCUS_24480 gene ppnN 1624 2997 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771604.1 protein_id gnl|my_center|LOCUS_24480 3427 3008 gene locus_tag LOCUS_24490 3427 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 4315 3524 gene locus_tag LOCUS_24500 4315 3524 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266523.1 protein_id gnl|my_center|LOCUS_24500 7360 4649 gene locus_tag LOCUS_24510 7360 4649 CDS product arsenate reductase (azurin) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229171.1 protein_id gnl|my_center|LOCUS_24510 8059 7460 gene locus_tag LOCUS_24520 8059 7460 CDS product arsenate reductase (azurin) small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229170.1 protein_id gnl|my_center|LOCUS_24520 9240 8089 gene locus_tag LOCUS_24530 9240 8089 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_24530 9125 9367 gene locus_tag LOCUS_24540 9125 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 10436 9372 gene locus_tag LOCUS_24550 10436 9372 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence079 386 129 gene locus_tag LOCUS_24560 386 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 664 3270 gene locus_tag LOCUS_24570 gene mutS 664 3270 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_24570 4880 3552 gene locus_tag LOCUS_24580 4880 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 5042 5365 gene locus_tag LOCUS_24590 5042 5365 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_24590 6530 5814 gene locus_tag LOCUS_24600 6530 5814 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_24600 7079 6597 gene locus_tag LOCUS_24610 7079 6597 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772268.1 protein_id gnl|my_center|LOCUS_24610 8046 7126 gene locus_tag LOCUS_24620 gene xerD 8046 7126 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_24620 8512 8030 gene locus_tag LOCUS_24630 8512 8030 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522636.1 protein_id gnl|my_center|LOCUS_24630 9007 8663 gene locus_tag LOCUS_24640 gene rplS 9007 8663 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_24640 9825 9088 gene locus_tag LOCUS_24650 gene trmD 9825 9088 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704631.1 protein_id gnl|my_center|LOCUS_24650 10366 9836 gene locus_tag LOCUS_24660 gene rimM 10366 9836 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043266.1 protein_id gnl|my_center|LOCUS_24660 10651 10400 gene locus_tag LOCUS_24670 gene rpsP 10651 10400 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071566.1 protein_id gnl|my_center|LOCUS_24670 11310 10933 gene locus_tag LOCUS_24680 11310 10933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 12445 11753 gene locus_tag LOCUS_24690 12445 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence080 1517 168 gene locus_tag LOCUS_24700 1517 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2515 1655 gene locus_tag LOCUS_24710 2515 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 3748 2636 gene locus_tag LOCUS_24720 gene hisC 3748 2636 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_24720 4974 3889 gene locus_tag LOCUS_24730 gene pheA 4974 3889 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_24730 6151 4988 gene locus_tag LOCUS_24740 6151 4988 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_24740 7375 6275 gene locus_tag LOCUS_24750 gene serC 7375 6275 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766746.1 protein_id gnl|my_center|LOCUS_24750 10213 7586 gene locus_tag LOCUS_24760 gene gyrA 10213 7586 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815974.1 protein_id gnl|my_center|LOCUS_24760 11567 10527 gene locus_tag LOCUS_24770 gene mtnA 11567 10527 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091449.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence081 <1 540 gene locus_tag LOCUS_24780 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000788423.1:type IV pilus secretin PilQ family protein 699 1217 gene locus_tag LOCUS_24790 699 1217 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_24790 1214 2329 gene locus_tag LOCUS_24800 gene aroB 1214 2329 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_24800 2326 3480 gene locus_tag LOCUS_24810 2326 3480 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806949.1 protein_id gnl|my_center|LOCUS_24810 3512 3754 gene locus_tag LOCUS_24820 3512 3754 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037968.1 protein_id gnl|my_center|LOCUS_24820 3755 5356 gene locus_tag LOCUS_24830 3755 5356 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266379.1 protein_id gnl|my_center|LOCUS_24830 5534 10018 gene locus_tag LOCUS_24840 gene gltB 5534 10018 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_24840 10122 11528 gene locus_tag LOCUS_24850 10122 11528 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence082 705 70 gene locus_tag LOCUS_24860 705 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 1535 924 gene locus_tag LOCUS_24870 1535 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 1975 1535 gene locus_tag LOCUS_24880 1975 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 3200 3111 gene locus_tag LOCUS_t00360 3200 3111 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4043 3450 gene locus_tag LOCUS_24890 gene tadA 4043 3450 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 protein_id gnl|my_center|LOCUS_24890 6090 4126 gene locus_tag LOCUS_24900 6090 4126 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616027.1 protein_id gnl|my_center|LOCUS_24900 8438 6285 gene locus_tag LOCUS_24910 8438 6285 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_24910 8548 9822 gene locus_tag LOCUS_24920 8548 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 9815 10684 gene locus_tag LOCUS_24930 9815 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence083 3114 2584 gene locus_tag LOCUS_24940 3114 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 3731 3135 gene locus_tag LOCUS_24950 3731 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 5740 3731 gene locus_tag LOCUS_24960 5740 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 5915 5724 gene locus_tag LOCUS_24970 5915 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 6388 6050 gene locus_tag LOCUS_24980 6388 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 7453 6491 gene locus_tag LOCUS_24990 7453 6491 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939436.1 protein_id gnl|my_center|LOCUS_24990 7696 7457 gene locus_tag LOCUS_25000 7696 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 8142 7693 gene locus_tag LOCUS_25010 8142 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 8504 8139 gene locus_tag LOCUS_25020 8504 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 8962 8501 gene locus_tag LOCUS_25030 8962 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 10094 9042 gene locus_tag LOCUS_25040 10094 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 10503 10150 gene locus_tag LOCUS_25050 10503 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence084 297 1643 gene locus_tag LOCUS_25060 297 1643 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_25060 1765 5421 gene locus_tag LOCUS_25070 1765 5421 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459255.1 protein_id gnl|my_center|LOCUS_25070 5418 6557 gene locus_tag LOCUS_25080 5418 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 8160 6574 gene locus_tag LOCUS_25090 8160 6574 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133503194.1 protein_id gnl|my_center|LOCUS_25090 8534 8322 gene locus_tag LOCUS_25100 8534 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 9080 9904 gene locus_tag LOCUS_25110 9080 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence085 571 2028 gene locus_tag LOCUS_25120 571 2028 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933883.1 protein_id gnl|my_center|LOCUS_25120 2058 2183 gene locus_tag LOCUS_25130 2058 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2327 3496 gene locus_tag LOCUS_25140 gene sucC 2327 3496 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958199.1 protein_id gnl|my_center|LOCUS_25140 3496 4368 gene locus_tag LOCUS_25150 gene sucD 3496 4368 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771707.1 protein_id gnl|my_center|LOCUS_25150 4666 6297 gene locus_tag LOCUS_25160 4666 6297 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 protein_id gnl|my_center|LOCUS_25160 6328 6666 gene locus_tag LOCUS_25170 gene glnB 6328 6666 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231018.1 protein_id gnl|my_center|LOCUS_25170 7876 7043 gene locus_tag LOCUS_25180 7876 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 7942 8898 gene locus_tag LOCUS_25190 gene rluD 7942 8898 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707736.1 protein_id gnl|my_center|LOCUS_25190 8903 9646 gene locus_tag LOCUS_25200 gene pgeF 8903 9646 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence086 3699 2332 gene locus_tag LOCUS_25210 3699 2332 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870113.1 protein_id gnl|my_center|LOCUS_25210 5972 4107 gene locus_tag LOCUS_25220 5972 4107 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443916.1 protein_id gnl|my_center|LOCUS_25220 8094 6073 gene locus_tag LOCUS_25230 8094 6073 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 protein_id gnl|my_center|LOCUS_25230 9127 8087 gene locus_tag LOCUS_25240 9127 8087 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_25240 9624 9124 gene locus_tag LOCUS_25250 9624 9124 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038328.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence087 598 188 gene locus_tag LOCUS_25260 598 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1089 598 gene locus_tag LOCUS_25270 1089 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1946 1536 gene locus_tag LOCUS_25280 1946 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 2662 1943 gene locus_tag LOCUS_25290 2662 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2862 2653 gene locus_tag LOCUS_25300 2862 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 3266 2862 gene locus_tag LOCUS_25310 3266 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 3698 3276 gene locus_tag LOCUS_25320 3698 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 4073 3864 gene locus_tag LOCUS_25330 4073 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 4687 4070 gene locus_tag LOCUS_25340 4687 4070 CDS product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072605.1 protein_id gnl|my_center|LOCUS_25340 5036 4698 gene locus_tag LOCUS_25350 5036 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 4935 5180 gene locus_tag LOCUS_25360 4935 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 5475 5158 gene locus_tag LOCUS_25370 5475 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 5834 5478 gene locus_tag LOCUS_25380 5834 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 6481 5831 gene locus_tag LOCUS_25390 6481 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 7218 6481 gene locus_tag LOCUS_25400 7218 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 <9243 7275 gene locus_tag LOCUS_25410 <9243 7275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072599.1:transposase domain-containing protein >Feature sequence088 1545 157 gene locus_tag LOCUS_25420 gene cls 1545 157 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016286.1 protein_id gnl|my_center|LOCUS_25420 2060 1545 gene locus_tag LOCUS_25430 2060 1545 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202950645.1 protein_id gnl|my_center|LOCUS_25430 2910 2176 gene locus_tag LOCUS_25440 2910 2176 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_25440 3641 2907 gene locus_tag LOCUS_25450 3641 2907 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257105.1 protein_id gnl|my_center|LOCUS_25450 5548 3638 gene locus_tag LOCUS_25460 gene ftsH 5548 3638 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_25460 6232 7242 gene locus_tag LOCUS_25470 6232 7242 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence089 2579 249 gene locus_tag LOCUS_25480 2579 249 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104749.1 protein_id gnl|my_center|LOCUS_25480 2768 3346 gene locus_tag LOCUS_25490 2768 3346 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_25490 4050 3367 gene locus_tag LOCUS_25500 gene lolD 4050 3367 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_25500 5293 4043 gene locus_tag LOCUS_25510 5293 4043 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_25510 6060 5494 gene locus_tag LOCUS_25520 6060 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 7329 6328 gene locus_tag LOCUS_25530 7329 6328 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646584.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence090 2469 997 gene locus_tag LOCUS_25540 2469 997 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_25540 3702 2494 gene locus_tag LOCUS_25550 gene nhaA 3702 2494 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704638.1 protein_id gnl|my_center|LOCUS_25550 4681 3788 gene locus_tag LOCUS_25560 4681 3788 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_25560 6780 4783 gene locus_tag LOCUS_25570 gene aprA 6780 4783 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_25570 7318 6851 gene locus_tag LOCUS_25580 gene aprB 7318 6851 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence091 <1 828 gene locus_tag LOCUS_25590 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_110752062.1:PBECR2 nuclease fold domain-containing protein 918 1424 gene locus_tag LOCUS_25600 918 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 1918 1421 gene locus_tag LOCUS_25610 1918 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2148 1915 gene locus_tag LOCUS_25620 2148 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2757 2416 gene locus_tag LOCUS_25630 2757 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2979 4100 gene locus_tag LOCUS_25640 2979 4100 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232421.1 protein_id gnl|my_center|LOCUS_25640 4138 4554 gene locus_tag LOCUS_25650 4138 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 4594 5637 gene locus_tag LOCUS_25660 4594 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 5726 5962 gene locus_tag LOCUS_25670 5726 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 5969 6388 gene locus_tag LOCUS_25680 5969 6388 CDS product DUF1320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071001.1 protein_id gnl|my_center|LOCUS_25680 6388 6828 gene locus_tag LOCUS_25690 6388 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence092 36 184 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgtcgttgtcgctgtcca 2299 4611 gene locus_tag LOCUS_25700 2299 4611 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence093 228 1064 gene locus_tag LOCUS_25710 gene mscS 228 1064 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_25710 1560 1255 gene locus_tag LOCUS_25720 1560 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 1762 3852 gene locus_tag LOCUS_25730 1762 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 4021 4482 gene locus_tag LOCUS_25740 4021 4482 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_25740 4705 4499 gene locus_tag LOCUS_25750 4705 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 4592 6196 gene locus_tag LOCUS_25760 4592 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence094 1430 318 gene locus_tag LOCUS_25770 1430 318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_25770 2603 1482 gene locus_tag LOCUS_25780 2603 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 4480 2600 gene locus_tag LOCUS_25790 4480 2600 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391778.1 protein_id gnl|my_center|LOCUS_25790 5535 4504 gene locus_tag LOCUS_25800 5535 4504 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_25800 6748 5726 gene locus_tag LOCUS_25810 6748 5726 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040720.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence095 3102 1303 gene locus_tag LOCUS_25820 gene aspS 3102 1303 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123218.1 protein_id gnl|my_center|LOCUS_25820 3816 3163 gene locus_tag LOCUS_25830 3816 3163 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_25830 4135 3854 gene locus_tag LOCUS_25840 4135 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 4272 4706 gene locus_tag LOCUS_25850 4272 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 5562 4765 gene locus_tag LOCUS_25860 5562 4765 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_25860 6395 5706 gene locus_tag LOCUS_25870 6395 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence096 191 3352 gene locus_tag LOCUS_25880 191 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 3538 3777 gene locus_tag LOCUS_25890 3538 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3838 4770 gene locus_tag LOCUS_25900 3838 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022977.1 protein_id gnl|my_center|LOCUS_25900 4825 5727 gene locus_tag LOCUS_25910 4825 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 5833 6060 gene locus_tag LOCUS_25920 5833 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence097 913 2691 gene locus_tag LOCUS_25930 913 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 2745 5900 gene locus_tag LOCUS_25940 2745 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence098 990 466 gene locus_tag LOCUS_25950 gene yjgA 990 466 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101581.1 protein_id gnl|my_center|LOCUS_25950 4867 1004 gene locus_tag LOCUS_25960 4867 1004 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189879.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence099 445 1284 gene locus_tag LOCUS_25970 445 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2088 1459 gene locus_tag LOCUS_25980 2088 1459 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_25980 2830 2075 gene locus_tag LOCUS_25990 2830 2075 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 protein_id gnl|my_center|LOCUS_25990 2958 3647 gene locus_tag LOCUS_26000 2958 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 3981 3748 gene locus_tag LOCUS_26010 3981 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 6326 3981 gene locus_tag LOCUS_26020 6326 3981 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361687.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence100 2351 297 gene locus_tag LOCUS_26030 2351 297 CDS product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 protein_id gnl|my_center|LOCUS_26030 2851 4341 gene locus_tag LOCUS_26040 gene zwf 2851 4341 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_26040 4449 5153 gene locus_tag LOCUS_26050 gene fixJ 4449 5153 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_26050 5929 5216 gene locus_tag LOCUS_26060 5929 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence101 269 1825 gene locus_tag LOCUS_26070 269 1825 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085901.1 protein_id gnl|my_center|LOCUS_26070 1822 2709 gene locus_tag LOCUS_26080 1822 2709 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965715.1 protein_id gnl|my_center|LOCUS_26080 2800 3468 gene locus_tag LOCUS_26090 2800 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 3578 4705 gene locus_tag LOCUS_26100 3578 4705 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_26100 4712 5572 gene locus_tag LOCUS_26110 4712 5572 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704980.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence102 201 4 gene locus_tag LOCUS_26120 201 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 968 198 gene locus_tag LOCUS_26130 gene zapD 968 198 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_26130 1678 1064 gene locus_tag LOCUS_26140 gene coaE 1678 1064 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707572.1 protein_id gnl|my_center|LOCUS_26140 2752 1871 gene locus_tag LOCUS_26150 2752 1871 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_26150 3994 2774 gene locus_tag LOCUS_26160 3994 2774 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_26160 <5668 3998 gene locus_tag LOCUS_26170 <5668 3998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112841.1:type IV-A pilus assembly ATPase PilB >Feature sequence103 348 435 gene locus_tag LOCUS_t00370 348 435 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2077 551 gene locus_tag LOCUS_26180 2077 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 3162 2113 gene locus_tag LOCUS_26190 3162 2113 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_26190 3977 3264 gene locus_tag LOCUS_26200 3977 3264 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 protein_id gnl|my_center|LOCUS_26200 4642 3974 gene locus_tag LOCUS_26210 4642 3974 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869453.1 protein_id gnl|my_center|LOCUS_26210 <5535 4744 gene locus_tag LOCUS_26220 <5535 4744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403381.1:N-acetylneuraminate synthase >Feature sequence104 237 1316 gene locus_tag LOCUS_26230 237 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_26230 1337 1576 gene locus_tag LOCUS_26240 1337 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 1576 2739 gene locus_tag LOCUS_26250 1576 2739 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444330.1 protein_id gnl|my_center|LOCUS_26250 3017 4426 gene locus_tag LOCUS_26260 gene glnA 3017 4426 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110151.1 protein_id gnl|my_center|LOCUS_26260 4567 5088 gene locus_tag LOCUS_26270 4567 5088 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114474.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence105 256 1209 gene locus_tag LOCUS_26280 gene trxB 256 1209 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 protein_id gnl|my_center|LOCUS_26280 2173 1496 gene locus_tag LOCUS_26290 2173 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2241 3407 gene locus_tag LOCUS_26300 2241 3407 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192390.1 protein_id gnl|my_center|LOCUS_26300 3395 4114 gene locus_tag LOCUS_26310 gene aat 3395 4114 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_26310 4120 4863 gene locus_tag LOCUS_26320 4120 4863 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence106 3371 690 gene locus_tag LOCUS_26330 3371 690 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928965.1 protein_id gnl|my_center|LOCUS_26330 4043 3393 gene locus_tag LOCUS_26340 4043 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 4404 4018 gene locus_tag LOCUS_26350 4404 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence107 2306 888 gene locus_tag LOCUS_26360 gene leuC 2306 888 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 protein_id gnl|my_center|LOCUS_26360 2460 3362 gene locus_tag LOCUS_26370 2460 3362 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103885.1 protein_id gnl|my_center|LOCUS_26370 3412 4146 gene locus_tag LOCUS_26380 3412 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 4721 4248 gene locus_tag LOCUS_26390 4721 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence108 <1 3900 gene locus_tag LOCUS_26400 <1 3900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072088404.1:ATP-dependent RNA helicase HrpA >Feature sequence109 318 2537 gene locus_tag LOCUS_26410 318 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2534 2932 gene locus_tag LOCUS_26420 2534 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence110 273 1067 gene locus_tag LOCUS_26430 273 1067 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_26430 1315 2505 gene locus_tag LOCUS_26440 1315 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_26440 4412 2790 gene locus_tag LOCUS_26450 4412 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence111 1423 152 gene locus_tag LOCUS_26460 1423 152 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809081.1 protein_id gnl|my_center|LOCUS_26460 1875 1549 gene locus_tag LOCUS_26470 1875 1549 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_26470 2153 1872 gene locus_tag LOCUS_26480 2153 1872 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_26480 3848 2805 gene locus_tag LOCUS_26490 3848 2805 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence112 <4001 2869 gene locus_tag LOCUS_26500 <4001 2869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331488.1:conjugal transfer protein TraH >Feature sequence113 1037 843 gene locus_tag LOCUS_26510 1037 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 3310 1787 gene locus_tag LOCUS_26520 3310 1787 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 protein_id gnl|my_center|LOCUS_26520 3451 3535 gene locus_tag LOCUS_t00380 3451 3535 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3585 3658 gene locus_tag LOCUS_t00390 3585 3658 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3725 3799 gene locus_tag LOCUS_t00400 3725 3799 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence114 937 1851 gene locus_tag LOCUS_26530 937 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 1854 3455 gene locus_tag LOCUS_26540 1854 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence115 262 2055 gene locus_tag LOCUS_26550 gene mshL 262 2055 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073814.1 protein_id gnl|my_center|LOCUS_26550 2070 2993 gene locus_tag LOCUS_26560 gene mshM 2070 2993 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence116 >Feature sequence117 115 915 gene locus_tag LOCUS_26570 115 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 921 2861 gene locus_tag LOCUS_26580 921 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence118 601 1686 gene locus_tag LOCUS_26590 601 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 3085 2051 gene locus_tag LOCUS_26600 3085 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence119 29 1189 gene locus_tag LOCUS_26610 29 1189 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 protein_id gnl|my_center|LOCUS_26610 1566 2726 gene locus_tag LOCUS_26620 gene neuC 1566 2726 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088732.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence120 105 653 gene locus_tag LOCUS_26630 105 653 CDS product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037622.1 protein_id gnl|my_center|LOCUS_26630 653 1174 gene locus_tag LOCUS_26640 gene pilV 653 1174 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925904.1 protein_id gnl|my_center|LOCUS_26640 1171 1923 gene locus_tag LOCUS_26650 1171 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1935 2507 gene locus_tag LOCUS_26660 1935 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence121 439 1398 gene locus_tag LOCUS_26670 gene lipA 439 1398 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119196.1 protein_id gnl|my_center|LOCUS_26670 1609 2826 gene locus_tag LOCUS_26680 gene sat 1609 2826 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence122 <1 1133 gene locus_tag LOCUS_26690 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331488.1:conjugal transfer protein TraH >Feature sequence123 >Feature sequence124 <1 1164 gene locus_tag LOCUS_26700 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947796.1:type-F conjugative transfer system mating-pair stabilization protein TraN 1161 1979 gene locus_tag LOCUS_26710 gene traF 1161 1979 CDS product type-F conjugative transfer system pilin assembly protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947795.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence125 229 627 gene locus_tag LOCUS_26720 229 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1368 637 gene locus_tag LOCUS_26730 1368 637 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082451.1 protein_id gnl|my_center|LOCUS_26730 2030 1365 gene locus_tag LOCUS_26740 2030 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence126 >Feature sequence127 <2273 834 gene locus_tag LOCUS_26750 <2273 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000821859.1:type-F conjugative transfer system mating-pair stabilization protein TraN >Feature sequence128 797 126 gene locus_tag LOCUS_26760 797 126 CDS product MSHA biogenesis protein MshJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073816.1 protein_id gnl|my_center|LOCUS_26760 1423 794 gene locus_tag LOCUS_26770 1423 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence129 746 2137 gene locus_tag LOCUS_26780 746 2137 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198129.1 protein_id gnl|my_center|LOCUS_26780 >Feature sequence130 1697 333 gene locus_tag LOCUS_26790 1697 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence131 192 551 gene locus_tag LOCUS_26800 192 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 895 557 gene locus_tag LOCUS_26810 895 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 1188 973 gene locus_tag LOCUS_26820 1188 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820