>Feature sequence001 1148 2218 gene locus_tag LOCUS_00010 1148 2218 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_00010 2970 2224 gene locus_tag LOCUS_00020 gene rlmB 2970 2224 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_00020 4058 2970 gene locus_tag LOCUS_00030 4058 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4261 5031 gene locus_tag LOCUS_00040 4261 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7977 5020 gene locus_tag LOCUS_00050 7977 5020 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_00050 8711 8073 gene locus_tag LOCUS_00060 8711 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9439 8735 gene locus_tag LOCUS_00070 9439 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11041 9464 gene locus_tag LOCUS_00080 11041 9464 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206169.1 protein_id gnl|my_center|LOCUS_00080 12074 11022 gene locus_tag LOCUS_00090 12074 11022 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027223809.1 protein_id gnl|my_center|LOCUS_00090 12524 12153 gene locus_tag LOCUS_00100 12524 12153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14273 12591 gene locus_tag LOCUS_00110 gene ettA 14273 12591 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_00110 14467 14688 gene locus_tag LOCUS_00120 14467 14688 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_00120 15367 14696 gene locus_tag LOCUS_00130 15367 14696 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_00130 16497 15400 gene locus_tag LOCUS_00140 gene queA 16497 15400 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_00140 16716 17957 gene locus_tag LOCUS_00150 16716 17957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_00150 18396 20678 gene locus_tag LOCUS_00160 18396 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21383 21997 gene locus_tag LOCUS_00170 21383 21997 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_00170 21990 23330 gene locus_tag LOCUS_00180 21990 23330 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_00180 23383 24501 gene locus_tag LOCUS_00190 23383 24501 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391447.1 protein_id gnl|my_center|LOCUS_00190 24503 27916 gene locus_tag LOCUS_00200 24503 27916 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_00200 27923 29164 gene locus_tag LOCUS_00210 27923 29164 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_00210 30474 29161 gene locus_tag LOCUS_00220 30474 29161 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_00220 30599 32716 gene locus_tag LOCUS_00230 30599 32716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 35852 32694 gene locus_tag LOCUS_00240 35852 32694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 36765 35962 gene locus_tag LOCUS_00250 36765 35962 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037362.1 protein_id gnl|my_center|LOCUS_00250 37892 36753 gene locus_tag LOCUS_00260 37892 36753 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_00260 38570 38016 gene locus_tag LOCUS_00270 gene def 38570 38016 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_00270 38989 38567 gene locus_tag LOCUS_00280 gene ruvX 38989 38567 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_00280 39095 40750 gene locus_tag LOCUS_00290 39095 40750 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_00290 41764 40751 gene locus_tag LOCUS_00300 41764 40751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 41840 43153 gene locus_tag LOCUS_00310 41840 43153 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_00310 43140 43511 gene locus_tag LOCUS_00320 43140 43511 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_00320 44195 43569 gene locus_tag LOCUS_00330 44195 43569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 44967 44197 gene locus_tag LOCUS_00340 44967 44197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 <46060 45099 gene locus_tag LOCUS_00350 <46060 45099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545143.1:DegQ family serine endoprotease >Feature sequence002 1199 2458 gene locus_tag LOCUS_00360 gene mnmA 1199 2458 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_00360 2542 2814 gene locus_tag LOCUS_00370 2542 2814 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007137004.1 protein_id gnl|my_center|LOCUS_00370 2892 4145 gene locus_tag LOCUS_00380 2892 4145 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_00380 4126 4764 gene locus_tag LOCUS_00390 4126 4764 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_00390 4791 6071 gene locus_tag LOCUS_00400 4791 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 6177 6560 gene locus_tag LOCUS_00410 6177 6560 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_00410 7033 6557 gene locus_tag LOCUS_00420 7033 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 8232 7120 gene locus_tag LOCUS_00430 8232 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 8841 8299 gene locus_tag LOCUS_00440 8841 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 9896 9126 gene locus_tag LOCUS_00450 9896 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 11006 9918 gene locus_tag LOCUS_00460 11006 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 11160 11675 gene locus_tag LOCUS_00470 11160 11675 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_00470 11737 12654 gene locus_tag LOCUS_00480 11737 12654 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202057.1 protein_id gnl|my_center|LOCUS_00480 12731 15166 gene locus_tag LOCUS_00490 12731 15166 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_00490 15394 15867 gene locus_tag LOCUS_00500 15394 15867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 15957 16577 gene locus_tag LOCUS_00510 15957 16577 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_00510 16928 17512 gene locus_tag LOCUS_00520 16928 17512 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_00520 18433 17564 gene locus_tag LOCUS_00530 18433 17564 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_00530 19161 18472 gene locus_tag LOCUS_00540 19161 18472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 20183 19335 gene locus_tag LOCUS_00550 20183 19335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 21502 20198 gene locus_tag LOCUS_00560 21502 20198 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_00560 22084 21557 gene locus_tag LOCUS_00570 22084 21557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 22863 22096 gene locus_tag LOCUS_00580 22863 22096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 23373 22921 gene locus_tag LOCUS_00590 23373 22921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 23941 23393 gene locus_tag LOCUS_00600 23941 23393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 24770 24006 gene locus_tag LOCUS_00610 24770 24006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 26857 24767 gene locus_tag LOCUS_00620 26857 24767 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_00620 27458 26886 gene locus_tag LOCUS_00630 27458 26886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 28095 27511 gene locus_tag LOCUS_00640 28095 27511 CDS product DUF3347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073122886.1 protein_id gnl|my_center|LOCUS_00640 29915 28095 gene locus_tag LOCUS_00650 29915 28095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 31230 29953 gene locus_tag LOCUS_00660 31230 29953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 35053 31220 gene locus_tag LOCUS_00670 35053 31220 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_00670 35537 35154 gene locus_tag LOCUS_00680 35537 35154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 36040 35657 gene locus_tag LOCUS_00690 36040 35657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 36626 36183 gene locus_tag LOCUS_00700 36626 36183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 36973 36707 gene locus_tag LOCUS_00710 36973 36707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 38170 36992 gene locus_tag LOCUS_00720 38170 36992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 38592 38188 gene locus_tag LOCUS_00730 38592 38188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 39148 38900 gene locus_tag LOCUS_00740 39148 38900 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_00740 39947 39153 gene locus_tag LOCUS_00750 gene hypB 39947 39153 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_00750 40359 39955 gene locus_tag LOCUS_00760 gene hypA 40359 39955 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933459.1 protein_id gnl|my_center|LOCUS_00760 40538 41662 gene locus_tag LOCUS_00770 40538 41662 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_00770 41686 43419 gene locus_tag LOCUS_00780 41686 43419 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_00780 43437 44141 gene locus_tag LOCUS_00790 gene cybH 43437 44141 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_00790 44145 44675 gene locus_tag LOCUS_00800 44145 44675 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296886.1 protein_id gnl|my_center|LOCUS_00800 44997 44806 gene locus_tag LOCUS_00810 44997 44806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 >Feature sequence003 643 1548 gene locus_tag LOCUS_00820 643 1548 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_00820 1552 1764 gene locus_tag LOCUS_00830 1552 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 1761 2561 gene locus_tag LOCUS_00840 1761 2561 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_00840 2558 3232 gene locus_tag LOCUS_00850 gene truB 2558 3232 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_00850 3229 4152 gene locus_tag LOCUS_00860 3229 4152 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_00860 4180 6141 gene locus_tag LOCUS_00870 4180 6141 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_00870 6142 6522 gene locus_tag LOCUS_00880 gene gldC 6142 6522 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_00880 6700 9561 gene locus_tag LOCUS_00890 6700 9561 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_00890 9651 12554 gene locus_tag LOCUS_00900 9651 12554 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_00900 12551 13996 gene locus_tag LOCUS_00910 12551 13996 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_00910 14659 14048 gene locus_tag LOCUS_00920 14659 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 15456 14791 gene locus_tag LOCUS_00930 gene ung 15456 14791 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_00930 15615 16001 gene locus_tag LOCUS_00940 gene apaG 15615 16001 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257425.1 protein_id gnl|my_center|LOCUS_00940 16004 16780 gene locus_tag LOCUS_00950 16004 16780 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_00950 18006 17707 gene locus_tag LOCUS_00960 18006 17707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 19743 18031 gene locus_tag LOCUS_00970 19743 18031 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_00970 22478 20109 gene locus_tag LOCUS_00980 22478 20109 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_00980 22779 22486 gene locus_tag LOCUS_00990 22779 22486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 22861 23748 gene locus_tag LOCUS_01000 22861 23748 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_01000 23789 24628 gene locus_tag LOCUS_01010 23789 24628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 24609 25655 gene locus_tag LOCUS_01020 24609 25655 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_01020 25674 26354 gene locus_tag LOCUS_01030 25674 26354 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_01030 26351 26722 gene locus_tag LOCUS_01040 26351 26722 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_01040 28222 27113 gene locus_tag LOCUS_01050 28222 27113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 28600 29916 gene locus_tag LOCUS_01060 28600 29916 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_01060 29932 30675 gene locus_tag LOCUS_01070 gene kdsB 29932 30675 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_01070 31623 32228 gene locus_tag LOCUS_01080 31623 32228 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974856.1 protein_id gnl|my_center|LOCUS_01080 33249 32230 gene locus_tag LOCUS_01090 33249 32230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 33618 33253 gene locus_tag LOCUS_01100 33618 33253 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_01100 35214 33643 gene locus_tag LOCUS_01110 35214 33643 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_01110 37028 35214 gene locus_tag LOCUS_01120 37028 35214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 37174 38352 gene locus_tag LOCUS_01130 37174 38352 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_01130 39709 38639 gene locus_tag LOCUS_01140 39709 38639 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760932.1 protein_id gnl|my_center|LOCUS_01140 39878 40849 gene locus_tag LOCUS_01150 gene trpS 39878 40849 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_01150 40863 42584 gene locus_tag LOCUS_01160 40863 42584 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_01160 42589 43035 gene locus_tag LOCUS_01170 42589 43035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 >Feature sequence004 4433 897 gene locus_tag LOCUS_01180 gene smc 4433 897 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092731919.1 protein_id gnl|my_center|LOCUS_01180 4560 5123 gene locus_tag LOCUS_01190 4560 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 15772 5129 gene locus_tag LOCUS_01200 15772 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 17050 15872 gene locus_tag LOCUS_01210 17050 15872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 18043 17057 gene locus_tag LOCUS_01220 18043 17057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 21257 18126 gene locus_tag LOCUS_01230 21257 18126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 22714 21254 gene locus_tag LOCUS_01240 22714 21254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 25783 22727 gene locus_tag LOCUS_01250 25783 22727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 27199 25997 gene locus_tag LOCUS_01260 27199 25997 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_01260 27268 28362 gene locus_tag LOCUS_01270 27268 28362 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766782.1 protein_id gnl|my_center|LOCUS_01270 29056 28334 gene locus_tag LOCUS_01280 29056 28334 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_01280 29140 29694 gene locus_tag LOCUS_01290 29140 29694 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786125.1 protein_id gnl|my_center|LOCUS_01290 29842 32004 gene locus_tag LOCUS_01300 29842 32004 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_01300 33068 32055 gene locus_tag LOCUS_01310 33068 32055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 33199 34503 gene locus_tag LOCUS_01320 33199 34503 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_01320 35859 34510 gene locus_tag LOCUS_01330 35859 34510 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_01330 37192 35936 gene locus_tag LOCUS_01340 37192 35936 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202865.1 protein_id gnl|my_center|LOCUS_01340 37888 37196 gene locus_tag LOCUS_01350 37888 37196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 38783 37893 gene locus_tag LOCUS_01360 38783 37893 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_01360 39293 38796 gene locus_tag LOCUS_01370 39293 38796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 39431 39766 gene locus_tag LOCUS_01380 39431 39766 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941967.1 protein_id gnl|my_center|LOCUS_01380 39766 40794 gene locus_tag LOCUS_01390 gene arsS 39766 40794 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_01390 >Feature sequence005 267 1280 gene locus_tag LOCUS_01400 267 1280 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226719.1 protein_id gnl|my_center|LOCUS_01400 1528 6336 gene locus_tag LOCUS_01410 1528 6336 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072770864.1 protein_id gnl|my_center|LOCUS_01410 7573 6440 gene locus_tag LOCUS_01420 7573 6440 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_01420 7681 8205 gene locus_tag LOCUS_01430 7681 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 8290 10791 gene locus_tag LOCUS_01440 8290 10791 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765859.1 protein_id gnl|my_center|LOCUS_01440 10924 11760 gene locus_tag LOCUS_01450 10924 11760 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258363.1 protein_id gnl|my_center|LOCUS_01450 11818 13920 gene locus_tag LOCUS_01460 gene pta 11818 13920 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_01460 13917 15125 gene locus_tag LOCUS_01470 13917 15125 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940289.1 protein_id gnl|my_center|LOCUS_01470 15148 15888 gene locus_tag LOCUS_01480 15148 15888 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858053.1 protein_id gnl|my_center|LOCUS_01480 16885 15938 gene locus_tag LOCUS_01490 gene trxB 16885 15938 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_01490 17815 16946 gene locus_tag LOCUS_01500 17815 16946 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_01500 19897 17966 gene locus_tag LOCUS_01510 19897 17966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 20382 19897 gene locus_tag LOCUS_01520 20382 19897 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_01520 21238 20372 gene locus_tag LOCUS_01530 21238 20372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 21635 21276 gene locus_tag LOCUS_01540 21635 21276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 22249 21632 gene locus_tag LOCUS_01550 22249 21632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 24509 22380 gene locus_tag LOCUS_01560 gene pnp 24509 22380 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_01560 24871 24596 gene locus_tag LOCUS_01570 gene rpsO 24871 24596 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761978.1 protein_id gnl|my_center|LOCUS_01570 26857 24956 gene locus_tag LOCUS_01580 26857 24956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 27309 26914 gene locus_tag LOCUS_01590 27309 26914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 27835 27419 gene locus_tag LOCUS_01600 27835 27419 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 protein_id gnl|my_center|LOCUS_01600 28000 30879 gene locus_tag LOCUS_01610 28000 30879 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149111012.1 protein_id gnl|my_center|LOCUS_01610 30947 31576 gene locus_tag LOCUS_01620 30947 31576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784319.1 protein_id gnl|my_center|LOCUS_01620 31677 33437 gene locus_tag LOCUS_01630 31677 33437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 33465 34988 gene locus_tag LOCUS_01640 33465 34988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 36317 35031 gene locus_tag LOCUS_01650 36317 35031 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_01650 36382 37608 gene locus_tag LOCUS_01660 gene lhgO 36382 37608 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839995.1 protein_id gnl|my_center|LOCUS_01660 >Feature sequence006 678 2387 gene locus_tag LOCUS_01670 678 2387 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_01670 2391 3503 gene locus_tag LOCUS_01680 2391 3503 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016475.1 protein_id gnl|my_center|LOCUS_01680 4788 3508 gene locus_tag LOCUS_01690 4788 3508 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 protein_id gnl|my_center|LOCUS_01690 5941 5177 gene locus_tag LOCUS_01700 5941 5177 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_01700 7053 5959 gene locus_tag LOCUS_01710 7053 5959 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_01710 7170 8252 gene locus_tag LOCUS_01720 gene lpxK 7170 8252 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_01720 8281 10125 gene locus_tag LOCUS_01730 8281 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 10777 10130 gene locus_tag LOCUS_01740 10777 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 11993 10800 gene locus_tag LOCUS_01750 11993 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 12907 11990 gene locus_tag LOCUS_01760 12907 11990 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_01760 12977 13768 gene locus_tag LOCUS_01770 12977 13768 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_01770 14759 13725 gene locus_tag LOCUS_01780 14759 13725 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_01780 17736 15526 gene locus_tag LOCUS_01790 gene katG 17736 15526 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_01790 17900 18832 gene locus_tag LOCUS_01800 17900 18832 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_01800 20050 19475 gene locus_tag LOCUS_01810 20050 19475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 20213 20683 gene locus_tag LOCUS_01820 20213 20683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 20817 21431 gene locus_tag LOCUS_01830 20817 21431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 21480 22484 gene locus_tag LOCUS_01840 21480 22484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 22611 25133 gene locus_tag LOCUS_01850 gene gyrA 22611 25133 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_01850 25159 26313 gene locus_tag LOCUS_01860 25159 26313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 27556 26375 gene locus_tag LOCUS_01870 27556 26375 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_01870 28547 27732 gene locus_tag LOCUS_01880 28547 27732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 28702 28616 gene locus_tag LOCUS_t00010 28702 28616 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29584 28745 gene locus_tag LOCUS_01890 29584 28745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 29713 30729 gene locus_tag LOCUS_01900 gene holA 29713 30729 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_01900 30813 33794 gene locus_tag LOCUS_01910 30813 33794 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_01910 33820 35445 gene locus_tag LOCUS_01920 33820 35445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 35537 36472 gene locus_tag LOCUS_01930 35537 36472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 36484 37155 gene locus_tag LOCUS_01940 36484 37155 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_01940 37158 37553 gene locus_tag LOCUS_01950 37158 37553 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_01950 >Feature sequence007 472 2073 gene locus_tag LOCUS_01960 472 2073 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878019.1 protein_id gnl|my_center|LOCUS_01960 2268 3776 gene locus_tag LOCUS_01970 gene atpD 2268 3776 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_01970 3779 4030 gene locus_tag LOCUS_01980 3779 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 4369 4166 gene locus_tag LOCUS_01990 4369 4166 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_01990 5151 4528 gene locus_tag LOCUS_02000 5151 4528 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_02000 5355 6140 gene locus_tag LOCUS_02010 5355 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 6787 6149 gene locus_tag LOCUS_02020 6787 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 7815 6787 gene locus_tag LOCUS_02030 7815 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 8559 7837 gene locus_tag LOCUS_02040 8559 7837 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_02040 10140 8563 gene locus_tag LOCUS_02050 10140 8563 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963308.1 protein_id gnl|my_center|LOCUS_02050 10934 10206 gene locus_tag LOCUS_02060 10934 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 11041 11115 gene locus_tag LOCUS_t00020 11041 11115 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11924 11742 gene locus_tag LOCUS_02070 11924 11742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 13743 11953 gene locus_tag LOCUS_02080 13743 11953 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_02080 14933 13758 gene locus_tag LOCUS_02090 14933 13758 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_02090 17366 14964 gene locus_tag LOCUS_02100 17366 14964 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_02100 17851 17369 gene locus_tag LOCUS_02110 17851 17369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 18429 17944 gene locus_tag LOCUS_02120 18429 17944 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_02120 19466 18408 gene locus_tag LOCUS_02130 gene ribD 19466 18408 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964125.1 protein_id gnl|my_center|LOCUS_02130 20311 19610 gene locus_tag LOCUS_02140 20311 19610 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_02140 21687 20308 gene locus_tag LOCUS_02150 21687 20308 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_02150 22536 21736 gene locus_tag LOCUS_02160 22536 21736 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_02160 22649 22915 gene locus_tag LOCUS_02170 22649 22915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 25057 22964 gene locus_tag LOCUS_02180 gene recG 25057 22964 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_02180 25726 25139 gene locus_tag LOCUS_02190 25726 25139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 26225 25716 gene locus_tag LOCUS_02200 26225 25716 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921996.1 protein_id gnl|my_center|LOCUS_02200 27096 26215 gene locus_tag LOCUS_02210 27096 26215 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639946.1 protein_id gnl|my_center|LOCUS_02210 27829 27215 gene locus_tag LOCUS_02220 27829 27215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 29300 27894 gene locus_tag LOCUS_02230 gene fumC 29300 27894 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_02230 29975 29439 gene locus_tag LOCUS_02240 29975 29439 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_02240 30059 32659 gene locus_tag LOCUS_02250 gene mutS 30059 32659 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_02250 32743 33681 gene locus_tag LOCUS_02260 32743 33681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 33788 33861 gene locus_tag LOCUS_t00030 33788 33861 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 33899 33983 gene locus_tag LOCUS_t00040 33899 33983 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 1474 896 gene locus_tag LOCUS_02270 1474 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 2030 1503 gene locus_tag LOCUS_02280 gene yjjX 2030 1503 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261320.1 protein_id gnl|my_center|LOCUS_02280 2422 2165 gene locus_tag LOCUS_02290 2422 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 5039 2592 gene locus_tag LOCUS_02300 5039 2592 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 protein_id gnl|my_center|LOCUS_02300 5247 6584 gene locus_tag LOCUS_02310 5247 6584 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_02310 7634 6591 gene locus_tag LOCUS_02320 7634 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 8570 7638 gene locus_tag LOCUS_02330 8570 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 9015 10538 gene locus_tag LOCUS_02340 9015 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 10555 11382 gene locus_tag LOCUS_02350 gene mutM 10555 11382 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175950.1 protein_id gnl|my_center|LOCUS_02350 11530 11458 gene locus_tag LOCUS_t00050 11530 11458 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12759 11587 gene locus_tag LOCUS_02360 gene hflX 12759 11587 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202100.1 protein_id gnl|my_center|LOCUS_02360 12891 13994 gene locus_tag LOCUS_02370 12891 13994 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_02370 14062 14814 gene locus_tag LOCUS_02380 14062 14814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 14811 17147 gene locus_tag LOCUS_02390 14811 17147 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_02390 17163 17891 gene locus_tag LOCUS_02400 17163 17891 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_02400 17888 18865 gene locus_tag LOCUS_02410 17888 18865 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_02410 18918 20321 gene locus_tag LOCUS_02420 18918 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 20321 21085 gene locus_tag LOCUS_02430 20321 21085 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_02430 21095 22033 gene locus_tag LOCUS_02440 21095 22033 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_02440 22030 22776 gene locus_tag LOCUS_02450 22030 22776 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_02450 22809 24833 gene locus_tag LOCUS_02460 gene uvrB 22809 24833 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963054.1 protein_id gnl|my_center|LOCUS_02460 25532 24909 gene locus_tag LOCUS_02470 gene udk 25532 24909 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963257.1 protein_id gnl|my_center|LOCUS_02470 26110 25529 gene locus_tag LOCUS_02480 26110 25529 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_02480 26596 26111 gene locus_tag LOCUS_02490 26596 26111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 27600 26593 gene locus_tag LOCUS_02500 27600 26593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 28603 27584 gene locus_tag LOCUS_02510 28603 27584 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_02510 28789 29208 gene locus_tag LOCUS_02520 28789 29208 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_02520 30427 29675 gene locus_tag LOCUS_02530 30427 29675 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404513.1 protein_id gnl|my_center|LOCUS_02530 30548 32476 gene locus_tag LOCUS_02540 gene dxs 30548 32476 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_02540 32473 33246 gene locus_tag LOCUS_02550 32473 33246 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_02550 33381 34127 gene locus_tag LOCUS_02560 33381 34127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 34990 34175 gene locus_tag LOCUS_02570 gene mazG 34990 34175 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence009 2008 896 gene locus_tag LOCUS_02580 2008 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 2265 3506 gene locus_tag LOCUS_02590 2265 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 5184 4213 gene locus_tag LOCUS_02600 gene queG 5184 4213 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_02600 6222 5191 gene locus_tag LOCUS_02610 gene ruvB 6222 5191 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_02610 6295 7344 gene locus_tag LOCUS_02620 6295 7344 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_02620 7344 8075 gene locus_tag LOCUS_02630 7344 8075 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130094389.1 protein_id gnl|my_center|LOCUS_02630 8161 10056 gene locus_tag LOCUS_02640 gene acs 8161 10056 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_02640 10059 10256 gene locus_tag LOCUS_02650 10059 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 10352 13051 gene locus_tag LOCUS_02660 10352 13051 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_02660 13361 13044 gene locus_tag LOCUS_02670 13361 13044 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_02670 14469 13351 gene locus_tag LOCUS_02680 gene recF 14469 13351 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_02680 14563 15600 gene locus_tag LOCUS_02690 gene pdhA 14563 15600 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_02690 15654 16358 gene locus_tag LOCUS_02700 15654 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 16860 16381 gene locus_tag LOCUS_02710 16860 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 17386 16949 gene locus_tag LOCUS_02720 17386 16949 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_02720 20899 18161 gene locus_tag LOCUS_02730 gene ppdK 20899 18161 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_02730 21550 21179 gene locus_tag LOCUS_02740 21550 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 22016 21543 gene locus_tag LOCUS_02750 22016 21543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 22731 21985 gene locus_tag LOCUS_02760 22731 21985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 27522 22882 gene locus_tag LOCUS_02770 27522 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 28341 27820 gene locus_tag LOCUS_02780 28341 27820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 29151 28825 gene locus_tag LOCUS_02790 29151 28825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 29473 29126 gene locus_tag LOCUS_02800 29473 29126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 30900 29485 gene locus_tag LOCUS_02810 30900 29485 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_02810 32400 30904 gene locus_tag LOCUS_02820 32400 30904 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence010 <1 899 gene locus_tag LOCUS_02830 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963479.1:replication-associated recombination protein A 1199 2317 gene locus_tag LOCUS_02840 1199 2317 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203483.1 protein_id gnl|my_center|LOCUS_02840 2617 2417 gene locus_tag LOCUS_02850 2617 2417 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_02850 2949 2620 gene locus_tag LOCUS_02860 2949 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 4175 3168 gene locus_tag LOCUS_02870 gene galE 4175 3168 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_02870 5167 4172 gene locus_tag LOCUS_02880 5167 4172 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_02880 6476 5157 gene locus_tag LOCUS_02890 6476 5157 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103020726.1 protein_id gnl|my_center|LOCUS_02890 6648 7781 gene locus_tag LOCUS_02900 6648 7781 CDS product Acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245999.1 protein_id gnl|my_center|LOCUS_02900 7853 8047 gene locus_tag LOCUS_02910 gene rpsU 7853 8047 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933577.1 protein_id gnl|my_center|LOCUS_02910 8198 9073 gene locus_tag LOCUS_02920 gene xerC 8198 9073 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_02920 9102 9398 gene locus_tag LOCUS_02930 9102 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 10749 9496 gene locus_tag LOCUS_02940 gene metK 10749 9496 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_02940 11555 10842 gene locus_tag LOCUS_02950 11555 10842 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_02950 12316 11552 gene locus_tag LOCUS_02960 12316 11552 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_02960 13026 12313 gene locus_tag LOCUS_02970 13026 12313 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_02970 13089 13544 gene locus_tag LOCUS_02980 13089 13544 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_02980 13541 14071 gene locus_tag LOCUS_02990 13541 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 14111 14875 gene locus_tag LOCUS_03000 14111 14875 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_03000 14872 15537 gene locus_tag LOCUS_03010 14872 15537 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839781.1 protein_id gnl|my_center|LOCUS_03010 15540 16415 gene locus_tag LOCUS_03020 15540 16415 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_03020 16475 17575 gene locus_tag LOCUS_03030 16475 17575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 17586 18299 gene locus_tag LOCUS_03040 17586 18299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 18356 19105 gene locus_tag LOCUS_03050 18356 19105 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_03050 19109 21739 gene locus_tag LOCUS_03060 19109 21739 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_03060 21805 22308 gene locus_tag LOCUS_03070 21805 22308 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_03070 22361 22900 gene locus_tag LOCUS_03080 22361 22900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 22973 23875 gene locus_tag LOCUS_03090 22973 23875 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791345.1 protein_id gnl|my_center|LOCUS_03090 25053 23872 gene locus_tag LOCUS_03100 25053 23872 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_03100 25821 25141 gene locus_tag LOCUS_03110 25821 25141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 28071 25825 gene locus_tag LOCUS_03120 28071 25825 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_03120 28648 28064 gene locus_tag LOCUS_03130 28648 28064 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963208.1 protein_id gnl|my_center|LOCUS_03130 28759 29766 gene locus_tag LOCUS_03140 28759 29766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 29922 30923 gene locus_tag LOCUS_03150 29922 30923 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041807480.1 protein_id gnl|my_center|LOCUS_03150 31095 31820 gene locus_tag LOCUS_03160 31095 31820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 >Feature sequence011 2175 328 gene locus_tag LOCUS_03170 2175 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2977 2189 gene locus_tag LOCUS_03180 2977 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 4087 3023 gene locus_tag LOCUS_03190 gene ddlA 4087 3023 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053170.1 protein_id gnl|my_center|LOCUS_03190 7137 4150 gene locus_tag LOCUS_03200 7137 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 8348 7233 gene locus_tag LOCUS_03210 8348 7233 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_03210 8520 10463 gene locus_tag LOCUS_03220 gene dnaG 8520 10463 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_03220 10538 11755 gene locus_tag LOCUS_03230 10538 11755 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_03230 11752 12354 gene locus_tag LOCUS_03240 11752 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 12360 13130 gene locus_tag LOCUS_03250 gene surE 12360 13130 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_03250 14080 13433 gene locus_tag LOCUS_03260 14080 13433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 14374 14210 gene locus_tag LOCUS_03270 14374 14210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 14575 17601 gene locus_tag LOCUS_03280 14575 17601 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_03280 17620 19023 gene locus_tag LOCUS_03290 17620 19023 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_03290 19730 19059 gene locus_tag LOCUS_03300 19730 19059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 20175 19702 gene locus_tag LOCUS_03310 20175 19702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 22731 20227 gene locus_tag LOCUS_03320 gene priA 22731 20227 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108457.1 protein_id gnl|my_center|LOCUS_03320 23769 22786 gene locus_tag LOCUS_03330 23769 22786 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_03330 25346 23832 gene locus_tag LOCUS_03340 25346 23832 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_03340 26035 25592 gene locus_tag LOCUS_03350 gene rplI 26035 25592 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_03350 26294 26043 gene locus_tag LOCUS_03360 gene rpsR 26294 26043 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_03360 26659 26291 gene locus_tag LOCUS_03370 gene rpsF 26659 26291 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_03370 30656 26733 gene locus_tag LOCUS_03380 30656 26733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence012 <1 1763 gene locus_tag LOCUS_03390 <1 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037676.1:NAD(P)-binding domain-containing protein 1763 2461 gene locus_tag LOCUS_03400 1763 2461 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_03400 2464 3945 gene locus_tag LOCUS_03410 2464 3945 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_03410 3971 5260 gene locus_tag LOCUS_03420 3971 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 7221 5221 gene locus_tag LOCUS_03430 7221 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7538 8110 gene locus_tag LOCUS_03440 7538 8110 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_03440 8152 8778 gene locus_tag LOCUS_03450 8152 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 8768 9232 gene locus_tag LOCUS_03460 8768 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 9390 9941 gene locus_tag LOCUS_03470 9390 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 10087 10160 gene locus_tag LOCUS_t00060 10087 10160 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10217 11146 gene locus_tag LOCUS_03480 10217 11146 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_03480 11186 11833 gene locus_tag LOCUS_03490 11186 11833 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962325.1 protein_id gnl|my_center|LOCUS_03490 11921 12481 gene locus_tag LOCUS_03500 gene pth 11921 12481 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_03500 13677 12478 gene locus_tag LOCUS_03510 13677 12478 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788673.1 protein_id gnl|my_center|LOCUS_03510 15568 13685 gene locus_tag LOCUS_03520 15568 13685 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763354.1 protein_id gnl|my_center|LOCUS_03520 15843 15583 gene locus_tag LOCUS_03530 15843 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 17931 15880 gene locus_tag LOCUS_03540 gene metG 17931 15880 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_03540 18082 18642 gene locus_tag LOCUS_03550 18082 18642 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_03550 18654 19637 gene locus_tag LOCUS_03560 18654 19637 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203440.1 protein_id gnl|my_center|LOCUS_03560 19641 22247 gene locus_tag LOCUS_03570 19641 22247 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_03570 22251 23063 gene locus_tag LOCUS_03580 22251 23063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 23217 24341 gene locus_tag LOCUS_03590 23217 24341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 24463 25548 gene locus_tag LOCUS_03600 24463 25548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 25627 27423 gene locus_tag LOCUS_03610 gene typA 25627 27423 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_03610 27436 27975 gene locus_tag LOCUS_03620 27436 27975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 28383 27976 gene locus_tag LOCUS_03630 28383 27976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 28595 29758 gene locus_tag LOCUS_03640 gene dinB 28595 29758 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_03640 >Feature sequence013 635 351 gene locus_tag LOCUS_03650 635 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 697 3078 gene locus_tag LOCUS_03660 697 3078 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_03660 3173 3559 gene locus_tag LOCUS_03670 3173 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 4262 3594 gene locus_tag LOCUS_03680 4262 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 5424 4288 gene locus_tag LOCUS_03690 5424 4288 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_03690 6178 5426 gene locus_tag LOCUS_03700 6178 5426 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_03700 7151 6885 gene locus_tag LOCUS_03710 7151 6885 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588503.1 protein_id gnl|my_center|LOCUS_03710 7393 7151 gene locus_tag LOCUS_03720 7393 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 7551 10196 gene locus_tag LOCUS_03730 7551 10196 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_03730 10536 11798 gene locus_tag LOCUS_03740 10536 11798 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_03740 11834 14965 gene locus_tag LOCUS_03750 11834 14965 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_03750 14981 16348 gene locus_tag LOCUS_03760 gene nrfD 14981 16348 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_03760 16352 16873 gene locus_tag LOCUS_03770 16352 16873 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_03770 16893 17510 gene locus_tag LOCUS_03780 16893 17510 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_03780 17528 18853 gene locus_tag LOCUS_03790 17528 18853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 18875 19942 gene locus_tag LOCUS_03800 18875 19942 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_03800 19974 21887 gene locus_tag LOCUS_03810 19974 21887 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_03810 21898 22809 gene locus_tag LOCUS_03820 gene cyoE 21898 22809 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_03820 22816 23397 gene locus_tag LOCUS_03830 22816 23397 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_03830 23407 24072 gene locus_tag LOCUS_03840 23407 24072 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394318.1 protein_id gnl|my_center|LOCUS_03840 24091 24423 gene locus_tag LOCUS_03850 24091 24423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 24473 25027 gene locus_tag LOCUS_03860 24473 25027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 25031 25588 gene locus_tag LOCUS_03870 25031 25588 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_03870 25602 25847 gene locus_tag LOCUS_03880 25602 25847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence014 <1 966 gene locus_tag LOCUS_03890 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144042.1:amidase family protein 963 2111 gene locus_tag LOCUS_03900 963 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3122 2478 gene locus_tag LOCUS_03910 3122 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 3275 4270 gene locus_tag LOCUS_03920 3275 4270 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_03920 4263 5468 gene locus_tag LOCUS_03930 4263 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_03930 6028 5465 gene locus_tag LOCUS_03940 gene scpB 6028 5465 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932165.1 protein_id gnl|my_center|LOCUS_03940 6424 6029 gene locus_tag LOCUS_03950 6424 6029 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_03950 7376 6543 gene locus_tag LOCUS_03960 7376 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 8319 7351 gene locus_tag LOCUS_03970 8319 7351 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404368.1 protein_id gnl|my_center|LOCUS_03970 9416 8409 gene locus_tag LOCUS_03980 9416 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640628.1 protein_id gnl|my_center|LOCUS_03980 10459 9485 gene locus_tag LOCUS_03990 10459 9485 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_03990 10544 11059 gene locus_tag LOCUS_04000 10544 11059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 11436 12200 gene locus_tag LOCUS_04010 gene tpiA 11436 12200 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_04010 12197 12526 gene locus_tag LOCUS_04020 12197 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 12526 13365 gene locus_tag LOCUS_04030 gene prmA 12526 13365 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_04030 14327 13362 gene locus_tag LOCUS_04040 14327 13362 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779459.1 protein_id gnl|my_center|LOCUS_04040 15077 14349 gene locus_tag LOCUS_04050 15077 14349 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_04050 15147 15572 gene locus_tag LOCUS_04060 15147 15572 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140128.1 protein_id gnl|my_center|LOCUS_04060 15627 17099 gene locus_tag LOCUS_04070 gene cls 15627 17099 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435010.1 protein_id gnl|my_center|LOCUS_04070 17148 18338 gene locus_tag LOCUS_04080 17148 18338 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_04080 18341 19474 gene locus_tag LOCUS_04090 18341 19474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014770990.1 protein_id gnl|my_center|LOCUS_04090 19471 20076 gene locus_tag LOCUS_04100 19471 20076 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933473.1 protein_id gnl|my_center|LOCUS_04100 20084 20914 gene locus_tag LOCUS_04110 20084 20914 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_04110 20911 21813 gene locus_tag LOCUS_04120 gene rfbD 20911 21813 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_04120 21897 23294 gene locus_tag LOCUS_04130 21897 23294 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838467.1 protein_id gnl|my_center|LOCUS_04130 23558 23911 gene locus_tag LOCUS_04140 gene rplS 23558 23911 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_04140 23999 24838 gene locus_tag LOCUS_04150 gene accD 23999 24838 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence015 1246 953 gene locus_tag LOCUS_04160 1246 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 1391 1984 gene locus_tag LOCUS_04170 1391 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 1981 3237 gene locus_tag LOCUS_04180 1981 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3215 4135 gene locus_tag LOCUS_04190 3215 4135 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_04190 4132 5037 gene locus_tag LOCUS_04200 4132 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 5030 5764 gene locus_tag LOCUS_04210 5030 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 5771 6871 gene locus_tag LOCUS_04220 5771 6871 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_04220 6868 7983 gene locus_tag LOCUS_04230 6868 7983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_04230 8059 8706 gene locus_tag LOCUS_04240 8059 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 8707 9270 gene locus_tag LOCUS_04250 8707 9270 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_04250 9933 11039 gene locus_tag LOCUS_04260 9933 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 11119 12678 gene locus_tag LOCUS_04270 11119 12678 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_04270 12681 13838 gene locus_tag LOCUS_04280 gene galK 12681 13838 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_04280 14736 13843 gene locus_tag LOCUS_04290 14736 13843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 15088 15402 gene locus_tag LOCUS_04300 15088 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 15428 15667 gene locus_tag LOCUS_04310 gene tusA 15428 15667 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_04310 15679 16191 gene locus_tag LOCUS_04320 15679 16191 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_04320 16212 17306 gene locus_tag LOCUS_04330 16212 17306 CDS product lipoate protein ligase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881270.1 protein_id gnl|my_center|LOCUS_04330 17278 17526 gene locus_tag LOCUS_04340 17278 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 17604 17984 gene locus_tag LOCUS_04350 17604 17984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 18018 18485 gene locus_tag LOCUS_04360 18018 18485 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 protein_id gnl|my_center|LOCUS_04360 18547 19257 gene locus_tag LOCUS_04370 18547 19257 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880210.1 protein_id gnl|my_center|LOCUS_04370 19277 20464 gene locus_tag LOCUS_04380 19277 20464 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_04380 20495 21553 gene locus_tag LOCUS_04390 20495 21553 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_04390 21564 22304 gene locus_tag LOCUS_04400 21564 22304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880214.1 protein_id gnl|my_center|LOCUS_04400 22346 23605 gene locus_tag LOCUS_04410 22346 23605 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_04410 23646 24014 gene locus_tag LOCUS_04420 23646 24014 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_04420 24041 24487 gene locus_tag LOCUS_04430 24041 24487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 24472 25434 gene locus_tag LOCUS_04440 24472 25434 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880219.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence016 653 468 gene locus_tag LOCUS_04450 653 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 1884 1150 gene locus_tag LOCUS_04460 1884 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 2513 1881 gene locus_tag LOCUS_04470 2513 1881 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759988.1 protein_id gnl|my_center|LOCUS_04470 2883 2707 gene locus_tag LOCUS_04480 2883 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3722 3120 gene locus_tag LOCUS_04490 3722 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4321 3773 gene locus_tag LOCUS_04500 4321 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5322 4660 gene locus_tag LOCUS_04510 5322 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 6166 5549 gene locus_tag LOCUS_04520 6166 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 7346 6174 gene locus_tag LOCUS_04530 7346 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 7713 7519 gene locus_tag LOCUS_04540 7713 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 8409 8095 gene locus_tag LOCUS_04550 8409 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 8633 8391 gene locus_tag LOCUS_04560 8633 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 9820 9044 gene locus_tag LOCUS_04570 9820 9044 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_04570 9941 10975 gene locus_tag LOCUS_04580 9941 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 11148 12419 gene locus_tag LOCUS_04590 11148 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 12518 13735 gene locus_tag LOCUS_04600 12518 13735 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140498.1 protein_id gnl|my_center|LOCUS_04600 13740 15062 gene locus_tag LOCUS_04610 13740 15062 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_04610 15165 16595 gene locus_tag LOCUS_04620 15165 16595 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071114.1 protein_id gnl|my_center|LOCUS_04620 16592 17968 gene locus_tag LOCUS_04630 16592 17968 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339253.1 protein_id gnl|my_center|LOCUS_04630 17961 19436 gene locus_tag LOCUS_04640 17961 19436 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_04640 19501 20778 gene locus_tag LOCUS_04650 19501 20778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 20775 22133 gene locus_tag LOCUS_04660 20775 22133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 22797 22189 gene locus_tag LOCUS_04670 22797 22189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 24007 22802 gene locus_tag LOCUS_04680 24007 22802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 <26015 24007 gene locus_tag LOCUS_04690 <26015 24007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001044441.1:M23 family metallopeptidase >Feature sequence017 1788 442 gene locus_tag LOCUS_04700 1788 442 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_04700 2285 1833 gene locus_tag LOCUS_04710 gene ssb 2285 1833 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_04710 3369 2287 gene locus_tag LOCUS_04720 gene mutY 3369 2287 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_04720 3505 3798 gene locus_tag LOCUS_04730 3505 3798 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_04730 4313 5719 gene locus_tag LOCUS_04740 4313 5719 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_04740 5730 6749 gene locus_tag LOCUS_04750 gene gldB 5730 6749 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_04750 7492 6836 gene locus_tag LOCUS_04760 7492 6836 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963735.1 protein_id gnl|my_center|LOCUS_04760 8320 7559 gene locus_tag LOCUS_04770 8320 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 9127 8435 gene locus_tag LOCUS_04780 9127 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 9264 10733 gene locus_tag LOCUS_04790 gene guaB 9264 10733 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_04790 10797 12833 gene locus_tag LOCUS_04800 10797 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 12836 13174 gene locus_tag LOCUS_04810 gene rsbV 12836 13174 CDS product anti sigma b factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721460.1 protein_id gnl|my_center|LOCUS_04810 13171 13590 gene locus_tag LOCUS_04820 13171 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 13675 15633 gene locus_tag LOCUS_04830 13675 15633 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_04830 15662 16498 gene locus_tag LOCUS_04840 15662 16498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 16455 17834 gene locus_tag LOCUS_04850 16455 17834 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963305.1 protein_id gnl|my_center|LOCUS_04850 17845 18810 gene locus_tag LOCUS_04860 17845 18810 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_04860 19473 18814 gene locus_tag LOCUS_04870 19473 18814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 20436 19570 gene locus_tag LOCUS_04880 20436 19570 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107576.1 protein_id gnl|my_center|LOCUS_04880 20967 20443 gene locus_tag LOCUS_04890 20967 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 21225 22061 gene locus_tag LOCUS_04900 21225 22061 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_04900 22110 22988 gene locus_tag LOCUS_04910 22110 22988 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_04910 24538 23297 gene locus_tag LOCUS_04920 24538 23297 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence018 1317 217 gene locus_tag LOCUS_04930 1317 217 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130602656.1 protein_id gnl|my_center|LOCUS_04930 2736 1384 gene locus_tag LOCUS_04940 gene gdhA 2736 1384 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_04940 5559 2749 gene locus_tag LOCUS_04950 gene uvrA 5559 2749 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_04950 5788 6396 gene locus_tag LOCUS_04960 5788 6396 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_04960 6371 6580 gene locus_tag LOCUS_04970 6371 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 6602 7270 gene locus_tag LOCUS_04980 gene nth 6602 7270 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_04980 7274 9031 gene locus_tag LOCUS_04990 gene asnB 7274 9031 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_04990 9028 10200 gene locus_tag LOCUS_05000 9028 10200 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_05000 10321 11487 gene locus_tag LOCUS_05010 10321 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 11484 12602 gene locus_tag LOCUS_05020 11484 12602 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050765261.1 protein_id gnl|my_center|LOCUS_05020 12590 14482 gene locus_tag LOCUS_05030 gene asnB 12590 14482 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027075.1 protein_id gnl|my_center|LOCUS_05030 14550 16685 gene locus_tag LOCUS_05040 14550 16685 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_05040 16682 17986 gene locus_tag LOCUS_05050 16682 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 17979 19154 gene locus_tag LOCUS_05060 gene vpsj 17979 19154 CDS product exopolysaccharide biosynthesis protein VpsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843487.1 protein_id gnl|my_center|LOCUS_05060 19135 19905 gene locus_tag LOCUS_05070 gene vpsK 19135 19905 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_05070 20042 21424 gene locus_tag LOCUS_05080 20042 21424 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_05080 21414 22526 gene locus_tag LOCUS_05090 21414 22526 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_05090 22579 23598 gene locus_tag LOCUS_05100 gene pheS 22579 23598 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_05100 23601 24455 gene locus_tag LOCUS_05110 23601 24455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 24448 24864 gene locus_tag LOCUS_05120 24448 24864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 <25678 24947 gene locus_tag LOCUS_05130 <25678 24947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964148.1:sigma-70 family RNA polymerase sigma factor >Feature sequence019 587 270 gene locus_tag LOCUS_05140 gene nuoK 587 270 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775579.1 protein_id gnl|my_center|LOCUS_05140 1092 580 gene locus_tag LOCUS_05150 1092 580 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764300.1 protein_id gnl|my_center|LOCUS_05150 1583 1095 gene locus_tag LOCUS_05160 1583 1095 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109090.1 protein_id gnl|my_center|LOCUS_05160 2687 1596 gene locus_tag LOCUS_05170 gene nuoH 2687 1596 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_05170 3823 2690 gene locus_tag LOCUS_05180 3823 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05180 4284 3823 gene locus_tag LOCUS_05190 4284 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 4856 4281 gene locus_tag LOCUS_05200 4856 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5197 4847 gene locus_tag LOCUS_05210 5197 4847 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760952.1 protein_id gnl|my_center|LOCUS_05210 6221 5202 gene locus_tag LOCUS_05220 6221 5202 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791975.1 protein_id gnl|my_center|LOCUS_05220 8061 6223 gene locus_tag LOCUS_05230 8061 6223 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_05230 8523 10523 gene locus_tag LOCUS_05240 8523 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 11720 10533 gene locus_tag LOCUS_05250 11720 10533 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_05250 13821 11785 gene locus_tag LOCUS_05260 13821 11785 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_05260 14239 13814 gene locus_tag LOCUS_05270 14239 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_05270 14438 15139 gene locus_tag LOCUS_05280 14438 15139 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_05280 15149 16615 gene locus_tag LOCUS_05290 15149 16615 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_05290 16715 18013 gene locus_tag LOCUS_05300 16715 18013 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405198.1 protein_id gnl|my_center|LOCUS_05300 19636 18869 gene locus_tag LOCUS_05310 19636 18869 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_05310 21060 19729 gene locus_tag LOCUS_05320 21060 19729 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_05320 21146 21219 gene locus_tag LOCUS_t00070 21146 21219 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 21846 21589 gene locus_tag LOCUS_05330 21846 21589 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_05330 22046 21846 gene locus_tag LOCUS_05340 22046 21846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 22849 22154 gene locus_tag LOCUS_05350 gene deoD 22849 22154 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110707.1 protein_id gnl|my_center|LOCUS_05350 >Feature sequence020 <1 1215 gene locus_tag LOCUS_05360 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963312.1:DNA-directed RNA polymerase subunit beta 1249 5556 gene locus_tag LOCUS_05370 gene rpoC 1249 5556 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_05370 5559 5882 gene locus_tag LOCUS_05380 5559 5882 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_05380 6080 6454 gene locus_tag LOCUS_05390 gene rpsL 6080 6454 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963473.1 protein_id gnl|my_center|LOCUS_05390 6478 6945 gene locus_tag LOCUS_05400 gene rpsG 6478 6945 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_05400 6948 9074 gene locus_tag LOCUS_05410 gene fusA 6948 9074 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963471.1 protein_id gnl|my_center|LOCUS_05410 9085 9390 gene locus_tag LOCUS_05420 gene rpsJ 9085 9390 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_05420 9599 10201 gene locus_tag LOCUS_05430 gene rplC 9599 10201 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_05430 10206 10838 gene locus_tag LOCUS_05440 gene rplD 10206 10838 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963468.1 protein_id gnl|my_center|LOCUS_05440 10835 11122 gene locus_tag LOCUS_05450 gene rplW 10835 11122 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_05450 11137 11961 gene locus_tag LOCUS_05460 gene rplB 11137 11961 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_05460 11961 12239 gene locus_tag LOCUS_05470 gene rpsS 11961 12239 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_05470 12242 12628 gene locus_tag LOCUS_05480 gene rplV 12242 12628 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_05480 12631 13341 gene locus_tag LOCUS_05490 gene rpsC 12631 13341 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963464.1 protein_id gnl|my_center|LOCUS_05490 13384 13806 gene locus_tag LOCUS_05500 gene rplP 13384 13806 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 protein_id gnl|my_center|LOCUS_05500 13809 14012 gene locus_tag LOCUS_05510 gene rpmC 13809 14012 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963462.1 protein_id gnl|my_center|LOCUS_05510 14012 14266 gene locus_tag LOCUS_05520 gene rpsQ 14012 14266 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_05520 14269 14637 gene locus_tag LOCUS_05530 gene rplN 14269 14637 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_05530 14640 14978 gene locus_tag LOCUS_05540 gene rplX 14640 14978 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 protein_id gnl|my_center|LOCUS_05540 14982 15530 gene locus_tag LOCUS_05550 gene rplE 14982 15530 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_05550 15540 15809 gene locus_tag LOCUS_05560 gene rpsN 15540 15809 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_05560 15911 16309 gene locus_tag LOCUS_05570 gene rpsH 15911 16309 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_05570 16322 16873 gene locus_tag LOCUS_05580 gene rplF 16322 16873 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_05580 16886 17233 gene locus_tag LOCUS_05590 gene rplR 16886 17233 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_05590 17240 17761 gene locus_tag LOCUS_05600 gene rpsE 17240 17761 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963453.1 protein_id gnl|my_center|LOCUS_05600 17767 17946 gene locus_tag LOCUS_05610 gene rpmD 17767 17946 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085234.1 protein_id gnl|my_center|LOCUS_05610 17946 18398 gene locus_tag LOCUS_05620 gene rplO 17946 18398 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_05620 18400 19722 gene locus_tag LOCUS_05630 gene secY 18400 19722 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_05630 19731 20504 gene locus_tag LOCUS_05640 gene map 19731 20504 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_05640 20506 20724 gene locus_tag LOCUS_05650 gene infA 20506 20724 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_05650 20846 21220 gene locus_tag LOCUS_05660 gene rpsM 20846 21220 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_05660 21237 21629 gene locus_tag LOCUS_05670 gene rpsK 21237 21629 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_05670 21819 22271 gene locus_tag LOCUS_05680 21819 22271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 22322 23311 gene locus_tag LOCUS_05690 22322 23311 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_05690 23318 24022 gene locus_tag LOCUS_05700 23318 24022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 24107 25207 gene locus_tag LOCUS_05710 gene carA 24107 25207 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence021 474 154 gene locus_tag LOCUS_05720 474 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1994 738 gene locus_tag LOCUS_05730 1994 738 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_05730 2308 2562 gene locus_tag LOCUS_05740 2308 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2841 4889 gene locus_tag LOCUS_05750 2841 4889 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_05750 5559 6182 gene locus_tag LOCUS_05760 5559 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 6189 7217 gene locus_tag LOCUS_05770 6189 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7252 8475 gene locus_tag LOCUS_05780 gene nrfD 7252 8475 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_05780 9944 8637 gene locus_tag LOCUS_05790 gene serS 9944 8637 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_05790 10162 10383 gene locus_tag LOCUS_05800 10162 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 11657 10593 gene locus_tag LOCUS_05810 11657 10593 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109381.1 protein_id gnl|my_center|LOCUS_05810 14296 11699 gene locus_tag LOCUS_05820 14296 11699 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_05820 14749 16125 gene locus_tag LOCUS_05830 14749 16125 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_05830 16174 18201 gene locus_tag LOCUS_05840 16174 18201 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693189.1 protein_id gnl|my_center|LOCUS_05840 18253 19467 gene locus_tag LOCUS_05850 18253 19467 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940107.1 protein_id gnl|my_center|LOCUS_05850 19460 19882 gene locus_tag LOCUS_05860 19460 19882 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280500.1 protein_id gnl|my_center|LOCUS_05860 21061 19868 gene locus_tag LOCUS_05870 gene dcm 21061 19868 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203404.1 protein_id gnl|my_center|LOCUS_05870 21213 23798 gene locus_tag LOCUS_05880 21213 23798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 >Feature sequence022 1054 89 gene locus_tag LOCUS_05890 1054 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1498 2283 gene locus_tag LOCUS_05900 1498 2283 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_05900 2303 3787 gene locus_tag LOCUS_05910 2303 3787 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_05910 3794 4237 gene locus_tag LOCUS_05920 gene dut 3794 4237 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_05920 4285 6054 gene locus_tag LOCUS_05930 4285 6054 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_05930 6029 6799 gene locus_tag LOCUS_05940 6029 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 6810 7988 gene locus_tag LOCUS_05950 6810 7988 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129254226.1 protein_id gnl|my_center|LOCUS_05950 8061 8264 gene locus_tag LOCUS_05960 8061 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 8591 9859 gene locus_tag LOCUS_05970 8591 9859 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_05970 10046 11011 gene locus_tag LOCUS_05980 10046 11011 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_05980 11077 13386 gene locus_tag LOCUS_05990 11077 13386 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766293.1 protein_id gnl|my_center|LOCUS_05990 13383 13976 gene locus_tag LOCUS_06000 gene ruvA 13383 13976 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_06000 14067 21155 gene locus_tag LOCUS_06010 gene sprA 14067 21155 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100614127.1 protein_id gnl|my_center|LOCUS_06010 21259 21636 gene locus_tag LOCUS_06020 gene gcvH 21259 21636 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_06020 21626 22024 gene locus_tag LOCUS_06030 21626 22024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 22102 22761 gene locus_tag LOCUS_06040 22102 22761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 22952 23629 gene locus_tag LOCUS_06050 22952 23629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 >Feature sequence023 <1 767 gene locus_tag LOCUS_06060 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962403.1:DUF3108 domain-containing protein 797 1534 gene locus_tag LOCUS_06070 797 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1578 2141 gene locus_tag LOCUS_06080 1578 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 2314 5574 gene locus_tag LOCUS_06090 2314 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5564 6433 gene locus_tag LOCUS_06100 5564 6433 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_06100 7568 6456 gene locus_tag LOCUS_06110 7568 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 8674 7568 gene locus_tag LOCUS_06120 gene dprA 8674 7568 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_06120 9022 8678 gene locus_tag LOCUS_06130 9022 8678 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_06130 10144 9158 gene locus_tag LOCUS_06140 10144 9158 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_06140 11182 10199 gene locus_tag LOCUS_06150 11182 10199 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_06150 11272 13935 gene locus_tag LOCUS_06160 gene alaS 11272 13935 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109057.1 protein_id gnl|my_center|LOCUS_06160 14129 15202 gene locus_tag LOCUS_06170 14129 15202 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_06170 16927 15851 gene locus_tag LOCUS_06180 16927 15851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 17563 16949 gene locus_tag LOCUS_06190 17563 16949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 17951 19507 gene locus_tag LOCUS_06200 gene dnaB 17951 19507 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_06200 19539 20411 gene locus_tag LOCUS_06210 19539 20411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 20505 21890 gene locus_tag LOCUS_06220 20505 21890 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_06220 21887 22606 gene locus_tag LOCUS_06230 gene ric 21887 22606 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_06230 22651 23643 gene locus_tag LOCUS_06240 22651 23643 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399251.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence024 <1 552 gene locus_tag LOCUS_06250 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962398.1:excinuclease ABC subunit UvrC 1543 593 gene locus_tag LOCUS_06260 1543 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3121 1553 gene locus_tag LOCUS_06270 3121 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 4059 3208 gene locus_tag LOCUS_06280 4059 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 5227 4145 gene locus_tag LOCUS_06290 5227 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 6348 5392 gene locus_tag LOCUS_06300 6348 5392 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_06300 7240 6458 gene locus_tag LOCUS_06310 7240 6458 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_06310 8355 7261 gene locus_tag LOCUS_06320 8355 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10051 8339 gene locus_tag LOCUS_06330 10051 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 10032 11201 gene locus_tag LOCUS_06340 gene hemW 10032 11201 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763952.1 protein_id gnl|my_center|LOCUS_06340 11198 11947 gene locus_tag LOCUS_06350 11198 11947 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_06350 12114 12455 gene locus_tag LOCUS_06360 12114 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 13578 12865 gene locus_tag LOCUS_06370 13578 12865 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_06370 14622 13582 gene locus_tag LOCUS_06380 14622 13582 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_06380 14943 14683 gene locus_tag LOCUS_06390 14943 14683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 17837 14982 gene locus_tag LOCUS_06400 gene uvrA 17837 14982 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813763.1 protein_id gnl|my_center|LOCUS_06400 19040 18048 gene locus_tag LOCUS_06410 19040 18048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 19561 19067 gene locus_tag LOCUS_06420 gene purE 19561 19067 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_06420 20697 19558 gene locus_tag LOCUS_06430 20697 19558 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_06430 22198 20690 gene locus_tag LOCUS_06440 22198 20690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 22247 22618 gene locus_tag LOCUS_06450 gene rbfA 22247 22618 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence025 446 3001 gene locus_tag LOCUS_06460 446 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 3220 3519 gene locus_tag LOCUS_06470 3220 3519 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_06470 3524 3838 gene locus_tag LOCUS_06480 3524 3838 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_06480 4577 3888 gene locus_tag LOCUS_06490 4577 3888 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_06490 4622 4984 gene locus_tag LOCUS_06500 4622 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 4991 5752 gene locus_tag LOCUS_06510 4991 5752 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_06510 5781 6299 gene locus_tag LOCUS_06520 5781 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 7382 6330 gene locus_tag LOCUS_06530 7382 6330 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_06530 10039 7616 gene locus_tag LOCUS_06540 10039 7616 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_06540 11149 10172 gene locus_tag LOCUS_06550 11149 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962863.1 protein_id gnl|my_center|LOCUS_06550 11354 11719 gene locus_tag LOCUS_06560 11354 11719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 11728 12288 gene locus_tag LOCUS_06570 11728 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 12702 12313 gene locus_tag LOCUS_06580 12702 12313 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_06580 13308 12733 gene locus_tag LOCUS_06590 13308 12733 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_06590 13637 13329 gene locus_tag LOCUS_06600 13637 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 15415 13637 gene locus_tag LOCUS_06610 15415 13637 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_06610 18305 15435 gene locus_tag LOCUS_06620 18305 15435 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_06620 19982 18366 gene locus_tag LOCUS_06630 gene nrfD 19982 18366 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_06630 20286 21599 gene locus_tag LOCUS_06640 20286 21599 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051113354.1 protein_id gnl|my_center|LOCUS_06640 21592 22572 gene locus_tag LOCUS_06650 21592 22572 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963375.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence026 4094 699 gene locus_tag LOCUS_06660 4094 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5025 4180 gene locus_tag LOCUS_06670 5025 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 5682 5032 gene locus_tag LOCUS_06680 5682 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 7155 5758 gene locus_tag LOCUS_06690 7155 5758 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_06690 10172 7167 gene locus_tag LOCUS_06700 10172 7167 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_06700 12216 10336 gene locus_tag LOCUS_06710 12216 10336 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_06710 12851 12246 gene locus_tag LOCUS_06720 12851 12246 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_06720 13745 12867 gene locus_tag LOCUS_06730 13745 12867 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963593.1 protein_id gnl|my_center|LOCUS_06730 15580 13790 gene locus_tag LOCUS_06740 gene lepA 15580 13790 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788089.1 protein_id gnl|my_center|LOCUS_06740 16308 15652 gene locus_tag LOCUS_06750 16308 15652 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_06750 16467 16859 gene locus_tag LOCUS_06760 gene rsfS 16467 16859 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_06760 16886 19015 gene locus_tag LOCUS_06770 gene ftsH 16886 19015 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_06770 19036 19827 gene locus_tag LOCUS_06780 19036 19827 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_06780 19778 20611 gene locus_tag LOCUS_06790 19778 20611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 20839 21048 gene locus_tag LOCUS_06800 20839 21048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 <22653 21052 gene locus_tag LOCUS_06810 <22653 21052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962373.1:amidophosphoribosyltransferase >Feature sequence027 <1 896 gene locus_tag LOCUS_06820 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962645.1:NAD(P)-dependent oxidoreductase 1862 870 gene locus_tag LOCUS_06830 1862 870 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_06830 3156 1963 gene locus_tag LOCUS_06840 3156 1963 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_06840 3203 4225 gene locus_tag LOCUS_06850 3203 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 5068 4487 gene locus_tag LOCUS_06860 5068 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 5998 5138 gene locus_tag LOCUS_06870 5998 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 6349 6062 gene locus_tag LOCUS_06880 6349 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 8374 6626 gene locus_tag LOCUS_06890 8374 6626 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_06890 8536 8754 gene locus_tag LOCUS_06900 8536 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 11288 8751 gene locus_tag LOCUS_06910 11288 8751 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_06910 11998 11378 gene locus_tag LOCUS_06920 11998 11378 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_06920 12627 11998 gene locus_tag LOCUS_06930 12627 11998 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_06930 12818 13867 gene locus_tag LOCUS_06940 gene mltG 12818 13867 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_06940 13871 14293 gene locus_tag LOCUS_06950 13871 14293 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_06950 14274 15242 gene locus_tag LOCUS_06960 14274 15242 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_06960 15304 15389 gene locus_tag LOCUS_t00080 15304 15389 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15821 17932 gene locus_tag LOCUS_06970 15821 17932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 18021 20834 gene locus_tag LOCUS_06980 gene carB 18021 20834 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_06980 20836 21057 gene locus_tag LOCUS_06990 20836 21057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 21936 21061 gene locus_tag LOCUS_07000 21936 21061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence028 491 1531 gene locus_tag LOCUS_07010 gene hemE 491 1531 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_07010 1528 2892 gene locus_tag LOCUS_07020 gene hemN 1528 2892 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_07020 3960 2878 gene locus_tag LOCUS_07030 3960 2878 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_07030 4456 4250 gene locus_tag LOCUS_07040 4456 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 5208 5546 gene locus_tag LOCUS_07050 5208 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 6400 5576 gene locus_tag LOCUS_07060 gene menB 6400 5576 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_07060 8091 6391 gene locus_tag LOCUS_07070 gene menD 8091 6391 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_07070 9271 8093 gene locus_tag LOCUS_07080 9271 8093 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_07080 9651 9271 gene locus_tag LOCUS_07090 9651 9271 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035435.1 protein_id gnl|my_center|LOCUS_07090 9737 10354 gene locus_tag LOCUS_07100 9737 10354 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_07100 10409 10924 gene locus_tag LOCUS_07110 10409 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 10921 12066 gene locus_tag LOCUS_07120 10921 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_07120 12192 12118 gene locus_tag LOCUS_t00090 12192 12118 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13444 12254 gene locus_tag LOCUS_07130 gene sucC 13444 12254 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_07130 13883 14563 gene locus_tag LOCUS_07140 13883 14563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_07140 14544 15413 gene locus_tag LOCUS_07150 14544 15413 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512742.1 protein_id gnl|my_center|LOCUS_07150 15458 16204 gene locus_tag LOCUS_07160 15458 16204 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_07160 17265 16279 gene locus_tag LOCUS_07170 gene gap 17265 16279 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_07170 17605 17677 gene locus_tag LOCUS_t00100 17605 17677 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17731 17976 gene locus_tag LOCUS_07180 17731 17976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 18315 19004 gene locus_tag LOCUS_07190 18315 19004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 19129 20532 gene locus_tag LOCUS_07200 19129 20532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 21181 20561 gene locus_tag LOCUS_07210 21181 20561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 21577 21278 gene locus_tag LOCUS_07220 21577 21278 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_07220 21776 21564 gene locus_tag LOCUS_07230 21776 21564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence029 <1 839 gene locus_tag LOCUS_07240 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788554.1:trypsin-like peptidase domain-containing protein 1632 2396 gene locus_tag LOCUS_07250 1632 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2393 3502 gene locus_tag LOCUS_07260 2393 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 3570 4271 gene locus_tag LOCUS_07270 3570 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 4437 4249 gene locus_tag LOCUS_07280 4437 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 4570 4851 gene locus_tag LOCUS_07290 4570 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 4994 5833 gene locus_tag LOCUS_07300 4994 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 6449 5859 gene locus_tag LOCUS_07310 6449 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 6786 6439 gene locus_tag LOCUS_07320 6786 6439 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_07320 8111 6804 gene locus_tag LOCUS_07330 gene murA 8111 6804 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_07330 8743 8108 gene locus_tag LOCUS_07340 8743 8108 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_07340 11029 8750 gene locus_tag LOCUS_07350 11029 8750 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111477477.1 protein_id gnl|my_center|LOCUS_07350 11275 12129 gene locus_tag LOCUS_07360 11275 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 12171 12734 gene locus_tag LOCUS_07370 12171 12734 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_07370 12739 13815 gene locus_tag LOCUS_07380 12739 13815 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926811.1 protein_id gnl|my_center|LOCUS_07380 14993 13884 gene locus_tag LOCUS_07390 14993 13884 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_07390 15534 14980 gene locus_tag LOCUS_07400 15534 14980 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_07400 15571 16437 gene locus_tag LOCUS_07410 gene folP 15571 16437 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_07410 16421 17302 gene locus_tag LOCUS_07420 gene cdaA 16421 17302 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762592.1 protein_id gnl|my_center|LOCUS_07420 18557 17295 gene locus_tag LOCUS_07430 18557 17295 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_07430 18684 19697 gene locus_tag LOCUS_07440 gene fbp 18684 19697 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_07440 19736 20233 gene locus_tag LOCUS_07450 19736 20233 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_07450 20310 21014 gene locus_tag LOCUS_07460 gene pyrH 20310 21014 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence030 699 857 gene locus_tag LOCUS_07470 699 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 1972 863 gene locus_tag LOCUS_07480 1972 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2035 2733 gene locus_tag LOCUS_07490 2035 2733 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023286.1 protein_id gnl|my_center|LOCUS_07490 2730 3959 gene locus_tag LOCUS_07500 gene serA 2730 3959 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_07500 6196 3986 gene locus_tag LOCUS_07510 6196 3986 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_07510 6834 6247 gene locus_tag LOCUS_07520 6834 6247 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_07520 7000 7656 gene locus_tag LOCUS_07530 gene pdxH 7000 7656 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814302.1 protein_id gnl|my_center|LOCUS_07530 7663 8910 gene locus_tag LOCUS_07540 7663 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 9630 8914 gene locus_tag LOCUS_07550 gene bshB1 9630 8914 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_07550 10760 9702 gene locus_tag LOCUS_07560 10760 9702 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_07560 12937 11429 gene locus_tag LOCUS_07570 12937 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 13741 13097 gene locus_tag LOCUS_07580 13741 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 15265 13865 gene locus_tag LOCUS_07590 15265 13865 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_07590 16524 15376 gene locus_tag LOCUS_07600 16524 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 17228 16719 gene locus_tag LOCUS_07610 17228 16719 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_07610 17359 19674 gene locus_tag LOCUS_07620 gene topA 17359 19674 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_07620 19944 20171 gene locus_tag LOCUS_07630 19944 20171 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_07630 20168 20515 gene locus_tag LOCUS_07640 20168 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence031 186 1007 gene locus_tag LOCUS_07650 186 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1000 2685 gene locus_tag LOCUS_07660 1000 2685 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_07660 2821 5886 gene locus_tag LOCUS_07670 gene ccsA 2821 5886 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_07670 5994 6464 gene locus_tag LOCUS_07680 5994 6464 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826748.1 protein_id gnl|my_center|LOCUS_07680 6473 7714 gene locus_tag LOCUS_07690 gene nusA 6473 7714 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_07690 7753 10371 gene locus_tag LOCUS_07700 7753 10371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 10383 10586 gene locus_tag LOCUS_07710 10383 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 11305 10649 gene locus_tag LOCUS_07720 11305 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 12547 11309 gene locus_tag LOCUS_07730 12547 11309 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546645.1 protein_id gnl|my_center|LOCUS_07730 14265 12739 gene locus_tag LOCUS_07740 14265 12739 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_07740 15056 14325 gene locus_tag LOCUS_07750 gene lptB 15056 14325 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_07750 16759 15053 gene locus_tag LOCUS_07760 gene recJ 16759 15053 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_07760 16860 19790 gene locus_tag LOCUS_07770 16860 19790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 <20525 19834 gene locus_tag LOCUS_07780 <20525 19834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107764.1:ammonia-forming cytochrome c nitrite reductase >Feature sequence032 36 3311 gene locus_tag LOCUS_07790 36 3311 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_07790 3333 3734 gene locus_tag LOCUS_07800 3333 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 3734 4144 gene locus_tag LOCUS_07810 gene ybeY 3734 4144 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_07810 4221 6083 gene locus_tag LOCUS_07820 gene mnmG 4221 6083 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_07820 6088 6978 gene locus_tag LOCUS_07830 6088 6978 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403756.1 protein_id gnl|my_center|LOCUS_07830 6914 8668 gene locus_tag LOCUS_07840 6914 8668 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_07840 8783 8986 gene locus_tag LOCUS_07850 8783 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 9086 10921 gene locus_tag LOCUS_07860 9086 10921 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_07860 11169 11648 gene locus_tag LOCUS_07870 11169 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 13009 11756 gene locus_tag LOCUS_07880 13009 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 13182 15317 gene locus_tag LOCUS_07890 gene ccoN 13182 15317 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_07890 15324 15524 gene locus_tag LOCUS_07900 15324 15524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 15511 16440 gene locus_tag LOCUS_07910 15511 16440 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_07910 16486 17904 gene locus_tag LOCUS_07920 gene ccoG 16486 17904 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_07920 17906 18340 gene locus_tag LOCUS_07930 17906 18340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 18340 19017 gene locus_tag LOCUS_07940 18340 19017 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence033 728 288 gene locus_tag LOCUS_07950 728 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 903 673 gene locus_tag LOCUS_07960 903 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 1447 977 gene locus_tag LOCUS_07970 gene moaC 1447 977 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036201.1 protein_id gnl|my_center|LOCUS_07970 1528 2757 gene locus_tag LOCUS_07980 1528 2757 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_07980 3345 2746 gene locus_tag LOCUS_07990 3345 2746 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796757.1 protein_id gnl|my_center|LOCUS_07990 3514 3840 gene locus_tag LOCUS_08000 3514 3840 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555815.1 protein_id gnl|my_center|LOCUS_08000 3863 4174 gene locus_tag LOCUS_08010 3863 4174 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_08010 6005 4305 gene locus_tag LOCUS_08020 6005 4305 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_08020 6198 6422 gene locus_tag LOCUS_08030 6198 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_08030 7421 6408 gene locus_tag LOCUS_08040 7421 6408 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_08040 7753 7421 gene locus_tag LOCUS_08050 7753 7421 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537018.1 protein_id gnl|my_center|LOCUS_08050 9624 7768 gene locus_tag LOCUS_08060 9624 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 11115 9625 gene locus_tag LOCUS_08070 gene hutH 11115 9625 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962994.1 protein_id gnl|my_center|LOCUS_08070 12495 11122 gene locus_tag LOCUS_08080 gene hisS 12495 11122 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_08080 12649 13065 gene locus_tag LOCUS_08090 12649 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 13309 14196 gene locus_tag LOCUS_08100 13309 14196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 14291 15310 gene locus_tag LOCUS_08110 14291 15310 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380272.1 protein_id gnl|my_center|LOCUS_08110 15323 15958 gene locus_tag LOCUS_08120 15323 15958 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218470.1 protein_id gnl|my_center|LOCUS_08120 18880 16046 gene locus_tag LOCUS_08130 18880 16046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence034 1 1041 gene locus_tag LOCUS_08140 1 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 2445 1615 gene locus_tag LOCUS_08150 2445 1615 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_08150 2690 2442 gene locus_tag LOCUS_08160 2690 2442 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876114.1 protein_id gnl|my_center|LOCUS_08160 5721 2683 gene locus_tag LOCUS_08170 5721 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 6149 6613 gene locus_tag LOCUS_08180 6149 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 7072 6620 gene locus_tag LOCUS_08190 7072 6620 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_08190 8307 7069 gene locus_tag LOCUS_08200 gene lysA 8307 7069 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_08200 9464 8442 gene locus_tag LOCUS_08210 9464 8442 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_08210 9746 10000 gene locus_tag LOCUS_08220 9746 10000 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676042.1 protein_id gnl|my_center|LOCUS_08220 9990 10421 gene locus_tag LOCUS_08230 9990 10421 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_08230 10543 11049 gene locus_tag LOCUS_08240 10543 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 11183 12682 gene locus_tag LOCUS_08250 11183 12682 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_08250 12772 13215 gene locus_tag LOCUS_08260 12772 13215 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_08260 14102 13266 gene locus_tag LOCUS_08270 gene murQ 14102 13266 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760452.1 protein_id gnl|my_center|LOCUS_08270 14852 14103 gene locus_tag LOCUS_08280 14852 14103 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706132.1 protein_id gnl|my_center|LOCUS_08280 14960 16897 gene locus_tag LOCUS_08290 14960 16897 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence035 <1 1220 gene locus_tag LOCUS_08300 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261736.1:ABC transporter permease 1224 1907 gene locus_tag LOCUS_08310 1224 1907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_08310 1918 3153 gene locus_tag LOCUS_08320 1918 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_08320 3331 6552 gene locus_tag LOCUS_08330 3331 6552 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_08330 6941 7645 gene locus_tag LOCUS_08340 6941 7645 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_08340 8728 7634 gene locus_tag LOCUS_08350 8728 7634 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104264.1 protein_id gnl|my_center|LOCUS_08350 10458 8734 gene locus_tag LOCUS_08360 10458 8734 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880726.1 protein_id gnl|my_center|LOCUS_08360 11556 10462 gene locus_tag LOCUS_08370 gene hypD 11556 10462 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_08370 11834 11553 gene locus_tag LOCUS_08380 11834 11553 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_08380 12579 11875 gene locus_tag LOCUS_08390 gene hypB 12579 11875 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_08390 12939 12592 gene locus_tag LOCUS_08400 12939 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 14434 12941 gene locus_tag LOCUS_08410 14434 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 14672 14406 gene locus_tag LOCUS_08420 14672 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 14986 14672 gene locus_tag LOCUS_08430 14986 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 15469 14987 gene locus_tag LOCUS_08440 15469 14987 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021168.1 protein_id gnl|my_center|LOCUS_08440 17135 15540 gene locus_tag LOCUS_08450 17135 15540 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728265.1 protein_id gnl|my_center|LOCUS_08450 18074 17163 gene locus_tag LOCUS_08460 18074 17163 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258627.1 protein_id gnl|my_center|LOCUS_08460 18344 19180 gene locus_tag LOCUS_08470 18344 19180 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence036 568 128 gene locus_tag LOCUS_08480 568 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1663 743 gene locus_tag LOCUS_08490 1663 743 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868717.1 protein_id gnl|my_center|LOCUS_08490 2316 1660 gene locus_tag LOCUS_08500 2316 1660 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172761.1 protein_id gnl|my_center|LOCUS_08500 2551 4116 gene locus_tag LOCUS_08510 2551 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4205 4561 gene locus_tag LOCUS_08520 4205 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4628 5071 gene locus_tag LOCUS_08530 4628 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 5135 5392 gene locus_tag LOCUS_08540 5135 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 5618 6682 gene locus_tag LOCUS_08550 5618 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 7545 6679 gene locus_tag LOCUS_08560 7545 6679 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_08560 7686 9722 gene locus_tag LOCUS_08570 7686 9722 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_08570 9944 10327 gene locus_tag LOCUS_08580 9944 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 10828 11541 gene locus_tag LOCUS_08590 10828 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 11637 11816 gene locus_tag LOCUS_08600 11637 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 11888 12055 gene locus_tag LOCUS_08610 11888 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 12145 13125 gene locus_tag LOCUS_08620 12145 13125 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028525108.1 protein_id gnl|my_center|LOCUS_08620 14519 13188 gene locus_tag LOCUS_08630 gene ffh 14519 13188 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_08630 14839 17283 gene locus_tag LOCUS_08640 14839 17283 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_08640 17285 18052 gene locus_tag LOCUS_08650 17285 18052 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404272.1 protein_id gnl|my_center|LOCUS_08650 18652 18359 gene locus_tag LOCUS_08660 18652 18359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 18918 18652 gene locus_tag LOCUS_08670 18918 18652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence037 658 744 gene locus_tag LOCUS_t00110 658 744 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 865 792 gene locus_tag LOCUS_t00120 865 792 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1163 888 gene locus_tag LOCUS_08680 1163 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2074 1160 gene locus_tag LOCUS_08690 2074 1160 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_08690 2720 2172 gene locus_tag LOCUS_08700 2720 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3139 2831 gene locus_tag LOCUS_08710 3139 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4681 3224 gene locus_tag LOCUS_08720 4681 3224 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532746.1 protein_id gnl|my_center|LOCUS_08720 5607 4657 gene locus_tag LOCUS_08730 5607 4657 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_08730 6675 5668 gene locus_tag LOCUS_08740 gene rlmN 6675 5668 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_08740 6836 8125 gene locus_tag LOCUS_08750 6836 8125 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_08750 8215 9360 gene locus_tag LOCUS_08760 8215 9360 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_08760 9528 12188 gene locus_tag LOCUS_08770 gene clpB 9528 12188 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963875.1 protein_id gnl|my_center|LOCUS_08770 15435 12268 gene locus_tag LOCUS_08780 15435 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 15779 16222 gene locus_tag LOCUS_08790 gene rplM 15779 16222 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760800.1 protein_id gnl|my_center|LOCUS_08790 16227 16613 gene locus_tag LOCUS_08800 gene rpsI 16227 16613 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_08800 16696 17472 gene locus_tag LOCUS_08810 gene rpsB 16696 17472 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962623.1 protein_id gnl|my_center|LOCUS_08810 17575 18411 gene locus_tag LOCUS_08820 gene tsf 17575 18411 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence038 822 607 gene locus_tag LOCUS_08830 822 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1256 816 gene locus_tag LOCUS_08840 1256 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1357 2298 gene locus_tag LOCUS_08850 1357 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2329 3153 gene locus_tag LOCUS_08860 2329 3153 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_08860 3279 4565 gene locus_tag LOCUS_08870 3279 4565 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963440.1 protein_id gnl|my_center|LOCUS_08870 4643 4909 gene locus_tag LOCUS_08880 4643 4909 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_08880 4913 5614 gene locus_tag LOCUS_08890 4913 5614 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_08890 5616 6848 gene locus_tag LOCUS_08900 5616 6848 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_08900 6998 8086 gene locus_tag LOCUS_08910 6998 8086 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_08910 8804 8094 gene locus_tag LOCUS_08920 8804 8094 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_08920 9517 8879 gene locus_tag LOCUS_08930 9517 8879 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832147.1 protein_id gnl|my_center|LOCUS_08930 9916 10500 gene locus_tag LOCUS_08940 9916 10500 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_08940 10519 10932 gene locus_tag LOCUS_08950 10519 10932 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_08950 11001 11849 gene locus_tag LOCUS_08960 11001 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 11850 12311 gene locus_tag LOCUS_08970 11850 12311 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_08970 13444 12305 gene locus_tag LOCUS_08980 13444 12305 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465532.1 protein_id gnl|my_center|LOCUS_08980 15284 13437 gene locus_tag LOCUS_08990 15284 13437 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_08990 16215 15376 gene locus_tag LOCUS_09000 16215 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 17057 16212 gene locus_tag LOCUS_09010 17057 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 17113 17988 gene locus_tag LOCUS_09020 17113 17988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence039 439 996 gene locus_tag LOCUS_09030 439 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 993 3623 gene locus_tag LOCUS_09040 993 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 5176 3782 gene locus_tag LOCUS_09050 gene lpdA 5176 3782 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_09050 5331 6077 gene locus_tag LOCUS_09060 gene fabG 5331 6077 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_09060 6204 6809 gene locus_tag LOCUS_09070 6204 6809 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_09070 6897 7904 gene locus_tag LOCUS_09080 6897 7904 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_09080 7992 8339 gene locus_tag LOCUS_09090 7992 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 8421 11411 gene locus_tag LOCUS_09100 gene secDF 8421 11411 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_09100 11596 12147 gene locus_tag LOCUS_09110 11596 12147 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223369.1 protein_id gnl|my_center|LOCUS_09110 12158 12487 gene locus_tag LOCUS_09120 12158 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 15405 12529 gene locus_tag LOCUS_09130 gene gcvP 15405 12529 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_09130 15583 17088 gene locus_tag LOCUS_09140 15583 17088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 17540 17085 gene locus_tag LOCUS_09150 17540 17085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence040 241 975 gene locus_tag LOCUS_09160 241 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1677 1072 gene locus_tag LOCUS_09170 1677 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2335 1670 gene locus_tag LOCUS_09180 2335 1670 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462716.1 protein_id gnl|my_center|LOCUS_09180 5647 2567 gene locus_tag LOCUS_09190 5647 2567 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_09190 7728 6097 gene locus_tag LOCUS_09200 gene pruA 7728 6097 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_09200 8520 7825 gene locus_tag LOCUS_09210 8520 7825 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_09210 8888 8520 gene locus_tag LOCUS_09220 8888 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 8979 9614 gene locus_tag LOCUS_09230 8979 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 9939 10250 gene locus_tag LOCUS_09240 9939 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 10254 10841 gene locus_tag LOCUS_09250 10254 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 11043 10882 gene locus_tag LOCUS_09260 11043 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 13026 12163 gene locus_tag LOCUS_09270 13026 12163 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_09270 13818 13168 gene locus_tag LOCUS_09280 13818 13168 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698413.1 protein_id gnl|my_center|LOCUS_09280 16100 13815 gene locus_tag LOCUS_09290 16100 13815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence041 93 1514 gene locus_tag LOCUS_09300 93 1514 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_09300 1606 2898 gene locus_tag LOCUS_09310 1606 2898 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_09310 2900 3766 gene locus_tag LOCUS_09320 gene tatC 2900 3766 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_09320 3756 4190 gene locus_tag LOCUS_09330 gene rpiB 3756 4190 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_09330 4303 4629 gene locus_tag LOCUS_09340 4303 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4633 6081 gene locus_tag LOCUS_09350 4633 6081 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351354.1 protein_id gnl|my_center|LOCUS_09350 6088 7065 gene locus_tag LOCUS_09360 6088 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 7251 8039 gene locus_tag LOCUS_09370 7251 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 8052 8594 gene locus_tag LOCUS_09380 gene rimM 8052 8594 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962516.1 protein_id gnl|my_center|LOCUS_09380 8584 9273 gene locus_tag LOCUS_09390 gene trmD 8584 9273 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_09390 9309 10679 gene locus_tag LOCUS_09400 9309 10679 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_09400 11287 10688 gene locus_tag LOCUS_09410 gene coaE 11287 10688 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_09410 12242 11280 gene locus_tag LOCUS_09420 12242 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 12569 12252 gene locus_tag LOCUS_09430 gene yajC 12569 12252 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402802.1 protein_id gnl|my_center|LOCUS_09430 13120 12599 gene locus_tag LOCUS_09440 13120 12599 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_09440 13444 13133 gene locus_tag LOCUS_09450 13444 13133 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964581.1 protein_id gnl|my_center|LOCUS_09450 14604 13453 gene locus_tag LOCUS_09460 14604 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 15766 14663 gene locus_tag LOCUS_09470 15766 14663 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence042 1388 435 gene locus_tag LOCUS_09480 1388 435 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 protein_id gnl|my_center|LOCUS_09480 2129 1458 gene locus_tag LOCUS_09490 2129 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2290 3501 gene locus_tag LOCUS_09500 gene megL 2290 3501 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674490.1 protein_id gnl|my_center|LOCUS_09500 3585 4679 gene locus_tag LOCUS_09510 3585 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 9193 4682 gene locus_tag LOCUS_09520 9193 4682 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_09520 9286 10290 gene locus_tag LOCUS_09530 gene tsaD 9286 10290 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_09530 10316 10753 gene locus_tag LOCUS_09540 10316 10753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 10746 11207 gene locus_tag LOCUS_09550 gene smpB 10746 11207 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_09550 11211 11999 gene locus_tag LOCUS_09560 11211 11999 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_09560 12056 12550 gene locus_tag LOCUS_09570 12056 12550 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_09570 13271 12597 gene locus_tag LOCUS_09580 13271 12597 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_09580 13865 13272 gene locus_tag LOCUS_09590 13865 13272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 13994 15826 gene locus_tag LOCUS_09600 13994 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 16445 15813 gene locus_tag LOCUS_09610 16445 15813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 16755 16504 gene locus_tag LOCUS_09620 16755 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 <17621 16745 gene locus_tag LOCUS_09630 <17621 16745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920858.1:cyclic pyranopterin monophosphate synthase MoaC >Feature sequence043 923 1999 gene locus_tag LOCUS_09640 923 1999 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_09640 2011 2967 gene locus_tag LOCUS_09650 2011 2967 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545028.1 protein_id gnl|my_center|LOCUS_09650 2967 3128 gene locus_tag LOCUS_09660 2967 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 3192 3731 gene locus_tag LOCUS_09670 3192 3731 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_09670 3764 4234 gene locus_tag LOCUS_09680 3764 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 4256 4813 gene locus_tag LOCUS_09690 4256 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 4850 5893 gene locus_tag LOCUS_09700 4850 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5926 7158 gene locus_tag LOCUS_09710 gene xseA 5926 7158 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_09710 7155 7358 gene locus_tag LOCUS_09720 7155 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7417 9189 gene locus_tag LOCUS_09730 7417 9189 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_09730 9191 11197 gene locus_tag LOCUS_09740 gene ligA 9191 11197 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963952.1 protein_id gnl|my_center|LOCUS_09740 11194 11697 gene locus_tag LOCUS_09750 11194 11697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 11697 12566 gene locus_tag LOCUS_09760 gene dapA 11697 12566 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_09760 12816 12640 gene locus_tag LOCUS_09770 12816 12640 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_09770 14171 12924 gene locus_tag LOCUS_09780 14171 12924 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_09780 14357 15853 gene locus_tag LOCUS_09790 gene accC 14357 15853 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_09790 15858 16454 gene locus_tag LOCUS_09800 15858 16454 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963543.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence044 910 161 gene locus_tag LOCUS_09810 910 161 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_09810 2090 897 gene locus_tag LOCUS_09820 2090 897 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_09820 3472 2105 gene locus_tag LOCUS_09830 3472 2105 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_09830 4321 3605 gene locus_tag LOCUS_09840 4321 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5331 4324 gene locus_tag LOCUS_09850 5331 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5480 6397 gene locus_tag LOCUS_09860 5480 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444439.1 protein_id gnl|my_center|LOCUS_09860 6989 6552 gene locus_tag LOCUS_09870 6989 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 7483 6989 gene locus_tag LOCUS_09880 7483 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 7908 7486 gene locus_tag LOCUS_09890 7908 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 9499 7883 gene locus_tag LOCUS_09900 9499 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 10614 9793 gene locus_tag LOCUS_09910 10614 9793 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225423.1 protein_id gnl|my_center|LOCUS_09910 10721 11059 gene locus_tag LOCUS_09920 10721 11059 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020391.1 protein_id gnl|my_center|LOCUS_09920 12470 11076 gene locus_tag LOCUS_09930 gene dnaA 12470 11076 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_09930 12706 13746 gene locus_tag LOCUS_09940 12706 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 13730 15850 gene locus_tag LOCUS_09950 gene scpA 13730 15850 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence045 432 1148 gene locus_tag LOCUS_09960 gene dapB 432 1148 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_09960 1220 2383 gene locus_tag LOCUS_09970 1220 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3141 2380 gene locus_tag LOCUS_09980 3141 2380 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_09980 4157 3138 gene locus_tag LOCUS_09990 4157 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 4675 4220 gene locus_tag LOCUS_10000 4675 4220 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918221.1 protein_id gnl|my_center|LOCUS_10000 6859 4679 gene locus_tag LOCUS_10010 6859 4679 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_10010 7554 7048 gene locus_tag LOCUS_10020 7554 7048 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932308.1 protein_id gnl|my_center|LOCUS_10020 7798 10134 gene locus_tag LOCUS_10030 7798 10134 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_10030 10131 10505 gene locus_tag LOCUS_10040 10131 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 11374 10544 gene locus_tag LOCUS_10050 gene kdsA 11374 10544 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_10050 12477 11401 gene locus_tag LOCUS_10060 12477 11401 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072443.1 protein_id gnl|my_center|LOCUS_10060 13832 12636 gene locus_tag LOCUS_10070 13832 12636 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_10070 14715 13846 gene locus_tag LOCUS_10080 14715 13846 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_10080 15392 14715 gene locus_tag LOCUS_10090 gene cmk 15392 14715 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_10090 15595 17232 gene locus_tag LOCUS_10100 gene ade 15595 17232 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence046 774 1928 gene locus_tag LOCUS_10110 774 1928 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_10110 2091 2594 gene locus_tag LOCUS_10120 2091 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2584 3147 gene locus_tag LOCUS_10130 2584 3147 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383033.1 protein_id gnl|my_center|LOCUS_10130 3447 3842 gene locus_tag LOCUS_10140 3447 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 4854 3871 gene locus_tag LOCUS_10150 4854 3871 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_10150 4958 5626 gene locus_tag LOCUS_10160 4958 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 8068 5663 gene locus_tag LOCUS_10170 8068 5663 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_10170 8370 9482 gene locus_tag LOCUS_10180 gene ald 8370 9482 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_10180 9991 9533 gene locus_tag LOCUS_10190 9991 9533 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_10190 10073 10846 gene locus_tag LOCUS_10200 10073 10846 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_10200 12182 10860 gene locus_tag LOCUS_10210 12182 10860 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_10210 12703 12242 gene locus_tag LOCUS_10220 12703 12242 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761058.1 protein_id gnl|my_center|LOCUS_10220 13224 12703 gene locus_tag LOCUS_10230 13224 12703 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404424.1 protein_id gnl|my_center|LOCUS_10230 13609 13274 gene locus_tag LOCUS_10240 13609 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 14471 13641 gene locus_tag LOCUS_10250 14471 13641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 14649 14561 gene locus_tag LOCUS_t00130 14649 14561 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15838 14744 gene locus_tag LOCUS_10260 15838 14744 CDS product type I asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796414.1 protein_id gnl|my_center|LOCUS_10260 16607 15831 gene locus_tag LOCUS_10270 16607 15831 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence047 1613 2155 gene locus_tag LOCUS_10280 1613 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2155 2613 gene locus_tag LOCUS_10290 2155 2613 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_10290 3965 2940 gene locus_tag LOCUS_10300 3965 2940 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 protein_id gnl|my_center|LOCUS_10300 5104 3971 gene locus_tag LOCUS_10310 5104 3971 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051287133.1 protein_id gnl|my_center|LOCUS_10310 5501 5202 gene locus_tag LOCUS_10320 5501 5202 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190833654.1 protein_id gnl|my_center|LOCUS_10320 5751 5494 gene locus_tag LOCUS_10330 5751 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 5878 6561 gene locus_tag LOCUS_10340 5878 6561 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_10340 7837 6611 gene locus_tag LOCUS_10350 gene icd 7837 6611 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989744.1 protein_id gnl|my_center|LOCUS_10350 8018 8536 gene locus_tag LOCUS_10360 8018 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 10753 8987 gene locus_tag LOCUS_10370 10753 8987 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_10370 11162 11539 gene locus_tag LOCUS_10380 11162 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 12264 11536 gene locus_tag LOCUS_10390 12264 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 15672 12316 gene locus_tag LOCUS_10400 gene mfd 15672 12316 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_10400 15755 16147 gene locus_tag LOCUS_10410 15755 16147 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence048 <1 1482 gene locus_tag LOCUS_10420 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091514757.1:DNA gyrase/topoisomerase IV subunit A 1482 2168 gene locus_tag LOCUS_10430 1482 2168 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658321.1 protein_id gnl|my_center|LOCUS_10430 2172 2783 gene locus_tag LOCUS_10440 2172 2783 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_10440 2872 5343 gene locus_tag LOCUS_10450 2872 5343 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107653.1 protein_id gnl|my_center|LOCUS_10450 6507 5347 gene locus_tag LOCUS_10460 6507 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6852 6610 gene locus_tag LOCUS_10470 6852 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 7114 6866 gene locus_tag LOCUS_10480 7114 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 7431 7688 gene locus_tag LOCUS_10490 7431 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 7831 7757 gene locus_tag LOCUS_t00140 7831 7757 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7996 7923 gene locus_tag LOCUS_t00150 7996 7923 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8913 8077 gene locus_tag LOCUS_10500 8913 8077 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_10500 8950 9912 gene locus_tag LOCUS_10510 8950 9912 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_10510 9899 10579 gene locus_tag LOCUS_10520 9899 10579 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801447.1 protein_id gnl|my_center|LOCUS_10520 10572 11846 gene locus_tag LOCUS_10530 10572 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 11846 12838 gene locus_tag LOCUS_10540 11846 12838 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_10540 12843 14189 gene locus_tag LOCUS_10550 12843 14189 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784758.1 protein_id gnl|my_center|LOCUS_10550 14595 14257 gene locus_tag LOCUS_10560 14595 14257 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_10560 14887 14585 gene locus_tag LOCUS_10570 14887 14585 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_10570 15124 16254 gene locus_tag LOCUS_10580 15124 16254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 17152 16328 gene locus_tag LOCUS_10590 17152 16328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence049 856 1452 gene locus_tag LOCUS_10600 gene yihA 856 1452 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_10600 2418 1474 gene locus_tag LOCUS_10610 2418 1474 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_10610 3213 2422 gene locus_tag LOCUS_10620 3213 2422 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_10620 5010 3220 gene locus_tag LOCUS_10630 gene mutL 5010 3220 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_10630 5369 5016 gene locus_tag LOCUS_10640 5369 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 5437 6729 gene locus_tag LOCUS_10650 5437 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 6726 7859 gene locus_tag LOCUS_10660 gene bshA 6726 7859 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_10660 7938 8564 gene locus_tag LOCUS_10670 7938 8564 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532957.1 protein_id gnl|my_center|LOCUS_10670 8713 9159 gene locus_tag LOCUS_10680 8713 9159 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376389.1 protein_id gnl|my_center|LOCUS_10680 9741 9310 gene locus_tag LOCUS_10690 9741 9310 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_10690 9988 9734 gene locus_tag LOCUS_10700 9988 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 10568 10284 gene locus_tag LOCUS_10710 10568 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 10690 10615 gene locus_tag LOCUS_t00160 10690 10615 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10857 13298 gene locus_tag LOCUS_10720 10857 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 15614 13647 gene locus_tag LOCUS_10730 15614 13647 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_10730 <17114 15763 gene locus_tag LOCUS_10740 <17114 15763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257240.1:aldehyde dehydrogenase >Feature sequence050 1467 763 gene locus_tag LOCUS_10750 gene pepE 1467 763 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421763.1 protein_id gnl|my_center|LOCUS_10750 1733 1488 gene locus_tag LOCUS_10760 1733 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1888 2013 gene locus_tag LOCUS_10770 1888 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2253 4157 gene locus_tag LOCUS_10780 2253 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4154 5182 gene locus_tag LOCUS_10790 4154 5182 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_10790 6376 5183 gene locus_tag LOCUS_10800 6376 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 6548 9337 gene locus_tag LOCUS_10810 6548 9337 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_10810 9349 10464 gene locus_tag LOCUS_10820 9349 10464 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_10820 10549 11352 gene locus_tag LOCUS_10830 10549 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 11493 11930 gene locus_tag LOCUS_10840 11493 11930 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_10840 12360 11941 gene locus_tag LOCUS_10850 12360 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 12962 12498 gene locus_tag LOCUS_10860 12962 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 13165 14529 gene locus_tag LOCUS_10870 13165 14529 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_10870 14513 16423 gene locus_tag LOCUS_10880 14513 16423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence051 4420 3167 gene locus_tag LOCUS_10890 4420 3167 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_10890 5120 4449 gene locus_tag LOCUS_10900 5120 4449 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_10900 5744 5130 gene locus_tag LOCUS_10910 5744 5130 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_10910 7328 5772 gene locus_tag LOCUS_10920 7328 5772 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444186.1 protein_id gnl|my_center|LOCUS_10920 7664 7455 gene locus_tag LOCUS_10930 7664 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 8074 8757 gene locus_tag LOCUS_10940 8074 8757 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_10940 8766 10688 gene locus_tag LOCUS_10950 8766 10688 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_10950 10798 11550 gene locus_tag LOCUS_10960 10798 11550 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_10960 11887 13044 gene locus_tag LOCUS_10970 11887 13044 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_10970 13060 15312 gene locus_tag LOCUS_10980 13060 15312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 16707 15322 gene locus_tag LOCUS_10990 16707 15322 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence052 36 260 gene locus_tag LOCUS_11000 36 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1782 508 gene locus_tag LOCUS_11010 1782 508 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218080540.1 protein_id gnl|my_center|LOCUS_11010 2261 1797 gene locus_tag LOCUS_11020 2261 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3459 2269 gene locus_tag LOCUS_11030 3459 2269 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_11030 4415 3468 gene locus_tag LOCUS_11040 4415 3468 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_11040 5403 4420 gene locus_tag LOCUS_11050 gene meaB 5403 4420 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_11050 5463 6734 gene locus_tag LOCUS_11060 5463 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 6957 7889 gene locus_tag LOCUS_11070 6957 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 8639 7938 gene locus_tag LOCUS_11080 8639 7938 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_11080 10653 8656 gene locus_tag LOCUS_11090 10653 8656 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_11090 11432 10650 gene locus_tag LOCUS_11100 11432 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 11592 12566 gene locus_tag LOCUS_11110 11592 12566 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_11110 12763 13212 gene locus_tag LOCUS_11120 gene mraZ 12763 13212 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_11120 13202 14137 gene locus_tag LOCUS_11130 gene rsmH 13202 14137 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_11130 14130 14492 gene locus_tag LOCUS_11140 14130 14492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 14489 16579 gene locus_tag LOCUS_11150 14489 16579 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence053 <1 2988 gene locus_tag LOCUS_11160 <1 2988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766447.1:SusC/RagA family TonB-linked outer membrane protein 3000 4346 gene locus_tag LOCUS_11170 3000 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4473 5159 gene locus_tag LOCUS_11180 4473 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6268 5171 gene locus_tag LOCUS_11190 gene lpxB 6268 5171 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089240244.1 protein_id gnl|my_center|LOCUS_11190 6488 8518 gene locus_tag LOCUS_11200 6488 8518 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_11200 9744 8524 gene locus_tag LOCUS_11210 gene clpX 9744 8524 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_11210 10453 9785 gene locus_tag LOCUS_11220 gene clpP 10453 9785 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_11220 11927 10551 gene locus_tag LOCUS_11230 gene tig 11927 10551 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_11230 12046 11962 gene locus_tag LOCUS_t00170 12046 11962 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12159 14402 gene locus_tag LOCUS_11240 12159 14402 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_11240 14442 14915 gene locus_tag LOCUS_11250 14442 14915 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_11250 14920 15261 gene locus_tag LOCUS_11260 14920 15261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 15267 16532 gene locus_tag LOCUS_11270 15267 16532 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789791.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence054 131 1402 gene locus_tag LOCUS_11280 131 1402 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_11280 1395 1907 gene locus_tag LOCUS_11290 1395 1907 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_11290 1947 2783 gene locus_tag LOCUS_11300 1947 2783 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_11300 2780 3127 gene locus_tag LOCUS_11310 2780 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3337 3615 gene locus_tag LOCUS_11320 3337 3615 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_11320 3647 5278 gene locus_tag LOCUS_11330 gene groL 3647 5278 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932217.1 protein_id gnl|my_center|LOCUS_11330 6862 5354 gene locus_tag LOCUS_11340 6862 5354 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_11340 7084 8688 gene locus_tag LOCUS_11350 gene pckA 7084 8688 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_11350 8794 10329 gene locus_tag LOCUS_11360 8794 10329 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_11360 10875 10333 gene locus_tag LOCUS_11370 10875 10333 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933473.1 protein_id gnl|my_center|LOCUS_11370 11521 10922 gene locus_tag LOCUS_11380 11521 10922 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_11380 12481 11534 gene locus_tag LOCUS_11390 12481 11534 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_11390 13232 12501 gene locus_tag LOCUS_11400 13232 12501 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_11400 13312 13629 gene locus_tag LOCUS_11410 13312 13629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 13689 15044 gene locus_tag LOCUS_11420 13689 15044 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_11420 15046 15852 gene locus_tag LOCUS_11430 15046 15852 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence055 <1 1193 gene locus_tag LOCUS_11440 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814911.1:phosphoribosylformylglycinamidine synthase 1500 1195 gene locus_tag LOCUS_11450 1500 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1820 2572 gene locus_tag LOCUS_11460 1820 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2677 12093 gene locus_tag LOCUS_11470 2677 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 12165 13361 gene locus_tag LOCUS_11480 12165 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 13368 14741 gene locus_tag LOCUS_11490 13368 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 14914 16197 gene locus_tag LOCUS_11500 14914 16197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence056 2090 897 gene locus_tag LOCUS_11510 2090 897 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840191.1 protein_id gnl|my_center|LOCUS_11510 2860 2183 gene locus_tag LOCUS_11520 2860 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4787 2904 gene locus_tag LOCUS_11530 4787 2904 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_11530 5561 4788 gene locus_tag LOCUS_11540 5561 4788 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_11540 7591 5567 gene locus_tag LOCUS_11550 7591 5567 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109032.1 protein_id gnl|my_center|LOCUS_11550 8652 7705 gene locus_tag LOCUS_11560 8652 7705 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_11560 8741 9514 gene locus_tag LOCUS_11570 8741 9514 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_11570 9525 9800 gene locus_tag LOCUS_11580 9525 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 10579 9797 gene locus_tag LOCUS_11590 10579 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 11280 10576 gene locus_tag LOCUS_11600 11280 10576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460087.1 protein_id gnl|my_center|LOCUS_11600 12505 11273 gene locus_tag LOCUS_11610 12505 11273 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_11610 13020 12592 gene locus_tag LOCUS_11620 13020 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 13616 13017 gene locus_tag LOCUS_11630 13616 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_11630 15670 13724 gene locus_tag LOCUS_11640 gene nosZ 15670 13724 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_11640 <16275 15728 gene locus_tag LOCUS_11650 <16275 15728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528503.1:fasciclin domain-containing protein >Feature sequence057 6105 625 gene locus_tag LOCUS_11660 6105 625 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_11660 6525 7247 gene locus_tag LOCUS_11670 6525 7247 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_11670 7244 9253 gene locus_tag LOCUS_11680 gene tkt 7244 9253 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_11680 9255 10277 gene locus_tag LOCUS_11690 gene glpX 9255 10277 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_11690 10298 11356 gene locus_tag LOCUS_11700 gene fba 10298 11356 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388354.1 protein_id gnl|my_center|LOCUS_11700 11386 12834 gene locus_tag LOCUS_11710 11386 12834 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085371.1 protein_id gnl|my_center|LOCUS_11710 12875 13297 gene locus_tag LOCUS_11720 12875 13297 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085372.1 protein_id gnl|my_center|LOCUS_11720 13327 14241 gene locus_tag LOCUS_11730 gene cbbX 13327 14241 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975098.1 protein_id gnl|my_center|LOCUS_11730 14247 15131 gene locus_tag LOCUS_11740 14247 15131 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence058 585 4142 gene locus_tag LOCUS_11750 585 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 4139 4510 gene locus_tag LOCUS_11760 4139 4510 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_11760 4512 4787 gene locus_tag LOCUS_11770 4512 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4784 5548 gene locus_tag LOCUS_11780 4784 5548 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_11780 5548 7056 gene locus_tag LOCUS_11790 5548 7056 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403085.1 protein_id gnl|my_center|LOCUS_11790 8501 7053 gene locus_tag LOCUS_11800 gene pyk 8501 7053 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_11800 8940 8521 gene locus_tag LOCUS_11810 8940 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 9095 9334 gene locus_tag LOCUS_11820 9095 9334 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_11820 9348 10595 gene locus_tag LOCUS_11830 gene fabF 9348 10595 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_11830 10613 11353 gene locus_tag LOCUS_11840 10613 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 11356 13182 gene locus_tag LOCUS_11850 gene nadE 11356 13182 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_11850 13210 14415 gene locus_tag LOCUS_11860 13210 14415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 14531 14908 gene locus_tag LOCUS_11870 14531 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 15207 14977 gene locus_tag LOCUS_11880 gene yidD 15207 14977 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_11880 <15998 15210 gene locus_tag LOCUS_11890 <15998 15210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963213.1:alanine dehydrogenase >Feature sequence059 325 122 gene locus_tag LOCUS_11900 325 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 985 1641 gene locus_tag LOCUS_11910 985 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2274 1645 gene locus_tag LOCUS_11920 2274 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2433 4133 gene locus_tag LOCUS_11930 gene ggt 2433 4133 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_11930 5884 4991 gene locus_tag LOCUS_11940 5884 4991 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066162.1 protein_id gnl|my_center|LOCUS_11940 6436 5888 gene locus_tag LOCUS_11950 6436 5888 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963538.1 protein_id gnl|my_center|LOCUS_11950 8255 6468 gene locus_tag LOCUS_11960 gene argS 8255 6468 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_11960 9232 8261 gene locus_tag LOCUS_11970 9232 8261 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_11970 10116 9202 gene locus_tag LOCUS_11980 10116 9202 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_11980 10362 11120 gene locus_tag LOCUS_11990 10362 11120 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_11990 11184 12050 gene locus_tag LOCUS_12000 11184 12050 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531695.1 protein_id gnl|my_center|LOCUS_12000 12126 13226 gene locus_tag LOCUS_12010 12126 13226 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065470411.1 protein_id gnl|my_center|LOCUS_12010 13297 13740 gene locus_tag LOCUS_12020 13297 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 13939 15027 gene locus_tag LOCUS_12030 gene gcvT 13939 15027 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_12030 15033 15515 gene locus_tag LOCUS_12040 15033 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence060 940 416 gene locus_tag LOCUS_12050 940 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1815 940 gene locus_tag LOCUS_12060 1815 940 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_12060 2748 1945 gene locus_tag LOCUS_12070 2748 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 3638 2748 gene locus_tag LOCUS_12080 3638 2748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_12080 4120 3629 gene locus_tag LOCUS_12090 4120 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 4695 4192 gene locus_tag LOCUS_12100 4695 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 5269 4730 gene locus_tag LOCUS_12110 5269 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 5784 5266 gene locus_tag LOCUS_12120 5784 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769198.1 protein_id gnl|my_center|LOCUS_12120 6286 5765 gene locus_tag LOCUS_12130 6286 5765 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_12130 7180 6431 gene locus_tag LOCUS_12140 7180 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 7303 8973 gene locus_tag LOCUS_12150 7303 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 9056 10675 gene locus_tag LOCUS_12160 9056 10675 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_12160 11705 11166 gene locus_tag LOCUS_12170 11705 11166 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_12170 12519 11950 gene locus_tag LOCUS_12180 12519 11950 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_12180 12914 12612 gene locus_tag LOCUS_12190 12914 12612 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404036.1 protein_id gnl|my_center|LOCUS_12190 13616 13023 gene locus_tag LOCUS_12200 13616 13023 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_12200 15637 13685 gene locus_tag LOCUS_12210 15637 13685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence061 773 72 gene locus_tag LOCUS_12220 773 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1132 2106 gene locus_tag LOCUS_12230 1132 2106 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_12230 2117 4426 gene locus_tag LOCUS_12240 2117 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 4431 5264 gene locus_tag LOCUS_12250 4431 5264 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_12250 5261 6007 gene locus_tag LOCUS_12260 5261 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 6020 8020 gene locus_tag LOCUS_12270 6020 8020 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_12270 8020 8589 gene locus_tag LOCUS_12280 8020 8589 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_12280 8590 9174 gene locus_tag LOCUS_12290 8590 9174 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070530.1 protein_id gnl|my_center|LOCUS_12290 9217 9792 gene locus_tag LOCUS_12300 9217 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 9931 10446 gene locus_tag LOCUS_12310 9931 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 11727 10450 gene locus_tag LOCUS_12320 gene tyrS 11727 10450 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_12320 11907 12881 gene locus_tag LOCUS_12330 11907 12881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 12887 13657 gene locus_tag LOCUS_12340 12887 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 13654 14595 gene locus_tag LOCUS_12350 gene miaA 13654 14595 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_12350 15282 14629 gene locus_tag LOCUS_12360 15282 14629 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963065.1 protein_id gnl|my_center|LOCUS_12360 15715 15476 gene locus_tag LOCUS_12370 15715 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence062 126 737 gene locus_tag LOCUS_12380 126 737 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_12380 734 1915 gene locus_tag LOCUS_12390 gene trpB 734 1915 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_12390 1908 2687 gene locus_tag LOCUS_12400 gene trpA 1908 2687 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_12400 2777 4144 gene locus_tag LOCUS_12410 2777 4144 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_12410 4240 4725 gene locus_tag LOCUS_12420 4240 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 4732 5712 gene locus_tag LOCUS_12430 4732 5712 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175128.1 protein_id gnl|my_center|LOCUS_12430 6084 5719 gene locus_tag LOCUS_12440 6084 5719 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812026.1 protein_id gnl|my_center|LOCUS_12440 6128 6514 gene locus_tag LOCUS_12450 gene trxA 6128 6514 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_12450 6569 6931 gene locus_tag LOCUS_12460 6569 6931 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389737.1 protein_id gnl|my_center|LOCUS_12460 7111 7890 gene locus_tag LOCUS_12470 7111 7890 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286976.1 protein_id gnl|my_center|LOCUS_12470 8037 8657 gene locus_tag LOCUS_12480 8037 8657 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_12480 8753 9787 gene locus_tag LOCUS_12490 8753 9787 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920726.1 protein_id gnl|my_center|LOCUS_12490 9803 10840 gene locus_tag LOCUS_12500 9803 10840 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_12500 10873 12180 gene locus_tag LOCUS_12510 10873 12180 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_12510 14396 12333 gene locus_tag LOCUS_12520 14396 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence063 404 817 gene locus_tag LOCUS_12530 404 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1631 801 gene locus_tag LOCUS_12540 1631 801 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071980.1 protein_id gnl|my_center|LOCUS_12540 1747 2376 gene locus_tag LOCUS_12550 1747 2376 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_12550 2670 3923 gene locus_tag LOCUS_12560 2670 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3938 5266 gene locus_tag LOCUS_12570 3938 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 6554 5331 gene locus_tag LOCUS_12580 6554 5331 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_12580 7153 6563 gene locus_tag LOCUS_12590 7153 6563 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459507.1 protein_id gnl|my_center|LOCUS_12590 7272 7760 gene locus_tag LOCUS_12600 gene msrB 7272 7760 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070109.1 protein_id gnl|my_center|LOCUS_12600 8139 7801 gene locus_tag LOCUS_12610 gene arsC 8139 7801 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_12610 8687 8145 gene locus_tag LOCUS_12620 gene hslV 8687 8145 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932864.1 protein_id gnl|my_center|LOCUS_12620 9735 8782 gene locus_tag LOCUS_12630 9735 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 11436 9769 gene locus_tag LOCUS_12640 11436 9769 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_12640 14462 11562 gene locus_tag LOCUS_12650 14462 11562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157307892.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence064 <1 1071 gene locus_tag LOCUS_12660 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932966.1:magnesium chelatase ATPase subunit I 1068 2933 gene locus_tag LOCUS_12670 gene bchD 1068 2933 CDS product magnesium chelatase ATPase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932965.1 protein_id gnl|my_center|LOCUS_12670 3098 3790 gene locus_tag LOCUS_12680 3098 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3791 4300 gene locus_tag LOCUS_12690 3791 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 <15128 4387 gene locus_tag LOCUS_12700 <15128 4387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966116.1:FecR domain-containing protein >Feature sequence065 2642 1434 gene locus_tag LOCUS_12710 2642 1434 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_12710 2779 3831 gene locus_tag LOCUS_12720 gene aroB 2779 3831 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_12720 4021 3824 gene locus_tag LOCUS_12730 4021 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4140 5369 gene locus_tag LOCUS_12740 gene aroA 4140 5369 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303115.1 protein_id gnl|my_center|LOCUS_12740 7477 5774 gene locus_tag LOCUS_12750 7477 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 7547 8179 gene locus_tag LOCUS_12760 7547 8179 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933512.1 protein_id gnl|my_center|LOCUS_12760 8775 8176 gene locus_tag LOCUS_12770 8775 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 9429 8812 gene locus_tag LOCUS_12780 9429 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 9907 9464 gene locus_tag LOCUS_12790 9907 9464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 10219 11025 gene locus_tag LOCUS_12800 10219 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 11006 11359 gene locus_tag LOCUS_12810 11006 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 11368 11781 gene locus_tag LOCUS_12820 11368 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 14945 11820 gene locus_tag LOCUS_12830 14945 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence066 <1 2393 gene locus_tag LOCUS_12840 <1 2393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:fibronectin type III domain-containing protein 3433 2426 gene locus_tag LOCUS_12850 3433 2426 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_12850 3522 3833 gene locus_tag LOCUS_12860 3522 3833 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_12860 4767 3838 gene locus_tag LOCUS_12870 4767 3838 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_12870 4908 5255 gene locus_tag LOCUS_12880 4908 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 5368 6465 gene locus_tag LOCUS_12890 gene ychF 5368 6465 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_12890 6689 7444 gene locus_tag LOCUS_12900 6689 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 8693 7422 gene locus_tag LOCUS_12910 8693 7422 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404472.1 protein_id gnl|my_center|LOCUS_12910 8788 9345 gene locus_tag LOCUS_12920 8788 9345 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_12920 9342 10514 gene locus_tag LOCUS_12930 9342 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 10778 11536 gene locus_tag LOCUS_12940 10778 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 11762 12448 gene locus_tag LOCUS_12950 11762 12448 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_12950 <15029 12466 gene locus_tag LOCUS_12960 <15029 12466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173072481.1:ATP-binding cassette domain-containing protein >Feature sequence067 866 171 gene locus_tag LOCUS_12970 gene rsmI 866 171 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_12970 1558 863 gene locus_tag LOCUS_12980 1558 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1905 1636 gene locus_tag LOCUS_12990 1905 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4035 1927 gene locus_tag LOCUS_13000 4035 1927 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_13000 5459 4155 gene locus_tag LOCUS_13010 5459 4155 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_13010 5706 5452 gene locus_tag LOCUS_13020 5706 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6256 5696 gene locus_tag LOCUS_13030 6256 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 7569 6259 gene locus_tag LOCUS_13040 7569 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 8856 7585 gene locus_tag LOCUS_13050 8856 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 9598 8843 gene locus_tag LOCUS_13060 9598 8843 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_13060 9743 11227 gene locus_tag LOCUS_13070 9743 11227 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986831.1 protein_id gnl|my_center|LOCUS_13070 11304 11567 gene locus_tag LOCUS_13080 11304 11567 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356062.1 protein_id gnl|my_center|LOCUS_13080 11568 13625 gene locus_tag LOCUS_13090 gene feoB 11568 13625 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_13090 14545 13634 gene locus_tag LOCUS_13100 14545 13634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence068 3027 853 gene locus_tag LOCUS_13110 3027 853 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_13110 3636 3127 gene locus_tag LOCUS_13120 3636 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4241 3633 gene locus_tag LOCUS_13130 4241 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 5564 4590 gene locus_tag LOCUS_13140 5564 4590 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_13140 5648 6388 gene locus_tag LOCUS_13150 5648 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 6839 7846 gene locus_tag LOCUS_13160 6839 7846 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_13160 8757 7843 gene locus_tag LOCUS_13170 8757 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 9306 8818 gene locus_tag LOCUS_13180 9306 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 9368 9979 gene locus_tag LOCUS_13190 9368 9979 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_13190 10020 12230 gene locus_tag LOCUS_13200 10020 12230 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_13200 12274 14448 gene locus_tag LOCUS_13210 12274 14448 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence069 1568 534 gene locus_tag LOCUS_13220 1568 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1656 2921 gene locus_tag LOCUS_13230 gene tviB 1656 2921 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_13230 3466 2918 gene locus_tag LOCUS_13240 gene rfbC 3466 2918 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_13240 4323 3463 gene locus_tag LOCUS_13250 gene rfbA 4323 3463 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_13250 5331 4375 gene locus_tag LOCUS_13260 5331 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 6503 5328 gene locus_tag LOCUS_13270 6503 5328 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554710.1 protein_id gnl|my_center|LOCUS_13270 7565 6531 gene locus_tag LOCUS_13280 7565 6531 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_13280 7922 7566 gene locus_tag LOCUS_13290 7922 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 7803 8141 gene locus_tag LOCUS_13300 7803 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 8689 8198 gene locus_tag LOCUS_13310 8689 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 9194 8709 gene locus_tag LOCUS_13320 9194 8709 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_13320 9676 9203 gene locus_tag LOCUS_13330 9676 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 10645 9776 gene locus_tag LOCUS_13340 gene nadC 10645 9776 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_13340 11052 10651 gene locus_tag LOCUS_13350 11052 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 11167 12702 gene locus_tag LOCUS_13360 gene gpmI 11167 12702 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_13360 12695 13285 gene locus_tag LOCUS_13370 12695 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 13594 13289 gene locus_tag LOCUS_13380 13594 13289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 <14476 13831 gene locus_tag LOCUS_13390 <14476 13831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044233708.1:PmeII family type II restriction endonuclease >Feature sequence070 3032 744 gene locus_tag LOCUS_13400 3032 744 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_13400 5513 3051 gene locus_tag LOCUS_13410 5513 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 5708 6571 gene locus_tag LOCUS_13420 5708 6571 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_13420 6577 7032 gene locus_tag LOCUS_13430 6577 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 6968 7210 gene locus_tag LOCUS_13440 6968 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 7224 7577 gene locus_tag LOCUS_13450 7224 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 7647 8681 gene locus_tag LOCUS_13460 gene atpB 7647 8681 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964549.1 protein_id gnl|my_center|LOCUS_13460 8718 8960 gene locus_tag LOCUS_13470 8718 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 9030 9524 gene locus_tag LOCUS_13480 9030 9524 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_13480 9527 10063 gene locus_tag LOCUS_13490 gene atpH 9527 10063 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_13490 10086 11666 gene locus_tag LOCUS_13500 gene atpA 10086 11666 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_13500 11679 12548 gene locus_tag LOCUS_13510 11679 12548 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_13510 12644 13471 gene locus_tag LOCUS_13520 12644 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 13465 14085 gene locus_tag LOCUS_13530 13465 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence071 222 872 gene locus_tag LOCUS_13540 222 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 876 1904 gene locus_tag LOCUS_13550 876 1904 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_13550 1972 2727 gene locus_tag LOCUS_13560 1972 2727 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_13560 2882 3478 gene locus_tag LOCUS_13570 2882 3478 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_13570 3487 4488 gene locus_tag LOCUS_13580 3487 4488 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 protein_id gnl|my_center|LOCUS_13580 4617 7976 gene locus_tag LOCUS_13590 4617 7976 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_13590 8136 10034 gene locus_tag LOCUS_13600 gene htpG 8136 10034 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_13600 10109 10867 gene locus_tag LOCUS_13610 gene lipB 10109 10867 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_13610 11398 11706 gene locus_tag LOCUS_13620 11398 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 11855 12370 gene locus_tag LOCUS_13630 11855 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 <14258 12432 gene locus_tag LOCUS_13640 <14258 12432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141063.1:CHAT domain-containing protein >Feature sequence072 280 113 gene locus_tag LOCUS_13650 280 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1068 319 gene locus_tag LOCUS_13660 1068 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1948 1052 gene locus_tag LOCUS_13670 1948 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2560 3144 gene locus_tag LOCUS_13680 2560 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 3137 3418 gene locus_tag LOCUS_13690 3137 3418 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_13690 3470 4255 gene locus_tag LOCUS_13700 3470 4255 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103020948.1 protein_id gnl|my_center|LOCUS_13700 4256 6415 gene locus_tag LOCUS_13710 4256 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 6549 7349 gene locus_tag LOCUS_13720 6549 7349 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_13720 7412 8740 gene locus_tag LOCUS_13730 7412 8740 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_13730 8839 11265 gene locus_tag LOCUS_13740 8839 11265 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence073 1540 800 gene locus_tag LOCUS_13750 gene paaC 1540 800 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_13750 2151 1552 gene locus_tag LOCUS_13760 2151 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3149 2157 gene locus_tag LOCUS_13770 gene paaA 3149 2157 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_13770 3729 3151 gene locus_tag LOCUS_13780 3729 3151 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_13780 3843 4325 gene locus_tag LOCUS_13790 3843 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 4331 4585 gene locus_tag LOCUS_13800 4331 4585 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789182.1 protein_id gnl|my_center|LOCUS_13800 5642 4611 gene locus_tag LOCUS_13810 5642 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 6332 5649 gene locus_tag LOCUS_13820 6332 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 6907 6329 gene locus_tag LOCUS_13830 6907 6329 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_13830 9413 6981 gene locus_tag LOCUS_13840 9413 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 9772 9410 gene locus_tag LOCUS_13850 9772 9410 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813353.1 protein_id gnl|my_center|LOCUS_13850 10589 9972 gene locus_tag LOCUS_13860 10589 9972 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_13860 11446 10586 gene locus_tag LOCUS_13870 11446 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 11534 12415 gene locus_tag LOCUS_13880 11534 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 12412 13296 gene locus_tag LOCUS_13890 gene wapR 12412 13296 CDS product alpha-1,3-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114547.1 protein_id gnl|my_center|LOCUS_13890 <14194 13277 gene locus_tag LOCUS_13900 <14194 13277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:OmpA family protein >Feature sequence074 <1 1924 gene locus_tag LOCUS_13910 <1 1924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073389.1:pitrilysin family protein 2252 2025 gene locus_tag LOCUS_13920 2252 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3502 2252 gene locus_tag LOCUS_13930 3502 2252 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_13930 5414 3540 gene locus_tag LOCUS_13940 5414 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 6753 5482 gene locus_tag LOCUS_13950 6753 5482 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_13950 7710 6802 gene locus_tag LOCUS_13960 gene cysD 7710 6802 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_13960 8309 7713 gene locus_tag LOCUS_13970 gene cysC 8309 7713 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_13970 9126 8302 gene locus_tag LOCUS_13980 gene cysQ 9126 8302 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628026.1 protein_id gnl|my_center|LOCUS_13980 10387 9119 gene locus_tag LOCUS_13990 10387 9119 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_13990 11664 10657 gene locus_tag LOCUS_14000 11664 10657 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969498.1 protein_id gnl|my_center|LOCUS_14000 13257 11665 gene locus_tag LOCUS_14010 13257 11665 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920632.1 protein_id gnl|my_center|LOCUS_14010 <14147 13267 gene locus_tag LOCUS_14020 <14147 13267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389819.1:dihydrodipicolinate synthase family protein >Feature sequence075 386 1882 gene locus_tag LOCUS_14030 386 1882 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_14030 1884 3044 gene locus_tag LOCUS_14040 1884 3044 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_14040 3044 4360 gene locus_tag LOCUS_14050 gene rseP 3044 4360 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_14050 4372 5397 gene locus_tag LOCUS_14060 4372 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_14060 7662 5377 gene locus_tag LOCUS_14070 7662 5377 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_14070 7824 8255 gene locus_tag LOCUS_14080 7824 8255 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_14080 8252 8548 gene locus_tag LOCUS_14090 8252 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 8897 8598 gene locus_tag LOCUS_14100 8897 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 9240 8890 gene locus_tag LOCUS_14110 9240 8890 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_14110 10425 9343 gene locus_tag LOCUS_14120 10425 9343 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214278.1 protein_id gnl|my_center|LOCUS_14120 11045 10425 gene locus_tag LOCUS_14130 11045 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 11751 11170 gene locus_tag LOCUS_14140 11751 11170 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_14140 11865 12659 gene locus_tag LOCUS_14150 11865 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 12681 13331 gene locus_tag LOCUS_14160 12681 13331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 13698 13351 gene locus_tag LOCUS_14170 13698 13351 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence076 192 1841 gene locus_tag LOCUS_14180 gene merA 192 1841 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031939.1 protein_id gnl|my_center|LOCUS_14180 1854 2078 gene locus_tag LOCUS_14190 1854 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2987 2085 gene locus_tag LOCUS_14200 2987 2085 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_14200 3448 2984 gene locus_tag LOCUS_14210 3448 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3809 3558 gene locus_tag LOCUS_14220 3809 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 4215 4406 gene locus_tag LOCUS_14230 4215 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4485 5111 gene locus_tag LOCUS_14240 4485 5111 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_14240 5121 5474 gene locus_tag LOCUS_14250 5121 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 9215 5550 gene locus_tag LOCUS_14260 9215 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 9468 10118 gene locus_tag LOCUS_14270 9468 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 10136 10600 gene locus_tag LOCUS_14280 10136 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 13267 10826 gene locus_tag LOCUS_14290 13267 10826 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence077 663 226 gene locus_tag LOCUS_14300 663 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2069 1026 gene locus_tag LOCUS_14310 gene arsB 2069 1026 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162498585.1 protein_id gnl|my_center|LOCUS_14310 2695 2072 gene locus_tag LOCUS_14320 2695 2072 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_14320 3602 2718 gene locus_tag LOCUS_14330 3602 2718 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_14330 3953 3621 gene locus_tag LOCUS_14340 3953 3621 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_14340 4859 4086 gene locus_tag LOCUS_14350 4859 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 5805 4939 gene locus_tag LOCUS_14360 5805 4939 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444000.1 protein_id gnl|my_center|LOCUS_14360 5951 6316 gene locus_tag LOCUS_14370 5951 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 6458 6703 gene locus_tag LOCUS_14380 6458 6703 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_14380 8275 6770 gene locus_tag LOCUS_14390 8275 6770 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_14390 8799 8392 gene locus_tag LOCUS_14400 8799 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 9107 9727 gene locus_tag LOCUS_14410 9107 9727 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_14410 10267 11091 gene locus_tag LOCUS_14420 10267 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 11092 11922 gene locus_tag LOCUS_14430 11092 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence078 365 1129 gene locus_tag LOCUS_14440 365 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1163 3448 gene locus_tag LOCUS_14450 1163 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 3572 6274 gene locus_tag LOCUS_14460 3572 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6274 8352 gene locus_tag LOCUS_14470 6274 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 8511 8594 gene locus_tag LOCUS_t00180 8511 8594 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 8669 8742 gene locus_tag LOCUS_t00190 8669 8742 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8790 8862 gene locus_tag LOCUS_t00200 8790 8862 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8969 10156 gene locus_tag LOCUS_14480 gene tuf 8969 10156 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_14480 10269 10342 gene locus_tag LOCUS_t00210 10269 10342 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 10365 10556 gene locus_tag LOCUS_14490 gene secE 10365 10556 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_14490 10569 11123 gene locus_tag LOCUS_14500 gene nusG 10569 11123 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_14500 11136 11582 gene locus_tag LOCUS_14510 gene rplK 11136 11582 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_14510 11592 12290 gene locus_tag LOCUS_14520 gene rplA 11592 12290 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_14520 12293 12829 gene locus_tag LOCUS_14530 gene rplJ 12293 12829 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_14530 12862 13248 gene locus_tag LOCUS_14540 gene rplL 12862 13248 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782165.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence079 1604 396 gene locus_tag LOCUS_14550 1604 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1936 1658 gene locus_tag LOCUS_14560 1936 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2238 2023 gene locus_tag LOCUS_14570 2238 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 3294 2458 gene locus_tag LOCUS_14580 3294 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 3375 4805 gene locus_tag LOCUS_14590 3375 4805 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_14590 7368 4807 gene locus_tag LOCUS_14600 7368 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 8835 7498 gene locus_tag LOCUS_14610 8835 7498 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_14610 10133 8832 gene locus_tag LOCUS_14620 gene kynU 10133 8832 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_14620 11271 10249 gene locus_tag LOCUS_14630 11271 10249 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_14630 11783 11268 gene locus_tag LOCUS_14640 11783 11268 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964325.1 protein_id gnl|my_center|LOCUS_14640 11893 12705 gene locus_tag LOCUS_14650 11893 12705 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479969.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence080 3427 4059 gene locus_tag LOCUS_14660 3427 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 4130 5173 gene locus_tag LOCUS_14670 4130 5173 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138280268.1 protein_id gnl|my_center|LOCUS_14670 5420 8581 gene locus_tag LOCUS_14680 5420 8581 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176521608.1 protein_id gnl|my_center|LOCUS_14680 8606 9955 gene locus_tag LOCUS_14690 8606 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 10070 12559 gene locus_tag LOCUS_14700 10070 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_14700 <13265 12580 gene locus_tag LOCUS_14710 <13265 12580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964479.1:serine hydrolase >Feature sequence081 <1 566 gene locus_tag LOCUS_14720 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016944168.1:queuosine precursor transporter 575 1993 gene locus_tag LOCUS_14730 575 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 3182 2553 gene locus_tag LOCUS_14740 3182 2553 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831548.1 protein_id gnl|my_center|LOCUS_14740 6270 3220 gene locus_tag LOCUS_14750 6270 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_14750 6878 7093 gene locus_tag LOCUS_14760 6878 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 7927 7223 gene locus_tag LOCUS_14770 7927 7223 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_14770 7962 8597 gene locus_tag LOCUS_14780 gene pyrE 7962 8597 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_14780 10846 8603 gene locus_tag LOCUS_14790 10846 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 11337 11137 gene locus_tag LOCUS_14800 11337 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 12575 11541 gene locus_tag LOCUS_14810 12575 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence082 930 6137 gene locus_tag LOCUS_14820 930 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 6225 7193 gene locus_tag LOCUS_14830 gene mltB 6225 7193 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_14830 7248 9359 gene locus_tag LOCUS_14840 7248 9359 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021631.1 protein_id gnl|my_center|LOCUS_14840 9361 9702 gene locus_tag LOCUS_14850 9361 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 9702 10757 gene locus_tag LOCUS_14860 9702 10757 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462750.1 protein_id gnl|my_center|LOCUS_14860 10750 11154 gene locus_tag LOCUS_14870 10750 11154 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_14870 11151 12596 gene locus_tag LOCUS_14880 11151 12596 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence083 4012 791 gene locus_tag LOCUS_14890 4012 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 5116 4067 gene locus_tag LOCUS_14900 5116 4067 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_14900 5174 5818 gene locus_tag LOCUS_14910 5174 5818 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_14910 5823 6485 gene locus_tag LOCUS_14920 5823 6485 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099200.1 protein_id gnl|my_center|LOCUS_14920 6525 9893 gene locus_tag LOCUS_14930 gene porU 6525 9893 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_14930 9900 11138 gene locus_tag LOCUS_14940 gene porV 9900 11138 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_14940 11140 12399 gene locus_tag LOCUS_14950 11140 12399 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_14950 12683 12577 gene locus_tag LOCUS_r00010 12683 12577 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence084 1947 865 gene locus_tag LOCUS_14960 1947 865 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_14960 6238 1940 gene locus_tag LOCUS_14970 6238 1940 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203498.1 protein_id gnl|my_center|LOCUS_14970 6814 7011 gene locus_tag LOCUS_14980 6814 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 6960 7202 gene locus_tag LOCUS_14990 6960 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 7327 8052 gene locus_tag LOCUS_15000 7327 8052 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_15000 8045 9706 gene locus_tag LOCUS_15010 8045 9706 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_15010 9714 11024 gene locus_tag LOCUS_15020 9714 11024 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_15020 11025 12410 gene locus_tag LOCUS_15030 11025 12410 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence085 1179 391 gene locus_tag LOCUS_15040 gene ispE 1179 391 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_15040 2003 1188 gene locus_tag LOCUS_15050 2003 1188 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_15050 5448 2191 gene locus_tag LOCUS_15060 5448 2191 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_15060 7532 5604 gene locus_tag LOCUS_15070 gene dnaK 7532 5604 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_15070 8458 7679 gene locus_tag LOCUS_15080 8458 7679 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889135.1 protein_id gnl|my_center|LOCUS_15080 9103 8480 gene locus_tag LOCUS_15090 9103 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 10560 9103 gene locus_tag LOCUS_15100 gene rpoN 10560 9103 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_15100 10751 12157 gene locus_tag LOCUS_15110 gene asnS 10751 12157 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence086 3504 2497 gene locus_tag LOCUS_15120 3504 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15120 3810 5708 gene locus_tag LOCUS_15130 3810 5708 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_15130 5709 6686 gene locus_tag LOCUS_15140 gene astE 5709 6686 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368506.1 protein_id gnl|my_center|LOCUS_15140 6723 7130 gene locus_tag LOCUS_15150 6723 7130 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_15150 7093 7776 gene locus_tag LOCUS_15160 gene folE 7093 7776 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_15160 7915 10128 gene locus_tag LOCUS_15170 7915 10128 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_15170 10202 10627 gene locus_tag LOCUS_15180 10202 10627 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008612795.1 protein_id gnl|my_center|LOCUS_15180 10946 11485 gene locus_tag LOCUS_15190 10946 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 11487 12344 gene locus_tag LOCUS_15200 11487 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence087 <1 845 gene locus_tag LOCUS_15210 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962614.1:threonine ammonia-lyase IlvA 1032 2123 gene locus_tag LOCUS_15220 1032 2123 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_15220 2309 2740 gene locus_tag LOCUS_15230 2309 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 3126 3974 gene locus_tag LOCUS_15240 3126 3974 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_15240 3975 5156 gene locus_tag LOCUS_15250 3975 5156 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962425.1 protein_id gnl|my_center|LOCUS_15250 5126 6040 gene locus_tag LOCUS_15260 5126 6040 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_15260 6037 7143 gene locus_tag LOCUS_15270 6037 7143 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_15270 7192 7485 gene locus_tag LOCUS_15280 gene trxA 7192 7485 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963919.1 protein_id gnl|my_center|LOCUS_15280 7578 8969 gene locus_tag LOCUS_15290 7578 8969 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_15290 9033 12158 gene locus_tag LOCUS_15300 9033 12158 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence088 <1 2475 gene locus_tag LOCUS_15310 <1 2475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208256196.1:exo-alpha-sialidase 2526 3647 gene locus_tag LOCUS_15320 2526 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4793 3663 gene locus_tag LOCUS_15330 4793 3663 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_15330 5433 4843 gene locus_tag LOCUS_15340 5433 4843 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 protein_id gnl|my_center|LOCUS_15340 6517 5426 gene locus_tag LOCUS_15350 6517 5426 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_15350 7792 6521 gene locus_tag LOCUS_15360 gene dacB 7792 6521 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217314.1 protein_id gnl|my_center|LOCUS_15360 10983 8443 gene locus_tag LOCUS_15370 10983 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence089 129 2504 gene locus_tag LOCUS_15380 129 2504 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964303.1 protein_id gnl|my_center|LOCUS_15380 2501 3313 gene locus_tag LOCUS_15390 2501 3313 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_15390 4671 3373 gene locus_tag LOCUS_15400 gene ahcY 4671 3373 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_15400 4731 6332 gene locus_tag LOCUS_15410 4731 6332 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858148.1 protein_id gnl|my_center|LOCUS_15410 6319 6984 gene locus_tag LOCUS_15420 6319 6984 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078432.1 protein_id gnl|my_center|LOCUS_15420 6977 7729 gene locus_tag LOCUS_15430 6977 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 7732 8622 gene locus_tag LOCUS_15440 7732 8622 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767582.1 protein_id gnl|my_center|LOCUS_15440 9720 8602 gene locus_tag LOCUS_15450 9720 8602 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_15450 9819 10778 gene locus_tag LOCUS_15460 9819 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence090 1665 3419 gene locus_tag LOCUS_15470 1665 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3543 4658 gene locus_tag LOCUS_15480 3543 4658 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_15480 5445 4894 gene locus_tag LOCUS_15490 5445 4894 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_15490 5667 5593 gene locus_tag LOCUS_t00220 5667 5593 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6117 6042 gene locus_tag LOCUS_t00230 6117 6042 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6318 6227 gene locus_tag LOCUS_t00240 6318 6227 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6453 7214 gene locus_tag LOCUS_15500 6453 7214 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108120.1 protein_id gnl|my_center|LOCUS_15500 7227 9041 gene locus_tag LOCUS_15510 7227 9041 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_15510 11223 9502 gene locus_tag LOCUS_15520 11223 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 11359 11841 gene locus_tag LOCUS_15530 11359 11841 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence091 <1 1239 gene locus_tag LOCUS_15540 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964158.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 1223 2386 gene locus_tag LOCUS_15550 1223 2386 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061084.1 protein_id gnl|my_center|LOCUS_15550 2467 3507 gene locus_tag LOCUS_15560 gene murG 2467 3507 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_15560 3504 4877 gene locus_tag LOCUS_15570 gene murC 3504 4877 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_15570 4865 5623 gene locus_tag LOCUS_15580 4865 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 5643 6938 gene locus_tag LOCUS_15590 gene ftsA 5643 6938 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_15590 6967 8493 gene locus_tag LOCUS_15600 6967 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 <11935 8648 gene locus_tag LOCUS_15610 <11935 8648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199111712.1:T9SS type A sorting domain-containing protein >Feature sequence092 1945 110 gene locus_tag LOCUS_15620 gene glmS 1945 110 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_15620 3370 1958 gene locus_tag LOCUS_15630 3370 1958 CDS product DUF4270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769575.1 protein_id gnl|my_center|LOCUS_15630 4241 3363 gene locus_tag LOCUS_15640 4241 3363 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_15640 4298 5164 gene locus_tag LOCUS_15650 gene panC 4298 5164 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_15650 5145 5492 gene locus_tag LOCUS_15660 5145 5492 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962286.1 protein_id gnl|my_center|LOCUS_15660 5495 6520 gene locus_tag LOCUS_15670 5495 6520 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_15670 6522 7217 gene locus_tag LOCUS_15680 6522 7217 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_15680 7248 8387 gene locus_tag LOCUS_15690 7248 8387 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_15690 8510 9430 gene locus_tag LOCUS_15700 8510 9430 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_15700 10141 9413 gene locus_tag LOCUS_15710 10141 9413 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_15710 10509 10141 gene locus_tag LOCUS_15720 10509 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 10876 10499 gene locus_tag LOCUS_15730 10876 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence093 751 1761 gene locus_tag LOCUS_15740 751 1761 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_15740 2029 4404 gene locus_tag LOCUS_15750 2029 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 4407 5765 gene locus_tag LOCUS_15760 4407 5765 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_15760 5762 7252 gene locus_tag LOCUS_15770 5762 7252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_15770 7236 7949 gene locus_tag LOCUS_15780 gene pgmB 7236 7949 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387394.1 protein_id gnl|my_center|LOCUS_15780 7930 10266 gene locus_tag LOCUS_15790 7930 10266 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_15790 10406 11254 gene locus_tag LOCUS_15800 10406 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence094 564 1442 gene locus_tag LOCUS_15810 564 1442 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_15810 1501 2931 gene locus_tag LOCUS_15820 1501 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3355 2936 gene locus_tag LOCUS_15830 3355 2936 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_15830 5011 3467 gene locus_tag LOCUS_15840 5011 3467 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_15840 7274 5871 gene locus_tag LOCUS_15850 7274 5871 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_15850 8280 7891 gene locus_tag LOCUS_15860 8280 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 8581 9864 gene locus_tag LOCUS_15870 8581 9864 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_15870 9993 10067 gene locus_tag LOCUS_t00250 9993 10067 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10945 10331 gene locus_tag LOCUS_15880 10945 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 11672 11214 gene locus_tag LOCUS_15890 11672 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence095 <1 750 gene locus_tag LOCUS_15900 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788929.1:efflux RND transporter periplasmic adaptor subunit 801 3908 gene locus_tag LOCUS_15910 801 3908 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_15910 3910 5349 gene locus_tag LOCUS_15920 3910 5349 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_15920 6381 5350 gene locus_tag LOCUS_15930 6381 5350 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_15930 7004 6456 gene locus_tag LOCUS_15940 7004 6456 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_15940 8381 7044 gene locus_tag LOCUS_15950 8381 7044 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_15950 9164 8454 gene locus_tag LOCUS_15960 9164 8454 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_15960 9768 9376 gene locus_tag LOCUS_15970 9768 9376 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080552.1 protein_id gnl|my_center|LOCUS_15970 10082 9765 gene locus_tag LOCUS_15980 10082 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 10251 10754 gene locus_tag LOCUS_15990 gene tpx 10251 10754 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_15990 10770 11183 gene locus_tag LOCUS_16000 10770 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence096 115 312 gene locus_tag LOCUS_16010 115 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 981 316 gene locus_tag LOCUS_16020 981 316 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_16020 2267 993 gene locus_tag LOCUS_16030 2267 993 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403282.1 protein_id gnl|my_center|LOCUS_16030 3158 2325 gene locus_tag LOCUS_16040 3158 2325 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_16040 3348 3139 gene locus_tag LOCUS_16050 3348 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4267 3323 gene locus_tag LOCUS_16060 4267 3323 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840143.1 protein_id gnl|my_center|LOCUS_16060 4352 5347 gene locus_tag LOCUS_16070 gene dusB 4352 5347 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_16070 5344 6228 gene locus_tag LOCUS_16080 5344 6228 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_16080 6498 7655 gene locus_tag LOCUS_16090 6498 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 7745 9661 gene locus_tag LOCUS_16100 7745 9661 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_16100 9639 10616 gene locus_tag LOCUS_16110 9639 10616 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_16110 10670 11722 gene locus_tag LOCUS_16120 10670 11722 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence097 154 951 gene locus_tag LOCUS_16130 154 951 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_16130 923 1798 gene locus_tag LOCUS_16140 923 1798 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_16140 1795 2373 gene locus_tag LOCUS_16150 gene purN 1795 2373 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_16150 2440 3963 gene locus_tag LOCUS_16160 gene purH 2440 3963 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_16160 4080 5105 gene locus_tag LOCUS_16170 4080 5105 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_16170 5107 5916 gene locus_tag LOCUS_16180 5107 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 5913 6428 gene locus_tag LOCUS_16190 5913 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 6425 8242 gene locus_tag LOCUS_16200 gene mrdA 6425 8242 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_16200 8242 9513 gene locus_tag LOCUS_16210 gene rodA 8242 9513 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_16210 11068 10007 gene locus_tag LOCUS_16220 11068 10007 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence098 1616 864 gene locus_tag LOCUS_16230 1616 864 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_16230 2187 1603 gene locus_tag LOCUS_16240 2187 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2298 3224 gene locus_tag LOCUS_16250 2298 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3588 4205 gene locus_tag LOCUS_16260 3588 4205 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_16260 4192 5394 gene locus_tag LOCUS_16270 4192 5394 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_16270 5381 6355 gene locus_tag LOCUS_16280 gene argC 5381 6355 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_16280 6364 7170 gene locus_tag LOCUS_16290 gene proC 6364 7170 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_16290 7167 8300 gene locus_tag LOCUS_16300 7167 8300 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_16300 8314 9276 gene locus_tag LOCUS_16310 8314 9276 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_16310 9263 10036 gene locus_tag LOCUS_16320 gene argB 9263 10036 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence099 1950 2747 gene locus_tag LOCUS_16330 1950 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 3015 3173 gene locus_tag LOCUS_16340 3015 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 4947 3562 gene locus_tag LOCUS_16350 4947 3562 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778115.1 protein_id gnl|my_center|LOCUS_16350 5862 5011 gene locus_tag LOCUS_16360 gene prmC 5862 5011 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_16360 5954 6301 gene locus_tag LOCUS_16370 5954 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 8441 6456 gene locus_tag LOCUS_16380 8441 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 8604 10748 gene locus_tag LOCUS_16390 8604 10748 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012792659.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence100 1764 472 gene locus_tag LOCUS_16400 1764 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1890 3845 gene locus_tag LOCUS_16410 gene gyrB 1890 3845 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_16410 3901 4590 gene locus_tag LOCUS_16420 3901 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 6344 5289 gene locus_tag LOCUS_16430 6344 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16430 6650 6402 gene locus_tag LOCUS_16440 6650 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 7770 6634 gene locus_tag LOCUS_16450 gene nahK 7770 6634 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_16450 8935 7754 gene locus_tag LOCUS_16460 8935 7754 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_16460 9159 9965 gene locus_tag LOCUS_16470 gene trxA 9159 9965 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932886.1 protein_id gnl|my_center|LOCUS_16470 9972 10193 gene locus_tag LOCUS_16480 9972 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 10201 10587 gene locus_tag LOCUS_16490 10201 10587 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence101 691 2190 gene locus_tag LOCUS_16500 691 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 4115 2223 gene locus_tag LOCUS_16510 gene asnB 4115 2223 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_16510 7104 4171 gene locus_tag LOCUS_16520 7104 4171 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_16520 7205 7645 gene locus_tag LOCUS_16530 7205 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 7694 7768 gene locus_tag LOCUS_t00260 7694 7768 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8629 7937 gene locus_tag LOCUS_16540 8629 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 8729 9631 gene locus_tag LOCUS_16550 8729 9631 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038965.1 protein_id gnl|my_center|LOCUS_16550 9749 10486 gene locus_tag LOCUS_16560 9749 10486 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence102 1142 954 gene locus_tag LOCUS_16570 1142 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1253 1492 gene locus_tag LOCUS_16580 1253 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1634 2317 gene locus_tag LOCUS_16590 gene fsa 1634 2317 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107927.1 protein_id gnl|my_center|LOCUS_16590 2321 2527 gene locus_tag LOCUS_16600 2321 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2524 3222 gene locus_tag LOCUS_16610 2524 3222 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_16610 4268 3210 gene locus_tag LOCUS_16620 4268 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 4770 4249 gene locus_tag LOCUS_16630 4770 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 5318 4773 gene locus_tag LOCUS_16640 5318 4773 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_16640 6104 5397 gene locus_tag LOCUS_16650 6104 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 7558 6104 gene locus_tag LOCUS_16660 7558 6104 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_16660 8665 7604 gene locus_tag LOCUS_16670 8665 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 <10794 8686 gene locus_tag LOCUS_16680 <10794 8686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021765.1:DUF2341 domain-containing protein >Feature sequence103 4327 353 gene locus_tag LOCUS_16690 4327 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 7260 4471 gene locus_tag LOCUS_16700 7260 4471 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928965.1 protein_id gnl|my_center|LOCUS_16700 7491 7730 gene locus_tag LOCUS_16710 7491 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 8644 7727 gene locus_tag LOCUS_16720 8644 7727 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_16720 9183 8644 gene locus_tag LOCUS_16730 gene pyrR 9183 8644 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_16730 9603 9532 gene locus_tag LOCUS_t00270 9603 9532 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9806 9582 gene locus_tag LOCUS_16740 9806 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 <10786 9860 gene locus_tag LOCUS_16750 <10786 9860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005775782.1:30S ribosomal protein S1 >Feature sequence104 <1 1091 gene locus_tag LOCUS_16760 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090750.1:DNA polymerase/3'-5' exonuclease PolX 1733 1251 gene locus_tag LOCUS_16770 1733 1251 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946130.1 protein_id gnl|my_center|LOCUS_16770 3120 1735 gene locus_tag LOCUS_16780 gene hslU 3120 1735 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932863.1 protein_id gnl|my_center|LOCUS_16780 4098 3133 gene locus_tag LOCUS_16790 4098 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 6571 4124 gene locus_tag LOCUS_16800 gene lon 6571 4124 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_16800 6747 8708 gene locus_tag LOCUS_16810 6747 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 8729 9454 gene locus_tag LOCUS_16820 8729 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 9997 9494 gene locus_tag LOCUS_16830 9997 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_16830 10284 9994 gene locus_tag LOCUS_16840 10284 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence105 1854 1165 gene locus_tag LOCUS_16850 1854 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2017 3009 gene locus_tag LOCUS_16860 2017 3009 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_16860 3674 3015 gene locus_tag LOCUS_16870 3674 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 4198 3671 gene locus_tag LOCUS_16880 4198 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 4883 4215 gene locus_tag LOCUS_16890 4883 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 6740 4968 gene locus_tag LOCUS_16900 6740 4968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_16900 7496 6753 gene locus_tag LOCUS_16910 gene truA 7496 6753 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_16910 8698 7499 gene locus_tag LOCUS_16920 gene pcaF 8698 7499 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075194926.1 protein_id gnl|my_center|LOCUS_16920 8764 9219 gene locus_tag LOCUS_16930 8764 9219 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107333.1 protein_id gnl|my_center|LOCUS_16930 10010 9216 gene locus_tag LOCUS_16940 10010 9216 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence106 373 1092 gene locus_tag LOCUS_16950 373 1092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_16950 1102 1647 gene locus_tag LOCUS_16960 1102 1647 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_16960 1722 2783 gene locus_tag LOCUS_16970 1722 2783 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_16970 2802 3713 gene locus_tag LOCUS_16980 2802 3713 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759751.1 protein_id gnl|my_center|LOCUS_16980 3710 4294 gene locus_tag LOCUS_16990 3710 4294 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_16990 4291 4728 gene locus_tag LOCUS_17000 4291 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 4736 5116 gene locus_tag LOCUS_17010 gene crcB 4736 5116 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_17010 6627 5113 gene locus_tag LOCUS_17020 6627 5113 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_17020 7399 6728 gene locus_tag LOCUS_17030 7399 6728 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104390.1 protein_id gnl|my_center|LOCUS_17030 7633 8364 gene locus_tag LOCUS_17040 7633 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 8426 9004 gene locus_tag LOCUS_17050 8426 9004 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_17050 9588 9001 gene locus_tag LOCUS_17060 gene lpxF 9588 9001 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108022.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence107 1620 1249 gene locus_tag LOCUS_17070 1620 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1745 1969 gene locus_tag LOCUS_17080 1745 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1989 2528 gene locus_tag LOCUS_17090 1989 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2713 3765 gene locus_tag LOCUS_17100 2713 3765 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 protein_id gnl|my_center|LOCUS_17100 4863 5162 gene locus_tag LOCUS_17110 4863 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 5626 5153 gene locus_tag LOCUS_17120 5626 5153 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_17120 5748 7163 gene locus_tag LOCUS_17130 5748 7163 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142683.1 protein_id gnl|my_center|LOCUS_17130 7550 7164 gene locus_tag LOCUS_17140 7550 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence108 <1 1349 gene locus_tag LOCUS_17150 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882683.1:thiamine pyrophosphate-dependent enzyme 3721 1352 gene locus_tag LOCUS_17160 3721 1352 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_17160 3779 4513 gene locus_tag LOCUS_17170 3779 4513 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_17170 5053 4562 gene locus_tag LOCUS_17180 5053 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 5852 5073 gene locus_tag LOCUS_17190 gene lpxA 5852 5073 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_17190 7246 5849 gene locus_tag LOCUS_17200 7246 5849 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_17200 8288 7260 gene locus_tag LOCUS_17210 gene lpxD 8288 7260 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_17210 9524 8301 gene locus_tag LOCUS_17220 9524 8301 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence109 1245 1544 gene locus_tag LOCUS_17230 1245 1544 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084855.1 protein_id gnl|my_center|LOCUS_17230 2126 3829 gene locus_tag LOCUS_17240 2126 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 3879 5708 gene locus_tag LOCUS_17250 3879 5708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_17250 7723 6032 gene locus_tag LOCUS_17260 7723 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 8056 7871 gene locus_tag LOCUS_17270 8056 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 8244 9659 gene locus_tag LOCUS_17280 8244 9659 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164034966.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence110 172 543 gene locus_tag LOCUS_17290 172 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 970 551 gene locus_tag LOCUS_17300 970 551 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264684.1 protein_id gnl|my_center|LOCUS_17300 2718 1372 gene locus_tag LOCUS_17310 2718 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3853 2783 gene locus_tag LOCUS_17320 gene prfA 3853 2783 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964025.1 protein_id gnl|my_center|LOCUS_17320 4542 4018 gene locus_tag LOCUS_17330 4542 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 5200 4556 gene locus_tag LOCUS_17340 gene plsY 5200 4556 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_17340 5441 10282 gene locus_tag LOCUS_17350 5441 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence111 327 1313 gene locus_tag LOCUS_17360 327 1313 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_17360 1564 1310 gene locus_tag LOCUS_17370 1564 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3015 1831 gene locus_tag LOCUS_17380 3015 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3193 4218 gene locus_tag LOCUS_17390 3193 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4211 4957 gene locus_tag LOCUS_17400 4211 4957 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_17400 6418 4961 gene locus_tag LOCUS_17410 6418 4961 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_17410 7758 6415 gene locus_tag LOCUS_17420 gene trkA 7758 6415 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_17420 8194 7844 gene locus_tag LOCUS_17430 8194 7844 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_17430 9909 8368 gene locus_tag LOCUS_17440 9909 8368 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence112 <1 789 gene locus_tag LOCUS_17450 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203421.1:polyprenyl synthetase family protein 915 1811 gene locus_tag LOCUS_17460 915 1811 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_17460 1814 2986 gene locus_tag LOCUS_17470 1814 2986 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_17470 3552 2977 gene locus_tag LOCUS_17480 3552 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3585 4730 gene locus_tag LOCUS_17490 3585 4730 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_17490 6081 5458 gene locus_tag LOCUS_17500 6081 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 6375 6163 gene locus_tag LOCUS_17510 6375 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 6507 8909 gene locus_tag LOCUS_17520 6507 8909 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_17520 8915 9106 gene locus_tag LOCUS_17530 8915 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 9156 9683 gene locus_tag LOCUS_17540 9156 9683 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070769.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence113 1884 2579 gene locus_tag LOCUS_17550 1884 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2609 3493 gene locus_tag LOCUS_17560 gene lipA 2609 3493 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_17560 3552 5552 gene locus_tag LOCUS_17570 3552 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 5615 6199 gene locus_tag LOCUS_17580 5615 6199 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_17580 7281 6205 gene locus_tag LOCUS_17590 7281 6205 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444177.1 protein_id gnl|my_center|LOCUS_17590 7379 8407 gene locus_tag LOCUS_17600 7379 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17600 8608 9525 gene locus_tag LOCUS_17610 8608 9525 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence114 604 1596 gene locus_tag LOCUS_17620 gene moaA 604 1596 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_17620 3111 1924 gene locus_tag LOCUS_17630 3111 1924 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_17630 3190 3897 gene locus_tag LOCUS_17640 3190 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 3900 5372 gene locus_tag LOCUS_17650 3900 5372 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_17650 6456 5356 gene locus_tag LOCUS_17660 6456 5356 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_17660 7754 6453 gene locus_tag LOCUS_17670 7754 6453 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_17670 7854 8825 gene locus_tag LOCUS_17680 gene pfkA 7854 8825 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_17680 <9842 9271 gene locus_tag LOCUS_17690 <9842 9271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759877.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA >Feature sequence115 462 2594 gene locus_tag LOCUS_17700 462 2594 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_17700 2607 5726 gene locus_tag LOCUS_17710 2607 5726 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_17710 5927 7312 gene locus_tag LOCUS_17720 5927 7312 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_17720 7309 7881 gene locus_tag LOCUS_17730 7309 7881 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_17730 7910 8896 gene locus_tag LOCUS_17740 gene trpD 7910 8896 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_17740 8893 9690 gene locus_tag LOCUS_17750 gene trpC 8893 9690 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence116 1323 598 gene locus_tag LOCUS_17760 1323 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2054 1704 gene locus_tag LOCUS_17770 2054 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 4747 2156 gene locus_tag LOCUS_17780 4747 2156 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055271316.1 protein_id gnl|my_center|LOCUS_17780 5429 4851 gene locus_tag LOCUS_17790 gene nadD 5429 4851 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_17790 6010 5435 gene locus_tag LOCUS_17800 gene gmk 6010 5435 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_17800 6291 6010 gene locus_tag LOCUS_17810 6291 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 6869 6300 gene locus_tag LOCUS_17820 6869 6300 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_17820 7199 7888 gene locus_tag LOCUS_17830 7199 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 8340 7885 gene locus_tag LOCUS_17840 8340 7885 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence117 1704 1075 gene locus_tag LOCUS_17850 1704 1075 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_17850 1784 1858 gene locus_tag LOCUS_t00280 1784 1858 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1893 2171 gene locus_tag LOCUS_17860 1893 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2356 4470 gene locus_tag LOCUS_17870 2356 4470 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046743078.1 protein_id gnl|my_center|LOCUS_17870 5650 4583 gene locus_tag LOCUS_17880 gene fbaA 5650 4583 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482445.1 protein_id gnl|my_center|LOCUS_17880 7334 5787 gene locus_tag LOCUS_17890 7334 5787 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 protein_id gnl|my_center|LOCUS_17890 8995 7406 gene locus_tag LOCUS_17900 8995 7406 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075356.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence118 <1 1392 gene locus_tag LOCUS_17910 <1 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203365.1:VWA domain-containing protein 1496 2374 gene locus_tag LOCUS_17920 1496 2374 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838346.1 protein_id gnl|my_center|LOCUS_17920 2406 2864 gene locus_tag LOCUS_17930 2406 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3102 3521 gene locus_tag LOCUS_17940 3102 3521 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356039.1 protein_id gnl|my_center|LOCUS_17940 5934 3532 gene locus_tag LOCUS_17950 gene thrA 5934 3532 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_17950 7237 5939 gene locus_tag LOCUS_17960 7237 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 8409 7234 gene locus_tag LOCUS_17970 8409 7234 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206657.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence119 2284 656 gene locus_tag LOCUS_17980 2284 656 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_17980 3248 2289 gene locus_tag LOCUS_17990 3248 2289 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_17990 4003 3260 gene locus_tag LOCUS_18000 4003 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4206 6893 gene locus_tag LOCUS_18010 4206 6893 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_18010 7093 8520 gene locus_tag LOCUS_18020 7093 8520 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_18020 <9114 8599 gene locus_tag LOCUS_18030 <9114 8599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759776.1:lysine--tRNA ligase >Feature sequence120 906 490 gene locus_tag LOCUS_18040 906 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2328 988 gene locus_tag LOCUS_18050 2328 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3929 2328 gene locus_tag LOCUS_18060 3929 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 4210 4022 gene locus_tag LOCUS_18070 4210 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4182 4943 gene locus_tag LOCUS_18080 4182 4943 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_18080 4933 5526 gene locus_tag LOCUS_18090 4933 5526 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_18090 6012 6731 gene locus_tag LOCUS_18100 6012 6731 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_18100 6781 8925 gene locus_tag LOCUS_18110 gene rnr 6781 8925 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence121 416 2704 gene locus_tag LOCUS_18120 416 2704 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_18120 2811 5312 gene locus_tag LOCUS_18130 2811 5312 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384833.1 protein_id gnl|my_center|LOCUS_18130 5339 7069 gene locus_tag LOCUS_18140 5339 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 <9020 7140 gene locus_tag LOCUS_18150 <9020 7140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964324.1:penicillin-binding protein 1C >Feature sequence122 <1 791 gene locus_tag LOCUS_18160 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787732.1:LptF/LptG family permease 788 1672 gene locus_tag LOCUS_18170 788 1672 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120520.1 protein_id gnl|my_center|LOCUS_18170 2989 1676 gene locus_tag LOCUS_18180 2989 1676 CDS product acyl-CoA--6-aminopenicillanic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332932.1 protein_id gnl|my_center|LOCUS_18180 3899 2994 gene locus_tag LOCUS_18190 3899 2994 CDS product DUF6206 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879311.1 protein_id gnl|my_center|LOCUS_18190 5209 3902 gene locus_tag LOCUS_18200 5209 3902 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_18200 6381 5272 gene locus_tag LOCUS_18210 6381 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 6778 6431 gene locus_tag LOCUS_18220 6778 6431 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530010.1 protein_id gnl|my_center|LOCUS_18220 6910 7293 gene locus_tag LOCUS_18230 6910 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 8025 7300 gene locus_tag LOCUS_18240 gene hisA 8025 7300 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963103.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence123 500 784 gene locus_tag LOCUS_18250 500 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1503 781 gene locus_tag LOCUS_18260 1503 781 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_18260 2530 1487 gene locus_tag LOCUS_18270 2530 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3213 2527 gene locus_tag LOCUS_18280 3213 2527 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_18280 4321 3293 gene locus_tag LOCUS_18290 4321 3293 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 protein_id gnl|my_center|LOCUS_18290 4478 5506 gene locus_tag LOCUS_18300 gene recA 4478 5506 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_18300 5513 6124 gene locus_tag LOCUS_18310 5513 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence124 814 1782 gene locus_tag LOCUS_18320 814 1782 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_18320 1803 2501 gene locus_tag LOCUS_18330 1803 2501 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_18330 2543 3541 gene locus_tag LOCUS_18340 2543 3541 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_18340 4402 3527 gene locus_tag LOCUS_18350 gene ppk2 4402 3527 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727269.1 protein_id gnl|my_center|LOCUS_18350 5298 4402 gene locus_tag LOCUS_18360 gene ppk2 5298 4402 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_18360 5381 5755 gene locus_tag LOCUS_18370 5381 5755 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108047.1 protein_id gnl|my_center|LOCUS_18370 5782 7047 gene locus_tag LOCUS_18380 5782 7047 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387517.1 protein_id gnl|my_center|LOCUS_18380 7110 7562 gene locus_tag LOCUS_18390 7110 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7678 8652 gene locus_tag LOCUS_18400 7678 8652 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666158.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence125 2439 1636 gene locus_tag LOCUS_18410 2439 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2718 2446 gene locus_tag LOCUS_18420 2718 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 4471 2807 gene locus_tag LOCUS_18430 gene fadD 4471 2807 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072530.1 protein_id gnl|my_center|LOCUS_18430 4606 5253 gene locus_tag LOCUS_18440 4606 5253 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_18440 5260 5790 gene locus_tag LOCUS_18450 5260 5790 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_18450 5783 6235 gene locus_tag LOCUS_18460 5783 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 8476 6290 gene locus_tag LOCUS_18470 8476 6290 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence126 <1 2177 gene locus_tag LOCUS_18480 <1 2177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809310.1:formate dehydrogenase subunit alpha 2192 3460 gene locus_tag LOCUS_18490 2192 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 3948 3463 gene locus_tag LOCUS_18500 gene paaJ 3948 3463 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813291.1 protein_id gnl|my_center|LOCUS_18500 4222 5142 gene locus_tag LOCUS_18510 4222 5142 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_18510 5173 5901 gene locus_tag LOCUS_18520 5173 5901 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_18520 5904 7412 gene locus_tag LOCUS_18530 5904 7412 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_18530 7405 8322 gene locus_tag LOCUS_18540 7405 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence127 5788 2603 gene locus_tag LOCUS_18550 5788 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 6563 5877 gene locus_tag LOCUS_18560 6563 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 7109 6600 gene locus_tag LOCUS_18570 7109 6600 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_18570 7213 8676 gene locus_tag LOCUS_18580 gene miaB 7213 8676 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence128 939 199 gene locus_tag LOCUS_18590 939 199 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18590 1295 1678 gene locus_tag LOCUS_18600 1295 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 3784 2111 gene locus_tag LOCUS_18610 3784 2111 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615608.1 protein_id gnl|my_center|LOCUS_18610 5260 3935 gene locus_tag LOCUS_18620 5260 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 6384 5353 gene locus_tag LOCUS_18630 gene selD 6384 5353 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815585.1 protein_id gnl|my_center|LOCUS_18630 7409 6381 gene locus_tag LOCUS_18640 gene mnmH 7409 6381 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937872.1 protein_id gnl|my_center|LOCUS_18640 8217 7477 gene locus_tag LOCUS_18650 8217 7477 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence129 <1 912 gene locus_tag LOCUS_18660 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963529.1:bacillithiol biosynthesis cysteine-adding enzyme BshC 1844 1377 gene locus_tag LOCUS_18670 1844 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2820 2146 gene locus_tag LOCUS_18680 gene mnmD 2820 2146 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_18680 2923 3729 gene locus_tag LOCUS_18690 gene bamD 2923 3729 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_18690 3733 4056 gene locus_tag LOCUS_18700 3733 4056 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_18700 4070 5269 gene locus_tag LOCUS_18710 gene coaBC 4070 5269 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_18710 5262 6152 gene locus_tag LOCUS_18720 5262 6152 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_18720 6222 7874 gene locus_tag LOCUS_18730 gene recN 6222 7874 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence130 1078 200 gene locus_tag LOCUS_18740 1078 200 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256554.1 protein_id gnl|my_center|LOCUS_18740 1469 3373 gene locus_tag LOCUS_18750 1469 3373 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_18750 3377 4426 gene locus_tag LOCUS_18760 3377 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963574.1 protein_id gnl|my_center|LOCUS_18760 5718 4798 gene locus_tag LOCUS_18770 5718 4798 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_18770 6105 5785 gene locus_tag LOCUS_18780 gene trxA 6105 5785 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_18780 <8394 6183 gene locus_tag LOCUS_18790 <8394 6183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010992125.1:DNA polymerase III subunit alpha >Feature sequence131 797 3 gene locus_tag LOCUS_18800 797 3 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_18800 1868 942 gene locus_tag LOCUS_18810 1868 942 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_18810 2053 2595 gene locus_tag LOCUS_18820 gene ftnA 2053 2595 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650594.1 protein_id gnl|my_center|LOCUS_18820 3390 2599 gene locus_tag LOCUS_18830 3390 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 3694 4152 gene locus_tag LOCUS_18840 3694 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 4143 4739 gene locus_tag LOCUS_18850 4143 4739 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_18850 4892 6205 gene locus_tag LOCUS_18860 gene mtaB 4892 6205 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_18860 6572 6964 gene locus_tag LOCUS_18870 6572 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 7644 6961 gene locus_tag LOCUS_18880 7644 6961 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179862255.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence132 2629 242 gene locus_tag LOCUS_18890 2629 242 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254325.1 protein_id gnl|my_center|LOCUS_18890 3610 2642 gene locus_tag LOCUS_18900 gene deoC 3610 2642 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391592.1 protein_id gnl|my_center|LOCUS_18900 4037 3702 gene locus_tag LOCUS_18910 4037 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 5204 4134 gene locus_tag LOCUS_18920 5204 4134 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_18920 5924 5223 gene locus_tag LOCUS_18930 5924 5223 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809261.1 protein_id gnl|my_center|LOCUS_18930 7477 5921 gene locus_tag LOCUS_18940 7477 5921 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence133 1572 1369 gene locus_tag LOCUS_18950 1572 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3485 1575 gene locus_tag LOCUS_18960 3485 1575 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203674.1 protein_id gnl|my_center|LOCUS_18960 3982 3620 gene locus_tag LOCUS_18970 3982 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_18970 4118 4465 gene locus_tag LOCUS_18980 gene ssb 4118 4465 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_18980 4637 5881 gene locus_tag LOCUS_18990 4637 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 6031 7887 gene locus_tag LOCUS_19000 6031 7887 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence134 1218 367 gene locus_tag LOCUS_19010 1218 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2460 1228 gene locus_tag LOCUS_19020 2460 1228 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166151256.1 protein_id gnl|my_center|LOCUS_19020 2685 3869 gene locus_tag LOCUS_19030 2685 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_19030 4732 3866 gene locus_tag LOCUS_19040 4732 3866 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_19040 4860 5315 gene locus_tag LOCUS_19050 4860 5315 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_19050 7027 5312 gene locus_tag LOCUS_19060 7027 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 7283 7209 gene locus_tag LOCUS_t00290 7283 7209 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 <8268 7413 gene locus_tag LOCUS_19070 <8268 7413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404958.1:alpha/beta fold hydrolase >Feature sequence135 151 1581 gene locus_tag LOCUS_19080 151 1581 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453606.1 protein_id gnl|my_center|LOCUS_19080 1991 1701 gene locus_tag LOCUS_19090 1991 1701 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784184.1 protein_id gnl|my_center|LOCUS_19090 2524 3009 gene locus_tag LOCUS_19100 2524 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 3195 3626 gene locus_tag LOCUS_19110 gene norC 3195 3626 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_19110 3659 5026 gene locus_tag LOCUS_19120 3659 5026 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327923.1 protein_id gnl|my_center|LOCUS_19120 5106 5888 gene locus_tag LOCUS_19130 5106 5888 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_19130 5891 7666 gene locus_tag LOCUS_19140 5891 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence136 1881 3497 gene locus_tag LOCUS_19150 1881 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3549 4298 gene locus_tag LOCUS_19160 3549 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 4779 4303 gene locus_tag LOCUS_19170 gene ispF 4779 4303 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_19170 6061 4784 gene locus_tag LOCUS_19180 6061 4784 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_19180 6137 8116 gene locus_tag LOCUS_19190 6137 8116 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence137 1236 805 gene locus_tag LOCUS_19200 1236 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2619 1327 gene locus_tag LOCUS_19210 2619 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2995 2612 gene locus_tag LOCUS_19220 2995 2612 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_19220 3290 4210 gene locus_tag LOCUS_19230 3290 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 4498 4710 gene locus_tag LOCUS_19240 4498 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 4712 5035 gene locus_tag LOCUS_19250 4712 5035 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_19250 <8134 5119 gene locus_tag LOCUS_19260 <8134 5119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899883.1:hydantoinase B/oxoprolinase family protein >Feature sequence138 1273 674 gene locus_tag LOCUS_19270 1273 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2376 1336 gene locus_tag LOCUS_19280 2376 1336 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_19280 3275 2472 gene locus_tag LOCUS_19290 3275 2472 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_19290 5654 3288 gene locus_tag LOCUS_19300 5654 3288 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_19300 6122 5658 gene locus_tag LOCUS_19310 6122 5658 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_19310 6541 6149 gene locus_tag LOCUS_19320 6541 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 6767 7840 gene locus_tag LOCUS_19330 6767 7840 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030710.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence139 1688 732 gene locus_tag LOCUS_19340 gene hemB 1688 732 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_19340 2415 1678 gene locus_tag LOCUS_19350 2415 1678 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_19350 3335 2412 gene locus_tag LOCUS_19360 gene hemC 3335 2412 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962224.1 protein_id gnl|my_center|LOCUS_19360 4582 3332 gene locus_tag LOCUS_19370 gene hemA 4582 3332 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_19370 4733 5755 gene locus_tag LOCUS_19380 gene hemH 4733 5755 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_19380 5752 7086 gene locus_tag LOCUS_19390 gene hemG 5752 7086 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383354.1 protein_id gnl|my_center|LOCUS_19390 7924 7271 gene locus_tag LOCUS_19400 7924 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence140 483 1127 gene locus_tag LOCUS_19410 483 1127 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_19410 4023 2023 gene locus_tag LOCUS_19420 gene tkt 4023 2023 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_19420 4740 4231 gene locus_tag LOCUS_19430 4740 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 6285 4852 gene locus_tag LOCUS_19440 6285 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 7074 6475 gene locus_tag LOCUS_19450 gene bstA 7074 6475 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243944.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence141 660 1670 gene locus_tag LOCUS_19460 gene pdxA 660 1670 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_19460 1800 2342 gene locus_tag LOCUS_19470 1800 2342 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_19470 2329 2514 gene locus_tag LOCUS_19480 gene rpmF 2329 2514 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_19480 2545 3465 gene locus_tag LOCUS_19490 gene plsX 2545 3465 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_19490 3476 4474 gene locus_tag LOCUS_19500 3476 4474 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964468.1 protein_id gnl|my_center|LOCUS_19500 4758 5321 gene locus_tag LOCUS_19510 gene efp 4758 5321 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_19510 5335 5814 gene locus_tag LOCUS_19520 gene accB 5335 5814 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_19520 5826 7187 gene locus_tag LOCUS_19530 gene accC 5826 7187 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence142 1472 3112 gene locus_tag LOCUS_19540 1472 3112 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_19540 3127 4929 gene locus_tag LOCUS_19550 gene yidC 3127 4929 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763174.1 protein_id gnl|my_center|LOCUS_19550 5042 5719 gene locus_tag LOCUS_19560 5042 5719 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 protein_id gnl|my_center|LOCUS_19560 5730 6494 gene locus_tag LOCUS_19570 5730 6494 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_19570 6498 7397 gene locus_tag LOCUS_19580 6498 7397 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760916.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence143 138 1031 gene locus_tag LOCUS_19590 gene era 138 1031 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_19590 1035 2339 gene locus_tag LOCUS_19600 gene der 1035 2339 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_19600 2418 2696 gene locus_tag LOCUS_19610 2418 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2751 3347 gene locus_tag LOCUS_19620 2751 3347 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_19620 3442 4449 gene locus_tag LOCUS_19630 3442 4449 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_19630 4559 5896 gene locus_tag LOCUS_19640 4559 5896 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence144 912 346 gene locus_tag LOCUS_19650 912 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1636 995 gene locus_tag LOCUS_19660 1636 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1805 2488 gene locus_tag LOCUS_19670 1805 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2489 2860 gene locus_tag LOCUS_19680 gene folB 2489 2860 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203462.1 protein_id gnl|my_center|LOCUS_19680 3216 2920 gene locus_tag LOCUS_19690 3216 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3449 3207 gene locus_tag LOCUS_19700 3449 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 3959 3651 gene locus_tag LOCUS_19710 3959 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 4069 4590 gene locus_tag LOCUS_19720 4069 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_19720 4610 5023 gene locus_tag LOCUS_19730 4610 5023 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927170.1 protein_id gnl|my_center|LOCUS_19730 5033 5692 gene locus_tag LOCUS_19740 5033 5692 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_19740 5722 6132 gene locus_tag LOCUS_19750 gene dtd 5722 6132 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_19750 6132 6458 gene locus_tag LOCUS_19760 6132 6458 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence145 1515 4097 gene locus_tag LOCUS_19770 1515 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 4175 4747 gene locus_tag LOCUS_19780 4175 4747 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200970.1 protein_id gnl|my_center|LOCUS_19780 5877 4753 gene locus_tag LOCUS_19790 5877 4753 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008588454.1 protein_id gnl|my_center|LOCUS_19790 7270 5885 gene locus_tag LOCUS_19800 gene glmM 7270 5885 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_19800 7534 7301 gene locus_tag LOCUS_19810 7534 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence146 1175 303 gene locus_tag LOCUS_19820 1175 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2347 1424 gene locus_tag LOCUS_19830 2347 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 5058 3883 gene locus_tag LOCUS_19840 5058 3883 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_19840 5745 5506 gene locus_tag LOCUS_19850 5745 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 7283 5817 gene locus_tag LOCUS_19860 7283 5817 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_19860 7627 7543 gene locus_tag LOCUS_t00300 7627 7543 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence147 82 2799 gene locus_tag LOCUS_19870 82 2799 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037073.1 protein_id gnl|my_center|LOCUS_19870 4031 3150 gene locus_tag LOCUS_19880 4031 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 5599 4211 gene locus_tag LOCUS_19890 5599 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 5623 6312 gene locus_tag LOCUS_19900 5623 6312 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_19900 6368 6919 gene locus_tag LOCUS_19910 6368 6919 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_19910 7449 6964 gene locus_tag LOCUS_19920 7449 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence148 284 658 gene locus_tag LOCUS_19930 284 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1373 786 gene locus_tag LOCUS_19940 1373 786 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_19940 1416 2366 gene locus_tag LOCUS_19950 1416 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2454 3080 gene locus_tag LOCUS_19960 2454 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 3882 3100 gene locus_tag LOCUS_19970 3882 3100 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_19970 4035 4643 gene locus_tag LOCUS_19980 4035 4643 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_19980 4702 6522 gene locus_tag LOCUS_19990 4702 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 6525 6977 gene locus_tag LOCUS_20000 gene bcp 6525 6977 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence149 599 820 gene locus_tag LOCUS_20010 599 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20010 920 1102 gene locus_tag LOCUS_20020 gene rpmG 920 1102 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_20020 1105 1260 gene locus_tag LOCUS_20030 1105 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1334 2299 gene locus_tag LOCUS_20040 gene ftsY 1334 2299 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_20040 2524 4308 gene locus_tag LOCUS_20050 2524 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 4305 5003 gene locus_tag LOCUS_20060 4305 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence150 730 98 gene locus_tag LOCUS_20070 730 98 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946491.1 protein_id gnl|my_center|LOCUS_20070 2009 774 gene locus_tag LOCUS_20080 2009 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3298 2009 gene locus_tag LOCUS_20090 3298 2009 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_20090 4215 3373 gene locus_tag LOCUS_20100 gene pyrF 4215 3373 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_20100 4929 4279 gene locus_tag LOCUS_20110 4929 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 <7297 4941 gene locus_tag LOCUS_20120 <7297 4941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963704.1:DNA translocase FtsK >Feature sequence151 1171 464 gene locus_tag LOCUS_20130 1171 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 1258 2298 gene locus_tag LOCUS_20140 1258 2298 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence152 727 266 gene locus_tag LOCUS_20150 727 266 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_20150 882 2114 gene locus_tag LOCUS_20160 882 2114 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_20160 2172 3326 gene locus_tag LOCUS_20170 2172 3326 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_20170 3344 4495 gene locus_tag LOCUS_20180 gene hppD 3344 4495 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_20180 4514 5773 gene locus_tag LOCUS_20190 gene fahA 4514 5773 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_20190 5824 6288 gene locus_tag LOCUS_20200 5824 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 6290 7156 gene locus_tag LOCUS_20210 6290 7156 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence153 649 1896 gene locus_tag LOCUS_20220 649 1896 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_20220 2936 1893 gene locus_tag LOCUS_20230 2936 1893 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109958.1 protein_id gnl|my_center|LOCUS_20230 4620 2926 gene locus_tag LOCUS_20240 4620 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 5312 4647 gene locus_tag LOCUS_20250 5312 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence154 1302 385 gene locus_tag LOCUS_20260 1302 385 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_20260 1699 1316 gene locus_tag LOCUS_20270 1699 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2675 1713 gene locus_tag LOCUS_20280 2675 1713 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963218.1 protein_id gnl|my_center|LOCUS_20280 4011 2692 gene locus_tag LOCUS_20290 4011 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 5228 4047 gene locus_tag LOCUS_20300 5228 4047 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_20300 5384 6700 gene locus_tag LOCUS_20310 5384 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence155 2855 45 gene locus_tag LOCUS_20320 2855 45 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_20320 4449 3151 gene locus_tag LOCUS_20330 4449 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 5301 4711 gene locus_tag LOCUS_20340 gene hisIE 5301 4711 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706033.1 protein_id gnl|my_center|LOCUS_20340 6069 5314 gene locus_tag LOCUS_20350 gene hisF 6069 5314 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_20350 6776 6063 gene locus_tag LOCUS_20360 gene hisA 6776 6063 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963103.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence156 1654 527 gene locus_tag LOCUS_20370 1654 527 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_20370 1781 2719 gene locus_tag LOCUS_20380 gene fmt 1781 2719 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 protein_id gnl|my_center|LOCUS_20380 2776 3276 gene locus_tag LOCUS_20390 gene dfrA 2776 3276 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_20390 3273 4073 gene locus_tag LOCUS_20400 3273 4073 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_20400 4081 4269 gene locus_tag LOCUS_20410 4081 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 4632 4273 gene locus_tag LOCUS_20420 4632 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 6380 4629 gene locus_tag LOCUS_20430 gene sppA 6380 4629 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_20430 6469 6957 gene locus_tag LOCUS_20440 gene folK 6469 6957 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence157 1789 2835 gene locus_tag LOCUS_20450 1789 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2849 4096 gene locus_tag LOCUS_20460 gene hutI 2849 4096 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_20460 4317 4829 gene locus_tag LOCUS_20470 4317 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 4864 6531 gene locus_tag LOCUS_20480 gene paaN 4864 6531 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 protein_id gnl|my_center|LOCUS_20480 6563 7045 gene locus_tag LOCUS_20490 6563 7045 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence158 <1 519 gene locus_tag LOCUS_20500 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062542257.1:HAMP domain-containing sensor histidine kinase 523 3945 gene locus_tag LOCUS_20510 523 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_20510 5529 4774 gene locus_tag LOCUS_20520 5529 4774 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_20520 6283 5534 gene locus_tag LOCUS_20530 6283 5534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence159 <1 706 gene locus_tag LOCUS_20540 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791502.1:glutamate--tRNA ligase 2765 1578 gene locus_tag LOCUS_20550 2765 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2945 3382 gene locus_tag LOCUS_20560 2945 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3271 4482 gene locus_tag LOCUS_20570 3271 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 4533 5951 gene locus_tag LOCUS_20580 4533 5951 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046312529.1 protein_id gnl|my_center|LOCUS_20580 6464 6219 gene locus_tag LOCUS_20590 6464 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 6923 6603 gene locus_tag LOCUS_20600 6923 6603 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764355.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence160 1532 636 gene locus_tag LOCUS_20610 1532 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2537 1545 gene locus_tag LOCUS_20620 2537 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 <6880 2549 gene locus_tag LOCUS_20630 <6880 2549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein >Feature sequence161 1053 247 gene locus_tag LOCUS_20640 1053 247 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_20640 1078 2178 gene locus_tag LOCUS_20650 1078 2178 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_20650 2251 2910 gene locus_tag LOCUS_20660 2251 2910 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_20660 2907 3941 gene locus_tag LOCUS_20670 2907 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 3919 4701 gene locus_tag LOCUS_20680 3919 4701 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392919.1 protein_id gnl|my_center|LOCUS_20680 4698 6119 gene locus_tag LOCUS_20690 4698 6119 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence162 1669 389 gene locus_tag LOCUS_20700 1669 389 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_20700 4701 1714 gene locus_tag LOCUS_20710 4701 1714 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_20710 5573 4863 gene locus_tag LOCUS_20720 5573 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 6252 5563 gene locus_tag LOCUS_20730 6252 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence163 <1 307 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatccttgttgtaatggatatgggtttctgac 1982 492 gene locus_tag LOCUS_20740 1982 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 4079 1995 gene locus_tag LOCUS_20750 4079 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 4664 4086 gene locus_tag LOCUS_20760 4664 4086 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_20760 6771 4657 gene locus_tag LOCUS_20770 6771 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence164 1814 765 gene locus_tag LOCUS_20780 1814 765 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_20780 2357 3532 gene locus_tag LOCUS_20790 2357 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 3585 4226 gene locus_tag LOCUS_20800 3585 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 5139 4240 gene locus_tag LOCUS_20810 gene xerD 5139 4240 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_20810 5225 5650 gene locus_tag LOCUS_20820 gene aroQ 5225 5650 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791941.1 protein_id gnl|my_center|LOCUS_20820 5660 6238 gene locus_tag LOCUS_20830 5660 6238 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_20830 6231 6704 gene locus_tag LOCUS_20840 gene rnhA 6231 6704 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence165 <1 947 gene locus_tag LOCUS_20850 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007340894.1:DcaP family trimeric outer membrane transporter 1002 2480 gene locus_tag LOCUS_20860 gene glpK 1002 2480 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_20860 2484 4055 gene locus_tag LOCUS_20870 2484 4055 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_20870 4096 4836 gene locus_tag LOCUS_20880 4096 4836 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence166 <1 1034 gene locus_tag LOCUS_20890 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783924.1:Fe-S cluster assembly protein SufB 1047 1808 gene locus_tag LOCUS_20900 gene sufC 1047 1808 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_20900 1808 3064 gene locus_tag LOCUS_20910 gene sufD 1808 3064 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096954.1 protein_id gnl|my_center|LOCUS_20910 3064 4314 gene locus_tag LOCUS_20920 3064 4314 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404136.1 protein_id gnl|my_center|LOCUS_20920 4311 4754 gene locus_tag LOCUS_20930 4311 4754 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_20930 4747 5106 gene locus_tag LOCUS_20940 4747 5106 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_20940 5176 5565 gene locus_tag LOCUS_20950 5176 5565 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_20950 5605 6558 gene locus_tag LOCUS_20960 5605 6558 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence167 3680 4975 gene locus_tag LOCUS_20970 3680 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4998 6053 gene locus_tag LOCUS_20980 4998 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence168 383 1471 gene locus_tag LOCUS_20990 383 1471 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881275.1 protein_id gnl|my_center|LOCUS_20990 1504 2262 gene locus_tag LOCUS_21000 1504 2262 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965997.1 protein_id gnl|my_center|LOCUS_21000 2259 3209 gene locus_tag LOCUS_21010 2259 3209 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903590.1 protein_id gnl|my_center|LOCUS_21010 3326 5404 gene locus_tag LOCUS_21020 3326 5404 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289484.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence169 1090 626 gene locus_tag LOCUS_21030 1090 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 4486 1139 gene locus_tag LOCUS_21040 gene secA 4486 1139 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962742.1 protein_id gnl|my_center|LOCUS_21040 5342 4587 gene locus_tag LOCUS_21050 gene dapF 5342 4587 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_21050 5390 5848 gene locus_tag LOCUS_21060 5390 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence170 1503 913 gene locus_tag LOCUS_21070 1503 913 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_21070 2779 1538 gene locus_tag LOCUS_21080 2779 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3034 2780 gene locus_tag LOCUS_21090 3034 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 4137 3031 gene locus_tag LOCUS_21100 4137 3031 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_21100 5078 4134 gene locus_tag LOCUS_21110 5078 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 5081 5653 gene locus_tag LOCUS_21120 gene ruvC 5081 5653 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence171 366 1217 gene locus_tag LOCUS_21130 366 1217 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_21130 1219 1563 gene locus_tag LOCUS_21140 1219 1563 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_21140 1860 1603 gene locus_tag LOCUS_21150 1860 1603 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_21150 2111 1857 gene locus_tag LOCUS_21160 2111 1857 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964534.1 protein_id gnl|my_center|LOCUS_21160 2534 3547 gene locus_tag LOCUS_21170 gene prfB 2534 3547 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 protein_id gnl|my_center|LOCUS_21170 3579 4754 gene locus_tag LOCUS_21180 3579 4754 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190330.1 protein_id gnl|my_center|LOCUS_21180 4741 5418 gene locus_tag LOCUS_21190 4741 5418 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_21190 5677 5468 gene locus_tag LOCUS_21200 5677 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence172 423 767 gene locus_tag LOCUS_21210 423 767 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_21210 2176 872 gene locus_tag LOCUS_21220 2176 872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_21220 3083 2169 gene locus_tag LOCUS_21230 3083 2169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_21230 4043 3156 gene locus_tag LOCUS_21240 4043 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 <5862 4134 gene locus_tag LOCUS_21250 <5862 4134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS type A sorting domain-containing protein >Feature sequence173 291 692 gene locus_tag LOCUS_21260 gene mce 291 692 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_21260 694 1752 gene locus_tag LOCUS_21270 gene thiL 694 1752 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_21270 <5850 1749 gene locus_tag LOCUS_21280 <5850 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:Calx-beta domain-containing protein >Feature sequence174 783 1457 gene locus_tag LOCUS_21290 783 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 1841 1461 gene locus_tag LOCUS_21300 1841 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1933 2499 gene locus_tag LOCUS_21310 1933 2499 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_21310 2981 4486 gene locus_tag LOCUS_21320 2981 4486 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036501.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence175 <1 750 gene locus_tag LOCUS_21330 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813377.1:OmpA family protein 1041 1793 gene locus_tag LOCUS_21340 gene ubiE 1041 1793 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_21340 1742 2476 gene locus_tag LOCUS_21350 1742 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2551 3312 gene locus_tag LOCUS_21360 2551 3312 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444884.1 protein_id gnl|my_center|LOCUS_21360 3752 3309 gene locus_tag LOCUS_21370 3752 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 4674 3760 gene locus_tag LOCUS_21380 4674 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 <5801 4734 gene locus_tag LOCUS_21390 <5801 4734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173072481.1:ATP-binding cassette domain-containing protein >Feature sequence176 <1 1272 gene locus_tag LOCUS_21400 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124903.1:DNA polymerase III subunit alpha 3172 1256 gene locus_tag LOCUS_21410 3172 1256 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_21410 3376 3188 gene locus_tag LOCUS_21420 3376 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 <5723 3378 gene locus_tag LOCUS_21430 <5723 3378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964063.1:T9SS sorting signal type C domain-containing protein >Feature sequence177 <1 581 gene locus_tag LOCUS_21440 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121074.1:HAD family hydrolase 3243 1858 gene locus_tag LOCUS_21450 3243 1858 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_21450 3356 4798 gene locus_tag LOCUS_21460 3356 4798 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence178 2366 714 gene locus_tag LOCUS_21470 2366 714 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974089.1 protein_id gnl|my_center|LOCUS_21470 2735 2370 gene locus_tag LOCUS_21480 2735 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 3577 2747 gene locus_tag LOCUS_21490 gene fdhD 3577 2747 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_21490 5260 3581 gene locus_tag LOCUS_21500 5260 3581 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_21500 5620 5514 gene locus_tag LOCUS_r00020 5620 5514 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence179 59 1399 gene locus_tag LOCUS_21510 gene purB 59 1399 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_21510 3462 2371 gene locus_tag LOCUS_21520 3462 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 4096 3656 gene locus_tag LOCUS_21530 4096 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 4291 4887 gene locus_tag LOCUS_21540 gene msrA 4291 4887 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence180 3 245 gene locus_tag LOCUS_21550 3 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 242 1315 gene locus_tag LOCUS_21560 gene leuB 242 1315 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_21560 1332 2225 gene locus_tag LOCUS_21570 1332 2225 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962619.1 protein_id gnl|my_center|LOCUS_21570 2269 3942 gene locus_tag LOCUS_21580 gene ilvD 2269 3942 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence181 <1 1846 gene locus_tag LOCUS_21590 <1 1846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974101.1:gamma-glutamyltransferase 1997 2902 gene locus_tag LOCUS_21600 1997 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3031 4047 gene locus_tag LOCUS_21610 3031 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 4376 4059 gene locus_tag LOCUS_21620 4376 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 5260 4523 gene locus_tag LOCUS_21630 5260 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence182 63 1685 gene locus_tag LOCUS_21640 63 1685 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_21640 1682 2341 gene locus_tag LOCUS_21650 gene rpe 1682 2341 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_21650 2349 4691 gene locus_tag LOCUS_21660 2349 4691 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_21660 <5399 4663 gene locus_tag LOCUS_21670 <5399 4663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121855.1:Nramp family divalent metal transporter >Feature sequence183 533 1411 gene locus_tag LOCUS_21680 533 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 1418 2101 gene locus_tag LOCUS_21690 1418 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2098 2745 gene locus_tag LOCUS_21700 2098 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 <5377 2783 gene locus_tag LOCUS_21710 <5377 2783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_183275411.1:DUF3320 domain-containing protein >Feature sequence184 1192 527 gene locus_tag LOCUS_21720 1192 527 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_21720 1797 1285 gene locus_tag LOCUS_21730 1797 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1851 2963 gene locus_tag LOCUS_21740 1851 2963 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763350.1 protein_id gnl|my_center|LOCUS_21740 3258 4709 gene locus_tag LOCUS_21750 gene nhaC 3258 4709 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_21750 4699 5313 gene locus_tag LOCUS_21760 4699 5313 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence185 4250 1062 gene locus_tag LOCUS_21770 4250 1062 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839665.1 protein_id gnl|my_center|LOCUS_21770 4565 4876 gene locus_tag LOCUS_21780 4565 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 4976 5052 gene locus_tag LOCUS_t00310 4976 5052 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence186 656 1360 gene locus_tag LOCUS_21790 656 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 1344 1973 gene locus_tag LOCUS_21800 1344 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 3546 2002 gene locus_tag LOCUS_21810 3546 2002 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964517.1 protein_id gnl|my_center|LOCUS_21810 3502 3762 gene locus_tag LOCUS_21820 3502 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 <5354 3768 gene locus_tag LOCUS_21830 <5354 3768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259450.1:cation:proton antiporter >Feature sequence187 319 2307 gene locus_tag LOCUS_21840 319 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2309 3568 gene locus_tag LOCUS_21850 2309 3568 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404924.1 protein_id gnl|my_center|LOCUS_21850 3565 4110 gene locus_tag LOCUS_21860 3565 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 4134 5096 gene locus_tag LOCUS_21870 4134 5096 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence188 2848 2489 gene locus_tag LOCUS_21880 2848 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 3224 2850 gene locus_tag LOCUS_21890 3224 2850 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_21890 3511 3221 gene locus_tag LOCUS_21900 3511 3221 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_21900 <5324 3718 gene locus_tag LOCUS_21910 <5324 3718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140378.1:amidohydrolase >Feature sequence189 1456 281 gene locus_tag LOCUS_21920 1456 281 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_21920 2502 1609 gene locus_tag LOCUS_21930 2502 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2741 3196 gene locus_tag LOCUS_21940 gene ribH 2741 3196 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_21940 4459 3467 gene locus_tag LOCUS_21950 gene rhuM 4459 3467 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence190 3031 101 gene locus_tag LOCUS_21960 3031 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 3185 4093 gene locus_tag LOCUS_21970 3185 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence191 556 95 gene locus_tag LOCUS_21980 556 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 904 2316 gene locus_tag LOCUS_21990 904 2316 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_21990 2390 2644 gene locus_tag LOCUS_22000 2390 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3115 4878 gene locus_tag LOCUS_22010 3115 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence192 2010 535 gene locus_tag LOCUS_22020 gene proS 2010 535 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963521.1 protein_id gnl|my_center|LOCUS_22020 2131 3426 gene locus_tag LOCUS_22030 2131 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 3484 5013 gene locus_tag LOCUS_22040 3484 5013 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence193 1709 399 gene locus_tag LOCUS_22050 1709 399 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_22050 1889 3418 gene locus_tag LOCUS_22060 1889 3418 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_22060 3438 4880 gene locus_tag LOCUS_22070 3438 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence194 798 2177 gene locus_tag LOCUS_22080 798 2177 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence195 1816 182 gene locus_tag LOCUS_22090 1816 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 1937 3103 gene locus_tag LOCUS_22100 1937 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 3106 4494 gene locus_tag LOCUS_22110 gene leuC 3106 4494 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence196 421 3192 gene locus_tag LOCUS_22120 gene polA 421 3192 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_22120 3361 3209 gene locus_tag LOCUS_22130 3361 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 3847 3521 gene locus_tag LOCUS_22140 3847 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 4055 3837 gene locus_tag LOCUS_22150 4055 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence197 38 1978 gene locus_tag LOCUS_22160 gene thrS 38 1978 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_22160 2101 2625 gene locus_tag LOCUS_22170 gene infC 2101 2625 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_22170 2655 2849 gene locus_tag LOCUS_22180 gene rpmI 2655 2849 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963049.1 protein_id gnl|my_center|LOCUS_22180 2929 3273 gene locus_tag LOCUS_22190 gene rplT 2929 3273 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence198 221 1078 gene locus_tag LOCUS_22200 gene hisG 221 1078 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_22200 1078 2367 gene locus_tag LOCUS_22210 gene hisD 1078 2367 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_22210 2360 3385 gene locus_tag LOCUS_22220 gene hisC 2360 3385 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963106.1 protein_id gnl|my_center|LOCUS_22220 3387 4475 gene locus_tag LOCUS_22230 gene hisB 3387 4475 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789124.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence199 1430 348 gene locus_tag LOCUS_22240 1430 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 1558 2310 gene locus_tag LOCUS_22250 1558 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2307 3290 gene locus_tag LOCUS_22260 2307 3290 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_22260 3361 4185 gene locus_tag LOCUS_22270 3361 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 4197 4799 gene locus_tag LOCUS_22280 4197 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence200 1472 504 gene locus_tag LOCUS_22290 gene arsM 1472 504 CDS product arsenosugar biosynthesis arsenite methyltransferase ArsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_22290 2845 1544 gene locus_tag LOCUS_22300 2845 1544 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_22300 2946 4271 gene locus_tag LOCUS_22310 2946 4271 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_22310 4405 4479 gene locus_tag LOCUS_t00320 4405 4479 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence201 1398 517 gene locus_tag LOCUS_22320 1398 517 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198488.1 protein_id gnl|my_center|LOCUS_22320 2158 1502 gene locus_tag LOCUS_22330 2158 1502 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023562.1 protein_id gnl|my_center|LOCUS_22330 2801 2214 gene locus_tag LOCUS_22340 2801 2214 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_22340 4272 2824 gene locus_tag LOCUS_22350 4272 2824 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence202 2587 2135 gene locus_tag LOCUS_22360 gene cdd 2587 2135 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_22360 2695 4041 gene locus_tag LOCUS_22370 2695 4041 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence203 390 686 gene locus_tag LOCUS_22380 390 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 699 1304 gene locus_tag LOCUS_22390 gene recR 699 1304 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_22390 1405 2421 gene locus_tag LOCUS_22400 gene rfbB 1405 2421 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035864.1 protein_id gnl|my_center|LOCUS_22400 2924 2613 gene locus_tag LOCUS_22410 2924 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 4141 3059 gene locus_tag LOCUS_22420 4141 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 4493 4290 gene locus_tag LOCUS_22430 4493 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence204 <1 698 gene locus_tag LOCUS_22440 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034097527.1:SDR family oxidoreductase 2614 701 gene locus_tag LOCUS_22450 2614 701 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405513.1 protein_id gnl|my_center|LOCUS_22450 2658 3809 gene locus_tag LOCUS_22460 2658 3809 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence205 2 2083 gene locus_tag LOCUS_22470 2 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2173 2475 gene locus_tag LOCUS_22480 2173 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2516 3394 gene locus_tag LOCUS_22490 gene fabD 2516 3394 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_22490 4731 3391 gene locus_tag LOCUS_22500 4731 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence206 667 3348 gene locus_tag LOCUS_22510 667 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 4660 3929 gene locus_tag LOCUS_22520 4660 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 4753 4826 gene locus_tag LOCUS_t00330 4753 4826 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence207 <1 2133 gene locus_tag LOCUS_22530 <1 2133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108282.1:bifunctional aspartate kinase/homoserine dehydrogenase I 2178 3065 gene locus_tag LOCUS_22540 2178 3065 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_22540 3062 4363 gene locus_tag LOCUS_22550 gene thrC 3062 4363 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence208 344 33 gene locus_tag LOCUS_22560 344 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 736 341 gene locus_tag LOCUS_22570 736 341 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_22570 1386 784 gene locus_tag LOCUS_22580 gene rsmG 1386 784 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_22580 1999 1391 gene locus_tag LOCUS_22590 1999 1391 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_22590 3120 1990 gene locus_tag LOCUS_22600 3120 1990 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129003072.1 protein_id gnl|my_center|LOCUS_22600 3199 4329 gene locus_tag LOCUS_22610 gene tgt 3199 4329 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence209 <1 2716 gene locus_tag LOCUS_22620 <1 2716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203230.1:alpha-amylase family glycosyl hydrolase >Feature sequence210 627 941 gene locus_tag LOCUS_22630 627 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 946 1209 gene locus_tag LOCUS_22640 gene rpmA 946 1209 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_22640 1318 1908 gene locus_tag LOCUS_22650 1318 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1905 2282 gene locus_tag LOCUS_22660 1905 2282 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764760.1 protein_id gnl|my_center|LOCUS_22660 2294 2851 gene locus_tag LOCUS_22670 2294 2851 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920958.1 protein_id gnl|my_center|LOCUS_22670 2928 3608 gene locus_tag LOCUS_22680 2928 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 4052 3639 gene locus_tag LOCUS_22690 4052 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence211 3 1775 gene locus_tag LOCUS_22700 3 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 1779 2075 gene locus_tag LOCUS_22710 1779 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2100 2384 gene locus_tag LOCUS_22720 2100 2384 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963283.1 protein_id gnl|my_center|LOCUS_22720 2458 4026 gene locus_tag LOCUS_22730 gene rny 2458 4026 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence212 998 2236 gene locus_tag LOCUS_22740 998 2236 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_22740 2236 2895 gene locus_tag LOCUS_22750 gene trmB 2236 2895 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_22750 3605 2892 gene locus_tag LOCUS_22760 3605 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 <4707 3655 gene locus_tag LOCUS_22770 <4707 3655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000405145.1:sterol desaturase family protein >Feature sequence213 1146 427 gene locus_tag LOCUS_22780 1146 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 3152 1146 gene locus_tag LOCUS_22790 3152 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 <4691 3259 gene locus_tag LOCUS_22800 <4691 3259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002195154.1:alanine/glycine:cation symporter family protein >Feature sequence214 1248 721 gene locus_tag LOCUS_22810 1248 721 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence215 436 972 gene locus_tag LOCUS_22820 436 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 1200 3539 gene locus_tag LOCUS_22830 1200 3539 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_22830 3542 4468 gene locus_tag LOCUS_22840 3542 4468 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203490.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence216 347 1708 gene locus_tag LOCUS_22850 gene mgtE 347 1708 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_22850 1720 2673 gene locus_tag LOCUS_22860 1720 2673 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_22860 2698 3519 gene locus_tag LOCUS_22870 2698 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3700 4173 gene locus_tag LOCUS_22880 gene greA 3700 4173 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_22880 4179 4571 gene locus_tag LOCUS_22890 4179 4571 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence217 325 483 gene locus_tag LOCUS_22900 325 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 874 617 gene locus_tag LOCUS_22910 874 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 904 1056 gene locus_tag LOCUS_22920 904 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1171 3291 gene locus_tag LOCUS_22930 1171 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 4127 3303 gene locus_tag LOCUS_22940 4127 3303 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974348.1 protein_id gnl|my_center|LOCUS_22940 4214 4543 gene locus_tag LOCUS_22950 4214 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 >Feature sequence218 127 2580 gene locus_tag LOCUS_22960 127 2580 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_22960 2649 4016 gene locus_tag LOCUS_22970 2649 4016 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_22970 <4615 4020 gene locus_tag LOCUS_22980 <4615 4020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044390357.1:glycerophosphodiester phosphodiesterase >Feature sequence219 1631 741 gene locus_tag LOCUS_22990 1631 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1734 3770 gene locus_tag LOCUS_23000 1734 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2096 2025 gene locus_tag LOCUS_t00340 2096 2025 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4181 3708 gene locus_tag LOCUS_23010 4181 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence220 <1 515 gene locus_tag LOCUS_23020 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108349.1:M28 family peptidase 1634 675 gene locus_tag LOCUS_23030 1634 675 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_23030 2730 1645 gene locus_tag LOCUS_23040 2730 1645 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_23040 2981 3238 gene locus_tag LOCUS_23050 2981 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 4318 3239 gene locus_tag LOCUS_23060 4318 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence221 208 1530 gene locus_tag LOCUS_23070 gene argH 208 1530 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_23070 3191 1527 gene locus_tag LOCUS_23080 gene rho 3191 1527 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962876.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence222 1618 2283 gene locus_tag LOCUS_23090 1618 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020790.1 protein_id gnl|my_center|LOCUS_23090 3060 2305 gene locus_tag LOCUS_23100 3060 2305 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_23100 3472 3927 gene locus_tag LOCUS_23110 3472 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence223 796 434 gene locus_tag LOCUS_23120 796 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 924 2270 gene locus_tag LOCUS_23130 924 2270 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_23130 2332 2973 gene locus_tag LOCUS_23140 2332 2973 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_23140 2973 4151 gene locus_tag LOCUS_23150 2973 4151 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838120.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence224 92 391 gene locus_tag LOCUS_23160 92 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence225 1697 75 gene locus_tag LOCUS_23170 1697 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2416 1697 gene locus_tag LOCUS_23180 2416 1697 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_23180 2607 3860 gene locus_tag LOCUS_23190 2607 3860 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence226 985 2169 gene locus_tag LOCUS_23200 985 2169 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763543.1 protein_id gnl|my_center|LOCUS_23200 2181 2513 gene locus_tag LOCUS_23210 2181 2513 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325418.1 protein_id gnl|my_center|LOCUS_23210 2611 3261 gene locus_tag LOCUS_23220 2611 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 3871 3290 gene locus_tag LOCUS_23230 3871 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence227 1972 863 gene locus_tag LOCUS_23240 gene paaK 1972 863 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976332.1 protein_id gnl|my_center|LOCUS_23240 4222 1988 gene locus_tag LOCUS_23250 4222 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence228 1051 104 gene locus_tag LOCUS_23260 1051 104 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_23260 1207 2403 gene locus_tag LOCUS_23270 gene kbl 1207 2403 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_23270 2403 3647 gene locus_tag LOCUS_23280 2403 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 3990 3628 gene locus_tag LOCUS_23290 3990 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence229 <1 975 gene locus_tag LOCUS_23300 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788070.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD 978 1349 gene locus_tag LOCUS_23310 978 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 1353 2300 gene locus_tag LOCUS_23320 1353 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2413 2622 gene locus_tag LOCUS_23330 2413 2622 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_23330 2649 2954 gene locus_tag LOCUS_23340 2649 2954 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_23340 3268 3885 gene locus_tag LOCUS_23350 3268 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 4100 3903 gene locus_tag LOCUS_23360 4100 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence230 <1 617 gene locus_tag LOCUS_23370 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546572.1:universal stress protein 683 1123 gene locus_tag LOCUS_23380 683 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1298 3157 gene locus_tag LOCUS_23390 1298 3157 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence231 279 506 gene locus_tag LOCUS_23400 279 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 1959 898 gene locus_tag LOCUS_23410 gene hypE 1959 898 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_23410 3611 1992 gene locus_tag LOCUS_23420 3611 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence232 829 1953 gene locus_tag LOCUS_23430 829 1953 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_23430 2813 1950 gene locus_tag LOCUS_23440 2813 1950 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081450.1 protein_id gnl|my_center|LOCUS_23440 3705 2797 gene locus_tag LOCUS_23450 3705 2797 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964573.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence233 2131 860 gene locus_tag LOCUS_23460 2131 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 3165 2128 gene locus_tag LOCUS_23470 3165 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence234 <1 653 gene locus_tag LOCUS_23480 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963720.1:MFS transporter 650 1612 gene locus_tag LOCUS_23490 650 1612 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_23490 1922 1623 gene locus_tag LOCUS_23500 1922 1623 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 protein_id gnl|my_center|LOCUS_23500 3469 2408 gene locus_tag LOCUS_23510 3469 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence235 135 257 gene locus_tag LOCUS_23520 135 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 401 919 gene locus_tag LOCUS_23530 gene idi 401 919 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890634.1 protein_id gnl|my_center|LOCUS_23530 1013 3952 gene locus_tag LOCUS_23540 gene leuS 1013 3952 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203753.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence236 <1 1571 gene locus_tag LOCUS_23550 <1 1571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963229.1:gliding motility-associated ABC transporter substrate-binding protein GldG 1571 2506 gene locus_tag LOCUS_23560 1571 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 2602 3726 gene locus_tag LOCUS_23570 gene dnaN 2602 3726 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence237 1 432 gene locus_tag LOCUS_23580 1 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 462 923 gene locus_tag LOCUS_23590 462 923 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_23590 943 3159 gene locus_tag LOCUS_23600 943 3159 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence238 >Feature sequence239 49 1431 gene locus_tag LOCUS_23610 49 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 1526 1963 gene locus_tag LOCUS_23620 1526 1963 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_23620 1998 3164 gene locus_tag LOCUS_23630 1998 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence240 2860 149 gene locus_tag LOCUS_23640 2860 149 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence241 <1 2321 gene locus_tag LOCUS_23650 <1 2321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939362.1:DEAD/DEAH box helicase 2333 3694 gene locus_tag LOCUS_23660 gene radA 2333 3694 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence242 552 85 gene locus_tag LOCUS_23670 552 85 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972483.1 protein_id gnl|my_center|LOCUS_23670 624 1397 gene locus_tag LOCUS_23680 624 1397 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_23680 2479 1445 gene locus_tag LOCUS_23690 2479 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2641 3072 gene locus_tag LOCUS_23700 2641 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 3093 3722 gene locus_tag LOCUS_23710 3093 3722 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence243 140 1786 gene locus_tag LOCUS_23720 140 1786 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence244 888 151 gene locus_tag LOCUS_23730 888 151 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_23730 1016 1441 gene locus_tag LOCUS_23740 1016 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2101 2832 gene locus_tag LOCUS_23750 2101 2832 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_23750 2832 3473 gene locus_tag LOCUS_23760 2832 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence245 1970 558 gene locus_tag LOCUS_23770 1970 558 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_23770 3305 1992 gene locus_tag LOCUS_23780 3305 1992 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence246 <1 2126 gene locus_tag LOCUS_23790 <1 2126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880400.1:carbamoyltransferase HypF 2206 3015 gene locus_tag LOCUS_23800 2206 3015 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_23800 3147 3365 gene locus_tag LOCUS_23810 3147 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence247 464 712 gene locus_tag LOCUS_23820 464 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 702 1751 gene locus_tag LOCUS_23830 702 1751 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965488.1 protein_id gnl|my_center|LOCUS_23830 1762 3120 gene locus_tag LOCUS_23840 gene fslC 1762 3120 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence248 718 1893 gene locus_tag LOCUS_23850 718 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_23850 2319 2008 gene locus_tag LOCUS_23860 2319 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 3638 3565 gene locus_tag LOCUS_t00350 3638 3565 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence249 2798 1392 gene locus_tag LOCUS_23870 2798 1392 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_23870 3469 2837 gene locus_tag LOCUS_23880 gene sdaAB 3469 2837 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706830.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence250 1573 551 gene locus_tag LOCUS_23890 1573 551 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_23890 1605 2519 gene locus_tag LOCUS_23900 1605 2519 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence251 >Feature sequence252 1543 464 gene locus_tag LOCUS_23910 1543 464 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_23910 2933 1605 gene locus_tag LOCUS_23920 2933 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 <3620 2953 gene locus_tag LOCUS_23930 <3620 2953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_185958394.1:TonB-dependent receptor >Feature sequence253 2429 63 gene locus_tag LOCUS_23940 2429 63 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_23940 3452 2457 gene locus_tag LOCUS_23950 3452 2457 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence254 <1 930 gene locus_tag LOCUS_23960 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003863539.1:potassium channel family protein 931 2295 gene locus_tag LOCUS_23970 931 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence255 <1 1859 gene locus_tag LOCUS_23980 <1 1859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein 1969 2841 gene locus_tag LOCUS_23990 1969 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 3538 2828 gene locus_tag LOCUS_24000 3538 2828 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764712.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence256 <1 786 gene locus_tag LOCUS_24010 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084235.1:methionine synthase 803 1759 gene locus_tag LOCUS_24020 gene metF 803 1759 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_24020 2095 1796 gene locus_tag LOCUS_24030 2095 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2518 2135 gene locus_tag LOCUS_24040 2518 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2708 3190 gene locus_tag LOCUS_24050 2708 3190 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736521.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence257 2235 1000 gene locus_tag LOCUS_24060 2235 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 3338 2235 gene locus_tag LOCUS_24070 gene wecB 3338 2235 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546846.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence258 222 295 gene locus_tag LOCUS_t00360 222 295 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1417 386 gene locus_tag LOCUS_24080 1417 386 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015531930.1 protein_id gnl|my_center|LOCUS_24080 1743 1420 gene locus_tag LOCUS_24090 1743 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 1959 1747 gene locus_tag LOCUS_24100 1959 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2701 2048 gene locus_tag LOCUS_24110 2701 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3363 2704 gene locus_tag LOCUS_24120 3363 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence259 3442 1373 gene locus_tag LOCUS_24130 3442 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence260 3171 2155 gene locus_tag LOCUS_24140 3171 2155 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence261 661 1215 gene locus_tag LOCUS_24150 661 1215 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_24150 1215 2282 gene locus_tag LOCUS_24160 1215 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2324 2839 gene locus_tag LOCUS_24170 2324 2839 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence262 1746 508 gene locus_tag LOCUS_24180 gene rocD 1746 508 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_24180 1948 2148 gene locus_tag LOCUS_24190 gene rpmB 1948 2148 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence263 1794 400 gene locus_tag LOCUS_24200 gene lpdA 1794 400 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_24200 3351 1807 gene locus_tag LOCUS_24210 gene odhB 3351 1807 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019797.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence264 425 829 gene locus_tag LOCUS_tm00010 425 829 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2468 1623 gene locus_tag LOCUS_24220 2468 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 3115 2453 gene locus_tag LOCUS_24230 3115 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence265 276 989 gene locus_tag LOCUS_24240 276 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 1113 964 gene locus_tag LOCUS_24250 1113 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1896 1165 gene locus_tag LOCUS_24260 1896 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 2655 1930 gene locus_tag LOCUS_24270 2655 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence266 1077 466 gene locus_tag LOCUS_24280 1077 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence267 76 1320 gene locus_tag LOCUS_24290 76 1320 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_24290 1317 2249 gene locus_tag LOCUS_24300 gene rsgA 1317 2249 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764015.1 protein_id gnl|my_center|LOCUS_24300 3080 2658 gene locus_tag LOCUS_24310 3080 2658 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence268 2934 703 gene locus_tag LOCUS_24320 2934 703 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_24320 2818 3030 gene locus_tag LOCUS_24330 2818 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence269 2925 2155 gene locus_tag LOCUS_24340 2925 2155 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082209.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence270 3 1319 gene locus_tag LOCUS_24350 3 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 1491 1679 gene locus_tag LOCUS_24360 1491 1679 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_24360 2626 1727 gene locus_tag LOCUS_24370 2626 1727 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_24370 <3159 2623 gene locus_tag LOCUS_24380 <3159 2623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007057650.1:DUF2183 domain-containing protein >Feature sequence271 <1 2400 gene locus_tag LOCUS_24390 <1 2400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058185.1:CHAT domain-containing protein >Feature sequence272 2238 1531 gene locus_tag LOCUS_24400 2238 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2963 2475 gene locus_tag LOCUS_24410 2963 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence273 732 1355 gene locus_tag LOCUS_24420 gene pnuC 732 1355 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_24420 1322 1867 gene locus_tag LOCUS_24430 1322 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2765 2469 gene locus_tag LOCUS_24440 2765 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence274 720 37 gene locus_tag LOCUS_24450 720 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1640 789 gene locus_tag LOCUS_24460 1640 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2335 1637 gene locus_tag LOCUS_24470 2335 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence275 347 1282 gene locus_tag LOCUS_24480 gene mdh 347 1282 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_24480 1618 2973 gene locus_tag LOCUS_24490 1618 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence276 1758 1108 gene locus_tag LOCUS_24500 1758 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 <2944 1755 gene locus_tag LOCUS_24510 <2944 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006285466.1:DASS family sodium-coupled anion symporter >Feature sequence277 389 2044 gene locus_tag LOCUS_24520 389 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2210 2527 gene locus_tag LOCUS_24530 2210 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence278 1492 320 gene locus_tag LOCUS_24540 1492 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2839 1562 gene locus_tag LOCUS_24550 gene purD 2839 1562 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence279 1260 1775 gene locus_tag LOCUS_24560 1260 1775 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence280 <1 873 gene locus_tag LOCUS_24570 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403341.1:S8 family peptidase 1201 878 gene locus_tag LOCUS_24580 1201 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1313 2278 gene locus_tag LOCUS_24590 1313 2278 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence281 2337 166 gene locus_tag LOCUS_24600 2337 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 <2858 2343 gene locus_tag LOCUS_24610 <2858 2343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:OmpA family protein >Feature sequence282 1943 891 gene locus_tag LOCUS_24620 1943 891 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_24620 <2848 1976 gene locus_tag LOCUS_24630 <2848 1976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003863514.1:GDP-mannose 4,6-dehydratase >Feature sequence283 278 883 gene locus_tag LOCUS_24640 278 883 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_24640 901 1926 gene locus_tag LOCUS_24650 901 1926 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051000.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence284 577 104 gene locus_tag LOCUS_24660 577 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 683 1114 gene locus_tag LOCUS_24670 683 1114 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889457.1 protein_id gnl|my_center|LOCUS_24670 1114 2526 gene locus_tag LOCUS_24680 1114 2526 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence285 1660 608 gene locus_tag LOCUS_24690 1660 608 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_24690 <2763 1693 gene locus_tag LOCUS_24700 <2763 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706703.1:GDP-mannose 4,6-dehydratase >Feature sequence286 1485 274 gene locus_tag LOCUS_24710 gene mraY 1485 274 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_24710 <2728 1487 gene locus_tag LOCUS_24720 <2728 1487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964160.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence287 1165 494 gene locus_tag LOCUS_24730 gene tsaB 1165 494 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_24730 <2701 1176 gene locus_tag LOCUS_24740 <2701 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765353.1:S41 family peptidase >Feature sequence288 <1 1283 gene locus_tag LOCUS_24750 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964044.1:methylmalonyl-CoA mutase family protein <2606 1286 gene locus_tag LOCUS_24760 <2606 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142698.1:phospholipid carrier-dependent glycosyltransferase >Feature sequence289 1464 130 gene locus_tag LOCUS_24770 1464 130 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943836.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence290 1413 934 gene locus_tag LOCUS_24780 1413 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence291 937 365 gene locus_tag LOCUS_24790 937 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence292 >Feature sequence293 430 1131 gene locus_tag LOCUS_24800 430 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 1293 2066 gene locus_tag LOCUS_24810 gene ygiD 1293 2066 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_24810 2084 2215 gene locus_tag LOCUS_24820 2084 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence294 1290 253 gene locus_tag LOCUS_24830 1290 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 2202 1333 gene locus_tag LOCUS_24840 2202 1333 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence295 <2278 1307 gene locus_tag LOCUS_24850 <2278 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816732.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence296 630 73 gene locus_tag LOCUS_24860 630 73 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence297 >Feature sequence298 216 995 gene locus_tag LOCUS_24870 216 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence299 >Feature sequence300 1728 355 gene locus_tag LOCUS_24880 gene mnmE 1728 355 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence301 <1 699 gene locus_tag LOCUS_24890 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925419.1:sodium-dependent transporter >Feature sequence302 238 1578 gene locus_tag LOCUS_24900 gene nqrF 238 1578 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence303 383 48 gene locus_tag LOCUS_24910 383 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 <2133 691 gene locus_tag LOCUS_24920 <2133 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010538536.1:trypsin-like peptidase domain-containing protein >Feature sequence304 <1 732 gene locus_tag LOCUS_24930 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760327.1:phosphopyruvate hydratase 843 1139 gene locus_tag LOCUS_24940 843 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1126 1647 gene locus_tag LOCUS_24950 1126 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence305 287 1936 gene locus_tag LOCUS_24960 gene pgi 287 1936 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790033.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence306 1940 450 gene locus_tag LOCUS_24970 gene cysS 1940 450 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence307 138 389 gene locus_tag LOCUS_24980 gene rpsT 138 389 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963520.1 protein_id gnl|my_center|LOCUS_24980 747 1442 gene locus_tag LOCUS_24990 gene radC 747 1442 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_24990 1439 2032 gene locus_tag LOCUS_25000 1439 2032 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888029.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence308 732 166 gene locus_tag LOCUS_25010 732 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139517245.1 protein_id gnl|my_center|LOCUS_25010 823 1527 gene locus_tag LOCUS_25020 823 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence309 668 381 gene locus_tag LOCUS_25030 668 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 816 2030 gene locus_tag LOCUS_25040 816 2030 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861662.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence310 400 780 gene locus_tag LOCUS_25050 400 780 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence311 >Feature sequence312