>Feature sequence01 1242 514 gene locus_tag LOCUS_0010 1242 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0010 2448 1282 gene locus_tag LOCUS_0020 gene eno 2448 1282 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084206.1 protein_id gnl|my_center|LOCUS_0020 3461 2445 gene locus_tag LOCUS_0030 3461 2445 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 protein_id gnl|my_center|LOCUS_0030 5950 3500 gene locus_tag LOCUS_0040 gene ppsA 5950 3500 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_0040 7279 5975 gene locus_tag LOCUS_0050 7279 5975 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_0050 7393 8067 gene locus_tag LOCUS_0060 7393 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 9860 8043 gene locus_tag LOCUS_0070 9860 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0070 10968 9868 gene locus_tag LOCUS_0080 10968 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 11687 11007 gene locus_tag LOCUS_0090 11687 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 13408 12587 gene locus_tag LOCUS_0100 13408 12587 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941055.1 protein_id gnl|my_center|LOCUS_0100 13512 14270 gene locus_tag LOCUS_0110 13512 14270 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030586.1 protein_id gnl|my_center|LOCUS_0110 17376 14356 gene locus_tag LOCUS_0120 17376 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 18915 17515 gene locus_tag LOCUS_0130 gene rpoD 18915 17515 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_0130 20728 18980 gene locus_tag LOCUS_0140 20728 18980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 24548 20799 gene locus_tag LOCUS_0150 24548 20799 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_0150 27778 24581 gene locus_tag LOCUS_0160 gene rpoB 27778 24581 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393945.1 protein_id gnl|my_center|LOCUS_0160 28918 28226 gene locus_tag LOCUS_0170 gene trmD 28918 28226 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_0170 29435 29064 gene locus_tag LOCUS_0180 29435 29064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 29996 29577 gene locus_tag LOCUS_0190 29996 29577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 30278 32344 gene locus_tag LOCUS_0200 gene rnr 30278 32344 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_0200 32431 32688 gene locus_tag LOCUS_0210 32431 32688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 33560 32811 gene locus_tag LOCUS_0220 33560 32811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 36363 34006 gene locus_tag LOCUS_0230 36363 34006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0230 37052 36357 gene locus_tag LOCUS_0240 gene rnc 37052 36357 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 protein_id gnl|my_center|LOCUS_0240 38147 37203 gene locus_tag LOCUS_0250 38147 37203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 38585 38337 gene locus_tag LOCUS_0260 38585 38337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 39294 38683 gene locus_tag LOCUS_0270 39294 38683 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056510.1 protein_id gnl|my_center|LOCUS_0270 39348 42566 gene locus_tag LOCUS_0280 39348 42566 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_0280 43201 42593 gene locus_tag LOCUS_0290 43201 42593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 43391 45124 gene locus_tag LOCUS_0300 gene thrS 43391 45124 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058036.1 protein_id gnl|my_center|LOCUS_0300 48028 45227 gene locus_tag LOCUS_0310 48028 45227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 49119 48289 gene locus_tag LOCUS_0320 49119 48289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 49554 50783 gene locus_tag LOCUS_0330 49554 50783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 53028 50947 gene locus_tag LOCUS_0340 gene gyrB 53028 50947 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_0340 53935 53177 gene locus_tag LOCUS_0350 53935 53177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 54345 53989 gene locus_tag LOCUS_0360 54345 53989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 56470 54536 gene locus_tag LOCUS_0370 gene pheT 56470 54536 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663007.1 protein_id gnl|my_center|LOCUS_0370 57229 56483 gene locus_tag LOCUS_0380 57229 56483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 58299 57253 gene locus_tag LOCUS_0390 58299 57253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 59947 58286 gene locus_tag LOCUS_0400 59947 58286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 60209 60136 gene locus_tag LOCUS_t0010 60209 60136 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 60830 60243 gene locus_tag LOCUS_0410 gene tsf 60830 60243 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545220.1 protein_id gnl|my_center|LOCUS_0410 61692 60904 gene locus_tag LOCUS_0420 gene rpsB 61692 60904 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259402.1 protein_id gnl|my_center|LOCUS_0420 62839 61853 gene locus_tag LOCUS_0430 gene prfA 62839 61853 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056003.1 protein_id gnl|my_center|LOCUS_0430 63235 62960 gene locus_tag LOCUS_0440 63235 62960 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678397.1 protein_id gnl|my_center|LOCUS_0440 64762 63296 gene locus_tag LOCUS_0450 64762 63296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 65569 64925 gene locus_tag LOCUS_0460 65569 64925 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_0460 65805 66818 gene locus_tag LOCUS_0470 65805 66818 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020716.1 protein_id gnl|my_center|LOCUS_0470 67051 66815 gene locus_tag LOCUS_0480 67051 66815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 68124 67126 gene locus_tag LOCUS_0490 68124 67126 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932485.1 protein_id gnl|my_center|LOCUS_0490 68595 68140 gene locus_tag LOCUS_0500 68595 68140 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868380.1 protein_id gnl|my_center|LOCUS_0500 69494 68631 gene locus_tag LOCUS_0510 69494 68631 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002663.1 protein_id gnl|my_center|LOCUS_0510 70721 69603 gene locus_tag LOCUS_0520 70721 69603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0520 72416 70764 gene locus_tag LOCUS_0530 72416 70764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0530 >Feature sequence02 1749 1147 gene locus_tag LOCUS_0540 gene clpP 1749 1147 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_0540 1992 2624 gene locus_tag LOCUS_0550 1992 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 3045 2638 gene locus_tag LOCUS_0560 3045 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0560 3321 4382 gene locus_tag LOCUS_0570 3321 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 5592 4438 gene locus_tag LOCUS_0580 5592 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 6165 5731 gene locus_tag LOCUS_0590 6165 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0590 7247 6225 gene locus_tag LOCUS_0600 7247 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0600 8972 7455 gene locus_tag LOCUS_0610 8972 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 9202 9534 gene locus_tag LOCUS_0620 9202 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 9766 12324 gene locus_tag LOCUS_0630 9766 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 13133 12321 gene locus_tag LOCUS_0640 13133 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0640 13864 14310 gene locus_tag LOCUS_0650 13864 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 14573 15166 gene locus_tag LOCUS_0660 14573 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 15315 15656 gene locus_tag LOCUS_0670 15315 15656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0670 15931 17628 gene locus_tag LOCUS_0680 15931 17628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0680 17731 18267 gene locus_tag LOCUS_0690 17731 18267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 18542 19768 gene locus_tag LOCUS_0700 18542 19768 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971562.1 protein_id gnl|my_center|LOCUS_0700 19780 21651 gene locus_tag LOCUS_0710 19780 21651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0710 21644 22267 gene locus_tag LOCUS_0720 21644 22267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0720 22579 24327 gene locus_tag LOCUS_0730 gene pilB 22579 24327 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_0730 24358 25575 gene locus_tag LOCUS_0740 24358 25575 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_0740 25565 27373 gene locus_tag LOCUS_0750 25565 27373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 27470 28045 gene locus_tag LOCUS_0760 27470 28045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 28112 29518 gene locus_tag LOCUS_0770 28112 29518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 29547 30326 gene locus_tag LOCUS_0780 29547 30326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 30323 31486 gene locus_tag LOCUS_0790 30323 31486 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228285.1 protein_id gnl|my_center|LOCUS_0790 31489 32028 gene locus_tag LOCUS_0800 31489 32028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0800 32501 32091 gene locus_tag LOCUS_0810 32501 32091 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_0810 32537 33973 gene locus_tag LOCUS_0820 32537 33973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0820 33970 35661 gene locus_tag LOCUS_0830 gene recJ 33970 35661 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_0830 35706 36146 gene locus_tag LOCUS_0840 35706 36146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 36228 37718 gene locus_tag LOCUS_0850 36228 37718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0850 38338 37745 gene locus_tag LOCUS_0860 38338 37745 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545523.1 protein_id gnl|my_center|LOCUS_0860 38473 39030 gene locus_tag LOCUS_0870 38473 39030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 39032 39940 gene locus_tag LOCUS_0880 39032 39940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 40517 40071 gene locus_tag LOCUS_0890 40517 40071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 40461 41105 gene locus_tag LOCUS_0900 40461 41105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0900 41131 41664 gene locus_tag LOCUS_0910 41131 41664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 41763 42173 gene locus_tag LOCUS_0920 gene rpsL 41763 42173 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 protein_id gnl|my_center|LOCUS_0920 42306 42713 gene locus_tag LOCUS_0930 gene rpsG 42306 42713 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_0930 43040 45199 gene locus_tag LOCUS_0940 gene fusA 43040 45199 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879924.1 protein_id gnl|my_center|LOCUS_0940 45573 46766 gene locus_tag LOCUS_0950 gene tuf 45573 46766 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869930.1 protein_id gnl|my_center|LOCUS_0950 47056 47415 gene locus_tag LOCUS_0960 gene rpsJ 47056 47415 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389727.1 protein_id gnl|my_center|LOCUS_0960 47487 48113 gene locus_tag LOCUS_0970 gene rplC 47487 48113 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_0970 48123 48830 gene locus_tag LOCUS_0980 gene rplD 48123 48830 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690088.1 protein_id gnl|my_center|LOCUS_0980 48831 49250 gene locus_tag LOCUS_0990 48831 49250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 49286 50134 gene locus_tag LOCUS_1000 gene rplB 49286 50134 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_1000 50863 51198 gene locus_tag LOCUS_1010 gene rpsS 50863 51198 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081828.1 protein_id gnl|my_center|LOCUS_1010 51244 51756 gene locus_tag LOCUS_1020 51244 51756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 51820 52491 gene locus_tag LOCUS_1030 gene rpsC 51820 52491 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892829.1 protein_id gnl|my_center|LOCUS_1030 52546 52977 gene locus_tag LOCUS_1040 gene rplP 52546 52977 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941219.1 protein_id gnl|my_center|LOCUS_1040 53025 53264 gene locus_tag LOCUS_1050 53025 53264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 53288 53587 gene locus_tag LOCUS_1060 53288 53587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 53600 53971 gene locus_tag LOCUS_1070 gene rplN 53600 53971 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495199.1 protein_id gnl|my_center|LOCUS_1070 54005 54316 gene locus_tag LOCUS_1080 gene rplX 54005 54316 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_1080 54366 54920 gene locus_tag LOCUS_1090 gene rplE 54366 54920 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_1090 55184 56158 gene locus_tag LOCUS_1100 55184 56158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 56155 56634 gene locus_tag LOCUS_1110 56155 56634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1110 56916 57728 gene locus_tag LOCUS_1120 56916 57728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 58516 57854 gene locus_tag LOCUS_1130 58516 57854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 59367 58885 gene locus_tag LOCUS_1140 59367 58885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1140 >Feature sequence03 <1 1044 gene locus_tag LOCUS_1150 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003640859.1:phospho-N-acetylmuramoyl-pentapeptide-transferase 1111 2211 gene locus_tag LOCUS_1160 gene spoVE 1111 2211 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_1160 2259 3404 gene locus_tag LOCUS_1170 gene murG 2259 3404 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724766.1 protein_id gnl|my_center|LOCUS_1170 3508 4833 gene locus_tag LOCUS_1180 3508 4833 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_1180 4859 5110 gene locus_tag LOCUS_1190 4859 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 5349 5579 gene locus_tag LOCUS_1200 5349 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1200 6075 5875 gene locus_tag LOCUS_1210 6075 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 6440 6081 gene locus_tag LOCUS_1220 6440 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 7637 6795 gene locus_tag LOCUS_1230 7637 6795 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705173.1 protein_id gnl|my_center|LOCUS_1230 8938 7655 gene locus_tag LOCUS_1240 8938 7655 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566494.1 protein_id gnl|my_center|LOCUS_1240 9881 9054 gene locus_tag LOCUS_1250 9881 9054 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074240.1 protein_id gnl|my_center|LOCUS_1250 10511 9945 gene locus_tag LOCUS_1260 10511 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1260 11640 10705 gene locus_tag LOCUS_1270 gene gnd 11640 10705 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933532.1 protein_id gnl|my_center|LOCUS_1270 11762 12052 gene locus_tag LOCUS_1280 11762 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1280 12211 13309 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atctacataagtagaaattttatataaggattagac 13939 13658 gene locus_tag LOCUS_1290 13939 13658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1290 14973 13927 gene locus_tag LOCUS_1300 14973 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 15544 15002 gene locus_tag LOCUS_1310 15544 15002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1310 19549 15647 gene locus_tag LOCUS_1320 19549 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 21296 19893 gene locus_tag LOCUS_1330 gene zwf 21296 19893 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_1330 23179 21311 gene locus_tag LOCUS_1340 23179 21311 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_1340 23904 23287 gene locus_tag LOCUS_1350 23904 23287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 24276 23953 gene locus_tag LOCUS_1360 24276 23953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1360 24678 24286 gene locus_tag LOCUS_1370 24678 24286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 24750 25046 gene locus_tag LOCUS_1380 gene rpmA 24750 25046 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081742.1 protein_id gnl|my_center|LOCUS_1380 25610 25164 gene locus_tag LOCUS_1390 gene rplI 25610 25164 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391680.1 protein_id gnl|my_center|LOCUS_1390 26846 25617 gene locus_tag LOCUS_1400 26846 25617 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_1400 27004 27921 gene locus_tag LOCUS_1410 gene corA 27004 27921 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_1410 27976 29448 gene locus_tag LOCUS_1420 gene cysS 27976 29448 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_1420 29546 30940 gene locus_tag LOCUS_1430 gene dnaB 29546 30940 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_1430 32214 31063 gene locus_tag LOCUS_1440 32214 31063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 32436 33101 gene locus_tag LOCUS_1450 gene recR 32436 33101 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256424.1 protein_id gnl|my_center|LOCUS_1450 34399 33200 gene locus_tag LOCUS_1460 34399 33200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 36371 34551 gene locus_tag LOCUS_1470 gene glmS 36371 34551 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838750.1 protein_id gnl|my_center|LOCUS_1470 36961 36641 gene locus_tag LOCUS_1480 gene rplU 36961 36641 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_1480 38133 37030 gene locus_tag LOCUS_1490 38133 37030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 40820 38139 gene locus_tag LOCUS_1500 40820 38139 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_1500 40891 41346 gene locus_tag LOCUS_1510 40891 41346 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_1510 41381 41824 gene locus_tag LOCUS_1520 41381 41824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1520 42541 41921 gene locus_tag LOCUS_1530 42541 41921 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207579.1 protein_id gnl|my_center|LOCUS_1530 43289 42534 gene locus_tag LOCUS_1540 43289 42534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 43864 43313 gene locus_tag LOCUS_1550 43864 43313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1550 44893 43925 gene locus_tag LOCUS_1560 44893 43925 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879978.1 protein_id gnl|my_center|LOCUS_1560 >Feature sequence04 334 753 gene locus_tag LOCUS_1570 334 753 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213035039.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_1570 896 1360 gene locus_tag LOCUS_1580 896 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 2604 3782 gene locus_tag LOCUS_1590 2604 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 4434 3823 gene locus_tag LOCUS_1600 gene cyaB 4434 3823 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249462.1 protein_id gnl|my_center|LOCUS_1600 4911 4489 gene locus_tag LOCUS_1610 4911 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 5512 5021 gene locus_tag LOCUS_1620 5512 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1620 6305 5868 gene locus_tag LOCUS_1630 6305 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 6897 6307 gene locus_tag LOCUS_1640 6897 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 8305 6902 gene locus_tag LOCUS_1650 gene merA 8305 6902 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846936.1 protein_id gnl|my_center|LOCUS_1650 8905 8618 gene locus_tag LOCUS_1660 8905 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 12206 8958 gene locus_tag LOCUS_1670 12206 8958 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880414.1 protein_id gnl|my_center|LOCUS_1670 13862 12225 gene locus_tag LOCUS_1680 13862 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 13904 14179 gene locus_tag LOCUS_1690 13904 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 14658 14194 gene locus_tag LOCUS_1700 14658 14194 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_1700 14657 14836 gene locus_tag LOCUS_1710 14657 14836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 16591 14900 gene locus_tag LOCUS_1720 16591 14900 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 protein_id gnl|my_center|LOCUS_1720 18463 16619 gene locus_tag LOCUS_1730 18463 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 19142 18489 gene locus_tag LOCUS_1740 19142 18489 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727611.1 protein_id gnl|my_center|LOCUS_1740 20663 19236 gene locus_tag LOCUS_1750 20663 19236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1750 21581 20670 gene locus_tag LOCUS_1760 21581 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1760 21830 21755 gene locus_tag LOCUS_t0020 21830 21755 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 23312 21909 gene locus_tag LOCUS_1770 23312 21909 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518852.1 protein_id gnl|my_center|LOCUS_1770 24624 23422 gene locus_tag LOCUS_1780 gene yhbH 24624 23422 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963900.1 protein_id gnl|my_center|LOCUS_1780 26786 24867 gene locus_tag LOCUS_1790 26786 24867 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518851.1 protein_id gnl|my_center|LOCUS_1790 27405 27321 gene locus_tag LOCUS_t0030 27405 27321 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28095 27508 gene locus_tag LOCUS_1800 28095 27508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 29050 28277 gene locus_tag LOCUS_1810 29050 28277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 29717 29070 gene locus_tag LOCUS_1820 29717 29070 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081614.1 protein_id gnl|my_center|LOCUS_1820 30237 29851 gene locus_tag LOCUS_1830 30237 29851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1830 30328 30254 gene locus_tag LOCUS_t0040 30328 30254 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30518 30446 gene locus_tag LOCUS_t0050 30518 30446 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30893 30558 gene locus_tag LOCUS_1840 30893 30558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1840 31589 31029 gene locus_tag LOCUS_1850 31589 31029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 32152 31586 gene locus_tag LOCUS_1860 32152 31586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 33264 32149 gene locus_tag LOCUS_1870 33264 32149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 33926 33342 gene locus_tag LOCUS_1880 33926 33342 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_1880 34345 33935 gene locus_tag LOCUS_1890 gene metG 34345 33935 CDS product methionine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880236.1 protein_id gnl|my_center|LOCUS_1890 34863 34435 gene locus_tag LOCUS_1900 gene ruvX 34863 34435 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053384.1 protein_id gnl|my_center|LOCUS_1900 34953 35204 gene locus_tag LOCUS_1910 34953 35204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1910 35382 35471 gene locus_tag LOCUS_t0060 35382 35471 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence05 266 338 gene locus_tag LOCUS_t0070 266 338 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 656 868 gene locus_tag LOCUS_1920 656 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 1350 1691 gene locus_tag LOCUS_1930 1350 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 1783 3747 gene locus_tag LOCUS_1940 1783 3747 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082373898.1 protein_id gnl|my_center|LOCUS_1940 3942 4748 gene locus_tag LOCUS_1950 3942 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 4764 5315 gene locus_tag LOCUS_1960 4764 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 5378 6034 gene locus_tag LOCUS_1970 5378 6034 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 protein_id gnl|my_center|LOCUS_1970 6399 6061 gene locus_tag LOCUS_1980 6399 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 6482 6841 gene locus_tag LOCUS_1990 6482 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1990 6992 7468 gene locus_tag LOCUS_2000 6992 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_2000 8845 7544 gene locus_tag LOCUS_2010 8845 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 10638 8923 gene locus_tag LOCUS_2020 10638 8923 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266230.1 protein_id gnl|my_center|LOCUS_2020 10962 10642 gene locus_tag LOCUS_2030 10962 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 11995 11024 gene locus_tag LOCUS_2040 gene rsmH 11995 11024 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_2040 12451 12017 gene locus_tag LOCUS_2050 gene mraZ 12451 12017 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_2050 14169 12709 gene locus_tag LOCUS_2060 gene lysS 14169 12709 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_2060 14692 14216 gene locus_tag LOCUS_2070 gene greA 14692 14216 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_2070 16461 14773 gene locus_tag LOCUS_2080 16461 14773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2080 16768 16469 gene locus_tag LOCUS_2090 16768 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 17529 16765 gene locus_tag LOCUS_2100 17529 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 18625 17549 gene locus_tag LOCUS_2110 18625 17549 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_2110 19815 18622 gene locus_tag LOCUS_2120 19815 18622 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389451.1 protein_id gnl|my_center|LOCUS_2120 21229 20117 gene locus_tag LOCUS_2130 gene rseP 21229 20117 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_2130 21904 21353 gene locus_tag LOCUS_2140 gene frr 21904 21353 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111654.1 protein_id gnl|my_center|LOCUS_2140 22576 21914 gene locus_tag LOCUS_2150 22576 21914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 27533 22662 gene locus_tag LOCUS_2160 27533 22662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2160 28952 27594 gene locus_tag LOCUS_2170 28952 27594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2170 31825 29063 gene locus_tag LOCUS_2180 31825 29063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 32550 31888 gene locus_tag LOCUS_2190 32550 31888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 33563 32550 gene locus_tag LOCUS_2200 33563 32550 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_2200 33631 34956 gene locus_tag LOCUS_2210 33631 34956 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_2210 >Feature sequence06 474 1 gene locus_tag LOCUS_2220 474 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 1048 482 gene locus_tag LOCUS_2230 1048 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 1392 1042 gene locus_tag LOCUS_2240 1392 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2240 2455 1640 gene locus_tag LOCUS_2250 2455 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 2638 3906 gene locus_tag LOCUS_2260 gene tyrS 2638 3906 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813495.1 protein_id gnl|my_center|LOCUS_2260 4603 3926 gene locus_tag LOCUS_2270 4603 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2270 4651 5880 gene locus_tag LOCUS_2280 gene pilM 4651 5880 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181416674.1 protein_id gnl|my_center|LOCUS_2280 6041 6862 gene locus_tag LOCUS_2290 6041 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 6899 7504 gene locus_tag LOCUS_2300 6899 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 7519 7845 gene locus_tag LOCUS_2310 7519 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2310 7912 9750 gene locus_tag LOCUS_2320 7912 9750 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_2320 9767 10210 gene locus_tag LOCUS_2330 9767 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2330 10226 11347 gene locus_tag LOCUS_2340 10226 11347 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173990.1 protein_id gnl|my_center|LOCUS_2340 11432 12640 gene locus_tag LOCUS_2350 11432 12640 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_2350 12796 13212 gene locus_tag LOCUS_2360 12796 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2360 13297 13746 gene locus_tag LOCUS_2370 13297 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 13767 14597 gene locus_tag LOCUS_2380 13767 14597 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583389.1 protein_id gnl|my_center|LOCUS_2380 14645 15310 gene locus_tag LOCUS_2390 14645 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 15362 16696 gene locus_tag LOCUS_2400 15362 16696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2400 16708 17289 gene locus_tag LOCUS_2410 16708 17289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2410 17258 18832 gene locus_tag LOCUS_2420 17258 18832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2420 18898 20940 gene locus_tag LOCUS_2430 gene ligA 18898 20940 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_2430 20962 21270 gene locus_tag LOCUS_2440 20962 21270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 21286 22704 gene locus_tag LOCUS_2450 gene gatA 21286 22704 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775913.1 protein_id gnl|my_center|LOCUS_2450 22749 24095 gene locus_tag LOCUS_2460 22749 24095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 24170 24241 gene locus_tag LOCUS_t0080 24170 24241 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 24352 25131 gene locus_tag LOCUS_2470 24352 25131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 25259 25954 gene locus_tag LOCUS_2480 25259 25954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 26028 26102 gene locus_tag LOCUS_t0090 26028 26102 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26151 26225 gene locus_tag LOCUS_t0100 26151 26225 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 26627 27148 gene locus_tag LOCUS_2490 26627 27148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2490 28186 27419 gene locus_tag LOCUS_2500 28186 27419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2500 28300 29883 gene locus_tag LOCUS_2510 28300 29883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 29927 30628 gene locus_tag LOCUS_2520 29927 30628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173093.1 protein_id gnl|my_center|LOCUS_2520 30625 31869 gene locus_tag LOCUS_2530 30625 31869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_2530 31949 32022 gene locus_tag LOCUS_t0110 31949 32022 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence07 1972 89 gene locus_tag LOCUS_2540 1972 89 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_2540 3076 2087 gene locus_tag LOCUS_2550 3076 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 3624 3124 gene locus_tag LOCUS_2560 3624 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 4041 3715 gene locus_tag LOCUS_2570 4041 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 4693 4019 gene locus_tag LOCUS_2580 4693 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 5098 4832 gene locus_tag LOCUS_2590 5098 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 5627 5112 gene locus_tag LOCUS_2600 5627 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 6593 5682 gene locus_tag LOCUS_2610 6593 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 7682 6621 gene locus_tag LOCUS_2620 gene mnmA 7682 6621 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170633.1 protein_id gnl|my_center|LOCUS_2620 8790 7780 gene locus_tag LOCUS_2630 gene mltG 8790 7780 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_2630 10047 8818 gene locus_tag LOCUS_2640 10047 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 11166 10120 gene locus_tag LOCUS_2650 11166 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 12158 11364 gene locus_tag LOCUS_2660 12158 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 14632 12176 gene locus_tag LOCUS_2670 gene leuS 14632 12176 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_2670 15705 14737 gene locus_tag LOCUS_2680 15705 14737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 16916 15816 gene locus_tag LOCUS_2690 gene ychF 16916 15816 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_2690 17491 16967 gene locus_tag LOCUS_2700 17491 16967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 17746 17501 gene locus_tag LOCUS_2710 17746 17501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 18147 17917 gene locus_tag LOCUS_2720 18147 17917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 19592 18153 gene locus_tag LOCUS_2730 gene atpD 19592 18153 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_2730 20281 19640 gene locus_tag LOCUS_2740 20281 19640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2740 21229 20306 gene locus_tag LOCUS_2750 gene atpG 21229 20306 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817813.1 protein_id gnl|my_center|LOCUS_2750 22888 21257 gene locus_tag LOCUS_2760 gene atpA 22888 21257 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880405.1 protein_id gnl|my_center|LOCUS_2760 23355 22912 gene locus_tag LOCUS_2770 23355 22912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 23807 23352 gene locus_tag LOCUS_2780 23807 23352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2780 24086 23832 gene locus_tag LOCUS_2790 gene atpE 24086 23832 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258898.1 protein_id gnl|my_center|LOCUS_2790 24933 24172 gene locus_tag LOCUS_2800 gene atpB 24933 24172 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768272.1 protein_id gnl|my_center|LOCUS_2800 25099 25026 gene locus_tag LOCUS_t0120 25099 25026 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27269 25266 gene locus_tag LOCUS_2810 27269 25266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 27561 27633 gene locus_tag LOCUS_t0130 27561 27633 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28111 27692 gene locus_tag LOCUS_2820 28111 27692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 28320 28856 gene locus_tag LOCUS_2830 28320 28856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 29093 29017 gene locus_tag LOCUS_t0140 29093 29017 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29333 29262 gene locus_tag LOCUS_t0150 29333 29262 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 29428 29357 gene locus_tag LOCUS_t0160 29428 29357 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 29511 29585 gene locus_tag LOCUS_t0170 29511 29585 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence08 327 22 gene locus_tag LOCUS_2840 327 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 707 925 gene locus_tag LOCUS_2850 707 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2850 1182 1098 gene locus_tag LOCUS_t0180 1182 1098 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1365 1898 gene locus_tag LOCUS_2860 1365 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2860 2025 2771 gene locus_tag LOCUS_2870 gene rlmB 2025 2771 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_2870 2987 3526 gene locus_tag LOCUS_2880 2987 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2880 3547 4257 gene locus_tag LOCUS_2890 3547 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 4455 4273 gene locus_tag LOCUS_2900 4455 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2900 4643 5491 gene locus_tag LOCUS_2910 4643 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 5488 6141 gene locus_tag LOCUS_2920 5488 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 6297 7112 gene locus_tag LOCUS_2930 6297 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 7332 8666 gene locus_tag LOCUS_2940 7332 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 8815 9006 gene locus_tag LOCUS_2950 8815 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 9059 9604 gene locus_tag LOCUS_2960 gene nusG 9059 9604 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_2960 9658 10083 gene locus_tag LOCUS_2970 gene rplK 9658 10083 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_2970 10667 11323 gene locus_tag LOCUS_2980 gene tmk 10667 11323 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919690.1 protein_id gnl|my_center|LOCUS_2980 11365 11790 gene locus_tag LOCUS_2990 gene dut 11365 11790 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 protein_id gnl|my_center|LOCUS_2990 11883 13151 gene locus_tag LOCUS_3000 11883 13151 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967039.1 protein_id gnl|my_center|LOCUS_3000 13370 13957 gene locus_tag LOCUS_3010 13370 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 14148 14885 gene locus_tag LOCUS_3020 14148 14885 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088432.1 protein_id gnl|my_center|LOCUS_3020 14885 15505 gene locus_tag LOCUS_3030 14885 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088431.1 protein_id gnl|my_center|LOCUS_3030 15502 16008 gene locus_tag LOCUS_3040 15502 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 16114 17187 gene locus_tag LOCUS_3050 16114 17187 CDS product DUF2914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405391.1 protein_id gnl|my_center|LOCUS_3050 17262 18401 gene locus_tag LOCUS_3060 17262 18401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3060 18512 20200 gene locus_tag LOCUS_3070 gene argS 18512 20200 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682282.1 protein_id gnl|my_center|LOCUS_3070 20252 23788 gene locus_tag LOCUS_3080 20252 23788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3080 23798 24400 gene locus_tag LOCUS_3090 23798 24400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 24493 26454 gene locus_tag LOCUS_3100 24493 26454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3100 26500 27903 gene locus_tag LOCUS_3110 26500 27903 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927177.1 protein_id gnl|my_center|LOCUS_3110 >Feature sequence09 780 1052 gene locus_tag LOCUS_3120 780 1052 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214112.1 protein_id gnl|my_center|LOCUS_3120 1480 1163 gene locus_tag LOCUS_3130 1480 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3130 2188 1652 gene locus_tag LOCUS_3140 gene dcd 2188 1652 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_3140 3035 2193 gene locus_tag LOCUS_3150 3035 2193 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976151.1 protein_id gnl|my_center|LOCUS_3150 3175 3753 gene locus_tag LOCUS_3160 3175 3753 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403191.1 protein_id gnl|my_center|LOCUS_3160 4959 3808 gene locus_tag LOCUS_3170 4959 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 6187 5039 gene locus_tag LOCUS_3180 6187 5039 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_3180 7744 6260 gene locus_tag LOCUS_3190 7744 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3190 8003 7931 gene locus_tag LOCUS_t0190 8003 7931 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9244 8132 gene locus_tag LOCUS_3200 9244 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 10160 9372 gene locus_tag LOCUS_3210 10160 9372 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256367.1 protein_id gnl|my_center|LOCUS_3210 10481 11779 gene locus_tag LOCUS_3220 10481 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 12665 11805 gene locus_tag LOCUS_3230 12665 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3230 14329 12806 gene locus_tag LOCUS_3240 14329 12806 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919415.1 protein_id gnl|my_center|LOCUS_3240 14787 16082 gene locus_tag LOCUS_3250 14787 16082 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938060.1 protein_id gnl|my_center|LOCUS_3250 17007 16156 gene locus_tag LOCUS_3260 17007 16156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 17062 17217 gene locus_tag LOCUS_3270 17062 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 19031 17187 gene locus_tag LOCUS_3280 19031 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3280 19595 19050 gene locus_tag LOCUS_3290 19595 19050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 20137 19838 gene locus_tag LOCUS_3300 20137 19838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 22732 20381 gene locus_tag LOCUS_3310 22732 20381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3310 23688 22981 gene locus_tag LOCUS_3320 23688 22981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3320 25548 23761 gene locus_tag LOCUS_3330 25548 23761 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_3330 26255 25563 gene locus_tag LOCUS_3340 26255 25563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3340 26483 26409 gene locus_tag LOCUS_t0200 26483 26409 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27134 26757 gene locus_tag LOCUS_3350 27134 26757 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851874.1 protein_id gnl|my_center|LOCUS_3350 27527 27600 gene locus_tag LOCUS_t0210 27527 27600 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence10 3578 171 gene locus_tag LOCUS_3360 3578 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 4233 3559 gene locus_tag LOCUS_3370 4233 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 5914 4325 gene locus_tag LOCUS_3380 5914 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 7972 6686 gene locus_tag LOCUS_3390 7972 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 11461 7991 gene locus_tag LOCUS_3400 11461 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 13332 11521 gene locus_tag LOCUS_3410 13332 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3410 14896 13322 gene locus_tag LOCUS_3420 14896 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 15358 14930 gene locus_tag LOCUS_3430 15358 14930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3430 16350 15355 gene locus_tag LOCUS_3440 16350 15355 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_3440 16521 18743 gene locus_tag LOCUS_3450 16521 18743 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_3450 18861 19577 gene locus_tag LOCUS_3460 18861 19577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3460 19584 20105 gene locus_tag LOCUS_3470 19584 20105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 20198 19992 gene locus_tag LOCUS_3480 20198 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3480 20414 20340 gene locus_tag LOCUS_t0220 20414 20340 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 20792 20502 gene locus_tag LOCUS_3490 20792 20502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 20978 21475 gene locus_tag LOCUS_3500 20978 21475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3500 22138 22065 gene locus_tag LOCUS_t0230 22138 22065 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22528 22277 gene locus_tag LOCUS_3510 22528 22277 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_3510 22663 23583 gene locus_tag LOCUS_3520 22663 23583 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_3520 24007 23678 gene locus_tag LOCUS_3530 24007 23678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 26143 24266 gene locus_tag LOCUS_3540 gene lepA 26143 24266 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925365.1 protein_id gnl|my_center|LOCUS_3540 >Feature sequence11 2059 3222 gene locus_tag LOCUS_3550 2059 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3550 4358 3219 gene locus_tag LOCUS_3560 4358 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3560 4920 4396 gene locus_tag LOCUS_3570 4920 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3570 6732 5092 gene locus_tag LOCUS_3580 6732 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3580 6923 6726 gene locus_tag LOCUS_3590 6923 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3590 6828 7358 gene locus_tag LOCUS_3600 6828 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3600 7339 7542 gene locus_tag LOCUS_3610 7339 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 8064 7453 gene locus_tag LOCUS_3620 8064 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 8195 8124 gene locus_tag LOCUS_t0240 8195 8124 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8940 8290 gene locus_tag LOCUS_3630 8940 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 10124 8937 gene locus_tag LOCUS_3640 10124 8937 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_3640 11173 10121 gene locus_tag LOCUS_3650 11173 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3650 12456 11452 gene locus_tag LOCUS_3660 12456 11452 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706765.1 protein_id gnl|my_center|LOCUS_3660 15045 12556 gene locus_tag LOCUS_3670 15045 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 15432 15049 gene locus_tag LOCUS_3680 15432 15049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 16478 15462 gene locus_tag LOCUS_3690 16478 15462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 17763 16495 gene locus_tag LOCUS_3700 gene serS 17763 16495 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_3700 17884 18753 gene locus_tag LOCUS_3710 17884 18753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 18912 21086 gene locus_tag LOCUS_3720 gene topA 18912 21086 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_3720 21218 22807 gene locus_tag LOCUS_3730 21218 22807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3730 23995 22844 gene locus_tag LOCUS_3740 23995 22844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3740 24142 24226 gene locus_tag LOCUS_t0250 24142 24226 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24503 25285 gene locus_tag LOCUS_3750 24503 25285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 >Feature sequence12 1096 500 gene locus_tag LOCUS_3760 1096 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3760 3175 1115 gene locus_tag LOCUS_3770 3175 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 3879 3373 gene locus_tag LOCUS_3780 3879 3373 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_3780 4634 4161 gene locus_tag LOCUS_3790 4634 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3790 7261 4634 gene locus_tag LOCUS_3800 gene clpB 7261 4634 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_3800 7990 7313 gene locus_tag LOCUS_3810 7990 7313 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222410.1 protein_id gnl|my_center|LOCUS_3810 8522 8151 gene locus_tag LOCUS_3820 8522 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3820 9584 8526 gene locus_tag LOCUS_3830 9584 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3830 10092 9715 gene locus_tag LOCUS_3840 10092 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3840 10475 10191 gene locus_tag LOCUS_3850 10475 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3850 10795 10472 gene locus_tag LOCUS_3860 10795 10472 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172803.1 protein_id gnl|my_center|LOCUS_3860 10991 11371 gene locus_tag LOCUS_3870 10991 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 11663 12088 gene locus_tag LOCUS_3880 11663 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3880 12232 13035 gene locus_tag LOCUS_3890 12232 13035 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257145.1 protein_id gnl|my_center|LOCUS_3890 13486 13755 gene locus_tag LOCUS_3900 13486 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3900 14317 13904 gene locus_tag LOCUS_3910 14317 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3910 14595 14524 gene locus_tag LOCUS_t0260 14595 14524 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15230 14700 gene locus_tag LOCUS_3920 15230 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 16330 15401 gene locus_tag LOCUS_3930 16330 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3930 18037 16361 gene locus_tag LOCUS_3940 gene pyrG 18037 16361 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_3940 19016 18090 gene locus_tag LOCUS_3950 gene ftsX 19016 18090 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_3950 19748 19068 gene locus_tag LOCUS_3960 gene ftsE 19748 19068 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_3960 20835 19939 gene locus_tag LOCUS_3970 20835 19939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3970 20965 20892 gene locus_tag LOCUS_t0270 20965 20892 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 21910 21014 gene locus_tag LOCUS_3980 21910 21014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3980 >Feature sequence13 561 1160 gene locus_tag LOCUS_3990 561 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3990 1317 1889 gene locus_tag LOCUS_4000 gene yjjX 1317 1889 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061167.1 protein_id gnl|my_center|LOCUS_4000 2086 1994 gene locus_tag LOCUS_r0010 2086 1994 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 78 percent of the 5S ribosomal RNA 2250 2166 gene locus_tag LOCUS_t0280 2250 2166 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5397 2370 gene locus_tag LOCUS_r0020 5397 2370 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 8350 5777 gene locus_tag LOCUS_4010 8350 5777 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_4010 9570 8392 gene locus_tag LOCUS_4020 9570 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4020 9748 9675 gene locus_tag LOCUS_t0290 9748 9675 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10619 9876 gene locus_tag LOCUS_4030 10619 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142339.1 protein_id gnl|my_center|LOCUS_4030 11359 10730 gene locus_tag LOCUS_4040 11359 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4040 11453 12370 gene locus_tag LOCUS_4050 11453 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 13035 12520 gene locus_tag LOCUS_4060 13035 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 13593 13090 gene locus_tag LOCUS_4070 13593 13090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 14458 13892 gene locus_tag LOCUS_4080 14458 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4080 14725 14528 gene locus_tag LOCUS_4090 14725 14528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4090 17101 14981 gene locus_tag LOCUS_4100 17101 14981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4100 18907 17999 gene locus_tag LOCUS_4110 18907 17999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4110 19130 21460 gene locus_tag LOCUS_4120 19130 21460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4120 >Feature sequence14 4219 3917 gene locus_tag LOCUS_4130 4219 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4130 4458 4231 gene locus_tag LOCUS_4140 4458 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 4587 4778 gene locus_tag LOCUS_4150 4587 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4150 5804 5004 gene locus_tag LOCUS_4160 5804 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4160 6397 7908 gene locus_tag LOCUS_4170 6397 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4170 8025 9389 gene locus_tag LOCUS_4180 gene murD 8025 9389 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530045.1 protein_id gnl|my_center|LOCUS_4180 9393 9905 gene locus_tag LOCUS_4190 9393 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 11572 9950 gene locus_tag LOCUS_4200 11572 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 11675 12991 gene locus_tag LOCUS_4210 gene murC 11675 12991 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_4210 13091 13774 gene locus_tag LOCUS_4220 gene rsmI 13091 13774 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951377.1 protein_id gnl|my_center|LOCUS_4220 13830 15269 gene locus_tag LOCUS_4230 13830 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4230 15301 17202 gene locus_tag LOCUS_4240 15301 17202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4240 17199 18746 gene locus_tag LOCUS_4250 17199 18746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4250 18759 20240 gene locus_tag LOCUS_4260 18759 20240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4260 >Feature sequence15 <1 945 gene locus_tag LOCUS_4270 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084336.1:fructose-bisphosphate aldolase class I 942 1592 gene locus_tag LOCUS_4280 942 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4280 1656 2411 gene locus_tag LOCUS_4290 1656 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 2420 3142 gene locus_tag LOCUS_4300 gene nth 2420 3142 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_4300 3144 3944 gene locus_tag LOCUS_4310 3144 3944 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356878.1 protein_id gnl|my_center|LOCUS_4310 3995 4258 gene locus_tag LOCUS_4320 3995 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 4242 5141 gene locus_tag LOCUS_4330 4242 5141 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_4330 6373 5162 gene locus_tag LOCUS_4340 6373 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 8435 6459 gene locus_tag LOCUS_4350 8435 6459 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_4350 10378 8537 gene locus_tag LOCUS_4360 10378 8537 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_4360 10909 10679 gene locus_tag LOCUS_4370 10909 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 11100 11417 gene locus_tag LOCUS_4380 gene groES 11100 11417 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258595.1 protein_id gnl|my_center|LOCUS_4380 11511 13169 gene locus_tag LOCUS_4390 gene groL 11511 13169 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392083.1 protein_id gnl|my_center|LOCUS_4390 13736 13251 gene locus_tag LOCUS_4400 13736 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 13936 14499 gene locus_tag LOCUS_4410 13936 14499 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_4410 14612 15592 gene locus_tag LOCUS_4420 14612 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4420 15628 16536 gene locus_tag LOCUS_4430 15628 16536 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868260.1 protein_id gnl|my_center|LOCUS_4430 16565 17155 gene locus_tag LOCUS_4440 16565 17155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4440 17212 17805 gene locus_tag LOCUS_4450 17212 17805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4450 19576 17870 gene locus_tag LOCUS_4460 19576 17870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4460 17990 18079 gene locus_tag LOCUS_t0300 17990 18079 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence16 2550 67 gene locus_tag LOCUS_4470 2550 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4470 4618 4187 gene locus_tag LOCUS_4480 4618 4187 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020586.1 protein_id gnl|my_center|LOCUS_4480 5144 4785 gene locus_tag LOCUS_4490 5144 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 5769 5260 gene locus_tag LOCUS_4500 5769 5260 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_4500 6928 5957 gene locus_tag LOCUS_4510 gene pip 6928 5957 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_4510 7038 9008 gene locus_tag LOCUS_4520 7038 9008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 9010 10809 gene locus_tag LOCUS_4530 gene polX 9010 10809 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_4530 11554 12093 gene locus_tag LOCUS_4540 gene def 11554 12093 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965769.1 protein_id gnl|my_center|LOCUS_4540 12580 13548 gene locus_tag LOCUS_4550 gene fmt 12580 13548 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255944.1 protein_id gnl|my_center|LOCUS_4550 13973 13614 gene locus_tag LOCUS_4560 13973 13614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4560 14283 13996 gene locus_tag LOCUS_4570 14283 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4570 14986 14597 gene locus_tag LOCUS_4580 14986 14597 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_4580 15715 15104 gene locus_tag LOCUS_4590 15715 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 15838 16107 gene locus_tag LOCUS_4600 15838 16107 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_4600 16240 16725 gene locus_tag LOCUS_4610 16240 16725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4610 17506 16886 gene locus_tag LOCUS_4620 gene ahpC 17506 16886 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761950.1 protein_id gnl|my_center|LOCUS_4620 17666 18265 gene locus_tag LOCUS_4630 17666 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 18789 18346 gene locus_tag LOCUS_4640 18789 18346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4640 19437 19042 gene locus_tag LOCUS_4650 19437 19042 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393003.1 protein_id gnl|my_center|LOCUS_4650 >Feature sequence17 411 725 gene locus_tag LOCUS_4660 411 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4660 815 988 gene locus_tag LOCUS_4670 815 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4670 2387 1191 gene locus_tag LOCUS_4680 gene tsaD 2387 1191 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414585.1 protein_id gnl|my_center|LOCUS_4680 2479 2799 gene locus_tag LOCUS_4690 2479 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4690 3134 3058 gene locus_tag LOCUS_t0310 3134 3058 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3172 5058 gene locus_tag LOCUS_4700 3172 5058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038783.1 protein_id gnl|my_center|LOCUS_4700 5071 5733 gene locus_tag LOCUS_4710 5071 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 5853 6983 gene locus_tag LOCUS_4720 5853 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4720 7504 7061 gene locus_tag LOCUS_4730 7504 7061 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_4730 7653 9065 gene locus_tag LOCUS_4740 7653 9065 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532293.1 protein_id gnl|my_center|LOCUS_4740 9093 10916 gene locus_tag LOCUS_4750 9093 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4750 11701 10937 gene locus_tag LOCUS_4760 11701 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4760 11979 12506 gene locus_tag LOCUS_4770 11979 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4770 12950 12576 gene locus_tag LOCUS_4780 12950 12576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4780 12993 13256 gene locus_tag LOCUS_4790 12993 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4790 13773 13285 gene locus_tag LOCUS_4800 13773 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4800 14129 14818 gene locus_tag LOCUS_4810 14129 14818 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027567.1 protein_id gnl|my_center|LOCUS_4810 14834 15031 gene locus_tag LOCUS_4820 14834 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4820 16181 15177 gene locus_tag LOCUS_4830 16181 15177 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613224.1 protein_id gnl|my_center|LOCUS_4830 16475 16386 gene locus_tag LOCUS_t0320 16475 16386 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16566 16638 gene locus_tag LOCUS_t0330 16566 16638 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17116 18540 gene locus_tag LOCUS_4840 17116 18540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 >Feature sequence18 352 618 gene locus_tag LOCUS_4850 352 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 942 3794 gene locus_tag LOCUS_4860 942 3794 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268604.1 protein_id gnl|my_center|LOCUS_4860 3894 4961 gene locus_tag LOCUS_4870 3894 4961 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883618.1 protein_id gnl|my_center|LOCUS_4870 5034 5384 gene locus_tag LOCUS_4880 5034 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 5487 5897 gene locus_tag LOCUS_4890 5487 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 5945 7141 gene locus_tag LOCUS_4900 gene tgt 5945 7141 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112950.1 protein_id gnl|my_center|LOCUS_4900 7248 9320 gene locus_tag LOCUS_4910 gene uvrB 7248 9320 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_4910 9370 10584 gene locus_tag LOCUS_4920 9370 10584 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_4920 10646 13234 gene locus_tag LOCUS_4930 gene uvrA 10646 13234 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546498.1 protein_id gnl|my_center|LOCUS_4930 13495 14739 gene locus_tag LOCUS_4940 13495 14739 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_4940 14772 15617 gene locus_tag LOCUS_4950 14772 15617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4950 15623 16603 gene locus_tag LOCUS_4960 15623 16603 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_4960 >Feature sequence19 98 1420 gene locus_tag LOCUS_4970 98 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4970 1689 2828 gene locus_tag LOCUS_4980 1689 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 2868 3095 gene locus_tag LOCUS_4990 gene infA 2868 3095 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546095.1 protein_id gnl|my_center|LOCUS_4990 3286 3669 gene locus_tag LOCUS_5000 gene rpsM 3286 3669 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258255.1 protein_id gnl|my_center|LOCUS_5000 3732 4169 gene locus_tag LOCUS_5010 gene rpsK 3732 4169 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390415.1 protein_id gnl|my_center|LOCUS_5010 4214 4822 gene locus_tag LOCUS_5020 gene rpsD 4214 4822 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_5020 4887 5858 gene locus_tag LOCUS_5030 4887 5858 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567511.1 protein_id gnl|my_center|LOCUS_5030 5902 6258 gene locus_tag LOCUS_5040 gene rplQ 5902 6258 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975188.1 protein_id gnl|my_center|LOCUS_5040 6272 6661 gene locus_tag LOCUS_5050 6272 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5050 6688 7128 gene locus_tag LOCUS_5060 gene rpsI 6688 7128 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258262.1 protein_id gnl|my_center|LOCUS_5060 7273 7848 gene locus_tag LOCUS_5070 7273 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5070 7964 9883 gene locus_tag LOCUS_5080 gene dnaK 7964 9883 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_5080 9970 11067 gene locus_tag LOCUS_5090 gene dnaJ 9970 11067 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_5090 11074 12126 gene locus_tag LOCUS_5100 11074 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5100 12123 13190 gene locus_tag LOCUS_5110 gene trpS 12123 13190 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769841.1 protein_id gnl|my_center|LOCUS_5110 13232 14599 gene locus_tag LOCUS_5120 gene aspS 13232 14599 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228692.1 protein_id gnl|my_center|LOCUS_5120 14664 15404 gene locus_tag LOCUS_5130 14664 15404 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_5130 15397 16005 gene locus_tag LOCUS_5140 gene scpB 15397 16005 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_5140 >Feature sequence20 395 847 gene locus_tag LOCUS_5150 gene smpB 395 847 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948526.1 protein_id gnl|my_center|LOCUS_5150 1684 854 gene locus_tag LOCUS_5160 1684 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 2059 2451 gene locus_tag LOCUS_tm0010 2059 2451 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3186 2749 gene locus_tag LOCUS_5170 3186 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 3456 3229 gene locus_tag LOCUS_5180 3456 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 4539 3469 gene locus_tag LOCUS_5190 4539 3469 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243654.1 protein_id gnl|my_center|LOCUS_5190 4842 4567 gene locus_tag LOCUS_5200 4842 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5200 5484 5086 gene locus_tag LOCUS_5210 5484 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 5601 6347 gene locus_tag LOCUS_5220 5601 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5220 7381 6362 gene locus_tag LOCUS_5230 7381 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 8895 7687 gene locus_tag LOCUS_5240 8895 7687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140349.1 protein_id gnl|my_center|LOCUS_5240 10316 8904 gene locus_tag LOCUS_5250 10316 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5250 11702 10323 gene locus_tag LOCUS_5260 11702 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5260 13535 12045 gene locus_tag LOCUS_5270 13535 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 14018 13542 gene locus_tag LOCUS_5280 14018 13542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 >Feature sequence21 477 956 gene locus_tag LOCUS_5290 477 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 1035 1107 gene locus_tag LOCUS_t0340 1035 1107 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1506 1222 gene locus_tag LOCUS_5300 gene rpsT 1506 1222 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583468.1 protein_id gnl|my_center|LOCUS_5300 1566 2165 gene locus_tag LOCUS_5310 gene ruvA 1566 2165 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460360.1 protein_id gnl|my_center|LOCUS_5310 2217 3476 gene locus_tag LOCUS_5320 2217 3476 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_5320 4250 3483 gene locus_tag LOCUS_5330 4250 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 4812 4279 gene locus_tag LOCUS_5340 4812 4279 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_5340 4888 5289 gene locus_tag LOCUS_5350 4888 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 5363 5436 gene locus_tag LOCUS_t0350 5363 5436 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5586 9029 gene locus_tag LOCUS_5360 5586 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5360 10175 9456 gene locus_tag LOCUS_5370 10175 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5370 12666 10183 gene locus_tag LOCUS_5380 gene polA 12666 10183 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228405.1 protein_id gnl|my_center|LOCUS_5380 13192 12677 gene locus_tag LOCUS_5390 gene tsaE 13192 12677 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_5390 13684 13304 gene locus_tag LOCUS_5400 13684 13304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5400 14214 13681 gene locus_tag LOCUS_5410 14214 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5410 >Feature sequence22 722 1687 gene locus_tag LOCUS_5420 722 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5420 1767 2813 gene locus_tag LOCUS_5430 1767 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 2911 3810 gene locus_tag LOCUS_5440 2911 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 4544 3807 gene locus_tag LOCUS_5450 4544 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5450 5298 4546 gene locus_tag LOCUS_5460 gene kdsB 5298 4546 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_5460 6280 5336 gene locus_tag LOCUS_5470 6280 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 7456 6347 gene locus_tag LOCUS_5480 7456 6347 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044860.1 protein_id gnl|my_center|LOCUS_5480 8406 7570 gene locus_tag LOCUS_5490 8406 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 9815 8403 gene locus_tag LOCUS_5500 9815 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 10725 9856 gene locus_tag LOCUS_5510 10725 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 11952 10834 gene locus_tag LOCUS_5520 11952 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5520 13324 11969 gene locus_tag LOCUS_5530 13324 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 13872 13405 gene locus_tag LOCUS_5540 13872 13405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5540 >Feature sequence23 75 332 gene locus_tag LOCUS_5550 75 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5550 671 1600 gene locus_tag LOCUS_5560 gene xerD 671 1600 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_5560 2272 3072 gene locus_tag LOCUS_5570 gene xth 2272 3072 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_5570 5574 4069 gene locus_tag LOCUS_5580 5574 4069 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_5580 5641 5714 gene locus_tag LOCUS_t0360 5641 5714 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5948 6319 gene locus_tag LOCUS_5590 5948 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5590 6562 6633 gene locus_tag LOCUS_t0370 6562 6633 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8273 6717 gene locus_tag LOCUS_5600 8273 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5600 8587 8736 gene locus_tag LOCUS_5610 8587 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 9402 8869 gene locus_tag LOCUS_5620 9402 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5620 9691 9449 gene locus_tag LOCUS_5630 9691 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 10039 10284 gene locus_tag LOCUS_5640 10039 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 10869 11210 gene locus_tag LOCUS_5650 10869 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 11544 13187 gene locus_tag LOCUS_5660 11544 13187 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_5660 >Feature sequence24 4599 7397 gene locus_tag LOCUS_5670 4599 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 7506 9866 gene locus_tag LOCUS_5680 7506 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5680 9914 10390 gene locus_tag LOCUS_5690 9914 10390 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730007.1 protein_id gnl|my_center|LOCUS_5690 10387 11073 gene locus_tag LOCUS_5700 gene rpe 10387 11073 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939801.1 protein_id gnl|my_center|LOCUS_5700 11291 12559 gene locus_tag LOCUS_5710 11291 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5710 >Feature sequence25 950 348 gene locus_tag LOCUS_5720 950 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 1459 1112 gene locus_tag LOCUS_5730 1459 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 2059 1586 gene locus_tag LOCUS_5740 2059 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 2595 2200 gene locus_tag LOCUS_5750 2595 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5750 3070 2690 gene locus_tag LOCUS_5760 3070 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5760 3605 3258 gene locus_tag LOCUS_5770 3605 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 3955 3689 gene locus_tag LOCUS_5780 3955 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 4610 4008 gene locus_tag LOCUS_5790 4610 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 6042 4744 gene locus_tag LOCUS_5800 6042 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5800 6586 6044 gene locus_tag LOCUS_5810 6586 6044 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880943.1 protein_id gnl|my_center|LOCUS_5810 9230 6762 gene locus_tag LOCUS_5820 gene gyrA 9230 6762 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_5820 9641 9315 gene locus_tag LOCUS_5830 9641 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5830 10410 9778 gene locus_tag LOCUS_5840 10410 9778 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_5840 10704 10922 gene locus_tag LOCUS_5850 10704 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 11161 12357 gene locus_tag LOCUS_5860 11161 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5860 >Feature sequence26 584 1780 gene locus_tag LOCUS_5870 gene rodA 584 1780 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_5870 2888 1743 gene locus_tag LOCUS_5880 2888 1743 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_5880 2967 4352 gene locus_tag LOCUS_5890 2967 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5890 4362 5498 gene locus_tag LOCUS_5900 4362 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 5485 6315 gene locus_tag LOCUS_5910 5485 6315 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222732.1 protein_id gnl|my_center|LOCUS_5910 6401 7759 gene locus_tag LOCUS_5920 gene secD 6401 7759 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902477.1 protein_id gnl|my_center|LOCUS_5920 7771 8730 gene locus_tag LOCUS_5930 gene secF 7771 8730 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144153.1 protein_id gnl|my_center|LOCUS_5930 8824 9393 gene locus_tag LOCUS_5940 8824 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5940 9510 10520 gene locus_tag LOCUS_5950 9510 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 10520 11614 gene locus_tag LOCUS_5960 10520 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 11653 12384 gene locus_tag LOCUS_5970 11653 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 >Feature sequence27 <1 738 gene locus_tag LOCUS_5980 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767983.1:glycosyltransferase family 4 protein 735 2090 gene locus_tag LOCUS_5990 735 2090 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_5990 2134 2700 gene locus_tag LOCUS_6000 2134 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 2755 4743 gene locus_tag LOCUS_6010 2755 4743 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_6010 4792 5127 gene locus_tag LOCUS_6020 4792 5127 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932868.1 protein_id gnl|my_center|LOCUS_6020 5239 6240 gene locus_tag LOCUS_6030 gene obgE 5239 6240 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083257.1 protein_id gnl|my_center|LOCUS_6030 6240 7709 gene locus_tag LOCUS_6040 gene gatB 6240 7709 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583528.1 protein_id gnl|my_center|LOCUS_6040 7845 8699 gene locus_tag LOCUS_6050 7845 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 9005 9706 gene locus_tag LOCUS_6060 9005 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6060 9791 10837 gene locus_tag LOCUS_6070 9791 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 >Feature sequence28 4114 5256 gene locus_tag LOCUS_6080 4114 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6080 5342 6559 gene locus_tag LOCUS_6090 5342 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6090 6862 8034 gene locus_tag LOCUS_6100 6862 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6100 8151 9218 gene locus_tag LOCUS_6110 8151 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6110 9277 9597 gene locus_tag LOCUS_6120 9277 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6120 9590 10405 gene locus_tag LOCUS_6130 9590 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6130 >Feature sequence29 987 1355 gene locus_tag LOCUS_6140 987 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 1372 3003 gene locus_tag LOCUS_6150 1372 3003 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_6150 3031 3771 gene locus_tag LOCUS_6160 3031 3771 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029261.1 protein_id gnl|my_center|LOCUS_6160 4015 5604 gene locus_tag LOCUS_6170 4015 5604 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_6170 6812 5754 gene locus_tag LOCUS_6180 6812 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6180 7099 9027 gene locus_tag LOCUS_6190 gene pcrA 7099 9027 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 protein_id gnl|my_center|LOCUS_6190 9055 9858 gene locus_tag LOCUS_6200 gene rsmA 9055 9858 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256787.1 protein_id gnl|my_center|LOCUS_6200 >Feature sequence30 2317 1256 gene locus_tag LOCUS_6210 2317 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6210 2740 2330 gene locus_tag LOCUS_6220 2740 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6220 4568 2745 gene locus_tag LOCUS_6230 4568 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 5255 4590 gene locus_tag LOCUS_6240 5255 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 5730 5296 gene locus_tag LOCUS_6250 5730 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 6375 5782 gene locus_tag LOCUS_6260 6375 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6260 8649 6388 gene locus_tag LOCUS_6270 8649 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6270 10109 8664 gene locus_tag LOCUS_6280 10109 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 >Feature sequence31 <1 897 gene locus_tag LOCUS_6290 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947527.1:recombinase RecA 1294 950 gene locus_tag LOCUS_6300 1294 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6300 1990 1355 gene locus_tag LOCUS_6310 gene sigR 1990 1355 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_6310 2080 2700 gene locus_tag LOCUS_6320 gene efp 2080 2700 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810907.1 protein_id gnl|my_center|LOCUS_6320 2980 2780 gene locus_tag LOCUS_6330 gene rpsR 2980 2780 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166236.1 protein_id gnl|my_center|LOCUS_6330 3489 3046 gene locus_tag LOCUS_6340 3489 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 4178 3534 gene locus_tag LOCUS_6350 4178 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6350 5351 4530 gene locus_tag LOCUS_6360 5351 4530 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_6360 6808 5348 gene locus_tag LOCUS_6370 gene metG 6808 5348 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041424295.1 protein_id gnl|my_center|LOCUS_6370 7951 6914 gene locus_tag LOCUS_6380 7951 6914 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 protein_id gnl|my_center|LOCUS_6380 9274 8000 gene locus_tag LOCUS_6390 9274 8000 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_6390 9444 9758 gene locus_tag LOCUS_6400 9444 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6400 >Feature sequence32 957 1490 gene locus_tag LOCUS_6410 gene infC 957 1490 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_6410 1575 1766 gene locus_tag LOCUS_6420 1575 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 1841 2173 gene locus_tag LOCUS_6430 gene rplT 1841 2173 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256290.1 protein_id gnl|my_center|LOCUS_6430 2711 2292 gene locus_tag LOCUS_6440 2711 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6440 3644 3024 gene locus_tag LOCUS_6450 3644 3024 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763353.1 protein_id gnl|my_center|LOCUS_6450 4507 3731 gene locus_tag LOCUS_6460 gene map 4507 3731 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173700.1 protein_id gnl|my_center|LOCUS_6460 5124 4525 gene locus_tag LOCUS_6470 5124 4525 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173701.1 protein_id gnl|my_center|LOCUS_6470 5197 5796 gene locus_tag LOCUS_6480 5197 5796 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_6480 7113 5839 gene locus_tag LOCUS_6490 gene secY 7113 5839 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207743.1 protein_id gnl|my_center|LOCUS_6490 7630 7181 gene locus_tag LOCUS_6500 gene rplO 7630 7181 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_6500 8257 7667 gene locus_tag LOCUS_6510 8257 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6510 8684 8325 gene locus_tag LOCUS_6520 gene rplR 8684 8325 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938614.1 protein_id gnl|my_center|LOCUS_6520 9236 8703 gene locus_tag LOCUS_6530 gene rplF 9236 8703 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873869.1 protein_id gnl|my_center|LOCUS_6530 9668 9273 gene locus_tag LOCUS_6540 gene rpsH 9668 9273 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258245.1 protein_id gnl|my_center|LOCUS_6540 >Feature sequence33 2270 1401 gene locus_tag LOCUS_6550 2270 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6550 2910 2242 gene locus_tag LOCUS_6560 2910 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6560 3599 2907 gene locus_tag LOCUS_6570 3599 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6570 4393 3605 gene locus_tag LOCUS_6580 4393 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6580 4986 4390 gene locus_tag LOCUS_6590 4986 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6590 5711 4983 gene locus_tag LOCUS_6600 5711 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 6344 5718 gene locus_tag LOCUS_6610 6344 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 7395 6328 gene locus_tag LOCUS_6620 7395 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6620 8524 7403 gene locus_tag LOCUS_6630 8524 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6630 9708 8548 gene locus_tag LOCUS_6640 9708 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 >Feature sequence34 701 60 gene locus_tag LOCUS_6650 gene pth 701 60 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880175.1 protein_id gnl|my_center|LOCUS_6650 997 1611 gene locus_tag LOCUS_6660 997 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6660 1750 1589 gene locus_tag LOCUS_6670 1750 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6670 1756 3018 gene locus_tag LOCUS_6680 1756 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6680 3165 3407 gene locus_tag LOCUS_6690 3165 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6690 3799 3587 gene locus_tag LOCUS_6700 3799 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6700 3964 5127 gene locus_tag LOCUS_6710 gene ftsA 3964 5127 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_6710 5355 6620 gene locus_tag LOCUS_6720 gene ftsZ 5355 6620 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_6720 6807 7730 gene locus_tag LOCUS_6730 6807 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6730 8269 7808 gene locus_tag LOCUS_6740 gene gspG 8269 7808 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209862.1 protein_id gnl|my_center|LOCUS_6740 9248 8694 gene locus_tag LOCUS_6750 9248 8694 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902148.1 protein_id gnl|my_center|LOCUS_6750 >Feature sequence35 1292 288 gene locus_tag LOCUS_6760 1292 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6760 2150 2061 gene locus_tag LOCUS_t0380 2150 2061 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4523 2358 gene locus_tag LOCUS_6770 4523 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6770 5500 4655 gene locus_tag LOCUS_6780 5500 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6780 5642 7834 gene locus_tag LOCUS_6790 gene recG 5642 7834 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_6790 7941 7866 gene locus_tag LOCUS_t0390 7941 7866 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 9662 8292 gene locus_tag LOCUS_6800 9662 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6800 >Feature sequence36 2168 894 gene locus_tag LOCUS_6810 gene nifS 2168 894 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_6810 2456 3979 gene locus_tag LOCUS_6820 gene infB 2456 3979 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869740.1 protein_id gnl|my_center|LOCUS_6820 3997 4335 gene locus_tag LOCUS_6830 3997 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6830 4348 4420 gene locus_tag LOCUS_t0400 4348 4420 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5130 4453 gene locus_tag LOCUS_6840 5130 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6840 5821 5123 gene locus_tag LOCUS_6850 5821 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6850 6577 5879 gene locus_tag LOCUS_6860 6577 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6860 7314 7398 gene locus_tag LOCUS_t0410 7314 7398 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8592 7753 gene locus_tag LOCUS_6870 8592 7753 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967090.1 protein_id gnl|my_center|LOCUS_6870 >Feature sequence37 235 2706 gene locus_tag LOCUS_6880 235 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6880 3324 2749 gene locus_tag LOCUS_6890 3324 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 4701 3385 gene locus_tag LOCUS_6900 gene hisS 4701 3385 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222811.1 protein_id gnl|my_center|LOCUS_6900 4722 5495 gene locus_tag LOCUS_6910 4722 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 6260 5820 gene locus_tag LOCUS_6920 6260 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6920 6433 7248 gene locus_tag LOCUS_6930 6433 7248 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388041.1 protein_id gnl|my_center|LOCUS_6930 7322 7813 gene locus_tag LOCUS_6940 7322 7813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6940 >Feature sequence38 2754 211 gene locus_tag LOCUS_6950 gene secA 2754 211 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545108.1 protein_id gnl|my_center|LOCUS_6950 3105 2872 gene locus_tag LOCUS_6960 3105 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6960 4376 3300 gene locus_tag LOCUS_6970 gene murB 4376 3300 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016649.1 protein_id gnl|my_center|LOCUS_6970 4567 5295 gene locus_tag LOCUS_6980 4567 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6980 >Feature sequence39 3 935 gene locus_tag LOCUS_6990 3 935 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209475689.1 protein_id gnl|my_center|LOCUS_6990 998 1933 gene locus_tag LOCUS_7000 998 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 1972 2979 gene locus_tag LOCUS_7010 1972 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7010 3066 3614 gene locus_tag LOCUS_7020 3066 3614 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036623.1 protein_id gnl|my_center|LOCUS_7020 3595 4515 gene locus_tag LOCUS_7030 3595 4515 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065230.1 protein_id gnl|my_center|LOCUS_7030 4576 4974 gene locus_tag LOCUS_7040 4576 4974 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_7040 5092 5835 gene locus_tag LOCUS_7050 5092 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7050 5886 6464 gene locus_tag LOCUS_7060 5886 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7060 >Feature sequence40 548 264 gene locus_tag LOCUS_7070 548 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7070 1223 675 gene locus_tag LOCUS_7080 1223 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 1354 1776 gene locus_tag LOCUS_7090 1354 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7090 3100 1913 gene locus_tag LOCUS_7100 3100 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 3431 3114 gene locus_tag LOCUS_7110 3431 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7110 3527 3600 gene locus_tag LOCUS_t0420 3527 3600 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3798 4511 gene locus_tag LOCUS_7120 3798 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7120 4701 4786 gene locus_tag LOCUS_t0430 4701 4786 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4905 5540 gene locus_tag LOCUS_7130 4905 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7130 5551 6684 gene locus_tag LOCUS_7140 5551 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7140 >Feature sequence41 3 455 gene locus_tag LOCUS_7150 3 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7150 1376 561 gene locus_tag LOCUS_7160 1376 561 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943378.1 protein_id gnl|my_center|LOCUS_7160 2523 1441 gene locus_tag LOCUS_7170 2523 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7170 3866 2556 gene locus_tag LOCUS_7180 3866 2556 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629647.1 protein_id gnl|my_center|LOCUS_7180 4204 3863 gene locus_tag LOCUS_7190 4204 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7190 4849 4286 gene locus_tag LOCUS_7200 gene lexA 4849 4286 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582447.1 protein_id gnl|my_center|LOCUS_7200 6218 5043 gene locus_tag LOCUS_7210 6218 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7210 >Feature sequence42 2222 2147 gene locus_tag LOCUS_t0440 2222 2147 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3617 2508 gene locus_tag LOCUS_7220 3617 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7220 3916 4533 gene locus_tag LOCUS_7230 3916 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7230 >Feature sequence43 2608 1241 gene locus_tag LOCUS_7240 2608 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7240 2951 3442 gene locus_tag LOCUS_7250 2951 3442 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_7250 4148 3546 gene locus_tag LOCUS_7260 4148 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7260 5208 4264 gene locus_tag LOCUS_7270 5208 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7270 5356 5430 gene locus_tag LOCUS_t0450 5356 5430 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence44 1000 452 gene locus_tag LOCUS_7280 1000 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7280 3357 1069 gene locus_tag LOCUS_7290 3357 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7290 4047 4601 gene locus_tag LOCUS_7300 4047 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7300 4731 5306 gene locus_tag LOCUS_7310 4731 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7310 >Feature sequence45 939 292 gene locus_tag LOCUS_7320 939 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7320 1805 1158 gene locus_tag LOCUS_7330 1805 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7330 1979 3409 gene locus_tag LOCUS_7340 1979 3409 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941969.1 protein_id gnl|my_center|LOCUS_7340 4136 3399 gene locus_tag LOCUS_7350 4136 3399 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028999.1 protein_id gnl|my_center|LOCUS_7350 4780 5193 gene locus_tag LOCUS_7360 4780 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7360 >Feature sequence46 2160 1918 gene locus_tag LOCUS_7370 2160 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7370 2177 2968 gene locus_tag LOCUS_7380 2177 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7380 >Feature sequence47 1081 107 gene locus_tag LOCUS_7390 1081 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7390 2554 1097 gene locus_tag LOCUS_7400 2554 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7400 <5173 2788 gene locus_tag LOCUS_7410 <5173 2788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546043.1:ATP-dependent chaperone ClpB >Feature sequence48 2429 357 gene locus_tag LOCUS_7420 2429 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7420 3322 2651 gene locus_tag LOCUS_7430 gene ung 3322 2651 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_7430 <4630 3369 gene locus_tag LOCUS_7440 <4630 3369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028534.1:glycosyl hydrolase >Feature sequence49 259 522 gene locus_tag LOCUS_7450 gene rpsO 259 522 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_7450 805 1371 gene locus_tag LOCUS_7460 805 1371 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_7460 1635 3782 gene locus_tag LOCUS_7470 gene pnp 1635 3782 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_7470 >Feature sequence50 52 573 gene locus_tag LOCUS_7480 52 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7480 573 1109 gene locus_tag LOCUS_7490 573 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7490 1938 1192 gene locus_tag LOCUS_7500 1938 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7500 3160 2216 gene locus_tag LOCUS_7510 3160 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7510 >Feature sequence51 1650 547 gene locus_tag LOCUS_7520 1650 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7520 1911 1999 gene locus_tag LOCUS_t0460 1911 1999 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2340 2053 gene locus_tag LOCUS_7530 2340 2053 CDS product bacteriophage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947967.1 protein_id gnl|my_center|LOCUS_7530 2661 2398 gene locus_tag LOCUS_7540 2661 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7540 >Feature sequence52 15 935 gene locus_tag LOCUS_7550 gene miaA 15 935 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_7550 >Feature sequence53 89 793 gene locus_tag LOCUS_7560 89 793 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028999.1 protein_id gnl|my_center|LOCUS_7560 2247 817 gene locus_tag LOCUS_7570 2247 817 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_7570