>Feature sequence001 89 298 gene locus_tag LOCUS_00010 89 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 291 758 gene locus_tag LOCUS_00020 291 758 CDS product DUF3106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044963.1 protein_id gnl|my_center|LOCUS_00020 1893 1087 gene locus_tag LOCUS_00030 1893 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00030 3160 2096 gene locus_tag LOCUS_00040 3160 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4268 3192 gene locus_tag LOCUS_00050 4268 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5448 4522 gene locus_tag LOCUS_00060 5448 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6189 7262 gene locus_tag LOCUS_00070 6189 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8899 7454 gene locus_tag LOCUS_00080 8899 7454 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982280.1 protein_id gnl|my_center|LOCUS_00080 10098 8896 gene locus_tag LOCUS_00090 10098 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11547 10135 gene locus_tag LOCUS_00100 11547 10135 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294691.1 protein_id gnl|my_center|LOCUS_00100 11843 12442 gene locus_tag LOCUS_00110 11843 12442 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_00110 12464 14011 gene locus_tag LOCUS_00120 12464 14011 CDS product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176617.1 protein_id gnl|my_center|LOCUS_00120 14072 14833 gene locus_tag LOCUS_00130 14072 14833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15276 16562 gene locus_tag LOCUS_00140 15276 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16674 17480 gene locus_tag LOCUS_00150 16674 17480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17543 18454 gene locus_tag LOCUS_00160 17543 18454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18722 19912 gene locus_tag LOCUS_00170 18722 19912 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485734.1 protein_id gnl|my_center|LOCUS_00170 21148 19922 gene locus_tag LOCUS_00180 21148 19922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21542 22672 gene locus_tag LOCUS_00190 21542 22672 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_00190 22689 23630 gene locus_tag LOCUS_00200 gene flgJ 22689 23630 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454015.1 protein_id gnl|my_center|LOCUS_00200 23661 25625 gene locus_tag LOCUS_00210 gene flgK 23661 25625 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 protein_id gnl|my_center|LOCUS_00210 25630 26838 gene locus_tag LOCUS_00220 gene flgL 25630 26838 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 protein_id gnl|my_center|LOCUS_00220 31147 26828 gene locus_tag LOCUS_00230 31147 26828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 31205 32158 gene locus_tag LOCUS_00240 31205 32158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 32724 33083 gene locus_tag LOCUS_00250 32724 33083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33770 33126 gene locus_tag LOCUS_00260 33770 33126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038337.1 protein_id gnl|my_center|LOCUS_00260 36263 33819 gene locus_tag LOCUS_00270 36263 33819 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_00270 36775 37845 gene locus_tag LOCUS_00280 36775 37845 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_00280 37842 38414 gene locus_tag LOCUS_00290 gene pilN 37842 38414 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_00290 38414 39055 gene locus_tag LOCUS_00300 38414 39055 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014841277.1 protein_id gnl|my_center|LOCUS_00300 39052 39597 gene locus_tag LOCUS_00310 gene pilP 39052 39597 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_00310 39718 41772 gene locus_tag LOCUS_00320 gene pilQ 39718 41772 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_00320 >Feature sequence002 <1 620 gene locus_tag LOCUS_00330 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390199.1:ATP-binding cassette domain-containing protein 617 1585 gene locus_tag LOCUS_00340 617 1585 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_00340 1588 2229 gene locus_tag LOCUS_00350 1588 2229 CDS product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940386.1 protein_id gnl|my_center|LOCUS_00350 5073 2389 gene locus_tag LOCUS_00360 5073 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 5936 5385 gene locus_tag LOCUS_00370 5936 5385 CDS product putative colanic acid biosynthesis acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_00370 6949 5978 gene locus_tag LOCUS_00380 6949 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 8550 7051 gene locus_tag LOCUS_00390 8550 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 9986 9087 gene locus_tag LOCUS_00400 9986 9087 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615482.1 protein_id gnl|my_center|LOCUS_00400 11605 10469 gene locus_tag LOCUS_00410 11605 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 13746 12808 gene locus_tag LOCUS_00420 13746 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 14936 13743 gene locus_tag LOCUS_00430 14936 13743 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213498758.1 protein_id gnl|my_center|LOCUS_00430 15885 14929 gene locus_tag LOCUS_00440 gene gmd 15885 14929 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771491.1 protein_id gnl|my_center|LOCUS_00440 16927 15878 gene locus_tag LOCUS_00450 16927 15878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 17557 17021 gene locus_tag LOCUS_00460 17557 17021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 18865 17978 gene locus_tag LOCUS_00470 18865 17978 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942894.1 protein_id gnl|my_center|LOCUS_00470 19716 18865 gene locus_tag LOCUS_00480 19716 18865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 19837 20106 gene locus_tag LOCUS_00490 19837 20106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 21426 20041 gene locus_tag LOCUS_00500 21426 20041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 22485 21538 gene locus_tag LOCUS_00510 22485 21538 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_00510 24001 22691 gene locus_tag LOCUS_00520 24001 22691 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974189.1 protein_id gnl|my_center|LOCUS_00520 26329 25550 gene locus_tag LOCUS_00530 gene exeN 26329 25550 CDS product GspN family type II secretion system protein ExeN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704549.1 protein_id gnl|my_center|LOCUS_00530 26829 26326 gene locus_tag LOCUS_00540 26829 26326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 28040 26826 gene locus_tag LOCUS_00550 28040 26826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 29032 28046 gene locus_tag LOCUS_00560 gene xcpX 29032 28046 CDS product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 protein_id gnl|my_center|LOCUS_00560 29643 29029 gene locus_tag LOCUS_00570 gene xcpW 29643 29029 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_00570 30038 29649 gene locus_tag LOCUS_00580 gene exeI 30038 29649 CDS product GspI family T2SS minor pseudopilin variant ExeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704544.1 protein_id gnl|my_center|LOCUS_00580 30568 30014 gene locus_tag LOCUS_00590 30568 30014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 31014 30565 gene locus_tag LOCUS_00600 gene xcpT 31014 30565 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_00600 32273 31059 gene locus_tag LOCUS_00610 gene xcpS 32273 31059 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_00610 34232 32694 gene locus_tag LOCUS_00620 gene xcpR 34232 32694 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_00620 36403 34229 gene locus_tag LOCUS_00630 gene gspD 36403 34229 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478663.1 protein_id gnl|my_center|LOCUS_00630 37411 36452 gene locus_tag LOCUS_00640 37411 36452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 37802 38308 gene locus_tag LOCUS_00650 37802 38308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 38305 39171 gene locus_tag LOCUS_00660 38305 39171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 39226 39969 gene locus_tag LOCUS_00670 39226 39969 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence003 1322 387 gene locus_tag LOCUS_00680 1322 387 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_00680 1410 1640 gene locus_tag LOCUS_00690 1410 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 1878 2249 gene locus_tag LOCUS_00700 1878 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 2798 4525 gene locus_tag LOCUS_00710 gene pilB 2798 4525 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_00710 4531 5757 gene locus_tag LOCUS_00720 4531 5757 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_00720 5780 6640 gene locus_tag LOCUS_00730 5780 6640 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 protein_id gnl|my_center|LOCUS_00730 6650 7288 gene locus_tag LOCUS_00740 gene coaE 6650 7288 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772796.1 protein_id gnl|my_center|LOCUS_00740 7445 9052 gene locus_tag LOCUS_00750 gene pilS 7445 9052 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_00750 9049 10386 gene locus_tag LOCUS_00760 gene pilR 9049 10386 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_00760 11222 10617 gene locus_tag LOCUS_00770 11222 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 12395 11271 gene locus_tag LOCUS_00780 12395 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 12881 13672 gene locus_tag LOCUS_00790 12881 13672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 13701 14774 gene locus_tag LOCUS_00800 13701 14774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 14786 16654 gene locus_tag LOCUS_00810 14786 16654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 17157 16837 gene locus_tag LOCUS_00820 gene nirD 17157 16837 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_00820 19677 17182 gene locus_tag LOCUS_00830 gene nirB 19677 17182 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_00830 20516 19857 gene locus_tag LOCUS_00840 gene narL 20516 19857 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_00840 22445 20517 gene locus_tag LOCUS_00850 gene narX 22445 20517 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_00850 22904 24280 gene locus_tag LOCUS_00860 22904 24280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 24335 24589 gene locus_tag LOCUS_00870 24335 24589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 24691 25110 gene locus_tag LOCUS_00880 24691 25110 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876531.1 protein_id gnl|my_center|LOCUS_00880 25138 25266 gene locus_tag LOCUS_00890 25138 25266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 25484 25284 gene locus_tag LOCUS_00900 25484 25284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 27276 25765 gene locus_tag LOCUS_00910 gene ilvA 27276 25765 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_00910 27500 28141 gene locus_tag LOCUS_00920 gene rpiA 27500 28141 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770348.1 protein_id gnl|my_center|LOCUS_00920 28335 29393 gene locus_tag LOCUS_00930 28335 29393 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920973.1 protein_id gnl|my_center|LOCUS_00930 31334 29667 gene locus_tag LOCUS_00940 31334 29667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 32439 31897 gene locus_tag LOCUS_00950 gene thpR 32439 31897 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 protein_id gnl|my_center|LOCUS_00950 32908 32426 gene locus_tag LOCUS_00960 gene pncC 32908 32426 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005019686.1 protein_id gnl|my_center|LOCUS_00960 33213 32908 gene locus_tag LOCUS_00970 gene pilZ 33213 32908 CDS product cyclic di-GMP-binding protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104055.1 protein_id gnl|my_center|LOCUS_00970 33618 36179 gene locus_tag LOCUS_00980 gene mutS 33618 36179 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957974.1 protein_id gnl|my_center|LOCUS_00980 36323 37339 gene locus_tag LOCUS_00990 36323 37339 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_00990 37508 39127 gene locus_tag LOCUS_01000 37508 39127 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_01000 39111 40160 gene locus_tag LOCUS_01010 39111 40160 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence004 2321 564 gene locus_tag LOCUS_01020 gene argS 2321 564 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_01020 4873 2654 gene locus_tag LOCUS_01030 4873 2654 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266372.1 protein_id gnl|my_center|LOCUS_01030 5541 6395 gene locus_tag LOCUS_01040 5541 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 6392 8632 gene locus_tag LOCUS_01050 6392 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 8632 10776 gene locus_tag LOCUS_01060 8632 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 10773 12386 gene locus_tag LOCUS_01070 10773 12386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 12454 13110 gene locus_tag LOCUS_01080 12454 13110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 13140 13673 gene locus_tag LOCUS_01090 13140 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 13670 15076 gene locus_tag LOCUS_01100 13670 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 15141 16211 gene locus_tag LOCUS_01110 15141 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 16252 17772 gene locus_tag LOCUS_01120 gene pelF 16252 17772 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_01120 17772 19220 gene locus_tag LOCUS_01130 gene pelG 17772 19220 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 protein_id gnl|my_center|LOCUS_01130 19204 20100 gene locus_tag LOCUS_01140 19204 20100 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_01140 20100 21041 gene locus_tag LOCUS_01150 20100 21041 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_01150 21940 21032 gene locus_tag LOCUS_01160 21940 21032 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_01160 22019 25687 gene locus_tag LOCUS_01170 gene metH 22019 25687 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514261.1 protein_id gnl|my_center|LOCUS_01170 26135 29953 gene locus_tag LOCUS_01180 26135 29953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 >Feature sequence005 189 1187 gene locus_tag LOCUS_01190 189 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391744.1 protein_id gnl|my_center|LOCUS_01190 1184 1471 gene locus_tag LOCUS_01200 1184 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 1607 3010 gene locus_tag LOCUS_01210 1607 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 3071 4666 gene locus_tag LOCUS_01220 3071 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 4699 5022 gene locus_tag LOCUS_01230 4699 5022 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_01230 5036 5638 gene locus_tag LOCUS_01240 gene recR 5036 5638 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036206.1 protein_id gnl|my_center|LOCUS_01240 5927 6310 gene locus_tag LOCUS_01250 5927 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 7306 6656 gene locus_tag LOCUS_01260 7306 6656 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_01260 7706 9910 gene locus_tag LOCUS_01270 7706 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 10000 13407 gene locus_tag LOCUS_01280 10000 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 13476 13883 gene locus_tag LOCUS_01290 13476 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 14009 14563 gene locus_tag LOCUS_01300 14009 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 17400 14581 gene locus_tag LOCUS_01310 17400 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 17599 17414 gene locus_tag LOCUS_01320 17599 17414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 18789 19679 gene locus_tag LOCUS_01330 18789 19679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 19690 20598 gene locus_tag LOCUS_01340 gene nrfD 19690 20598 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462220.1 protein_id gnl|my_center|LOCUS_01340 20699 23008 gene locus_tag LOCUS_01350 20699 23008 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943374.1 protein_id gnl|my_center|LOCUS_01350 23204 23719 gene locus_tag LOCUS_01360 23204 23719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 24154 24582 gene locus_tag LOCUS_01370 24154 24582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 24972 25832 gene locus_tag LOCUS_01380 24972 25832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 25968 26483 gene locus_tag LOCUS_01390 25968 26483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 26590 27753 gene locus_tag LOCUS_01400 26590 27753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 27779 28132 gene locus_tag LOCUS_01410 27779 28132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 28349 29230 gene locus_tag LOCUS_01420 28349 29230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 29233 29583 gene locus_tag LOCUS_01430 29233 29583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 31114 30002 gene locus_tag LOCUS_01440 31114 30002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 31047 31229 gene locus_tag LOCUS_01450 31047 31229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 31570 31920 gene locus_tag LOCUS_01460 31570 31920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 31937 32668 gene locus_tag LOCUS_01470 31937 32668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence006 183 2987 gene locus_tag LOCUS_01480 183 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 4086 3628 gene locus_tag LOCUS_01490 4086 3628 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 protein_id gnl|my_center|LOCUS_01490 4685 4086 gene locus_tag LOCUS_01500 gene wrbA 4685 4086 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 protein_id gnl|my_center|LOCUS_01500 5365 5601 gene locus_tag LOCUS_01510 5365 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 5647 6180 gene locus_tag LOCUS_01520 5647 6180 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_01520 6366 7085 gene locus_tag LOCUS_01530 6366 7085 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036097.1 protein_id gnl|my_center|LOCUS_01530 7090 7377 gene locus_tag LOCUS_01540 7090 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 8353 7418 gene locus_tag LOCUS_01550 gene ispH 8353 7418 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318785.1 protein_id gnl|my_center|LOCUS_01550 8407 9495 gene locus_tag LOCUS_01560 gene apbC 8407 9495 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_01560 9677 10243 gene locus_tag LOCUS_01570 gene dcd 9677 10243 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_01570 11502 10339 gene locus_tag LOCUS_01580 11502 10339 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 protein_id gnl|my_center|LOCUS_01580 11693 12895 gene locus_tag LOCUS_01590 11693 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 13480 14244 gene locus_tag LOCUS_01600 gene rfbF 13480 14244 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545825.1 protein_id gnl|my_center|LOCUS_01600 14513 15688 gene locus_tag LOCUS_01610 14513 15688 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974172.1 protein_id gnl|my_center|LOCUS_01610 15685 16233 gene locus_tag LOCUS_01620 gene rfbC 15685 16233 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_01620 16230 17537 gene locus_tag LOCUS_01630 16230 17537 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222496.1 protein_id gnl|my_center|LOCUS_01630 17530 18444 gene locus_tag LOCUS_01640 17530 18444 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_01640 18437 19519 gene locus_tag LOCUS_01650 18437 19519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 19535 20356 gene locus_tag LOCUS_01660 19535 20356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 20356 21522 gene locus_tag LOCUS_01670 20356 21522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 22143 22316 gene locus_tag LOCUS_01680 22143 22316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 22373 23182 gene locus_tag LOCUS_01690 22373 23182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 23584 25341 gene locus_tag LOCUS_01700 23584 25341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 25647 25985 gene locus_tag LOCUS_01710 25647 25985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 25958 27070 gene locus_tag LOCUS_01720 25958 27070 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_01720 27306 29006 gene locus_tag LOCUS_01730 gene proS 27306 29006 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368141.1 protein_id gnl|my_center|LOCUS_01730 29536 29204 gene locus_tag LOCUS_01740 29536 29204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 29941 30447 gene locus_tag LOCUS_01750 29941 30447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 >Feature sequence007 <1 1440 gene locus_tag LOCUS_01760 <1 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113244.1:dihydro-heme d1 dehydrogenase 1883 3265 gene locus_tag LOCUS_01770 gene cysG 1883 3265 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_01770 3276 3971 gene locus_tag LOCUS_01780 gene dnr 3276 3971 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_01780 5280 4165 gene locus_tag LOCUS_01790 5280 4165 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087731.1 protein_id gnl|my_center|LOCUS_01790 5515 5679 gene locus_tag LOCUS_01800 5515 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 5695 6231 gene locus_tag LOCUS_01810 gene cbaB 5695 6231 CDS product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 protein_id gnl|my_center|LOCUS_01810 6237 7973 gene locus_tag LOCUS_01820 6237 7973 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403093.1 protein_id gnl|my_center|LOCUS_01820 7983 8840 gene locus_tag LOCUS_01830 7983 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 8837 9733 gene locus_tag LOCUS_01840 8837 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 10009 11550 gene locus_tag LOCUS_01850 10009 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 11537 12037 gene locus_tag LOCUS_01860 11537 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 12331 13698 gene locus_tag LOCUS_01870 12331 13698 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597555.1 protein_id gnl|my_center|LOCUS_01870 14177 14839 gene locus_tag LOCUS_01880 14177 14839 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417707.1 protein_id gnl|my_center|LOCUS_01880 15410 15162 gene locus_tag LOCUS_01890 15410 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 16695 15631 gene locus_tag LOCUS_01900 16695 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 18240 16792 gene locus_tag LOCUS_01910 18240 16792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 21227 18525 gene locus_tag LOCUS_01920 21227 18525 CDS product arsenate reductase (azurin) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257094.1 protein_id gnl|my_center|LOCUS_01920 21823 21230 gene locus_tag LOCUS_01930 21823 21230 CDS product arsenate reductase (azurin) small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229170.1 protein_id gnl|my_center|LOCUS_01930 23052 21820 gene locus_tag LOCUS_01940 23052 21820 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_01940 24436 23378 gene locus_tag LOCUS_01950 24436 23378 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_01950 25042 25245 gene locus_tag LOCUS_01960 25042 25245 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040115264.1 protein_id gnl|my_center|LOCUS_01960 27151 25259 gene locus_tag LOCUS_01970 gene parE 27151 25259 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_01970 27870 27148 gene locus_tag LOCUS_01980 27870 27148 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 protein_id gnl|my_center|LOCUS_01980 28641 27883 gene locus_tag LOCUS_01990 28641 27883 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_01990 28929 28663 gene locus_tag LOCUS_02000 28929 28663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 29804 28926 gene locus_tag LOCUS_02010 gene dapA 29804 28926 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence008 1344 502 gene locus_tag LOCUS_02020 gene nei 1344 502 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113989.1 protein_id gnl|my_center|LOCUS_02020 2797 1346 gene locus_tag LOCUS_02030 2797 1346 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767670.1 protein_id gnl|my_center|LOCUS_02030 3141 5195 gene locus_tag LOCUS_02040 3141 5195 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_02040 5162 5335 gene locus_tag LOCUS_02050 gene nrdD 5162 5335 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389030.1 protein_id gnl|my_center|LOCUS_02050 5314 5931 gene locus_tag LOCUS_02060 5314 5931 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 protein_id gnl|my_center|LOCUS_02060 6810 8780 gene locus_tag LOCUS_02070 6810 8780 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_02070 9352 10800 gene locus_tag LOCUS_02080 9352 10800 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085030.1 protein_id gnl|my_center|LOCUS_02080 11080 12177 gene locus_tag LOCUS_02090 11080 12177 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706680.1 protein_id gnl|my_center|LOCUS_02090 12562 14718 gene locus_tag LOCUS_02100 12562 14718 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261021.1 protein_id gnl|my_center|LOCUS_02100 14854 16047 gene locus_tag LOCUS_02110 14854 16047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 16113 17240 gene locus_tag LOCUS_02120 16113 17240 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_02120 17248 18372 gene locus_tag LOCUS_02130 17248 18372 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 protein_id gnl|my_center|LOCUS_02130 18372 18821 gene locus_tag LOCUS_02140 18372 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 18833 19681 gene locus_tag LOCUS_02150 gene panC 18833 19681 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266657.1 protein_id gnl|my_center|LOCUS_02150 19809 20189 gene locus_tag LOCUS_02160 19809 20189 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036943.1 protein_id gnl|my_center|LOCUS_02160 21512 20226 gene locus_tag LOCUS_02170 gene tviB 21512 20226 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_02170 22815 24215 gene locus_tag LOCUS_02180 22815 24215 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_02180 25618 24443 gene locus_tag LOCUS_02190 25618 24443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 >Feature sequence009 <1 526 gene locus_tag LOCUS_02200 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113846.1:lysine--tRNA ligase 594 1955 gene locus_tag LOCUS_02210 594 1955 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946915.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02210 1956 2228 gene locus_tag LOCUS_02220 1956 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02220 2225 3058 gene locus_tag LOCUS_02230 gene kdsA 2225 3058 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_02230 3131 4423 gene locus_tag LOCUS_02240 gene eno 3131 4423 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_02240 4446 4715 gene locus_tag LOCUS_02250 4446 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 4731 5030 gene locus_tag LOCUS_02260 4731 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 5115 5450 gene locus_tag LOCUS_02270 5115 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 5447 7318 gene locus_tag LOCUS_02280 gene btuB 5447 7318 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_02280 7346 7951 gene locus_tag LOCUS_02290 gene cobO 7346 7951 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_02290 9552 7945 gene locus_tag LOCUS_02300 9552 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 11722 10247 gene locus_tag LOCUS_02310 gene zwf 11722 10247 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_02310 12639 11719 gene locus_tag LOCUS_02320 gene gnd 12639 11719 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402865.1 protein_id gnl|my_center|LOCUS_02320 12860 13063 gene locus_tag LOCUS_02330 12860 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 14570 13092 gene locus_tag LOCUS_02340 gene glgA 14570 13092 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099109.1 protein_id gnl|my_center|LOCUS_02340 16820 14625 gene locus_tag LOCUS_02350 gene glgB 16820 14625 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_02350 16926 18194 gene locus_tag LOCUS_02360 gene glgC 16926 18194 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_02360 18195 19667 gene locus_tag LOCUS_02370 gene malQ 18195 19667 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_02370 19767 20366 gene locus_tag LOCUS_02380 19767 20366 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_02380 20635 21288 gene locus_tag LOCUS_02390 20635 21288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 22515 21307 gene locus_tag LOCUS_02400 22515 21307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 22679 23866 gene locus_tag LOCUS_02410 22679 23866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 <25519 24349 gene locus_tag LOCUS_02420 <25519 24349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044893.1:cytochrome c3 family protein >Feature sequence010 722 129 gene locus_tag LOCUS_02430 722 129 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207732.1 protein_id gnl|my_center|LOCUS_02430 3730 2312 gene locus_tag LOCUS_02440 3730 2312 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109667839.1 protein_id gnl|my_center|LOCUS_02440 4890 3751 gene locus_tag LOCUS_02450 4890 3751 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_02450 5993 5088 gene locus_tag LOCUS_02460 5993 5088 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_02460 6525 6373 gene locus_tag LOCUS_02470 6525 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 6726 6556 gene locus_tag LOCUS_02480 6726 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 7345 7115 gene locus_tag LOCUS_02490 7345 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 12759 7330 gene locus_tag LOCUS_02500 12759 7330 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267807.1 protein_id gnl|my_center|LOCUS_02500 14201 12756 gene locus_tag LOCUS_02510 14201 12756 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102849.1 protein_id gnl|my_center|LOCUS_02510 14445 14954 gene locus_tag LOCUS_02520 14445 14954 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815454.1 protein_id gnl|my_center|LOCUS_02520 15917 15027 gene locus_tag LOCUS_02530 15917 15027 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 protein_id gnl|my_center|LOCUS_02530 16944 15940 gene locus_tag LOCUS_02540 16944 15940 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_02540 17893 16946 gene locus_tag LOCUS_02550 17893 16946 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706514.1 protein_id gnl|my_center|LOCUS_02550 18577 17903 gene locus_tag LOCUS_02560 18577 17903 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071224.1 protein_id gnl|my_center|LOCUS_02560 18737 19555 gene locus_tag LOCUS_02570 18737 19555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 19583 22180 gene locus_tag LOCUS_02580 19583 22180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 >Feature sequence011 1457 849 gene locus_tag LOCUS_02590 gene gmhA 1457 849 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942729.1 protein_id gnl|my_center|LOCUS_02590 2677 1454 gene locus_tag LOCUS_02600 gene waaF 2677 1454 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526219.1 protein_id gnl|my_center|LOCUS_02600 3594 2677 gene locus_tag LOCUS_02610 3594 2677 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_02610 4498 3704 gene locus_tag LOCUS_02620 4498 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 5934 4495 gene locus_tag LOCUS_02630 5934 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 6168 7148 gene locus_tag LOCUS_02640 gene pstS 6168 7148 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_02640 7296 9551 gene locus_tag LOCUS_02650 7296 9551 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768357.1 protein_id gnl|my_center|LOCUS_02650 9548 11200 gene locus_tag LOCUS_02660 gene pstA 9548 11200 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_02660 11208 12047 gene locus_tag LOCUS_02670 gene pstB 11208 12047 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071864.1 protein_id gnl|my_center|LOCUS_02670 12052 12768 gene locus_tag LOCUS_02680 gene phoU 12052 12768 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334097.1 protein_id gnl|my_center|LOCUS_02680 12771 13316 gene locus_tag LOCUS_02690 12771 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 13415 14860 gene locus_tag LOCUS_02700 gene fleQ 13415 14860 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_02700 15401 15087 gene locus_tag LOCUS_02710 15401 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 15713 15420 gene locus_tag LOCUS_02720 15713 15420 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 protein_id gnl|my_center|LOCUS_02720 15845 16918 gene locus_tag LOCUS_02730 gene fleS 15845 16918 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_02730 16924 18255 gene locus_tag LOCUS_02740 16924 18255 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706626.1 protein_id gnl|my_center|LOCUS_02740 18282 18596 gene locus_tag LOCUS_02750 gene fliE 18282 18596 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947487.1 protein_id gnl|my_center|LOCUS_02750 18754 20388 gene locus_tag LOCUS_02760 gene fliF 18754 20388 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109118.1 protein_id gnl|my_center|LOCUS_02760 20381 21415 gene locus_tag LOCUS_02770 gene fliG 20381 21415 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890098.1 protein_id gnl|my_center|LOCUS_02770 21503 22183 gene locus_tag LOCUS_02780 gene fliH 21503 22183 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930338.1 protein_id gnl|my_center|LOCUS_02780 >Feature sequence012 1540 335 gene locus_tag LOCUS_02790 1540 335 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 protein_id gnl|my_center|LOCUS_02790 2580 1816 gene locus_tag LOCUS_02800 gene pgl 2580 1816 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_02800 3776 3117 gene locus_tag LOCUS_02810 3776 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 5228 3930 gene locus_tag LOCUS_02820 5228 3930 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_02820 8374 5264 gene locus_tag LOCUS_02830 8374 5264 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_02830 9750 8371 gene locus_tag LOCUS_02840 9750 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 9634 9882 gene locus_tag LOCUS_02850 9634 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 10520 10428 gene locus_tag LOCUS_t00010 10520 10428 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11263 12555 gene locus_tag LOCUS_02860 gene mltF 11263 12555 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_02860 13227 12643 gene locus_tag LOCUS_02870 13227 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 14597 13314 gene locus_tag LOCUS_02880 gene hemL 14597 13314 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_02880 15259 14612 gene locus_tag LOCUS_02890 15259 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 16086 15256 gene locus_tag LOCUS_02900 16086 15256 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186397.1 protein_id gnl|my_center|LOCUS_02900 16288 16070 gene locus_tag LOCUS_02910 16288 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 19335 16825 gene locus_tag LOCUS_02920 19335 16825 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_02920 19980 19450 gene locus_tag LOCUS_02930 19980 19450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 21427 20000 gene locus_tag LOCUS_02940 gene ccoG 21427 20000 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707874.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence013 1169 444 gene locus_tag LOCUS_02950 gene sfsA 1169 444 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_02950 3361 1169 gene locus_tag LOCUS_02960 gene relA 3361 1169 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_02960 3785 3997 gene locus_tag LOCUS_02970 3785 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 4547 4023 gene locus_tag LOCUS_02980 4547 4023 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_02980 5069 5836 gene locus_tag LOCUS_02990 5069 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 6367 7410 gene locus_tag LOCUS_03000 6367 7410 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_03000 7532 8029 gene locus_tag LOCUS_03010 7532 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 9734 8364 gene locus_tag LOCUS_03020 gene radA 9734 8364 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555235.1 protein_id gnl|my_center|LOCUS_03020 10288 9737 gene locus_tag LOCUS_03030 10288 9737 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_03030 11384 10272 gene locus_tag LOCUS_03040 gene alr 11384 10272 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261110.1 protein_id gnl|my_center|LOCUS_03040 12723 11365 gene locus_tag LOCUS_03050 12723 11365 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_03050 13424 12975 gene locus_tag LOCUS_03060 gene rplI 13424 12975 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502894.1 protein_id gnl|my_center|LOCUS_03060 14373 13474 gene locus_tag LOCUS_03070 14373 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957858.1 protein_id gnl|my_center|LOCUS_03070 14652 14428 gene locus_tag LOCUS_03080 gene rpsR 14652 14428 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_03080 14939 14649 gene locus_tag LOCUS_03090 14939 14649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 15386 14973 gene locus_tag LOCUS_03100 gene rpsF 15386 14973 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095636.1 protein_id gnl|my_center|LOCUS_03100 15606 15866 gene locus_tag LOCUS_03110 15606 15866 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771337.1 protein_id gnl|my_center|LOCUS_03110 15879 16769 gene locus_tag LOCUS_03120 15879 16769 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_03120 16890 18749 gene locus_tag LOCUS_03130 gene dxs 16890 18749 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102816.1 protein_id gnl|my_center|LOCUS_03130 18784 19164 gene locus_tag LOCUS_03140 gene queD 18784 19164 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_03140 19168 19959 gene locus_tag LOCUS_03150 gene folE2 19168 19959 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_03150 20425 20105 gene locus_tag LOCUS_03160 20425 20105 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_03160 20863 20594 gene locus_tag LOCUS_03170 20863 20594 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_03170 21354 20857 gene locus_tag LOCUS_03180 21354 20857 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_03180 21764 21357 gene locus_tag LOCUS_03190 21764 21357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 >Feature sequence014 226 849 gene locus_tag LOCUS_03200 226 849 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229052.1 protein_id gnl|my_center|LOCUS_03200 3093 1189 gene locus_tag LOCUS_03210 3093 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 4217 3156 gene locus_tag LOCUS_03220 4217 3156 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_03220 5479 4214 gene locus_tag LOCUS_03230 gene fslC 5479 4214 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_03230 6126 5476 gene locus_tag LOCUS_03240 6126 5476 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925266.1 protein_id gnl|my_center|LOCUS_03240 7192 6194 gene locus_tag LOCUS_03250 7192 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 10608 7723 gene locus_tag LOCUS_03260 10608 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 12245 10605 gene locus_tag LOCUS_03270 12245 10605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 13121 12519 gene locus_tag LOCUS_03280 gene slmA 13121 12519 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073926.1 protein_id gnl|my_center|LOCUS_03280 14023 13121 gene locus_tag LOCUS_03290 gene argB 14023 13121 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_03290 15519 14104 gene locus_tag LOCUS_03300 15519 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 15994 15539 gene locus_tag LOCUS_03310 gene dut 15994 15539 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077682.1 protein_id gnl|my_center|LOCUS_03310 17584 16361 gene locus_tag LOCUS_03320 gene coaBC 17584 16361 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_03320 17657 18526 gene locus_tag LOCUS_03330 gene speE 17657 18526 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 protein_id gnl|my_center|LOCUS_03330 18846 19034 gene locus_tag LOCUS_03340 18846 19034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 19488 20078 gene locus_tag LOCUS_03350 19488 20078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 20293 20484 gene locus_tag LOCUS_03360 20293 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 20824 21102 gene locus_tag LOCUS_03370 20824 21102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence015 224 1474 gene locus_tag LOCUS_03380 224 1474 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266374.1 protein_id gnl|my_center|LOCUS_03380 1786 2604 gene locus_tag LOCUS_03390 gene rhdA 1786 2604 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_03390 2885 3547 gene locus_tag LOCUS_03400 2885 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 4414 3641 gene locus_tag LOCUS_03410 gene lpxA 4414 3641 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092373.1 protein_id gnl|my_center|LOCUS_03410 4857 4411 gene locus_tag LOCUS_03420 gene fabZ 4857 4411 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_03420 5921 4863 gene locus_tag LOCUS_03430 gene lpxD 5921 4863 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_03430 6419 5925 gene locus_tag LOCUS_03440 6419 5925 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_03440 8742 6463 gene locus_tag LOCUS_03450 gene bamA 8742 6463 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266976.1 protein_id gnl|my_center|LOCUS_03450 10148 8787 gene locus_tag LOCUS_03460 gene rseP 10148 8787 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 protein_id gnl|my_center|LOCUS_03460 11338 10154 gene locus_tag LOCUS_03470 gene ispC 11338 10154 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_03470 12183 11335 gene locus_tag LOCUS_03480 gene cdsA 12183 11335 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092388.1 protein_id gnl|my_center|LOCUS_03480 12997 12230 gene locus_tag LOCUS_03490 gene uppS 12997 12230 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_03490 13576 13019 gene locus_tag LOCUS_03500 gene frr 13576 13019 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_03500 14319 13573 gene locus_tag LOCUS_03510 gene pyrH 14319 13573 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 protein_id gnl|my_center|LOCUS_03510 15186 14329 gene locus_tag LOCUS_03520 gene tsf 15186 14329 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_03520 16419 15265 gene locus_tag LOCUS_03530 16419 15265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 16697 17464 gene locus_tag LOCUS_03540 gene map 16697 17464 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_03540 17461 20121 gene locus_tag LOCUS_03550 17461 20121 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_03550 >Feature sequence016 2522 1299 gene locus_tag LOCUS_03560 gene fabF 2522 1299 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_03560 3204 2968 gene locus_tag LOCUS_03570 gene acpP 3204 2968 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 protein_id gnl|my_center|LOCUS_03570 4151 3408 gene locus_tag LOCUS_03580 gene fabG 4151 3408 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091137.1 protein_id gnl|my_center|LOCUS_03580 5061 4135 gene locus_tag LOCUS_03590 gene fabD 5061 4135 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816075.1 protein_id gnl|my_center|LOCUS_03590 6052 5087 gene locus_tag LOCUS_03600 6052 5087 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_03600 7068 6067 gene locus_tag LOCUS_03610 gene plsX 7068 6067 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_03610 7460 7281 gene locus_tag LOCUS_03620 gene rpmF 7460 7281 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947121.1 protein_id gnl|my_center|LOCUS_03620 8005 7487 gene locus_tag LOCUS_03630 gene yceD 8005 7487 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072716.1 protein_id gnl|my_center|LOCUS_03630 8365 8081 gene locus_tag LOCUS_03640 8365 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939234.1 protein_id gnl|my_center|LOCUS_03640 10908 8380 gene locus_tag LOCUS_03650 10908 8380 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121835.1 protein_id gnl|my_center|LOCUS_03650 12477 11503 gene locus_tag LOCUS_03660 12477 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 12983 12474 gene locus_tag LOCUS_03670 12983 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 13486 12980 gene locus_tag LOCUS_03680 13486 12980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 14180 13491 gene locus_tag LOCUS_03690 14180 13491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 14553 14200 gene locus_tag LOCUS_03700 14553 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 15111 14563 gene locus_tag LOCUS_03710 15111 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 19153 15113 gene locus_tag LOCUS_03720 19153 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 19695 19153 gene locus_tag LOCUS_03730 19695 19153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 >Feature sequence017 330 1733 gene locus_tag LOCUS_03740 330 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 2700 2278 gene locus_tag LOCUS_03750 gene holC 2700 2278 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100593.1 protein_id gnl|my_center|LOCUS_03750 4190 2697 gene locus_tag LOCUS_03760 gene pepA 4190 2697 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_03760 4257 5357 gene locus_tag LOCUS_03770 gene lptF 4257 5357 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443992.1 protein_id gnl|my_center|LOCUS_03770 5354 6424 gene locus_tag LOCUS_03780 gene lptG 5354 6424 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_03780 6837 8648 gene locus_tag LOCUS_03790 6837 8648 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_03790 9113 9919 gene locus_tag LOCUS_03800 9113 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 11173 10037 gene locus_tag LOCUS_03810 11173 10037 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202471.1 protein_id gnl|my_center|LOCUS_03810 12130 11312 gene locus_tag LOCUS_03820 12130 11312 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_03820 13752 12118 gene locus_tag LOCUS_03830 13752 12118 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_03830 14681 14031 gene locus_tag LOCUS_03840 gene dsbA 14681 14031 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_03840 14982 15470 gene locus_tag LOCUS_03850 14982 15470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 16642 15545 gene locus_tag LOCUS_03860 16642 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 17533 17096 gene locus_tag LOCUS_03870 gene lysM 17533 17096 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_03870 18436 17852 gene locus_tag LOCUS_03880 18436 17852 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 protein_id gnl|my_center|LOCUS_03880 >Feature sequence018 1495 668 gene locus_tag LOCUS_03890 1495 668 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704877.1 protein_id gnl|my_center|LOCUS_03890 1851 1501 gene locus_tag LOCUS_03900 1851 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539929.1 protein_id gnl|my_center|LOCUS_03900 2118 1855 gene locus_tag LOCUS_03910 2118 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193682.1 protein_id gnl|my_center|LOCUS_03910 2617 2129 gene locus_tag LOCUS_03920 2617 2129 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192269.1 protein_id gnl|my_center|LOCUS_03920 3470 2652 gene locus_tag LOCUS_03930 3470 2652 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192012.1 protein_id gnl|my_center|LOCUS_03930 4419 3472 gene locus_tag LOCUS_03940 4419 3472 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539779.1 protein_id gnl|my_center|LOCUS_03940 5662 4400 gene locus_tag LOCUS_03950 5662 4400 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550379.1 protein_id gnl|my_center|LOCUS_03950 7782 5659 gene locus_tag LOCUS_03960 7782 5659 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193954.1 protein_id gnl|my_center|LOCUS_03960 10120 8132 gene locus_tag LOCUS_03970 gene nosZ 10120 8132 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011854083.1 protein_id gnl|my_center|LOCUS_03970 11244 10381 gene locus_tag LOCUS_03980 11244 10381 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_03980 12094 11426 gene locus_tag LOCUS_03990 gene fliA 12094 11426 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_03990 12991 12446 gene locus_tag LOCUS_04000 gene orn 12991 12446 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_04000 13236 14105 gene locus_tag LOCUS_04010 gene rsgA 13236 14105 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_04010 15432 14428 gene locus_tag LOCUS_04020 15432 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 16288 15440 gene locus_tag LOCUS_04030 gene motA 16288 15440 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_04030 16435 17958 gene locus_tag LOCUS_04040 16435 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence019 1356 1550 gene locus_tag LOCUS_04050 1356 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 1571 2578 gene locus_tag LOCUS_04060 gene nadE 1571 2578 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976175.1 protein_id gnl|my_center|LOCUS_04060 2575 3522 gene locus_tag LOCUS_04070 2575 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931913.1 protein_id gnl|my_center|LOCUS_04070 3535 4719 gene locus_tag LOCUS_04080 3535 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 5553 4885 gene locus_tag LOCUS_04090 5553 4885 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940394.1 protein_id gnl|my_center|LOCUS_04090 7183 6197 gene locus_tag LOCUS_04100 7183 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 7988 7161 gene locus_tag LOCUS_04110 7988 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 8225 10384 gene locus_tag LOCUS_04120 8225 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 10495 11805 gene locus_tag LOCUS_04130 10495 11805 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_04130 12113 12781 gene locus_tag LOCUS_04140 12113 12781 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729648.1 protein_id gnl|my_center|LOCUS_04140 13913 12876 gene locus_tag LOCUS_04150 13913 12876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 15072 13939 gene locus_tag LOCUS_04160 15072 13939 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_04160 15277 15077 gene locus_tag LOCUS_04170 15277 15077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 15256 16197 gene locus_tag LOCUS_04180 gene lepB 15256 16197 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120636.1 protein_id gnl|my_center|LOCUS_04180 17097 16363 gene locus_tag LOCUS_04190 gene lpxH 17097 16363 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113585.1 protein_id gnl|my_center|LOCUS_04190 17588 17094 gene locus_tag LOCUS_04200 gene ppiB 17588 17094 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255996.1 protein_id gnl|my_center|LOCUS_04200 18251 17664 gene locus_tag LOCUS_04210 18251 17664 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_04210 >Feature sequence020 174 2468 gene locus_tag LOCUS_04220 gene mrcB 174 2468 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_04220 2465 2953 gene locus_tag LOCUS_04230 2465 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 2954 3448 gene locus_tag LOCUS_04240 2954 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3474 5411 gene locus_tag LOCUS_04250 3474 5411 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_04250 5408 6097 gene locus_tag LOCUS_04260 gene tsaB 5408 6097 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 protein_id gnl|my_center|LOCUS_04260 6821 6114 gene locus_tag LOCUS_04270 6821 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 9579 6844 gene locus_tag LOCUS_04280 9579 6844 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_04280 9680 11665 gene locus_tag LOCUS_04290 9680 11665 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_04290 12756 11950 gene locus_tag LOCUS_04300 gene rsmA 12756 11950 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_04300 13643 12753 gene locus_tag LOCUS_04310 gene pdxA 13643 12753 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 protein_id gnl|my_center|LOCUS_04310 15054 13735 gene locus_tag LOCUS_04320 15054 13735 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_04320 17307 15070 gene locus_tag LOCUS_04330 17307 15070 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269131.1 protein_id gnl|my_center|LOCUS_04330 17708 17283 gene locus_tag LOCUS_04340 17708 17283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence021 1460 747 gene locus_tag LOCUS_04350 1460 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 2951 1515 gene locus_tag LOCUS_04360 gene gatB 2951 1515 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_04360 4411 2954 gene locus_tag LOCUS_04370 gene gatA 4411 2954 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_04370 4717 4430 gene locus_tag LOCUS_04380 gene gatC 4717 4430 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_04380 5056 6108 gene locus_tag LOCUS_04390 gene mreB 5056 6108 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918653.1 protein_id gnl|my_center|LOCUS_04390 6245 7081 gene locus_tag LOCUS_04400 gene mreC 6245 7081 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04400 7078 7563 gene locus_tag LOCUS_04410 gene mreD 7078 7563 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 protein_id gnl|my_center|LOCUS_04410 7608 9458 gene locus_tag LOCUS_04420 gene mrdA 7608 9458 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_04420 9451 10602 gene locus_tag LOCUS_04430 gene rodA 9451 10602 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_04430 10710 11606 gene locus_tag LOCUS_04440 10710 11606 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_04440 12314 11661 gene locus_tag LOCUS_04450 12314 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 13519 12377 gene locus_tag LOCUS_04460 13519 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 13851 15098 gene locus_tag LOCUS_04470 13851 15098 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_04470 15145 15768 gene locus_tag LOCUS_04480 gene lolD 15145 15768 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_04480 15755 16228 gene locus_tag LOCUS_04490 15755 16228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 16305 17573 gene locus_tag LOCUS_04500 16305 17573 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence022 1294 164 gene locus_tag LOCUS_04510 1294 164 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_04510 2073 1297 gene locus_tag LOCUS_04520 2073 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3761 2055 gene locus_tag LOCUS_04530 3761 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4876 3758 gene locus_tag LOCUS_04540 4876 3758 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942620.1 protein_id gnl|my_center|LOCUS_04540 5793 4873 gene locus_tag LOCUS_04550 5793 4873 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403764.1 protein_id gnl|my_center|LOCUS_04550 7189 5888 gene locus_tag LOCUS_04560 7189 5888 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122761.1 protein_id gnl|my_center|LOCUS_04560 8226 7186 gene locus_tag LOCUS_04570 8226 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 9602 8232 gene locus_tag LOCUS_04580 9602 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 10745 9618 gene locus_tag LOCUS_04590 10745 9618 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_04590 12892 11342 gene locus_tag LOCUS_04600 12892 11342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 13760 12969 gene locus_tag LOCUS_04610 13760 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 15611 14049 gene locus_tag LOCUS_04620 15611 14049 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_04620 16206 15631 gene locus_tag LOCUS_04630 16206 15631 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_04630 >Feature sequence023 1346 2380 gene locus_tag LOCUS_04640 gene argC 1346 2380 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_04640 2377 3111 gene locus_tag LOCUS_04650 2377 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 3243 3680 gene locus_tag LOCUS_04660 3243 3680 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_04660 3865 4749 gene locus_tag LOCUS_04670 3865 4749 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_04670 4787 4990 gene locus_tag LOCUS_04680 4787 4990 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_04680 5339 6241 gene locus_tag LOCUS_04690 5339 6241 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_04690 6220 6312 gene locus_tag LOCUS_t00020 6220 6312 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6364 7521 gene locus_tag LOCUS_04700 gene oprO 6364 7521 CDS product outer membrane porin OprO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104423.1 protein_id gnl|my_center|LOCUS_04700 7734 8432 gene locus_tag LOCUS_04710 7734 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 8599 11526 gene locus_tag LOCUS_04720 8599 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 11606 12562 gene locus_tag LOCUS_04730 11606 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_04730 12565 14337 gene locus_tag LOCUS_04740 12565 14337 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_04740 14386 16875 gene locus_tag LOCUS_04750 14386 16875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence024 1154 741 gene locus_tag LOCUS_04760 1154 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1811 2014 gene locus_tag LOCUS_04770 1811 2014 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 protein_id gnl|my_center|LOCUS_04770 2142 2405 gene locus_tag LOCUS_04780 2142 2405 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_04780 2632 2342 gene locus_tag LOCUS_04790 2632 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2719 5325 gene locus_tag LOCUS_04800 2719 5325 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933347.1 protein_id gnl|my_center|LOCUS_04800 5389 6054 gene locus_tag LOCUS_04810 5389 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 6054 7739 gene locus_tag LOCUS_04820 gene ubiB 6054 7739 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_04820 8114 8662 gene locus_tag LOCUS_04830 8114 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 8769 9257 gene locus_tag LOCUS_04840 8769 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 9376 11115 gene locus_tag LOCUS_04850 gene recJ 9376 11115 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_04850 11681 12898 gene locus_tag LOCUS_04860 gene alaC 11681 12898 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100170.1 protein_id gnl|my_center|LOCUS_04860 12895 14205 gene locus_tag LOCUS_04870 12895 14205 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_04870 14230 15306 gene locus_tag LOCUS_04880 gene thrC 14230 15306 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048893.1 protein_id gnl|my_center|LOCUS_04880 15321 16361 gene locus_tag LOCUS_04890 15321 16361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037015.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence025 <1 1387 gene locus_tag LOCUS_04900 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942718.1:IPT/TIG domain-containing protein 1934 3040 gene locus_tag LOCUS_04910 1934 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945959.1 protein_id gnl|my_center|LOCUS_04910 7216 3110 gene locus_tag LOCUS_04920 7216 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 8343 7309 gene locus_tag LOCUS_04930 gene sohB 8343 7309 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106011.1 protein_id gnl|my_center|LOCUS_04930 10649 8439 gene locus_tag LOCUS_04940 10649 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 10756 12519 gene locus_tag LOCUS_04950 10756 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 12509 14179 gene locus_tag LOCUS_04960 12509 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 15409 14201 gene locus_tag LOCUS_04970 gene lapB 15409 14201 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_04970 15725 15411 gene locus_tag LOCUS_04980 15725 15411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence026 1601 204 gene locus_tag LOCUS_04990 1601 204 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 protein_id gnl|my_center|LOCUS_04990 1752 2744 gene locus_tag LOCUS_05000 gene pdhA 1752 2744 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_05000 2744 3724 gene locus_tag LOCUS_05010 2744 3724 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_05010 3787 6819 gene locus_tag LOCUS_05020 3787 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 7910 6903 gene locus_tag LOCUS_05030 7910 6903 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_05030 8348 8635 gene locus_tag LOCUS_05040 8348 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 10065 8947 gene locus_tag LOCUS_05050 10065 8947 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_05050 14487 10270 gene locus_tag LOCUS_05060 14487 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 14689 15393 gene locus_tag LOCUS_05070 14689 15393 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814609.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence027 1580 333 gene locus_tag LOCUS_05080 gene tyrS 1580 333 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_05080 1725 3053 gene locus_tag LOCUS_05090 1725 3053 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_05090 3103 4221 gene locus_tag LOCUS_05100 3103 4221 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 protein_id gnl|my_center|LOCUS_05100 4864 4229 gene locus_tag LOCUS_05110 gene nudF 4864 4229 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 protein_id gnl|my_center|LOCUS_05110 5436 5654 gene locus_tag LOCUS_05120 5436 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 5644 7056 gene locus_tag LOCUS_05130 5644 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 7069 9204 gene locus_tag LOCUS_05140 7069 9204 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 protein_id gnl|my_center|LOCUS_05140 9589 9912 gene locus_tag LOCUS_05150 9589 9912 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811141.1 protein_id gnl|my_center|LOCUS_05150 10816 9968 gene locus_tag LOCUS_05160 gene nfo 10816 9968 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932008.1 protein_id gnl|my_center|LOCUS_05160 11288 12934 gene locus_tag LOCUS_05170 11288 12934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence028 1311 661 gene locus_tag LOCUS_05180 1311 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 1686 1339 gene locus_tag LOCUS_05190 1686 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 2922 1699 gene locus_tag LOCUS_05200 gene lpxB 2922 1699 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_05200 4009 2909 gene locus_tag LOCUS_05210 4009 2909 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 protein_id gnl|my_center|LOCUS_05210 4956 4006 gene locus_tag LOCUS_05220 4956 4006 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_05220 5574 5332 gene locus_tag LOCUS_05230 5574 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 5456 7087 gene locus_tag LOCUS_05240 5456 7087 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943573.1 protein_id gnl|my_center|LOCUS_05240 7111 8175 gene locus_tag LOCUS_05250 7111 8175 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_05250 8218 8544 gene locus_tag LOCUS_05260 8218 8544 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908409.1 protein_id gnl|my_center|LOCUS_05260 8531 9247 gene locus_tag LOCUS_05270 8531 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 9966 12068 gene locus_tag LOCUS_05280 gene prsK 9966 12068 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_05280 12099 13439 gene locus_tag LOCUS_05290 gene prsR 12099 13439 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_05290 14042 14266 gene locus_tag LOCUS_05300 14042 14266 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence029 207 497 gene locus_tag LOCUS_05310 207 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 1482 514 gene locus_tag LOCUS_05320 1482 514 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_05320 1977 1663 gene locus_tag LOCUS_05330 1977 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 1912 2865 gene locus_tag LOCUS_05340 1912 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 3846 2869 gene locus_tag LOCUS_05350 gene epmA 3846 2869 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175550.1 protein_id gnl|my_center|LOCUS_05350 4412 3843 gene locus_tag LOCUS_05360 gene efp 4412 3843 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_05360 4446 5447 gene locus_tag LOCUS_05370 gene epmB 4446 5447 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_05370 5822 5895 gene locus_tag LOCUS_t00030 5822 5895 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6397 5972 gene locus_tag LOCUS_05380 6397 5972 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543933.1 protein_id gnl|my_center|LOCUS_05380 7033 6398 gene locus_tag LOCUS_05390 gene nth 7033 6398 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948566.1 protein_id gnl|my_center|LOCUS_05390 7719 7030 gene locus_tag LOCUS_05400 7719 7030 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261584.1 protein_id gnl|my_center|LOCUS_05400 8354 7716 gene locus_tag LOCUS_05410 gene rsxG 8354 7716 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_05410 9333 8347 gene locus_tag LOCUS_05420 gene rsxD 9333 8347 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706452.1 protein_id gnl|my_center|LOCUS_05420 10900 9389 gene locus_tag LOCUS_05430 10900 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 11448 10897 gene locus_tag LOCUS_05440 gene rsxB 11448 10897 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103780.1 protein_id gnl|my_center|LOCUS_05440 12033 11452 gene locus_tag LOCUS_05450 gene rsxA 12033 11452 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 protein_id gnl|my_center|LOCUS_05450 14267 12258 gene locus_tag LOCUS_05460 gene metG 14267 12258 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097928.1 protein_id gnl|my_center|LOCUS_05460 >Feature sequence030 2799 1648 gene locus_tag LOCUS_05470 gene pilU 2799 1648 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_05470 3836 2796 gene locus_tag LOCUS_05480 gene pilT 3836 2796 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_05480 3877 4563 gene locus_tag LOCUS_05490 3877 4563 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_05490 4627 5454 gene locus_tag LOCUS_05500 gene proC 4627 5454 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_05500 5455 6036 gene locus_tag LOCUS_05510 5455 6036 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_05510 6188 7336 gene locus_tag LOCUS_05520 6188 7336 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266425.1 protein_id gnl|my_center|LOCUS_05520 7333 7935 gene locus_tag LOCUS_05530 gene metW 7333 7935 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_05530 9740 7956 gene locus_tag LOCUS_05540 9740 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 9949 11448 gene locus_tag LOCUS_05550 9949 11448 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768580.1 protein_id gnl|my_center|LOCUS_05550 11460 12167 gene locus_tag LOCUS_05560 11460 12167 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_05560 12154 12639 gene locus_tag LOCUS_05570 12154 12639 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786607.1 protein_id gnl|my_center|LOCUS_05570 12641 13126 gene locus_tag LOCUS_05580 12641 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 13298 13801 gene locus_tag LOCUS_05590 13298 13801 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_05590 13900 14265 gene locus_tag LOCUS_05600 13900 14265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence031 434 518 gene locus_tag LOCUS_t00040 434 518 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 678 1034 gene locus_tag LOCUS_05610 678 1034 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_05610 1025 1507 gene locus_tag LOCUS_05620 1025 1507 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_05620 1516 2142 gene locus_tag LOCUS_05630 1516 2142 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_05630 2135 3388 gene locus_tag LOCUS_05640 2135 3388 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930035.1 protein_id gnl|my_center|LOCUS_05640 3385 3882 gene locus_tag LOCUS_05650 gene nuoE 3385 3882 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_05650 3879 5165 gene locus_tag LOCUS_05660 gene nuoF 3879 5165 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_05660 5187 7559 gene locus_tag LOCUS_05670 gene nuoG 5187 7559 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948472.1 protein_id gnl|my_center|LOCUS_05670 7580 8617 gene locus_tag LOCUS_05680 gene nuoH 7580 8617 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_05680 8630 9118 gene locus_tag LOCUS_05690 gene nuoI 8630 9118 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_05690 9140 9769 gene locus_tag LOCUS_05700 9140 9769 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769059.1 protein_id gnl|my_center|LOCUS_05700 9766 10071 gene locus_tag LOCUS_05710 gene nuoK 9766 10071 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215628.1 protein_id gnl|my_center|LOCUS_05710 10087 12036 gene locus_tag LOCUS_05720 gene nuoL 10087 12036 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_05720 12066 13583 gene locus_tag LOCUS_05730 12066 13583 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence032 <1 1712 gene locus_tag LOCUS_05740 <1 1712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085035.1:RNA polymerase sigma factor RpoD 1787 1863 gene locus_tag LOCUS_t00050 1787 1863 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2628 1963 gene locus_tag LOCUS_05750 2628 1963 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705529.1 protein_id gnl|my_center|LOCUS_05750 3186 2707 gene locus_tag LOCUS_05760 gene smpB 3186 2707 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948526.1 protein_id gnl|my_center|LOCUS_05760 3598 4908 gene locus_tag LOCUS_05770 3598 4908 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_05770 4926 5363 gene locus_tag LOCUS_05780 4926 5363 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946119.1 protein_id gnl|my_center|LOCUS_05780 5350 5682 gene locus_tag LOCUS_05790 5350 5682 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918351.1 protein_id gnl|my_center|LOCUS_05790 5739 5815 gene locus_tag LOCUS_t00060 5739 5815 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6910 6086 gene locus_tag LOCUS_05800 6910 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 8735 7002 gene locus_tag LOCUS_05810 8735 7002 CDS product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176617.1 protein_id gnl|my_center|LOCUS_05810 13117 9659 gene locus_tag LOCUS_05820 13117 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence033 1429 59 gene locus_tag LOCUS_05830 gene tilS 1429 59 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_05830 2416 1442 gene locus_tag LOCUS_05840 gene accA 2416 1442 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_05840 2934 5045 gene locus_tag LOCUS_05850 2934 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 5246 5977 gene locus_tag LOCUS_05860 gene flgF 5246 5977 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073129.1 protein_id gnl|my_center|LOCUS_05860 5992 6777 gene locus_tag LOCUS_05870 gene flgG 5992 6777 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500810.1 protein_id gnl|my_center|LOCUS_05870 6787 7491 gene locus_tag LOCUS_05880 gene flgH 6787 7491 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082166.1 protein_id gnl|my_center|LOCUS_05880 7844 9391 gene locus_tag LOCUS_05890 7844 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 9399 11390 gene locus_tag LOCUS_05900 9399 11390 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_05900 12804 11338 gene locus_tag LOCUS_05910 12804 11338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence034 256 332 gene locus_tag LOCUS_t00070 256 332 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 365 441 gene locus_tag LOCUS_t00080 365 441 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 491 566 gene locus_tag LOCUS_t00090 491 566 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1352 834 gene locus_tag LOCUS_05920 1352 834 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262871.1 protein_id gnl|my_center|LOCUS_05920 1939 1385 gene locus_tag LOCUS_05930 1939 1385 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974667.1 protein_id gnl|my_center|LOCUS_05930 2727 3809 gene locus_tag LOCUS_05940 2727 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 3812 4612 gene locus_tag LOCUS_05950 3812 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 5476 4871 gene locus_tag LOCUS_05960 5476 4871 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_05960 6107 5574 gene locus_tag LOCUS_05970 gene ppa 6107 5574 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121243.1 protein_id gnl|my_center|LOCUS_05970 6223 6873 gene locus_tag LOCUS_05980 6223 6873 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_05980 7064 8047 gene locus_tag LOCUS_05990 gene amgK 7064 8047 CDS product N-acetylmuramate/N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113208.1 protein_id gnl|my_center|LOCUS_05990 8044 8700 gene locus_tag LOCUS_06000 8044 8700 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237801.1 protein_id gnl|my_center|LOCUS_06000 8697 9212 gene locus_tag LOCUS_06010 8697 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 9222 10679 gene locus_tag LOCUS_06020 9222 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 11720 10803 gene locus_tag LOCUS_06030 11720 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 11811 12401 gene locus_tag LOCUS_06040 11811 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence035 110 1756 gene locus_tag LOCUS_06050 110 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2919 3131 gene locus_tag LOCUS_06060 2919 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3668 5035 gene locus_tag LOCUS_06070 gene purB 3668 5035 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371741.1 protein_id gnl|my_center|LOCUS_06070 5032 5631 gene locus_tag LOCUS_06080 5032 5631 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 protein_id gnl|my_center|LOCUS_06080 8392 6005 gene locus_tag LOCUS_06090 8392 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 9576 8455 gene locus_tag LOCUS_06100 gene dctP 9576 8455 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_06100 12053 9891 gene locus_tag LOCUS_06110 gene uvrD 12053 9891 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096872.1 protein_id gnl|my_center|LOCUS_06110 12210 12644 gene locus_tag LOCUS_06120 12210 12644 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence036 1511 3076 gene locus_tag LOCUS_06130 gene cueO 1511 3076 CDS product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858205.1 protein_id gnl|my_center|LOCUS_06130 3214 3444 gene locus_tag LOCUS_06140 3214 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3827 4141 gene locus_tag LOCUS_06150 3827 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 4148 5977 gene locus_tag LOCUS_06160 4148 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 8191 5879 gene locus_tag LOCUS_06170 8191 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 9371 9180 gene locus_tag LOCUS_06180 9371 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 9358 11163 gene locus_tag LOCUS_06190 9358 11163 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941988.1 protein_id gnl|my_center|LOCUS_06190 12482 11367 gene locus_tag LOCUS_06200 12482 11367 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061514.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence037 724 179 gene locus_tag LOCUS_06210 gene nudE 724 179 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017765235.1 protein_id gnl|my_center|LOCUS_06210 954 1487 gene locus_tag LOCUS_06220 gene fliL 954 1487 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_06220 1502 2485 gene locus_tag LOCUS_06230 gene fliM 1502 2485 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083045.1 protein_id gnl|my_center|LOCUS_06230 2513 3106 gene locus_tag LOCUS_06240 2513 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3103 3543 gene locus_tag LOCUS_06250 3103 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3543 4319 gene locus_tag LOCUS_06260 gene fliP 3543 4319 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073102.1 protein_id gnl|my_center|LOCUS_06260 4309 4578 gene locus_tag LOCUS_06270 gene fliQ 4309 4578 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947514.1 protein_id gnl|my_center|LOCUS_06270 4586 5362 gene locus_tag LOCUS_06280 gene fliR 4586 5362 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_06280 5366 6484 gene locus_tag LOCUS_06290 gene flhB 5366 6484 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_06290 6504 8594 gene locus_tag LOCUS_06300 gene flhA 6504 8594 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_06300 8626 9975 gene locus_tag LOCUS_06310 gene flhF 8626 9975 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705286.1 protein_id gnl|my_center|LOCUS_06310 9962 10870 gene locus_tag LOCUS_06320 9962 10870 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634619.1 protein_id gnl|my_center|LOCUS_06320 10867 11589 gene locus_tag LOCUS_06330 gene fliA 10867 11589 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_06330 11626 12009 gene locus_tag LOCUS_06340 gene cheY 11626 12009 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634617.1 protein_id gnl|my_center|LOCUS_06340 12029 12775 gene locus_tag LOCUS_06350 12029 12775 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073094.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence038 847 230 gene locus_tag LOCUS_06360 gene wrbA 847 230 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 protein_id gnl|my_center|LOCUS_06360 2216 1104 gene locus_tag LOCUS_06370 gene dnaN 2216 1104 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097262.1 protein_id gnl|my_center|LOCUS_06370 3883 2543 gene locus_tag LOCUS_06380 gene dnaA 3883 2543 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769932.1 protein_id gnl|my_center|LOCUS_06380 4141 4275 gene locus_tag LOCUS_06390 gene rpmH 4141 4275 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014180.1 protein_id gnl|my_center|LOCUS_06390 4280 4642 gene locus_tag LOCUS_06400 gene rnpA 4280 4642 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707927.1 protein_id gnl|my_center|LOCUS_06400 4630 4854 gene locus_tag LOCUS_06410 gene yidD 4630 4854 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385278.1 protein_id gnl|my_center|LOCUS_06410 4855 6513 gene locus_tag LOCUS_06420 gene yidC 4855 6513 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105595.1 protein_id gnl|my_center|LOCUS_06420 6585 7871 gene locus_tag LOCUS_06430 gene mnmE 6585 7871 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981435.1 protein_id gnl|my_center|LOCUS_06430 7876 8793 gene locus_tag LOCUS_06440 7876 8793 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_06440 8797 9522 gene locus_tag LOCUS_06450 8797 9522 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257981.1 protein_id gnl|my_center|LOCUS_06450 9557 10525 gene locus_tag LOCUS_06460 9557 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 10562 10637 gene locus_tag LOCUS_t00100 10562 10637 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 10803 10931 gene locus_tag LOCUS_06470 10803 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 11060 11185 gene locus_tag LOCUS_06480 11060 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 11386 11640 gene locus_tag LOCUS_06490 11386 11640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 11687 11893 gene locus_tag LOCUS_06500 11687 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 11890 12270 gene locus_tag LOCUS_06510 11890 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence039 1127 336 gene locus_tag LOCUS_06520 1127 336 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_06520 2077 1124 gene locus_tag LOCUS_06530 gene lipA 2077 1124 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217175.1 protein_id gnl|my_center|LOCUS_06530 2871 2074 gene locus_tag LOCUS_06540 gene suhB 2871 2074 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_06540 3337 4080 gene locus_tag LOCUS_06550 gene trmJ 3337 4080 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_06550 4159 4929 gene locus_tag LOCUS_06560 gene cysE 4159 4929 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_06560 5063 5527 gene locus_tag LOCUS_06570 gene iscR 5063 5527 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552474.1 protein_id gnl|my_center|LOCUS_06570 5543 6760 gene locus_tag LOCUS_06580 5543 6760 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 protein_id gnl|my_center|LOCUS_06580 6782 7201 gene locus_tag LOCUS_06590 gene iscU 6782 7201 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331707.1 protein_id gnl|my_center|LOCUS_06590 7201 7524 gene locus_tag LOCUS_06600 gene iscA 7201 7524 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417916.1 protein_id gnl|my_center|LOCUS_06600 7521 8042 gene locus_tag LOCUS_06610 gene hscB 7521 8042 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072279.1 protein_id gnl|my_center|LOCUS_06610 8046 9935 gene locus_tag LOCUS_06620 gene hscA 8046 9935 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100622.1 protein_id gnl|my_center|LOCUS_06620 9947 10291 gene locus_tag LOCUS_06630 gene fdx 9947 10291 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_06630 10288 10497 gene locus_tag LOCUS_06640 gene iscX 10288 10497 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_06640 10634 10810 gene locus_tag LOCUS_06650 10634 10810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 11113 11988 gene locus_tag LOCUS_06660 11113 11988 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_06660 12174 12446 gene locus_tag LOCUS_06670 12174 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence040 364 291 gene locus_tag LOCUS_t00110 364 291 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1006 614 gene locus_tag LOCUS_06680 gene rpsI 1006 614 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631594.1 protein_id gnl|my_center|LOCUS_06680 1584 1156 gene locus_tag LOCUS_06690 gene rplM 1584 1156 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847599.1 protein_id gnl|my_center|LOCUS_06690 2352 1867 gene locus_tag LOCUS_06700 2352 1867 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266436.1 protein_id gnl|my_center|LOCUS_06700 7145 2349 gene locus_tag LOCUS_06710 7145 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 9184 7142 gene locus_tag LOCUS_06720 gene pilJ 9184 7142 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_06720 9749 9201 gene locus_tag LOCUS_06730 9749 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 10123 9746 gene locus_tag LOCUS_06740 gene pilH 10123 9746 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_06740 10615 10220 gene locus_tag LOCUS_06750 gene pilG 10615 10220 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_06750 10957 12246 gene locus_tag LOCUS_06760 gene gshA 10957 12246 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958508.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence041 1194 958 gene locus_tag LOCUS_06770 1194 958 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687723.1 protein_id gnl|my_center|LOCUS_06770 2577 1198 gene locus_tag LOCUS_06780 gene mucD 2577 1198 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_06780 3172 2681 gene locus_tag LOCUS_06790 3172 2681 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704746.1 protein_id gnl|my_center|LOCUS_06790 4193 3165 gene locus_tag LOCUS_06800 4193 3165 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_06800 4873 4190 gene locus_tag LOCUS_06810 4873 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 5469 4894 gene locus_tag LOCUS_06820 gene rpoE 5469 4894 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457274.1 protein_id gnl|my_center|LOCUS_06820 5585 7207 gene locus_tag LOCUS_06830 gene nadB 5585 7207 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_06830 7625 7176 gene locus_tag LOCUS_06840 7625 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 7836 7594 gene locus_tag LOCUS_06850 7836 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 8685 7975 gene locus_tag LOCUS_06860 gene pyrF 8685 7975 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687835.1 protein_id gnl|my_center|LOCUS_06860 9397 8705 gene locus_tag LOCUS_06870 gene mip 9397 8705 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_06870 10570 9503 gene locus_tag LOCUS_06880 gene aroG 10570 9503 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705850.1 protein_id gnl|my_center|LOCUS_06880 10881 10956 gene locus_tag LOCUS_t00120 10881 10956 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11046 11672 gene locus_tag LOCUS_06890 11046 11672 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_06890 11683 11758 gene locus_tag LOCUS_t00130 11683 11758 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence042 129 575 gene locus_tag LOCUS_06900 129 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 1900 1172 gene locus_tag LOCUS_06910 gene dnaQ 1900 1172 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_06910 2343 1909 gene locus_tag LOCUS_06920 gene rnhA 2343 1909 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_06920 3059 2340 gene locus_tag LOCUS_06930 3059 2340 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481108.1 protein_id gnl|my_center|LOCUS_06930 3201 3983 gene locus_tag LOCUS_06940 gene gloB 3201 3983 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262416.1 protein_id gnl|my_center|LOCUS_06940 4344 5222 gene locus_tag LOCUS_06950 4344 5222 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_06950 5347 5817 gene locus_tag LOCUS_06960 5347 5817 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 protein_id gnl|my_center|LOCUS_06960 7417 5897 gene locus_tag LOCUS_06970 gene lysS 7417 5897 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 protein_id gnl|my_center|LOCUS_06970 8337 7438 gene locus_tag LOCUS_06980 gene prfB 8337 7438 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06980 <12178 8594 gene locus_tag LOCUS_06990 <12178 8594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930621.1:hydantoinase B/oxoprolinase family protein >Feature sequence043 274 349 gene locus_tag LOCUS_t00140 274 349 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 404 754 gene locus_tag LOCUS_07000 gene secE 404 754 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707705.1 protein_id gnl|my_center|LOCUS_07000 759 1292 gene locus_tag LOCUS_07010 gene nusG 759 1292 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_07010 1452 1883 gene locus_tag LOCUS_07020 gene rplK 1452 1883 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946069.1 protein_id gnl|my_center|LOCUS_07020 1885 2580 gene locus_tag LOCUS_07030 gene rplA 1885 2580 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262793.1 protein_id gnl|my_center|LOCUS_07030 2812 3345 gene locus_tag LOCUS_07040 gene rplJ 2812 3345 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946071.1 protein_id gnl|my_center|LOCUS_07040 3418 3801 gene locus_tag LOCUS_07050 gene rplL 3418 3801 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_07050 3960 8033 gene locus_tag LOCUS_07060 gene rpoB 3960 8033 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence044 4197 688 gene locus_tag LOCUS_07070 gene smc 4197 688 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_07070 4386 4775 gene locus_tag LOCUS_07080 gene queF 4386 4775 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_07080 4772 6046 gene locus_tag LOCUS_07090 4772 6046 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969788.1 protein_id gnl|my_center|LOCUS_07090 8416 6353 gene locus_tag LOCUS_07100 8416 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 9311 8673 gene locus_tag LOCUS_07110 gene rnt 9311 8673 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_07110 10362 9304 gene locus_tag LOCUS_07120 gene pyrC 10362 9304 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_07120 11076 10402 gene locus_tag LOCUS_07130 gene radC 11076 10402 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_07130 11363 11288 gene locus_tag LOCUS_t00150 11363 11288 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11909 11418 gene locus_tag LOCUS_07140 11909 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence045 461 1099 gene locus_tag LOCUS_07150 461 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1116 2150 gene locus_tag LOCUS_07160 1116 2150 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074271.1 protein_id gnl|my_center|LOCUS_07160 2187 3263 gene locus_tag LOCUS_07170 2187 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3901 3239 gene locus_tag LOCUS_07180 3901 3239 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 protein_id gnl|my_center|LOCUS_07180 6011 3924 gene locus_tag LOCUS_07190 6011 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 7719 6331 gene locus_tag LOCUS_07200 7719 6331 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 protein_id gnl|my_center|LOCUS_07200 8685 7909 gene locus_tag LOCUS_07210 gene gloB 8685 7909 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262416.1 protein_id gnl|my_center|LOCUS_07210 8840 9631 gene locus_tag LOCUS_07220 8840 9631 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801254.1 protein_id gnl|my_center|LOCUS_07220 9628 10080 gene locus_tag LOCUS_07230 gene rnhA 9628 10080 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_07230 10083 10826 gene locus_tag LOCUS_07240 gene dnaQ 10083 10826 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267225.1 protein_id gnl|my_center|LOCUS_07240 11266 10892 gene locus_tag LOCUS_07250 11266 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence046 283 199 gene locus_tag LOCUS_t00160 283 199 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 361 1383 gene locus_tag LOCUS_07260 gene queA 361 1383 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705623.1 protein_id gnl|my_center|LOCUS_07260 1380 2495 gene locus_tag LOCUS_07270 gene tgt 1380 2495 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420264.1 protein_id gnl|my_center|LOCUS_07270 2531 2863 gene locus_tag LOCUS_07280 gene yajC 2531 2863 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_07280 2876 4741 gene locus_tag LOCUS_07290 gene secD 2876 4741 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_07290 4751 5698 gene locus_tag LOCUS_07300 gene secF 4751 5698 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 protein_id gnl|my_center|LOCUS_07300 6510 5749 gene locus_tag LOCUS_07310 6510 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 7612 6584 gene locus_tag LOCUS_07320 7612 6584 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_07320 8244 7741 gene locus_tag LOCUS_07330 8244 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 8571 9464 gene locus_tag LOCUS_07340 gene lpxC 8571 9464 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_07340 10024 11274 gene locus_tag LOCUS_07350 10024 11274 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence047 1515 484 gene locus_tag LOCUS_07360 1515 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 2192 1632 gene locus_tag LOCUS_07370 2192 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 4231 2852 gene locus_tag LOCUS_07380 gene amiB 4231 2852 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_07380 4608 4291 gene locus_tag LOCUS_07390 4608 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 5221 4619 gene locus_tag LOCUS_07400 5221 4619 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_07400 5692 5222 gene locus_tag LOCUS_07410 gene mlaD 5692 5222 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_07410 6477 5689 gene locus_tag LOCUS_07420 gene mlaE 6477 5689 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_07420 7289 6474 gene locus_tag LOCUS_07430 7289 6474 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_07430 7427 8173 gene locus_tag LOCUS_07440 7427 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 8177 9148 gene locus_tag LOCUS_07450 8177 9148 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_07450 9202 9408 gene locus_tag LOCUS_07460 9202 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 9408 10382 gene locus_tag LOCUS_07470 9408 10382 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_07470 10398 10922 gene locus_tag LOCUS_07480 10398 10922 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_07480 10947 11522 gene locus_tag LOCUS_07490 10947 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence048 3 191 gene locus_tag LOCUS_07500 3 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 206 961 gene locus_tag LOCUS_07510 gene ccmC 206 961 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036839.1 protein_id gnl|my_center|LOCUS_07510 954 1112 gene locus_tag LOCUS_07520 954 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1109 1564 gene locus_tag LOCUS_07530 gene ccmE 1109 1564 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_07530 1569 3551 gene locus_tag LOCUS_07540 1569 3551 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 protein_id gnl|my_center|LOCUS_07540 3556 4095 gene locus_tag LOCUS_07550 3556 4095 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_07550 4092 4592 gene locus_tag LOCUS_07560 4092 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 4589 5815 gene locus_tag LOCUS_07570 4589 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 6128 7129 gene locus_tag LOCUS_07580 6128 7129 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_07580 7315 8007 gene locus_tag LOCUS_07590 7315 8007 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_07590 8184 9989 gene locus_tag LOCUS_07600 8184 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 10053 11084 gene locus_tag LOCUS_07610 10053 11084 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence049 <1 833 gene locus_tag LOCUS_07620 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113794.1:valine--tRNA ligase 1106 2194 gene locus_tag LOCUS_07630 gene gmd 1106 2194 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_07630 2202 3161 gene locus_tag LOCUS_07640 2202 3161 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937401.1 protein_id gnl|my_center|LOCUS_07640 3210 4064 gene locus_tag LOCUS_07650 3210 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4683 4330 gene locus_tag LOCUS_07660 4683 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 8384 4782 gene locus_tag LOCUS_07670 8384 4782 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_07670 8905 8408 gene locus_tag LOCUS_07680 8905 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 10073 8958 gene locus_tag LOCUS_07690 10073 8958 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704649.1 protein_id gnl|my_center|LOCUS_07690 10513 10070 gene locus_tag LOCUS_07700 10513 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence050 455 778 gene locus_tag LOCUS_07710 455 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2597 765 gene locus_tag LOCUS_07720 gene glmS 2597 765 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114654.1 protein_id gnl|my_center|LOCUS_07720 3936 2611 gene locus_tag LOCUS_07730 gene glmU 3936 2611 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175168.1 protein_id gnl|my_center|LOCUS_07730 4232 4606 gene locus_tag LOCUS_07740 4232 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 5026 6042 gene locus_tag LOCUS_07750 gene trpD 5026 6042 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 protein_id gnl|my_center|LOCUS_07750 6042 6848 gene locus_tag LOCUS_07760 gene trpC 6042 6848 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_07760 8116 6905 gene locus_tag LOCUS_07770 8116 6905 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_07770 10450 8414 gene locus_tag LOCUS_07780 gene uvrB 10450 8414 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345654.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence051 3130 2513 gene locus_tag LOCUS_07790 gene can 3130 2513 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_07790 3723 3127 gene locus_tag LOCUS_07800 gene rnhB 3723 3127 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_07800 4273 3752 gene locus_tag LOCUS_07810 4273 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 5257 6942 gene locus_tag LOCUS_07820 5257 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 7097 8602 gene locus_tag LOCUS_07830 7097 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 9288 9530 gene locus_tag LOCUS_07840 9288 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 10017 10937 gene locus_tag LOCUS_07850 10017 10937 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943923.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence052 40 1056 gene locus_tag LOCUS_07860 40 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1687 2052 gene locus_tag LOCUS_07870 1687 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2615 3181 gene locus_tag LOCUS_07880 2615 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3348 4529 gene locus_tag LOCUS_07890 3348 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 4816 6558 gene locus_tag LOCUS_07900 4816 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 6564 7367 gene locus_tag LOCUS_07910 6564 7367 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_07910 7427 8353 gene locus_tag LOCUS_07920 7427 8353 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132696218.1 protein_id gnl|my_center|LOCUS_07920 8592 9368 gene locus_tag LOCUS_07930 8592 9368 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_07930 9393 10733 gene locus_tag LOCUS_07940 9393 10733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257973.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence053 201 3245 gene locus_tag LOCUS_07950 201 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 3313 3987 gene locus_tag LOCUS_07960 3313 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4009 4779 gene locus_tag LOCUS_07970 gene truA 4009 4779 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768766.1 protein_id gnl|my_center|LOCUS_07970 4789 5736 gene locus_tag LOCUS_07980 gene miaA 4789 5736 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095286.1 protein_id gnl|my_center|LOCUS_07980 5924 6181 gene locus_tag LOCUS_07990 gene hfq 5924 6181 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_07990 6193 7560 gene locus_tag LOCUS_08000 6193 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 7547 8728 gene locus_tag LOCUS_08010 gene hflK 7547 8728 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_08010 8728 9603 gene locus_tag LOCUS_08020 gene hflC 8728 9603 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_08020 9650 9838 gene locus_tag LOCUS_08030 9650 9838 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence054 <1 1294 gene locus_tag LOCUS_08040 <1 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958293.1:phosphoenolpyruvate--protein phosphotransferase 3061 1760 gene locus_tag LOCUS_08050 gene flgE 3061 1760 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_08050 4205 3528 gene locus_tag LOCUS_08060 gene flgD 4205 3528 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946950.1 protein_id gnl|my_center|LOCUS_08060 4641 4228 gene locus_tag LOCUS_08070 gene flgC 4641 4228 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 protein_id gnl|my_center|LOCUS_08070 5042 4644 gene locus_tag LOCUS_08080 gene flgB 5042 4644 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_08080 6058 5171 gene locus_tag LOCUS_08090 gene xerC 6058 5171 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_08090 6725 6045 gene locus_tag LOCUS_08100 6725 6045 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944790.1 protein_id gnl|my_center|LOCUS_08100 7615 6722 gene locus_tag LOCUS_08110 gene dapF 7615 6722 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704447.1 protein_id gnl|my_center|LOCUS_08110 9070 7622 gene locus_tag LOCUS_08120 9070 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 10343 9546 gene locus_tag LOCUS_08130 10343 9546 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence055 479 1435 gene locus_tag LOCUS_08140 gene rfaD 479 1435 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 protein_id gnl|my_center|LOCUS_08140 3960 1867 gene locus_tag LOCUS_08150 gene pnp 3960 1867 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071439.1 protein_id gnl|my_center|LOCUS_08150 4275 4006 gene locus_tag LOCUS_08160 gene rpsO 4275 4006 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369527.1 protein_id gnl|my_center|LOCUS_08160 7562 4755 gene locus_tag LOCUS_08170 gene ppc 7562 4755 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_08170 7949 9622 gene locus_tag LOCUS_08180 gene pgi 7949 9622 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916643.1 protein_id gnl|my_center|LOCUS_08180 10237 9722 gene locus_tag LOCUS_08190 10237 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140870.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence056 341 1348 gene locus_tag LOCUS_08200 341 1348 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093885.1 protein_id gnl|my_center|LOCUS_08200 1362 3323 gene locus_tag LOCUS_08210 1362 3323 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_08210 3350 3838 gene locus_tag LOCUS_08220 3350 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 4492 3917 gene locus_tag LOCUS_08230 4492 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 7622 4911 gene locus_tag LOCUS_08240 7622 4911 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975944.1 protein_id gnl|my_center|LOCUS_08240 8162 9634 gene locus_tag LOCUS_08250 8162 9634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 10208 10053 gene locus_tag LOCUS_08260 10208 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence057 1266 250 gene locus_tag LOCUS_08270 gene gpsA 1266 250 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_08270 1744 1289 gene locus_tag LOCUS_08280 gene secB 1744 1289 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704300.1 protein_id gnl|my_center|LOCUS_08280 2638 2213 gene locus_tag LOCUS_08290 2638 2213 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948012.1 protein_id gnl|my_center|LOCUS_08290 3555 3217 gene locus_tag LOCUS_08300 3555 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3867 5426 gene locus_tag LOCUS_08310 gene gpmM 3867 5426 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175917.1 protein_id gnl|my_center|LOCUS_08310 5464 6630 gene locus_tag LOCUS_08320 5464 6630 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_08320 6950 8266 gene locus_tag LOCUS_08330 gene cptA 6950 8266 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_08330 8276 8836 gene locus_tag LOCUS_08340 8276 8836 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_08340 9012 9383 gene locus_tag LOCUS_08350 9012 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 9402 10220 gene locus_tag LOCUS_08360 gene atpB 9402 10220 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence058 315 806 gene locus_tag LOCUS_08370 gene pyrR 315 806 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_08370 803 1783 gene locus_tag LOCUS_08380 803 1783 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_08380 1780 3057 gene locus_tag LOCUS_08390 1780 3057 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_08390 3707 3219 gene locus_tag LOCUS_08400 3707 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 4318 3785 gene locus_tag LOCUS_08410 4318 3785 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_08410 4587 6683 gene locus_tag LOCUS_08420 gene fimX 4587 6683 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_08420 7590 6703 gene locus_tag LOCUS_08430 gene htpX 7590 6703 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037436.1 protein_id gnl|my_center|LOCUS_08430 7942 9408 gene locus_tag LOCUS_08440 7942 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence059 1873 965 gene locus_tag LOCUS_08450 gene gluQRS 1873 965 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941983.1 protein_id gnl|my_center|LOCUS_08450 1980 2303 gene locus_tag LOCUS_08460 1980 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2417 2728 gene locus_tag LOCUS_08470 2417 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 3219 2737 gene locus_tag LOCUS_08480 gene dksA 3219 2737 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_08480 3305 4087 gene locus_tag LOCUS_08490 3305 4087 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_08490 4084 5253 gene locus_tag LOCUS_08500 4084 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 5971 5189 gene locus_tag LOCUS_08510 gene cysZ 5971 5189 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213487.1 protein_id gnl|my_center|LOCUS_08510 6249 5977 gene locus_tag LOCUS_08520 6249 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 9362 6594 gene locus_tag LOCUS_08530 9362 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 <10323 9359 gene locus_tag LOCUS_08540 <10323 9359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192539.1:NAD-dependent DNA ligase LigA >Feature sequence060 803 285 gene locus_tag LOCUS_08550 803 285 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_08550 2135 861 gene locus_tag LOCUS_08560 2135 861 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246215.1 protein_id gnl|my_center|LOCUS_08560 3628 2435 gene locus_tag LOCUS_08570 gene rnd 3628 2435 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969099.1 protein_id gnl|my_center|LOCUS_08570 3949 3671 gene locus_tag LOCUS_08580 3949 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 4271 5647 gene locus_tag LOCUS_08590 gene mpl 4271 5647 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093229.1 protein_id gnl|my_center|LOCUS_08590 5640 6272 gene locus_tag LOCUS_08600 5640 6272 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707290.1 protein_id gnl|my_center|LOCUS_08600 6262 6855 gene locus_tag LOCUS_08610 6262 6855 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038391.1 protein_id gnl|my_center|LOCUS_08610 8866 6788 gene locus_tag LOCUS_08620 8866 6788 CDS product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 protein_id gnl|my_center|LOCUS_08620 9823 8906 gene locus_tag LOCUS_08630 9823 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence061 1004 252 gene locus_tag LOCUS_08640 1004 252 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_08640 1862 1014 gene locus_tag LOCUS_08650 gene prmC 1862 1014 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036071.1 protein_id gnl|my_center|LOCUS_08650 2947 1859 gene locus_tag LOCUS_08660 gene prfA 2947 1859 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019960.1 protein_id gnl|my_center|LOCUS_08660 3219 2944 gene locus_tag LOCUS_08670 3219 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08670 4229 3297 gene locus_tag LOCUS_08680 4229 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08680 4747 6378 gene locus_tag LOCUS_08690 gene lbcA 4747 6378 CDS product proteolytic complex protein LbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352693.1 protein_id gnl|my_center|LOCUS_08690 6375 7019 gene locus_tag LOCUS_08700 gene lolB 6375 7019 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946293.1 protein_id gnl|my_center|LOCUS_08700 7016 7861 gene locus_tag LOCUS_08710 gene ispE 7016 7861 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_08710 7874 7948 gene locus_tag LOCUS_t00170 7874 7948 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7983 9050 gene locus_tag LOCUS_08720 7983 9050 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_08720 9179 9823 gene locus_tag LOCUS_08730 9179 9823 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence062 <1 1093 gene locus_tag LOCUS_08740 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926979.1:protein-disulfide reductase DsbD 1184 1657 gene locus_tag LOCUS_08750 gene aroQ 1184 1657 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_08750 1782 2285 gene locus_tag LOCUS_08760 gene accB 1782 2285 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 protein_id gnl|my_center|LOCUS_08760 2293 3633 gene locus_tag LOCUS_08770 gene accC 2293 3633 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884639.1 protein_id gnl|my_center|LOCUS_08770 3757 4635 gene locus_tag LOCUS_08780 gene prmA 3757 4635 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_08780 4635 5765 gene locus_tag LOCUS_08790 4635 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 6037 6657 gene locus_tag LOCUS_08800 6037 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 6661 7314 gene locus_tag LOCUS_08810 gene hisH 6661 7314 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687537.1 protein_id gnl|my_center|LOCUS_08810 7339 8085 gene locus_tag LOCUS_08820 gene hisA 7339 8085 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_08820 8082 8855 gene locus_tag LOCUS_08830 gene hisF 8082 8855 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_08830 8852 9253 gene locus_tag LOCUS_08840 gene hisI 8852 9253 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105339.1 protein_id gnl|my_center|LOCUS_08840 9246 9566 gene locus_tag LOCUS_08850 9246 9566 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_08850 9563 9898 gene locus_tag LOCUS_08860 9563 9898 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687490.1 protein_id gnl|my_center|LOCUS_08860 9992 10222 gene locus_tag LOCUS_08870 gene tatA 9992 10222 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508972.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence063 1335 1754 gene locus_tag LOCUS_08880 1335 1754 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703512.1 protein_id gnl|my_center|LOCUS_08880 2387 3184 gene locus_tag LOCUS_08890 2387 3184 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 protein_id gnl|my_center|LOCUS_08890 3190 3897 gene locus_tag LOCUS_08900 gene trmB 3190 3897 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_08900 3899 4177 gene locus_tag LOCUS_08910 3899 4177 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162995.1 protein_id gnl|my_center|LOCUS_08910 4375 5250 gene locus_tag LOCUS_08920 4375 5250 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_08920 5352 6542 gene locus_tag LOCUS_08930 gene lhgO 5352 6542 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920977.1 protein_id gnl|my_center|LOCUS_08930 6539 7645 gene locus_tag LOCUS_08940 gene rfbG 6539 7645 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_08940 8250 7597 gene locus_tag LOCUS_08950 gene rsmG 8250 7597 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099403.1 protein_id gnl|my_center|LOCUS_08950 10132 8243 gene locus_tag LOCUS_08960 gene mnmG 10132 8243 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence064 91 786 gene locus_tag LOCUS_08970 gene aat 91 786 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767399.1 protein_id gnl|my_center|LOCUS_08970 2177 780 gene locus_tag LOCUS_08980 2177 780 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037593.1 protein_id gnl|my_center|LOCUS_08980 4948 2210 gene locus_tag LOCUS_08990 gene acnA 4948 2210 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037030.1 protein_id gnl|my_center|LOCUS_08990 5586 4969 gene locus_tag LOCUS_09000 gene hflD 5586 4969 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262317.1 protein_id gnl|my_center|LOCUS_09000 6731 5583 gene locus_tag LOCUS_09010 gene mnmA 6731 5583 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 protein_id gnl|my_center|LOCUS_09010 6904 7143 gene locus_tag LOCUS_09020 6904 7143 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_09020 7184 7624 gene locus_tag LOCUS_09030 7184 7624 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 protein_id gnl|my_center|LOCUS_09030 7691 8950 gene locus_tag LOCUS_09040 7691 8950 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_09040 8947 9588 gene locus_tag LOCUS_09050 gene nadD 8947 9588 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_09050 9585 9935 gene locus_tag LOCUS_09060 gene rsfS 9585 9935 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence065 304 831 gene locus_tag LOCUS_09070 304 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1148 1072 gene locus_tag LOCUS_t00180 1148 1072 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2384 1194 gene locus_tag LOCUS_09080 2384 1194 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_09080 2929 3243 gene locus_tag LOCUS_09090 2929 3243 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_09090 3254 3967 gene locus_tag LOCUS_09100 3254 3967 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035515.1 protein_id gnl|my_center|LOCUS_09100 5035 5628 gene locus_tag LOCUS_09110 gene petA 5035 5628 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_09110 5629 6858 gene locus_tag LOCUS_09120 5629 6858 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_09120 6855 7586 gene locus_tag LOCUS_09130 6855 7586 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707595.1 protein_id gnl|my_center|LOCUS_09130 7715 8344 gene locus_tag LOCUS_09140 gene sspA 7715 8344 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 protein_id gnl|my_center|LOCUS_09140 8374 8754 gene locus_tag LOCUS_09150 8374 8754 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958412.1 protein_id gnl|my_center|LOCUS_09150 <10003 9156 gene locus_tag LOCUS_09160 <10003 9156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035947.1:FAD-linked oxidase C-terminal domain-containing protein >Feature sequence066 844 296 gene locus_tag LOCUS_09170 844 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2187 841 gene locus_tag LOCUS_09180 2187 841 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880881.1 protein_id gnl|my_center|LOCUS_09180 3292 2132 gene locus_tag LOCUS_09190 3292 2132 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_09190 3705 4043 gene locus_tag LOCUS_09200 gene glnK 3705 4043 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_09200 4075 5346 gene locus_tag LOCUS_09210 4075 5346 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_09210 5392 6036 gene locus_tag LOCUS_09220 5392 6036 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103113.1 protein_id gnl|my_center|LOCUS_09220 6179 7279 gene locus_tag LOCUS_09230 gene ntrB 6179 7279 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_09230 7276 8673 gene locus_tag LOCUS_09240 gene ntrC 7276 8673 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_09240 8794 9132 gene locus_tag LOCUS_09250 8794 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 9382 9612 gene locus_tag LOCUS_09260 9382 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence067 1171 287 gene locus_tag LOCUS_09270 1171 287 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_09270 4388 1191 gene locus_tag LOCUS_09280 4388 1191 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 protein_id gnl|my_center|LOCUS_09280 5723 4407 gene locus_tag LOCUS_09290 5723 4407 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 protein_id gnl|my_center|LOCUS_09290 7165 5960 gene locus_tag LOCUS_09300 7165 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 7650 7327 gene locus_tag LOCUS_09310 7650 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 8145 8582 gene locus_tag LOCUS_09320 8145 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence068 3177 2452 gene locus_tag LOCUS_09330 3177 2452 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_09330 4139 3234 gene locus_tag LOCUS_09340 gene xerD 4139 3234 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_09340 4659 4126 gene locus_tag LOCUS_09350 4659 4126 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957577.1 protein_id gnl|my_center|LOCUS_09350 5407 4733 gene locus_tag LOCUS_09360 5407 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 6181 5432 gene locus_tag LOCUS_09370 gene trmD 6181 5432 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502493.1 protein_id gnl|my_center|LOCUS_09370 6702 6190 gene locus_tag LOCUS_09380 gene rimM 6702 6190 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098350.1 protein_id gnl|my_center|LOCUS_09380 6993 6733 gene locus_tag LOCUS_09390 gene rpsP 6993 6733 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071566.1 protein_id gnl|my_center|LOCUS_09390 8449 7091 gene locus_tag LOCUS_09400 gene ffh 8449 7091 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 protein_id gnl|my_center|LOCUS_09400 9246 8482 gene locus_tag LOCUS_09410 9246 8482 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence069 779 492 gene locus_tag LOCUS_09420 779 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1224 790 gene locus_tag LOCUS_09430 1224 790 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_09430 2459 1431 gene locus_tag LOCUS_09440 2459 1431 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869954.1 protein_id gnl|my_center|LOCUS_09440 3381 2440 gene locus_tag LOCUS_09450 3381 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3984 5261 gene locus_tag LOCUS_09460 gene purD 3984 5261 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_09460 5279 5674 gene locus_tag LOCUS_09470 5279 5674 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377907.1 protein_id gnl|my_center|LOCUS_09470 6640 8343 gene locus_tag LOCUS_09480 6640 8343 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942718.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence070 920 435 gene locus_tag LOCUS_09490 920 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1610 951 gene locus_tag LOCUS_09500 1610 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2131 1607 gene locus_tag LOCUS_09510 2131 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 3842 2802 gene locus_tag LOCUS_09520 3842 2802 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_09520 5387 4119 gene locus_tag LOCUS_09530 gene waaA 5387 4119 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 protein_id gnl|my_center|LOCUS_09530 5664 5461 gene locus_tag LOCUS_09540 5664 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 5948 5664 gene locus_tag LOCUS_09550 5948 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 7195 6095 gene locus_tag LOCUS_09560 gene fbp 7195 6095 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228346.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence071 431 1447 gene locus_tag LOCUS_09570 431 1447 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175805.1 protein_id gnl|my_center|LOCUS_09570 2921 1485 gene locus_tag LOCUS_09580 2921 1485 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_09580 3263 3673 gene locus_tag LOCUS_09590 3263 3673 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_09590 4566 5225 gene locus_tag LOCUS_09600 gene ispD 4566 5225 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036879.1 protein_id gnl|my_center|LOCUS_09600 5216 5695 gene locus_tag LOCUS_09610 gene ispF 5216 5695 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266985.1 protein_id gnl|my_center|LOCUS_09610 5685 6728 gene locus_tag LOCUS_09620 gene truD 5685 6728 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 protein_id gnl|my_center|LOCUS_09620 6762 7340 gene locus_tag LOCUS_09630 6762 7340 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence072 583 1308 gene locus_tag LOCUS_09640 583 1308 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193573.1 protein_id gnl|my_center|LOCUS_09640 1860 1423 gene locus_tag LOCUS_09650 1860 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3770 1893 gene locus_tag LOCUS_09660 gene thiC 3770 1893 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_09660 3897 4559 gene locus_tag LOCUS_09670 3897 4559 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_09670 4641 5141 gene locus_tag LOCUS_09680 4641 5141 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_09680 5242 6051 gene locus_tag LOCUS_09690 5242 6051 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_09690 6067 7359 gene locus_tag LOCUS_09700 6067 7359 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_09700 7526 8512 gene locus_tag LOCUS_09710 gene dusB 7526 8512 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 protein_id gnl|my_center|LOCUS_09710 8509 8769 gene locus_tag LOCUS_09720 gene fis 8509 8769 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421285.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence073 144 341 gene locus_tag LOCUS_09730 gene rpmC 144 341 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555481.1 protein_id gnl|my_center|LOCUS_09730 338 601 gene locus_tag LOCUS_09740 gene rpsQ 338 601 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070622.1 protein_id gnl|my_center|LOCUS_09740 1110 1478 gene locus_tag LOCUS_09750 gene rplN 1110 1478 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_09750 1493 1810 gene locus_tag LOCUS_09760 gene rplX 1493 1810 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555478.1 protein_id gnl|my_center|LOCUS_09760 1823 2362 gene locus_tag LOCUS_09770 gene rplE 1823 2362 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 protein_id gnl|my_center|LOCUS_09770 2373 2678 gene locus_tag LOCUS_09780 gene rpsN 2373 2678 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049689.1 protein_id gnl|my_center|LOCUS_09780 2699 3094 gene locus_tag LOCUS_09790 gene rpsH 2699 3094 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644434.1 protein_id gnl|my_center|LOCUS_09790 3104 3274 gene locus_tag LOCUS_09800 3104 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09800 3287 3637 gene locus_tag LOCUS_09810 3287 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09810 3653 4006 gene locus_tag LOCUS_09820 gene rplR 3653 4006 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099023.1 protein_id gnl|my_center|LOCUS_09820 4017 4523 gene locus_tag LOCUS_09830 gene rpsE 4017 4523 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703641.1 protein_id gnl|my_center|LOCUS_09830 4528 4719 gene locus_tag LOCUS_09840 gene rpmD 4528 4719 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 protein_id gnl|my_center|LOCUS_09840 4721 5155 gene locus_tag LOCUS_09850 gene rplO 4721 5155 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070628.1 protein_id gnl|my_center|LOCUS_09850 5173 6528 gene locus_tag LOCUS_09860 gene secY 5173 6528 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070629.1 protein_id gnl|my_center|LOCUS_09860 6759 7115 gene locus_tag LOCUS_09870 gene rpsM 6759 7115 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648406.1 protein_id gnl|my_center|LOCUS_09870 7125 7520 gene locus_tag LOCUS_09880 gene rpsK 7125 7520 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005319702.1 protein_id gnl|my_center|LOCUS_09880 7536 8162 gene locus_tag LOCUS_09890 gene rpsD 7536 8162 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 protein_id gnl|my_center|LOCUS_09890 8223 9230 gene locus_tag LOCUS_09900 gene rpoA 8223 9230 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence074 2221 842 gene locus_tag LOCUS_09910 gene gcvPA 2221 842 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945877.1 protein_id gnl|my_center|LOCUS_09910 2616 2224 gene locus_tag LOCUS_09920 gene gcvH 2616 2224 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_09920 3715 2630 gene locus_tag LOCUS_09930 gene gcvT 3715 2630 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068693.1 protein_id gnl|my_center|LOCUS_09930 4623 3712 gene locus_tag LOCUS_09940 gene lipA 4623 3712 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172396.1 protein_id gnl|my_center|LOCUS_09940 6109 4940 gene locus_tag LOCUS_09950 gene ftsZ 6109 4940 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948309.1 protein_id gnl|my_center|LOCUS_09950 7385 6147 gene locus_tag LOCUS_09960 gene ftsA 7385 6147 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_09960 8187 7378 gene locus_tag LOCUS_09970 8187 7378 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094118.1 protein_id gnl|my_center|LOCUS_09970 9121 8171 gene locus_tag LOCUS_09980 9121 8171 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence075 5652 3475 gene locus_tag LOCUS_09990 5652 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 6831 5689 gene locus_tag LOCUS_10000 6831 5689 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521919.1 protein_id gnl|my_center|LOCUS_10000 7928 6831 gene locus_tag LOCUS_10010 gene aroB 7928 6831 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_10010 8510 7989 gene locus_tag LOCUS_10020 8510 7989 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806947.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence076 1239 115 gene locus_tag LOCUS_10030 1239 115 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 protein_id gnl|my_center|LOCUS_10030 1730 1236 gene locus_tag LOCUS_10040 gene purE 1730 1236 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188932.1 protein_id gnl|my_center|LOCUS_10040 1879 1963 gene locus_tag LOCUS_t00190 1879 1963 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1996 3300 gene locus_tag LOCUS_10050 gene tig 1996 3300 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198388.1 protein_id gnl|my_center|LOCUS_10050 3513 4109 gene locus_tag LOCUS_10060 gene clpP 3513 4109 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_10060 4396 5667 gene locus_tag LOCUS_10070 gene clpX 4396 5667 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552735.1 protein_id gnl|my_center|LOCUS_10070 5793 8231 gene locus_tag LOCUS_10080 gene lon 5793 8231 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_10080 8643 8915 gene locus_tag LOCUS_10090 gene hupB 8643 8915 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_10090 8932 9007 gene locus_tag LOCUS_t00200 8932 9007 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence077 1489 248 gene locus_tag LOCUS_10100 1489 248 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_10100 2974 1916 gene locus_tag LOCUS_10110 2974 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4125 3127 gene locus_tag LOCUS_10120 4125 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5289 4180 gene locus_tag LOCUS_10130 5289 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5901 5728 gene locus_tag LOCUS_10140 5901 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5918 6964 gene locus_tag LOCUS_10150 5918 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10150 6977 7771 gene locus_tag LOCUS_10160 6977 7771 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811924.1 protein_id gnl|my_center|LOCUS_10160 7789 8730 gene locus_tag LOCUS_10170 7789 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence078 1471 293 gene locus_tag LOCUS_10180 1471 293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_10180 1990 2796 gene locus_tag LOCUS_10190 1990 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2793 3764 gene locus_tag LOCUS_10200 2793 3764 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038232.1 protein_id gnl|my_center|LOCUS_10200 4023 5513 gene locus_tag LOCUS_10210 gene sbcB 4023 5513 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123272.1 protein_id gnl|my_center|LOCUS_10210 6021 5500 gene locus_tag LOCUS_10220 6021 5500 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_10220 6787 6035 gene locus_tag LOCUS_10230 6787 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 6867 7853 gene locus_tag LOCUS_10240 gene rluD 6867 7853 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166515.1 protein_id gnl|my_center|LOCUS_10240 7843 8574 gene locus_tag LOCUS_10250 gene pgeF 7843 8574 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112833.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence079 <1 884 gene locus_tag LOCUS_10260 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120323.1:carbohydrate kinase 877 3030 gene locus_tag LOCUS_10270 877 3030 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_10270 3090 5489 gene locus_tag LOCUS_10280 3090 5489 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143596.1 protein_id gnl|my_center|LOCUS_10280 7394 5799 gene locus_tag LOCUS_10290 7394 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 8145 7462 gene locus_tag LOCUS_10300 8145 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence080 1496 105 gene locus_tag LOCUS_10310 1496 105 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941477.1 protein_id gnl|my_center|LOCUS_10310 3724 1493 gene locus_tag LOCUS_10320 3724 1493 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_10320 4320 3706 gene locus_tag LOCUS_10330 4320 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 5692 4391 gene locus_tag LOCUS_10340 gene rsmB 5692 4391 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_10340 6639 5689 gene locus_tag LOCUS_10350 gene fmt 6639 5689 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_10350 7371 6661 gene locus_tag LOCUS_10360 7371 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 7264 8313 gene locus_tag LOCUS_10370 7264 8313 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence081 1165 35 gene locus_tag LOCUS_10380 1165 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1590 1180 gene locus_tag LOCUS_10390 1590 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2203 1886 gene locus_tag LOCUS_10400 2203 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2566 2213 gene locus_tag LOCUS_10410 gene fliS 2566 2213 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_10410 4133 2718 gene locus_tag LOCUS_10420 gene fliD 4133 2718 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146832.1 protein_id gnl|my_center|LOCUS_10420 4548 4180 gene locus_tag LOCUS_10430 4548 4180 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943643.1 protein_id gnl|my_center|LOCUS_10430 5747 4908 gene locus_tag LOCUS_10440 5747 4908 CDS product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767010.1 protein_id gnl|my_center|LOCUS_10440 5996 8503 gene locus_tag LOCUS_10450 5996 8503 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073156.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence082 2027 753 gene locus_tag LOCUS_10460 2027 753 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_10460 4405 2450 gene locus_tag LOCUS_10470 4405 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887353.1 protein_id gnl|my_center|LOCUS_10470 4606 5742 gene locus_tag LOCUS_10480 4606 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 6646 5771 gene locus_tag LOCUS_10490 6646 5771 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_10490 6744 7172 gene locus_tag LOCUS_10500 6744 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence083 2008 287 gene locus_tag LOCUS_10510 2008 287 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042597405.1 protein_id gnl|my_center|LOCUS_10510 2277 2005 gene locus_tag LOCUS_10520 gene ftsL 2277 2005 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035956.1 protein_id gnl|my_center|LOCUS_10520 3212 2274 gene locus_tag LOCUS_10530 gene rsmH 3212 2274 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 protein_id gnl|my_center|LOCUS_10530 3765 3280 gene locus_tag LOCUS_10540 gene mraZ 3765 3280 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095567.1 protein_id gnl|my_center|LOCUS_10540 5666 4800 gene locus_tag LOCUS_10550 gene rsmI 5666 4800 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016568902.1 protein_id gnl|my_center|LOCUS_10550 5873 7633 gene locus_tag LOCUS_10560 5873 7633 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_10560 7630 7989 gene locus_tag LOCUS_10570 7630 7989 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110149.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence084 606 1316 gene locus_tag LOCUS_10580 606 1316 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 protein_id gnl|my_center|LOCUS_10580 1566 1492 gene locus_tag LOCUS_t00210 1566 1492 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1665 3095 gene locus_tag LOCUS_10590 gene gltX 1665 3095 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026051153.1 protein_id gnl|my_center|LOCUS_10590 3512 4669 gene locus_tag LOCUS_10600 3512 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 4684 5814 gene locus_tag LOCUS_10610 4684 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 6198 6581 gene locus_tag LOCUS_10620 6198 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6822 8162 gene locus_tag LOCUS_10630 6822 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence085 514 1035 gene locus_tag LOCUS_10640 514 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1523 1143 gene locus_tag LOCUS_10650 1523 1143 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_10650 1621 2031 gene locus_tag LOCUS_10660 1621 2031 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174926.1 protein_id gnl|my_center|LOCUS_10660 2031 2945 gene locus_tag LOCUS_10670 2031 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3833 2976 gene locus_tag LOCUS_10680 3833 2976 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_10680 4733 3855 gene locus_tag LOCUS_10690 gene ftsX 4733 3855 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_10690 5488 4817 gene locus_tag LOCUS_10700 gene ftsE 5488 4817 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074183.1 protein_id gnl|my_center|LOCUS_10700 6493 5522 gene locus_tag LOCUS_10710 6493 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 6589 7965 gene locus_tag LOCUS_10720 6589 7965 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence086 2731 824 gene locus_tag LOCUS_10730 2731 824 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975868.1 protein_id gnl|my_center|LOCUS_10730 3567 2728 gene locus_tag LOCUS_10740 3567 2728 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209695.1 protein_id gnl|my_center|LOCUS_10740 3837 3592 gene locus_tag LOCUS_10750 3837 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3931 4230 gene locus_tag LOCUS_10760 3931 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 4874 4233 gene locus_tag LOCUS_10770 4874 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 6565 4871 gene locus_tag LOCUS_10780 6565 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 7651 6971 gene locus_tag LOCUS_10790 7651 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 8043 7648 gene locus_tag LOCUS_10800 8043 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence087 1178 57 gene locus_tag LOCUS_10810 gene amrS 1178 57 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_10810 1286 2095 gene locus_tag LOCUS_10820 gene amrB 1286 2095 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_10820 2073 2660 gene locus_tag LOCUS_10830 2073 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5106 3007 gene locus_tag LOCUS_10840 gene recG 5106 3007 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_10840 5502 5119 gene locus_tag LOCUS_10850 5502 5119 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_10850 7764 5518 gene locus_tag LOCUS_10860 gene spoT 7764 5518 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_10860 7954 7688 gene locus_tag LOCUS_10870 gene rpoZ 7954 7688 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096602.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence088 956 522 gene locus_tag LOCUS_10880 956 522 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082662.1 protein_id gnl|my_center|LOCUS_10880 955 1857 gene locus_tag LOCUS_10890 955 1857 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_10890 2243 1953 gene locus_tag LOCUS_10900 2243 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2584 4188 gene locus_tag LOCUS_10910 2584 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4294 8055 gene locus_tag LOCUS_10920 4294 8055 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193149.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence089 424 14 gene locus_tag LOCUS_10930 424 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1077 421 gene locus_tag LOCUS_10940 1077 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1364 2254 gene locus_tag LOCUS_10950 gene cysM 1364 2254 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554618.1 protein_id gnl|my_center|LOCUS_10950 2266 3594 gene locus_tag LOCUS_10960 gene rlmD 2266 3594 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 protein_id gnl|my_center|LOCUS_10960 3738 4445 gene locus_tag LOCUS_10970 3738 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 4467 4952 gene locus_tag LOCUS_10980 4467 4952 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_10980 4933 5430 gene locus_tag LOCUS_10990 4933 5430 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_10990 5439 6482 gene locus_tag LOCUS_11000 gene nagZ 5439 6482 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208334.1 protein_id gnl|my_center|LOCUS_11000 6487 7614 gene locus_tag LOCUS_11010 6487 7614 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence090 227 739 gene locus_tag LOCUS_11020 227 739 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244797.1 protein_id gnl|my_center|LOCUS_11020 944 1019 gene locus_tag LOCUS_t00220 944 1019 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1068 1143 gene locus_tag LOCUS_t00230 1068 1143 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2189 1425 gene locus_tag LOCUS_11030 2189 1425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090884.1 protein_id gnl|my_center|LOCUS_11030 3109 2186 gene locus_tag LOCUS_11040 3109 2186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267141.1 protein_id gnl|my_center|LOCUS_11040 4326 3106 gene locus_tag LOCUS_11050 4326 3106 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212197.1 protein_id gnl|my_center|LOCUS_11050 4963 6327 gene locus_tag LOCUS_11060 4963 6327 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_11060 6539 7096 gene locus_tag LOCUS_11070 gene hslV 6539 7096 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence091 2147 375 gene locus_tag LOCUS_11080 2147 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2839 2603 gene locus_tag LOCUS_11090 2839 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2924 3733 gene locus_tag LOCUS_11100 gene lgt 2924 3733 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_11100 3734 4528 gene locus_tag LOCUS_11110 3734 4528 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_11110 4528 5022 gene locus_tag LOCUS_11120 gene folA 4528 5022 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_11120 5016 5342 gene locus_tag LOCUS_11130 5016 5342 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 protein_id gnl|my_center|LOCUS_11130 5335 5808 gene locus_tag LOCUS_11140 5335 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 5798 6631 gene locus_tag LOCUS_11150 5798 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 7567 6764 gene locus_tag LOCUS_11160 gene tatC 7567 6764 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260928.1 protein_id gnl|my_center|LOCUS_11160 7938 7564 gene locus_tag LOCUS_11170 gene tatB 7938 7564 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931646.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence092 327 1484 gene locus_tag LOCUS_11180 327 1484 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143005.1 protein_id gnl|my_center|LOCUS_11180 1646 1822 gene locus_tag LOCUS_11190 1646 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1934 2599 gene locus_tag LOCUS_11200 1934 2599 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_11200 2618 3835 gene locus_tag LOCUS_11210 2618 3835 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356903.1 protein_id gnl|my_center|LOCUS_11210 3837 4655 gene locus_tag LOCUS_11220 3837 4655 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404131.1 protein_id gnl|my_center|LOCUS_11220 4648 5340 gene locus_tag LOCUS_11230 4648 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 6446 5652 gene locus_tag LOCUS_11240 6446 5652 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_11240 6924 6526 gene locus_tag LOCUS_11250 6924 6526 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_11250 6994 7458 gene locus_tag LOCUS_11260 6994 7458 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545179.1 protein_id gnl|my_center|LOCUS_11260 <8047 7541 gene locus_tag LOCUS_11270 <8047 7541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266523.1:zinc-dependent peptidase >Feature sequence093 1535 573 gene locus_tag LOCUS_11280 1535 573 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152113.1 protein_id gnl|my_center|LOCUS_11280 1845 1525 gene locus_tag LOCUS_11290 1845 1525 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947973.1 protein_id gnl|my_center|LOCUS_11290 2792 1848 gene locus_tag LOCUS_11300 2792 1848 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_11300 3352 4236 gene locus_tag LOCUS_11310 3352 4236 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382947.1 protein_id gnl|my_center|LOCUS_11310 4247 5926 gene locus_tag LOCUS_11320 gene recN 4247 5926 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113905.1 protein_id gnl|my_center|LOCUS_11320 6541 6026 gene locus_tag LOCUS_11330 6541 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6652 7587 gene locus_tag LOCUS_11340 6652 7587 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence094 <1 2250 gene locus_tag LOCUS_11350 <1 2250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037738.1:YhdP family protein 2292 3104 gene locus_tag LOCUS_11360 2292 3104 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_11360 3101 4558 gene locus_tag LOCUS_11370 gene tldD 3101 4558 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_11370 4780 6147 gene locus_tag LOCUS_11380 gene pmbA 4780 6147 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_11380 6203 7759 gene locus_tag LOCUS_11390 6203 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence095 200 1318 gene locus_tag LOCUS_11400 200 1318 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_11400 1318 2178 gene locus_tag LOCUS_11410 1318 2178 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_11410 2200 2454 gene locus_tag LOCUS_11420 2200 2454 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100311.1 protein_id gnl|my_center|LOCUS_11420 2451 3170 gene locus_tag LOCUS_11430 2451 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3189 4226 gene locus_tag LOCUS_11440 3189 4226 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203434.1 protein_id gnl|my_center|LOCUS_11440 4223 4786 gene locus_tag LOCUS_11450 4223 4786 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 protein_id gnl|my_center|LOCUS_11450 6810 5011 gene locus_tag LOCUS_11460 gene aspS 6810 5011 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123218.1 protein_id gnl|my_center|LOCUS_11460 7449 7174 gene locus_tag LOCUS_11470 7449 7174 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550867.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence096 198 713 gene locus_tag LOCUS_11480 198 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 710 1570 gene locus_tag LOCUS_11490 gene rapZ 710 1570 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268862.1 protein_id gnl|my_center|LOCUS_11490 1567 1968 gene locus_tag LOCUS_11500 1567 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_11500 1965 2234 gene locus_tag LOCUS_11510 1965 2234 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_11510 2789 2289 gene locus_tag LOCUS_11520 2789 2289 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_11520 4900 2786 gene locus_tag LOCUS_11530 4900 2786 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_11530 5370 4897 gene locus_tag LOCUS_11540 5370 4897 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940875.1 protein_id gnl|my_center|LOCUS_11540 7038 5749 gene locus_tag LOCUS_11550 gene phoR 7038 5749 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_11550 7744 7076 gene locus_tag LOCUS_11560 gene phoB 7744 7076 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence097 14 688 gene locus_tag LOCUS_11570 14 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1060 1839 gene locus_tag LOCUS_11580 1060 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1972 2817 gene locus_tag LOCUS_11590 1972 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 3397 4308 gene locus_tag LOCUS_11600 3397 4308 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494483.1 protein_id gnl|my_center|LOCUS_11600 4379 5428 gene locus_tag LOCUS_11610 gene hrcA 4379 5428 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_11610 5473 6051 gene locus_tag LOCUS_11620 gene grpE 5473 6051 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444334.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence098 709 221 gene locus_tag LOCUS_11630 gene folK 709 221 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_11630 1067 711 gene locus_tag LOCUS_11640 gene folB 1067 711 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_11640 1142 1735 gene locus_tag LOCUS_11650 gene plsY 1142 1735 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225265.1 protein_id gnl|my_center|LOCUS_11650 2619 1786 gene locus_tag LOCUS_11660 2619 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2621 2869 gene locus_tag LOCUS_11670 2621 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 3154 4317 gene locus_tag LOCUS_11680 3154 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 4314 4796 gene locus_tag LOCUS_11690 4314 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4923 5213 gene locus_tag LOCUS_11700 4923 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 5461 6606 gene locus_tag LOCUS_11710 5461 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence099 633 1265 gene locus_tag LOCUS_11720 633 1265 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_11720 1265 1687 gene locus_tag LOCUS_11730 1265 1687 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_11730 1735 3507 gene locus_tag LOCUS_11740 gene msbA 1735 3507 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097303.1 protein_id gnl|my_center|LOCUS_11740 3504 4490 gene locus_tag LOCUS_11750 gene lpxK 3504 4490 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211319.1 protein_id gnl|my_center|LOCUS_11750 4483 4665 gene locus_tag LOCUS_11760 4483 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4665 5441 gene locus_tag LOCUS_11770 gene kdsB 4665 5441 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957604.1 protein_id gnl|my_center|LOCUS_11770 5734 5483 gene locus_tag LOCUS_11780 5734 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence100 206 1813 gene locus_tag LOCUS_11790 206 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1845 3281 gene locus_tag LOCUS_11800 1845 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4404 3514 gene locus_tag LOCUS_11810 4404 3514 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072167.1 protein_id gnl|my_center|LOCUS_11810 5617 4397 gene locus_tag LOCUS_11820 5617 4397 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_11820 5863 5633 gene locus_tag LOCUS_11830 5863 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 6354 5860 gene locus_tag LOCUS_11840 6354 5860 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_11840 6899 7345 gene locus_tag LOCUS_11850 gene dtd 6899 7345 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence101 466 1590 gene locus_tag LOCUS_11860 466 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1587 3029 gene locus_tag LOCUS_11870 1587 3029 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387943.1 protein_id gnl|my_center|LOCUS_11870 3026 4876 gene locus_tag LOCUS_11880 3026 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 4876 5436 gene locus_tag LOCUS_11890 4876 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5433 7274 gene locus_tag LOCUS_11900 5433 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence102 21 1520 gene locus_tag LOCUS_11910 gene nusA 21 1520 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037645.1 protein_id gnl|my_center|LOCUS_11910 1534 4008 gene locus_tag LOCUS_11920 gene infB 1534 4008 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268881.1 protein_id gnl|my_center|LOCUS_11920 4005 4382 gene locus_tag LOCUS_11930 gene rbfA 4005 4382 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095188.1 protein_id gnl|my_center|LOCUS_11930 4379 5335 gene locus_tag LOCUS_11940 gene truB 4379 5335 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_11940 6703 5381 gene locus_tag LOCUS_11950 gene argA 6703 5381 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096265.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence103 <1 2137 gene locus_tag LOCUS_11960 <1 2137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087698.1:CusA/CzcA family heavy metal efflux RND transporter 2134 2616 gene locus_tag LOCUS_11970 2134 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2687 3178 gene locus_tag LOCUS_11980 2687 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 3200 3526 gene locus_tag LOCUS_11990 3200 3526 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_11990 3546 4157 gene locus_tag LOCUS_12000 3546 4157 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946769.1 protein_id gnl|my_center|LOCUS_12000 4188 4730 gene locus_tag LOCUS_12010 4188 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 4733 5248 gene locus_tag LOCUS_12020 4733 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 5313 5771 gene locus_tag LOCUS_12030 5313 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5768 6703 gene locus_tag LOCUS_12040 5768 6703 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036459.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence104 1069 1506 gene locus_tag LOCUS_12050 1069 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1554 3194 gene locus_tag LOCUS_12060 1554 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 4097 3351 gene locus_tag LOCUS_12070 4097 3351 CDS product formyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073064.1 protein_id gnl|my_center|LOCUS_12070 6039 4753 gene locus_tag LOCUS_12080 6039 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence105 <1 500 gene locus_tag LOCUS_12090 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073360.1:PilW family protein 746 1192 gene locus_tag LOCUS_12100 746 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1189 2268 gene locus_tag LOCUS_12110 1189 2268 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704649.1 protein_id gnl|my_center|LOCUS_12110 2268 2816 gene locus_tag LOCUS_12120 2268 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 2902 6624 gene locus_tag LOCUS_12130 2902 6624 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence106 1305 1000 gene locus_tag LOCUS_12140 1305 1000 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_12140 1491 1306 gene locus_tag LOCUS_12150 1491 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1608 2162 gene locus_tag LOCUS_12160 1608 2162 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099193.1 protein_id gnl|my_center|LOCUS_12160 2159 3469 gene locus_tag LOCUS_12170 gene pepP 2159 3469 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_12170 3462 4691 gene locus_tag LOCUS_12180 gene ubiH 3462 4691 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_12180 4688 5932 gene locus_tag LOCUS_12190 4688 5932 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262559.1 protein_id gnl|my_center|LOCUS_12190 5945 6745 gene locus_tag LOCUS_12200 5945 6745 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256130.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence107 <1 779 gene locus_tag LOCUS_12210 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209965.1:transketolase 852 1853 gene locus_tag LOCUS_12220 gene gap 852 1853 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_12220 1922 3178 gene locus_tag LOCUS_12230 1922 3178 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_12230 3225 4670 gene locus_tag LOCUS_12240 gene pyk 3225 4670 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958436.1 protein_id gnl|my_center|LOCUS_12240 4722 5786 gene locus_tag LOCUS_12250 gene fba 4722 5786 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022162.1 protein_id gnl|my_center|LOCUS_12250 <6873 6049 gene locus_tag LOCUS_12260 <6873 6049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038356.1:radical SAM family heme chaperone HemW >Feature sequence108 42 518 gene locus_tag LOCUS_12270 gene lspA 42 518 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112823.1 protein_id gnl|my_center|LOCUS_12270 1061 1951 gene locus_tag LOCUS_12280 1061 1951 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_12280 2425 1931 gene locus_tag LOCUS_12290 2425 1931 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706585.1 protein_id gnl|my_center|LOCUS_12290 2499 4787 gene locus_tag LOCUS_12300 2499 4787 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104749.1 protein_id gnl|my_center|LOCUS_12300 5208 4795 gene locus_tag LOCUS_12310 5208 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5992 5195 gene locus_tag LOCUS_12320 5992 5195 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_12320 6848 5994 gene locus_tag LOCUS_12330 6848 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence109 357 800 gene locus_tag LOCUS_12340 gene ssb 357 800 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_12340 817 3051 gene locus_tag LOCUS_12350 817 3051 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_12350 3583 3323 gene locus_tag LOCUS_12360 gene rpsT 3583 3323 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344603.1 protein_id gnl|my_center|LOCUS_12360 4230 4511 gene locus_tag LOCUS_12370 4230 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 4555 5157 gene locus_tag LOCUS_12380 4555 5157 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence110 1372 176 gene locus_tag LOCUS_12390 gene ftsW 1372 176 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216490.1 protein_id gnl|my_center|LOCUS_12390 2742 1372 gene locus_tag LOCUS_12400 gene murD 2742 1372 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268846.1 protein_id gnl|my_center|LOCUS_12400 3830 2748 gene locus_tag LOCUS_12410 gene mraY 3830 2748 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313553.1 protein_id gnl|my_center|LOCUS_12410 5186 3831 gene locus_tag LOCUS_12420 5186 3831 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_12420 6681 5179 gene locus_tag LOCUS_12430 6681 5179 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994100.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence111 <1 557 gene locus_tag LOCUS_12440 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112584.1:phosphoribosylglycinamide formyltransferase 642 1391 gene locus_tag LOCUS_12450 642 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2079 1456 gene locus_tag LOCUS_12460 gene crp 2079 1456 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_12460 2184 2600 gene locus_tag LOCUS_12470 2184 2600 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_12470 2644 3456 gene locus_tag LOCUS_12480 gene speD 2644 3456 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316303.1 protein_id gnl|my_center|LOCUS_12480 4303 3929 gene locus_tag LOCUS_12490 4303 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6637 4307 gene locus_tag LOCUS_12500 6637 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence112 <1 674 gene locus_tag LOCUS_12510 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003409396.1:Holliday junction branch migration DNA helicase RuvB 709 2205 gene locus_tag LOCUS_12520 709 2205 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 protein_id gnl|my_center|LOCUS_12520 2239 2811 gene locus_tag LOCUS_12530 2239 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2808 4169 gene locus_tag LOCUS_12540 gene glrR 2808 4169 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 protein_id gnl|my_center|LOCUS_12540 5139 4225 gene locus_tag LOCUS_12550 5139 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 6087 5404 gene locus_tag LOCUS_12560 6087 5404 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919005.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence113 1 186 gene locus_tag LOCUS_12570 1 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 452 820 gene locus_tag LOCUS_12580 gene tnpA 452 820 CDS product IS200/IS605-like element ISDra9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888562.1 protein_id gnl|my_center|LOCUS_12580 1878 1084 gene locus_tag LOCUS_12590 gene znuB 1878 1084 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240526.1 protein_id gnl|my_center|LOCUS_12590 2656 1862 gene locus_tag LOCUS_12600 gene znuC 2656 1862 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266293.1 protein_id gnl|my_center|LOCUS_12600 3851 2988 gene locus_tag LOCUS_12610 3851 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5047 3866 gene locus_tag LOCUS_12620 5047 3866 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194129.1 protein_id gnl|my_center|LOCUS_12620 <6635 5079 gene locus_tag LOCUS_12630 <6635 5079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958297.1:ribonucleoside-diphosphate reductase subunit alpha >Feature sequence114 <1 695 gene locus_tag LOCUS_12640 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530319.1:TIGR00730 family Rossman fold protein 848 1195 gene locus_tag LOCUS_12650 848 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1206 2168 gene locus_tag LOCUS_12660 1206 2168 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007184747.1 protein_id gnl|my_center|LOCUS_12660 2329 3933 gene locus_tag LOCUS_12670 2329 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 5162 3927 gene locus_tag LOCUS_12680 5162 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 6281 5175 gene locus_tag LOCUS_12690 6281 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence115 <1 609 gene locus_tag LOCUS_12700 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114408.1:phenylalanine--tRNA ligase subunit beta 612 908 gene locus_tag LOCUS_12710 gene ihfA 612 908 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 protein_id gnl|my_center|LOCUS_12710 892 1248 gene locus_tag LOCUS_12720 892 1248 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_12720 1354 1430 gene locus_tag LOCUS_t00240 1354 1430 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1781 2122 gene locus_tag LOCUS_12730 1781 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2123 2425 gene locus_tag LOCUS_12740 2123 2425 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 protein_id gnl|my_center|LOCUS_12740 2583 2801 gene locus_tag LOCUS_12750 2583 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3179 3712 gene locus_tag LOCUS_12760 3179 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3750 6269 gene locus_tag LOCUS_12770 3750 6269 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence116 215 1408 gene locus_tag LOCUS_12780 215 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1408 2595 gene locus_tag LOCUS_12790 1408 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2649 4025 gene locus_tag LOCUS_12800 2649 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 4022 5245 gene locus_tag LOCUS_12810 4022 5245 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241993.1 protein_id gnl|my_center|LOCUS_12810 5268 6398 gene locus_tag LOCUS_12820 5268 6398 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225996815.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence117 <1 617 gene locus_tag LOCUS_12830 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058062.1:type I restriction-modification system subunit M 1202 846 gene locus_tag LOCUS_12840 1202 846 CDS product DUF4870 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265546.1 protein_id gnl|my_center|LOCUS_12840 2099 1713 gene locus_tag LOCUS_12850 2099 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2743 2096 gene locus_tag LOCUS_12860 2743 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2820 2996 gene locus_tag LOCUS_12870 2820 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4697 3039 gene locus_tag LOCUS_12880 4697 3039 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_12880 5562 4690 gene locus_tag LOCUS_12890 gene sucD 5562 4690 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771707.1 protein_id gnl|my_center|LOCUS_12890 6554 5562 gene locus_tag LOCUS_12900 gene sucC 6554 5562 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316561.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence118 3 309 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcactggctgaagcgccacgtctcagaaaaac 807 520 gene locus_tag LOCUS_12910 807 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3744 811 gene locus_tag LOCUS_12920 3744 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 5972 3741 gene locus_tag LOCUS_12930 5972 3741 CDS product TIGR03986 family CRISPR-associated RAMP protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387942.1 protein_id gnl|my_center|LOCUS_12930 <6509 5969 gene locus_tag LOCUS_12940 <6509 5969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387943.1:RAMP superfamily CRISPR-associated protein >Feature sequence119 1206 172 gene locus_tag LOCUS_12950 gene hemH 1206 172 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925680.1 protein_id gnl|my_center|LOCUS_12950 1934 1635 gene locus_tag LOCUS_12960 gene ihfB 1934 1635 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705691.1 protein_id gnl|my_center|LOCUS_12960 3656 1989 gene locus_tag LOCUS_12970 gene rpsA 3656 1989 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_12970 4465 3785 gene locus_tag LOCUS_12980 gene cmk 4465 3785 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106707.1 protein_id gnl|my_center|LOCUS_12980 5781 4462 gene locus_tag LOCUS_12990 5781 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12990 <6473 5851 gene locus_tag LOCUS_13000 <6473 5851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766747.1:prephenate dehydrogenase/arogenate dehydrogenase family protein >Feature sequence120 1063 665 gene locus_tag LOCUS_13010 1063 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1691 1053 gene locus_tag LOCUS_13020 1691 1053 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_13020 4049 1824 gene locus_tag LOCUS_13030 4049 1824 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_13030 4364 4549 gene locus_tag LOCUS_13040 4364 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 5674 4562 gene locus_tag LOCUS_13050 5674 4562 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769406.1 protein_id gnl|my_center|LOCUS_13050 6220 5744 gene locus_tag LOCUS_13060 6220 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence121 289 1695 gene locus_tag LOCUS_13070 gene glnA 289 1695 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811164.1 protein_id gnl|my_center|LOCUS_13070 3880 1826 gene locus_tag LOCUS_13080 3880 1826 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_13080 5107 3923 gene locus_tag LOCUS_13090 gene ispG 5107 3923 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_13090 5768 5184 gene locus_tag LOCUS_13100 gene mobA 5768 5184 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence122 289 798 gene locus_tag LOCUS_13110 289 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 889 2646 gene locus_tag LOCUS_13120 889 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 3749 2943 gene locus_tag LOCUS_13130 gene panB 3749 2943 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707281.1 protein_id gnl|my_center|LOCUS_13130 4408 3755 gene locus_tag LOCUS_13140 4408 3755 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_13140 4948 4448 gene locus_tag LOCUS_13150 gene folK 4948 4448 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156774.1 protein_id gnl|my_center|LOCUS_13150 <6323 4945 gene locus_tag LOCUS_13160 <6323 4945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444485.1:polynucleotide adenylyltransferase PcnB >Feature sequence123 3306 1213 gene locus_tag LOCUS_13170 gene fusA 3306 1213 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 protein_id gnl|my_center|LOCUS_13170 3810 3340 gene locus_tag LOCUS_13180 gene rpsG 3810 3340 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093742.1 protein_id gnl|my_center|LOCUS_13180 4208 3834 gene locus_tag LOCUS_13190 gene rpsL 4208 3834 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543325.1 protein_id gnl|my_center|LOCUS_13190 4464 5201 gene locus_tag LOCUS_13200 4464 5201 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_13200 5194 6147 gene locus_tag LOCUS_13210 5194 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence124 1673 366 gene locus_tag LOCUS_13220 1673 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13220 1788 2114 gene locus_tag LOCUS_13230 gene trxA 1788 2114 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_13230 2358 3614 gene locus_tag LOCUS_13240 gene rho 2358 3614 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070765.1 protein_id gnl|my_center|LOCUS_13240 3761 4111 gene locus_tag LOCUS_13250 3761 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 5811 4459 gene locus_tag LOCUS_13260 5811 4459 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence125 1879 1313 gene locus_tag LOCUS_13270 gene dcd 1879 1313 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_13270 3110 2022 gene locus_tag LOCUS_13280 gene apbC 3110 2022 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_13280 3260 4255 gene locus_tag LOCUS_13290 gene ispH 3260 4255 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116992.1 protein_id gnl|my_center|LOCUS_13290 4509 4231 gene locus_tag LOCUS_13300 4509 4231 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947603.1 protein_id gnl|my_center|LOCUS_13300 4990 4514 gene locus_tag LOCUS_13310 4990 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5565 4987 gene locus_tag LOCUS_13320 5565 4987 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_13320 5987 5718 gene locus_tag LOCUS_13330 5987 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence126 <1 566 gene locus_tag LOCUS_13340 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704081.1:glycosyltransferase family 9 protein 763 2520 gene locus_tag LOCUS_13350 763 2520 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993346.1 protein_id gnl|my_center|LOCUS_13350 3042 2710 gene locus_tag LOCUS_13360 3042 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3705 3265 gene locus_tag LOCUS_13370 3705 3265 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125638.1 protein_id gnl|my_center|LOCUS_13370 5410 4067 gene locus_tag LOCUS_13380 gene rimO 5410 4067 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807313.1 protein_id gnl|my_center|LOCUS_13380 5601 5413 gene locus_tag LOCUS_13390 5601 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 6170 5601 gene locus_tag LOCUS_13400 gene gmhB 6170 5601 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072769.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence127 1811 27 gene locus_tag LOCUS_13410 1811 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2618 1857 gene locus_tag LOCUS_13420 2618 1857 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880615.1 protein_id gnl|my_center|LOCUS_13420 3455 2703 gene locus_tag LOCUS_13430 3455 2703 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880615.1 protein_id gnl|my_center|LOCUS_13430 4487 3651 gene locus_tag LOCUS_13440 4487 3651 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818638.1 protein_id gnl|my_center|LOCUS_13440 5848 4484 gene locus_tag LOCUS_13450 gene xseA 5848 4484 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence128 133 543 gene locus_tag LOCUS_13460 133 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 540 920 gene locus_tag LOCUS_13470 540 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2779 869 gene locus_tag LOCUS_13480 gene asnB 2779 869 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_13480 3687 2998 gene locus_tag LOCUS_13490 gene narI 3687 2998 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160113.1 protein_id gnl|my_center|LOCUS_13490 4230 3700 gene locus_tag LOCUS_13500 4230 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 6057 4270 gene locus_tag LOCUS_13510 gene narH 6057 4270 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092958.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence129 1463 561 gene locus_tag LOCUS_13520 gene galU 1463 561 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_13520 2203 1541 gene locus_tag LOCUS_13530 gene nfi 2203 1541 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_13530 3216 2200 gene locus_tag LOCUS_13540 3216 2200 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073065.1 protein_id gnl|my_center|LOCUS_13540 3678 5309 gene locus_tag LOCUS_13550 3678 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 5733 5314 gene locus_tag LOCUS_13560 5733 5314 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185972.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence130 1939 179 gene locus_tag LOCUS_13570 1939 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2243 2674 gene locus_tag LOCUS_13580 gene ndk 2243 2674 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958107.1 protein_id gnl|my_center|LOCUS_13580 2698 3786 gene locus_tag LOCUS_13590 gene rlmN 2698 3786 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092809.1 protein_id gnl|my_center|LOCUS_13590 3780 4556 gene locus_tag LOCUS_13600 gene pilW 3780 4556 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073190.1 protein_id gnl|my_center|LOCUS_13600 4560 5849 gene locus_tag LOCUS_13610 gene hisS 4560 5849 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107167.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence131 1614 1015 gene locus_tag LOCUS_13620 gene ruvA 1614 1015 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_13620 2108 1611 gene locus_tag LOCUS_13630 gene ruvC 2108 1611 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298649.1 protein_id gnl|my_center|LOCUS_13630 2867 2118 gene locus_tag LOCUS_13640 gene cvpC 2867 2118 CDS product Dot/Icm type IV secretion system effector transcriptional regulator CvpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772098.1 protein_id gnl|my_center|LOCUS_13640 3979 2879 gene locus_tag LOCUS_13650 gene nadA 3979 2879 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_13650 4605 4282 gene locus_tag LOCUS_13660 4605 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 5079 4696 gene locus_tag LOCUS_13670 5079 4696 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689992.1 protein_id gnl|my_center|LOCUS_13670 5141 5557 gene locus_tag LOCUS_13680 gene fur 5141 5557 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_13680 5731 5576 gene locus_tag LOCUS_13690 5731 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence132 816 154 gene locus_tag LOCUS_13700 816 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2004 820 gene locus_tag LOCUS_13710 2004 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2171 3448 gene locus_tag LOCUS_13720 2171 3448 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 protein_id gnl|my_center|LOCUS_13720 3605 3529 gene locus_tag LOCUS_t00250 3605 3529 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4574 3606 gene locus_tag LOCUS_13730 gene ispB 4574 3606 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_13730 4680 5309 gene locus_tag LOCUS_13740 gene yihA 4680 5309 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945886.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence133 1028 1468 gene locus_tag LOCUS_13750 gene ybgC 1028 1468 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 protein_id gnl|my_center|LOCUS_13750 1473 2171 gene locus_tag LOCUS_13760 gene tolQ 1473 2171 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418613.1 protein_id gnl|my_center|LOCUS_13760 2168 2608 gene locus_tag LOCUS_13770 gene tolR 2168 2608 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947302.1 protein_id gnl|my_center|LOCUS_13770 2620 3471 gene locus_tag LOCUS_13780 2620 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3468 4784 gene locus_tag LOCUS_13790 gene tolB 3468 4784 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707363.1 protein_id gnl|my_center|LOCUS_13790 4825 5355 gene locus_tag LOCUS_13800 gene pal 4825 5355 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111417.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence134 1 1968 gene locus_tag LOCUS_13810 1 1968 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262350.1 protein_id gnl|my_center|LOCUS_13810 1969 3030 gene locus_tag LOCUS_13820 1969 3030 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895569.1 protein_id gnl|my_center|LOCUS_13820 3049 3789 gene locus_tag LOCUS_13830 3049 3789 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436124.1 protein_id gnl|my_center|LOCUS_13830 3807 4604 gene locus_tag LOCUS_13840 gene motD 3807 4604 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 protein_id gnl|my_center|LOCUS_13840 4601 5404 gene locus_tag LOCUS_13850 4601 5404 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705294.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence135 3 428 gene locus_tag LOCUS_13860 3 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 435 944 gene locus_tag LOCUS_13870 435 944 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318487.1 protein_id gnl|my_center|LOCUS_13870 948 2459 gene locus_tag LOCUS_13880 gene purF 948 2459 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381064.1 protein_id gnl|my_center|LOCUS_13880 2507 3238 gene locus_tag LOCUS_13890 2507 3238 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_13890 4902 3250 gene locus_tag LOCUS_13900 4902 3250 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073637.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence136 2216 504 gene locus_tag LOCUS_13910 2216 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3825 2494 gene locus_tag LOCUS_13920 3825 2494 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_13920 4000 4503 gene locus_tag LOCUS_13930 4000 4503 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555745.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence137 1606 1154 gene locus_tag LOCUS_13940 1606 1154 CDS product lpg2359 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_13940 1839 1624 gene locus_tag LOCUS_13950 gene rpsU 1839 1624 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_13950 1981 3024 gene locus_tag LOCUS_13960 gene tsaD 1981 3024 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704779.1 protein_id gnl|my_center|LOCUS_13960 3514 3876 gene locus_tag LOCUS_13970 3514 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 3977 5272 gene locus_tag LOCUS_13980 3977 5272 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence138 >Feature sequence139 2267 2082 gene locus_tag LOCUS_13990 2267 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 2581 2264 gene locus_tag LOCUS_14000 2581 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3800 2574 gene locus_tag LOCUS_14010 3800 2574 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence140 1354 629 gene locus_tag LOCUS_14020 1354 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3100 1970 gene locus_tag LOCUS_14030 gene algW 3100 1970 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098831.1 protein_id gnl|my_center|LOCUS_14030 3144 3896 gene locus_tag LOCUS_14040 3144 3896 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_14040 3980 4183 gene locus_tag LOCUS_14050 gene rpmE 3980 4183 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027123.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence141 75 1250 gene locus_tag LOCUS_14060 gene miaB 75 1250 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071412.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14060 1247 2212 gene locus_tag LOCUS_14070 1247 2212 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268976.1 protein_id gnl|my_center|LOCUS_14070 2209 2682 gene locus_tag LOCUS_14080 gene ybeY 2209 2682 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663323.1 protein_id gnl|my_center|LOCUS_14080 2695 3597 gene locus_tag LOCUS_14090 2695 3597 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_14090 3628 5154 gene locus_tag LOCUS_14100 gene lnt 3628 5154 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118259.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence142 <1 978 gene locus_tag LOCUS_14110 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005172749.1:translation elongation factor 4 978 1790 gene locus_tag LOCUS_14120 gene lepB 978 1790 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363711.1 protein_id gnl|my_center|LOCUS_14120 1798 2466 gene locus_tag LOCUS_14130 gene rnc 1798 2466 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085565.1 protein_id gnl|my_center|LOCUS_14130 2459 3364 gene locus_tag LOCUS_14140 gene era 2459 3364 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363707.1 protein_id gnl|my_center|LOCUS_14140 3354 4070 gene locus_tag LOCUS_14150 gene recO 3354 4070 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209680.1 protein_id gnl|my_center|LOCUS_14150 4072 4812 gene locus_tag LOCUS_14160 gene pdxJ 4072 4812 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004969731.1 protein_id gnl|my_center|LOCUS_14160 4809 5189 gene locus_tag LOCUS_14170 gene acpS 4809 5189 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635063.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence143 1154 150 gene locus_tag LOCUS_14180 1154 150 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_14180 1969 1256 gene locus_tag LOCUS_14190 1969 1256 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_14190 5019 1966 gene locus_tag LOCUS_14200 5019 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence144 792 1340 gene locus_tag LOCUS_14210 792 1340 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 protein_id gnl|my_center|LOCUS_14210 1337 1975 gene locus_tag LOCUS_14220 1337 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2470 2832 gene locus_tag LOCUS_14230 2470 2832 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212575.1 protein_id gnl|my_center|LOCUS_14230 3327 4478 gene locus_tag LOCUS_14240 3327 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 4630 4965 gene locus_tag LOCUS_14250 4630 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence145 1694 195 gene locus_tag LOCUS_14260 1694 195 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_14260 3345 2365 gene locus_tag LOCUS_14270 gene sppA 3345 2365 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_14270 4009 3368 gene locus_tag LOCUS_14280 4009 3368 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_14280 5001 4006 gene locus_tag LOCUS_14290 gene rluC 5001 4006 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201356046.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence146 4021 173 gene locus_tag LOCUS_14300 4021 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 4514 4041 gene locus_tag LOCUS_14310 4514 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence147 <1 636 gene locus_tag LOCUS_14320 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945831.1:pyridoxal phosphate-dependent aminotransferase 2119 1214 gene locus_tag LOCUS_14330 2119 1214 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_14330 2273 3823 gene locus_tag LOCUS_14340 2273 3823 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_14340 3873 4292 gene locus_tag LOCUS_14350 3873 4292 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence148 1240 947 gene locus_tag LOCUS_14360 1240 947 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_14360 2358 1237 gene locus_tag LOCUS_14370 2358 1237 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_14370 2559 2903 gene locus_tag LOCUS_14380 2559 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2876 3964 gene locus_tag LOCUS_14390 2876 3964 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence149 225 518 gene locus_tag LOCUS_14400 225 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 531 854 gene locus_tag LOCUS_14410 531 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 862 3720 gene locus_tag LOCUS_14420 gene glnE 862 3720 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_14420 3827 4747 gene locus_tag LOCUS_14430 gene ilvE 3827 4747 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence150 1192 374 gene locus_tag LOCUS_14440 1192 374 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 protein_id gnl|my_center|LOCUS_14440 1143 2219 gene locus_tag LOCUS_14450 1143 2219 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704081.1 protein_id gnl|my_center|LOCUS_14450 2286 4163 gene locus_tag LOCUS_14460 2286 4163 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993346.1 protein_id gnl|my_center|LOCUS_14460 4915 4151 gene locus_tag LOCUS_14470 4915 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence151 90 17 gene locus_tag LOCUS_t00260 90 17 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 252 177 gene locus_tag LOCUS_t00270 252 177 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 522 1931 gene locus_tag LOCUS_14480 522 1931 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 protein_id gnl|my_center|LOCUS_14480 2389 3252 gene locus_tag LOCUS_14490 gene folD 2389 3252 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404473.1 protein_id gnl|my_center|LOCUS_14490 4868 3462 gene locus_tag LOCUS_14500 gene cysS 4868 3462 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225718.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence152 621 1031 gene locus_tag LOCUS_14510 621 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1723 1037 gene locus_tag LOCUS_14520 1723 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1988 1749 gene locus_tag LOCUS_14530 1988 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2557 2285 gene locus_tag LOCUS_14540 2557 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3259 2870 gene locus_tag LOCUS_14550 3259 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 3860 3360 gene locus_tag LOCUS_14560 3860 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4696 3857 gene locus_tag LOCUS_14570 4696 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence153 524 198 gene locus_tag LOCUS_14580 gene nirC 524 198 CDS product cytochrome c55X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084870.1 protein_id gnl|my_center|LOCUS_14580 700 1059 gene locus_tag LOCUS_14590 700 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1789 1070 gene locus_tag LOCUS_14600 1789 1070 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_14600 1887 2900 gene locus_tag LOCUS_14610 gene bioB 1887 2900 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035642.1 protein_id gnl|my_center|LOCUS_14610 2904 4088 gene locus_tag LOCUS_14620 2904 4088 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence154 1209 883 gene locus_tag LOCUS_14630 gene clpS 1209 883 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312564.1 protein_id gnl|my_center|LOCUS_14630 2500 1244 gene locus_tag LOCUS_14640 gene icd 2500 1244 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078068420.1 protein_id gnl|my_center|LOCUS_14640 2889 4676 gene locus_tag LOCUS_14650 2889 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence155 <1 718 gene locus_tag LOCUS_14660 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772330.1:recombinase RecA 731 1342 gene locus_tag LOCUS_14670 731 1342 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_14670 1608 2537 gene locus_tag LOCUS_14680 1608 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence156 256 1044 gene locus_tag LOCUS_14690 256 1044 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_14690 1083 1159 gene locus_tag LOCUS_t00280 1083 1159 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1670 1595 gene locus_tag LOCUS_t00290 1670 1595 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1797 2639 gene locus_tag LOCUS_14700 gene dam 1797 2639 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262697.1 protein_id gnl|my_center|LOCUS_14700 3104 3718 gene locus_tag LOCUS_14710 gene sodB 3104 3718 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366881.1 protein_id gnl|my_center|LOCUS_14710 3868 4641 gene locus_tag LOCUS_14720 gene rfbF 3868 4641 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence157 129 40 gene locus_tag LOCUS_t00300 129 40 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 295 963 gene locus_tag LOCUS_14730 295 963 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_14730 1176 3494 gene locus_tag LOCUS_14740 1176 3494 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403520.1 protein_id gnl|my_center|LOCUS_14740 3579 4175 gene locus_tag LOCUS_14750 3579 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4179 4610 gene locus_tag LOCUS_14760 4179 4610 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence158 1555 629 gene locus_tag LOCUS_14770 1555 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2072 2626 gene locus_tag LOCUS_14780 2072 2626 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226357.1 protein_id gnl|my_center|LOCUS_14780 2626 4041 gene locus_tag LOCUS_14790 2626 4041 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence159 690 304 gene locus_tag LOCUS_14800 690 304 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211234.1 protein_id gnl|my_center|LOCUS_14800 1302 895 gene locus_tag LOCUS_14810 1302 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 3178 1808 gene locus_tag LOCUS_14820 3178 1808 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_14820 3498 4364 gene locus_tag LOCUS_14830 gene rpoH 3498 4364 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence160 252 899 gene locus_tag LOCUS_14840 252 899 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_14840 1139 2074 gene locus_tag LOCUS_14850 1139 2074 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence161 183 1268 gene locus_tag LOCUS_14860 183 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2723 1332 gene locus_tag LOCUS_14870 gene der 2723 1332 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_14870 3865 2720 gene locus_tag LOCUS_14880 gene bamB 3865 2720 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_14880 4512 3865 gene locus_tag LOCUS_14890 4512 3865 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552488.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence162 318 1859 gene locus_tag LOCUS_14900 318 1859 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932512.1 protein_id gnl|my_center|LOCUS_14900 2609 1893 gene locus_tag LOCUS_14910 2609 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence163 154 471 gene locus_tag LOCUS_14920 gene rpsJ 154 471 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_14920 503 1153 gene locus_tag LOCUS_14930 gene rplC 503 1153 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218932.1 protein_id gnl|my_center|LOCUS_14930 1159 1773 gene locus_tag LOCUS_14940 gene rplD 1159 1773 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422344.1 protein_id gnl|my_center|LOCUS_14940 1770 2072 gene locus_tag LOCUS_14950 gene rplW 1770 2072 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 protein_id gnl|my_center|LOCUS_14950 2085 2912 gene locus_tag LOCUS_14960 gene rplB 2085 2912 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103878.1 protein_id gnl|my_center|LOCUS_14960 2977 3219 gene locus_tag LOCUS_14970 gene rpsS 2977 3219 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 protein_id gnl|my_center|LOCUS_14970 3230 3562 gene locus_tag LOCUS_14980 gene rplV 3230 3562 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383164.1 protein_id gnl|my_center|LOCUS_14980 3576 4256 gene locus_tag LOCUS_14990 gene rpsC 3576 4256 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_14990 4269 4682 gene locus_tag LOCUS_15000 gene rplP 4269 4682 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence164 1925 612 gene locus_tag LOCUS_15010 1925 612 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948436.1 protein_id gnl|my_center|LOCUS_15010 3670 1922 gene locus_tag LOCUS_15020 3670 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4471 3686 gene locus_tag LOCUS_15030 gene hemD 4471 3686 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703978.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence165 615 2567 gene locus_tag LOCUS_15040 gene slt 615 2567 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_15040 3109 2561 gene locus_tag LOCUS_15050 3109 2561 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_15050 3237 3626 gene locus_tag LOCUS_15060 3237 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4199 3750 gene locus_tag LOCUS_15070 gene tadA 4199 3750 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098309.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence166 627 1829 gene locus_tag LOCUS_15080 gene dapC 627 1829 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_15080 1842 2663 gene locus_tag LOCUS_15090 gene dapD 1842 2663 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095650.1 protein_id gnl|my_center|LOCUS_15090 2774 3901 gene locus_tag LOCUS_15100 gene dapE 2774 3901 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116563.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence167 3595 230 gene locus_tag LOCUS_15110 gene addA 3595 230 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923305.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence168 712 248 gene locus_tag LOCUS_15120 712 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1794 727 gene locus_tag LOCUS_15130 gene hemE 1794 727 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_15130 3207 1801 gene locus_tag LOCUS_15140 3207 1801 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 protein_id gnl|my_center|LOCUS_15140 3608 3234 gene locus_tag LOCUS_15150 3608 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15150 <4591 3621 gene locus_tag LOCUS_15160 <4591 3621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105326.1:glutamate synthase large subunit note possible pseudo, internal stop codon >Feature sequence169 2389 341 gene locus_tag LOCUS_15170 gene prlC 2389 341 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_15170 2798 3304 gene locus_tag LOCUS_15180 2798 3304 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957587.1 protein_id gnl|my_center|LOCUS_15180 3345 3420 gene locus_tag LOCUS_t00310 3345 3420 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence170 624 145 gene locus_tag LOCUS_15190 624 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1045 1623 gene locus_tag LOCUS_15200 1045 1623 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_15200 1620 1787 gene locus_tag LOCUS_15210 1620 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4034 1890 gene locus_tag LOCUS_15220 gene glgX 4034 1890 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113651.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence171 1938 541 gene locus_tag LOCUS_15230 1938 541 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948529.1 protein_id gnl|my_center|LOCUS_15230 2416 1949 gene locus_tag LOCUS_15240 2416 1949 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_15240 2826 4142 gene locus_tag LOCUS_15250 2826 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence172 532 1248 gene locus_tag LOCUS_15260 gene mutH 532 1248 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165371.1 protein_id gnl|my_center|LOCUS_15260 3564 1660 gene locus_tag LOCUS_15270 3564 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3660 4163 gene locus_tag LOCUS_15280 3660 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence173 939 295 gene locus_tag LOCUS_15290 gene coq7 939 295 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119684.1 protein_id gnl|my_center|LOCUS_15290 1094 2959 gene locus_tag LOCUS_15300 1094 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3203 3400 gene locus_tag LOCUS_15310 3203 3400 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_15310 3403 4014 gene locus_tag LOCUS_15320 3403 4014 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence174 520 62 gene locus_tag LOCUS_15330 gene rimP 520 62 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_15330 740 664 gene locus_tag LOCUS_t00320 740 664 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 858 2930 gene locus_tag LOCUS_15340 gene rep 858 2930 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045224090.1 protein_id gnl|my_center|LOCUS_15340 3435 3181 gene locus_tag LOCUS_15350 3435 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4385 3528 gene locus_tag LOCUS_15360 4385 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence175 1150 515 gene locus_tag LOCUS_15370 gene hisG 1150 515 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766526.1 protein_id gnl|my_center|LOCUS_15370 2507 1227 gene locus_tag LOCUS_15380 gene murA 2507 1227 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_15380 3630 2581 gene locus_tag LOCUS_15390 gene holA 3630 2581 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_15390 4136 3627 gene locus_tag LOCUS_15400 gene lptE 4136 3627 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947077.1 protein_id gnl|my_center|LOCUS_15400 4348 4133 gene locus_tag LOCUS_15410 4348 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence176 672 1751 gene locus_tag LOCUS_15420 672 1751 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_15420 1744 2445 gene locus_tag LOCUS_15430 1744 2445 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_15430 2449 3639 gene locus_tag LOCUS_15440 2449 3639 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459669.1 protein_id gnl|my_center|LOCUS_15440 3837 3682 gene locus_tag LOCUS_15450 gene rpmG 3837 3682 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392084.1 protein_id gnl|my_center|LOCUS_15450 4086 3850 gene locus_tag LOCUS_15460 gene rpmB 4086 3850 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014822.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence177 2380 1607 gene locus_tag LOCUS_15470 gene ccsA 2380 1607 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943519.1 protein_id gnl|my_center|LOCUS_15470 3691 2384 gene locus_tag LOCUS_15480 3691 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence178 1024 560 gene locus_tag LOCUS_15490 gene recX 1024 560 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766020.1 protein_id gnl|my_center|LOCUS_15490 2043 1108 gene locus_tag LOCUS_15500 2043 1108 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104999.1 protein_id gnl|my_center|LOCUS_15500 3269 2049 gene locus_tag LOCUS_15510 gene argJ 3269 2049 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208443.1 protein_id gnl|my_center|LOCUS_15510 <4327 3271 gene locus_tag LOCUS_15520 <4327 3271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073892.1:preprotein translocase subunit SecA >Feature sequence179 1823 825 gene locus_tag LOCUS_15530 gene mltB 1823 825 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_15530 3381 2005 gene locus_tag LOCUS_15540 3381 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 4078 3398 gene locus_tag LOCUS_15550 gene gph 4078 3398 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence180 524 1627 gene locus_tag LOCUS_15560 524 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1752 2027 gene locus_tag LOCUS_15570 1752 2027 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_15570 2020 2727 gene locus_tag LOCUS_15580 2020 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3393 2728 gene locus_tag LOCUS_15590 3393 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 3912 3403 gene locus_tag LOCUS_15600 3912 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence181 1004 1522 gene locus_tag LOCUS_15610 1004 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1529 2410 gene locus_tag LOCUS_15620 1529 2410 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_15620 3281 2754 gene locus_tag LOCUS_15630 gene def 3281 2754 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_15630 3973 3278 gene locus_tag LOCUS_15640 3973 3278 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085808.1 protein_id gnl|my_center|LOCUS_15640 4290 4105 gene locus_tag LOCUS_15650 4290 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence182 782 213 gene locus_tag LOCUS_15660 782 213 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_15660 1876 2484 gene locus_tag LOCUS_15670 1876 2484 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446889.1 protein_id gnl|my_center|LOCUS_15670 2481 4226 gene locus_tag LOCUS_15680 2481 4226 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957431.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence183 625 939 gene locus_tag LOCUS_15690 625 939 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074398.1 protein_id gnl|my_center|LOCUS_15690 936 1364 gene locus_tag LOCUS_15700 gene higA 936 1364 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560249.1 protein_id gnl|my_center|LOCUS_15700 1754 1664 gene locus_tag LOCUS_t00330 1754 1664 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2595 1816 gene locus_tag LOCUS_15710 gene anr 2595 1816 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_15710 3130 2678 gene locus_tag LOCUS_15720 gene moaE 3130 2678 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736458.1 protein_id gnl|my_center|LOCUS_15720 3365 3120 gene locus_tag LOCUS_15730 gene moaD 3365 3120 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418589.1 protein_id gnl|my_center|LOCUS_15730 3450 3929 gene locus_tag LOCUS_15740 gene moaC 3450 3929 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence184 3209 798 gene locus_tag LOCUS_15750 gene gyrB 3209 798 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356688.1 protein_id gnl|my_center|LOCUS_15750 <4219 3291 gene locus_tag LOCUS_15760 <4219 3291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097265.1:DNA replication/repair protein RecF >Feature sequence185 187 828 gene locus_tag LOCUS_15770 187 828 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_15770 821 2668 gene locus_tag LOCUS_15780 gene uvrC 821 2668 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_15780 2675 3250 gene locus_tag LOCUS_15790 gene pgsA 2675 3250 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037265.1 protein_id gnl|my_center|LOCUS_15790 3293 3369 gene locus_tag LOCUS_t00340 3293 3369 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4209 3565 gene locus_tag LOCUS_15800 4209 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence186 384 836 gene locus_tag LOCUS_15810 384 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 3334 1418 gene locus_tag LOCUS_15820 gene speA 3334 1418 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038943.1 protein_id gnl|my_center|LOCUS_15820 3751 3359 gene locus_tag LOCUS_15830 3751 3359 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940930.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence187 1240 401 gene locus_tag LOCUS_15840 gene ttcA 1240 401 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082462.1 protein_id gnl|my_center|LOCUS_15840 1620 1237 gene locus_tag LOCUS_15850 1620 1237 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_15850 1857 2498 gene locus_tag LOCUS_15860 1857 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3900 2608 gene locus_tag LOCUS_15870 3900 2608 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence188 1435 944 gene locus_tag LOCUS_15880 1435 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2909 1443 gene locus_tag LOCUS_15890 2909 1443 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_15890 3441 2902 gene locus_tag LOCUS_15900 3441 2902 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_15900 <4116 3434 gene locus_tag LOCUS_15910 <4116 3434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943355.1:bidirectional hydrogenase complex protein HoxU >Feature sequence189 561 121 gene locus_tag LOCUS_15920 gene nusB 561 121 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_15920 1036 566 gene locus_tag LOCUS_15930 gene ribE 1036 566 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_15930 2157 1033 gene locus_tag LOCUS_15940 gene ribBA 2157 1033 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_15940 2820 2164 gene locus_tag LOCUS_15950 2820 2164 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_15950 3951 2839 gene locus_tag LOCUS_15960 gene ribD 3951 2839 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704561.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence190 1239 109 gene locus_tag LOCUS_15970 gene proB 1239 109 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_15970 2294 1251 gene locus_tag LOCUS_15980 gene cgtA 2294 1251 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957543.1 protein_id gnl|my_center|LOCUS_15980 2619 2362 gene locus_tag LOCUS_15990 gene rpmA 2619 2362 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383095.1 protein_id gnl|my_center|LOCUS_15990 2970 2656 gene locus_tag LOCUS_16000 gene rplU 2970 2656 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 protein_id gnl|my_center|LOCUS_16000 3864 3058 gene locus_tag LOCUS_16010 gene tcdA 3864 3058 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112469.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence191 <1 550 gene locus_tag LOCUS_16020 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100943.1:glutathione synthase 547 1593 gene locus_tag LOCUS_16030 547 1593 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_16030 1590 1967 gene locus_tag LOCUS_16040 1590 1967 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461457.1 protein_id gnl|my_center|LOCUS_16040 1973 2506 gene locus_tag LOCUS_16050 gene eetB 1973 2506 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_16050 2584 3399 gene locus_tag LOCUS_16060 2584 3399 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_16060 3417 3977 gene locus_tag LOCUS_16070 3417 3977 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence192 444 235 gene locus_tag LOCUS_16080 444 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1583 795 gene locus_tag LOCUS_16090 1583 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3358 1844 gene locus_tag LOCUS_16100 3358 1844 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_16100 3620 3366 gene locus_tag LOCUS_16110 3620 3366 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958608.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence193 806 519 gene locus_tag LOCUS_16120 gene hpf 806 519 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162480.1 protein_id gnl|my_center|LOCUS_16120 2316 841 gene locus_tag LOCUS_16130 2316 841 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_16130 3450 2713 gene locus_tag LOCUS_16140 gene lptB 3450 2713 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_16140 3944 3447 gene locus_tag LOCUS_16150 3944 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence194 1410 916 gene locus_tag LOCUS_16160 gene ilvN 1410 916 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_16160 3128 1410 gene locus_tag LOCUS_16170 3128 1410 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185769.1 protein_id gnl|my_center|LOCUS_16170 4031 3282 gene locus_tag LOCUS_16180 4031 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence195 1021 443 gene locus_tag LOCUS_16190 1021 443 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942604.1 protein_id gnl|my_center|LOCUS_16190 2621 1029 gene locus_tag LOCUS_16200 2621 1029 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_16200 3651 2656 gene locus_tag LOCUS_16210 gene galE 3651 2656 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence196 321 488 gene locus_tag LOCUS_16220 321 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 3533 648 gene locus_tag LOCUS_16230 3533 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence197 <1 507 gene locus_tag LOCUS_16240 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186137.1:NADH-quinone oxidoreductase subunit M 544 1965 gene locus_tag LOCUS_16250 gene nuoN 544 1965 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958226.1 protein_id gnl|my_center|LOCUS_16250 3450 2056 gene locus_tag LOCUS_16260 3450 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence198 1307 261 gene locus_tag LOCUS_16270 1307 261 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454111.1 protein_id gnl|my_center|LOCUS_16270 2891 1560 gene locus_tag LOCUS_16280 2891 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 <3869 3220 gene locus_tag LOCUS_16290 <3869 3220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940973.1:aminopeptidase N >Feature sequence199 174 323 gene locus_tag LOCUS_16300 174 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 344 1021 gene locus_tag LOCUS_16310 344 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1129 1710 gene locus_tag LOCUS_16320 1129 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1730 3052 gene locus_tag LOCUS_16330 1730 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence200 <3820 3147 gene locus_tag LOCUS_16340 <3820 3147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582557.1:acetoin utilization protein AcuC >Feature sequence201 280 194 gene locus_tag LOCUS_t00350 280 194 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 391 2616 gene locus_tag LOCUS_16350 gene rnr 391 2616 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407829.1 protein_id gnl|my_center|LOCUS_16350 2616 3386 gene locus_tag LOCUS_16360 gene rlmB 2616 3386 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073677.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence202 399 965 gene locus_tag LOCUS_16370 399 965 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070536.1 protein_id gnl|my_center|LOCUS_16370 966 1850 gene locus_tag LOCUS_16380 gene ubiA 966 1850 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401244.1 protein_id gnl|my_center|LOCUS_16380 1921 2655 gene locus_tag LOCUS_16390 1921 2655 CDS product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 protein_id gnl|my_center|LOCUS_16390 <3768 2831 gene locus_tag LOCUS_16400 <3768 2831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002212156.1:proline--tRNA ligase >Feature sequence203 <1 1443 gene locus_tag LOCUS_16410 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958589.1:type I DNA topoisomerase 1440 2003 gene locus_tag LOCUS_16420 1440 2003 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769752.1 protein_id gnl|my_center|LOCUS_16420 2019 2234 gene locus_tag LOCUS_16430 2019 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2943 2266 gene locus_tag LOCUS_16440 gene queC 2943 2266 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463447.1 protein_id gnl|my_center|LOCUS_16440 3590 2943 gene locus_tag LOCUS_16450 gene queE 3590 2943 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence204 274 2205 gene locus_tag LOCUS_16460 gene ftsH 274 2205 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_16460 2257 2787 gene locus_tag LOCUS_16470 2257 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3214 2798 gene locus_tag LOCUS_16480 3214 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence205 430 1005 gene locus_tag LOCUS_16490 430 1005 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528588.1 protein_id gnl|my_center|LOCUS_16490 2453 942 gene locus_tag LOCUS_16500 2453 942 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_16500 3118 2453 gene locus_tag LOCUS_16510 3118 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 3337 3128 gene locus_tag LOCUS_16520 3337 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence206 1616 534 gene locus_tag LOCUS_16530 1616 534 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672294.1 protein_id gnl|my_center|LOCUS_16530 2916 1624 gene locus_tag LOCUS_16540 gene serS 2916 1624 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 protein_id gnl|my_center|LOCUS_16540 3345 2932 gene locus_tag LOCUS_16550 3345 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence207 537 2915 gene locus_tag LOCUS_16560 537 2915 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence208 2539 248 gene locus_tag LOCUS_16570 2539 248 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_16570 2656 3624 gene locus_tag LOCUS_16580 gene trxB 2656 3624 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941156.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence209 3052 2036 gene locus_tag LOCUS_16590 gene pheS 3052 2036 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_16590 3521 3183 gene locus_tag LOCUS_16600 gene rplT 3521 3183 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence210 119 1144 gene locus_tag LOCUS_16610 119 1144 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308002.1 protein_id gnl|my_center|LOCUS_16610 <3557 1401 gene locus_tag LOCUS_16620 <3557 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941469.1:phosphoenolpyruvate synthase >Feature sequence211 245 1033 gene locus_tag LOCUS_16630 245 1033 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_16630 1030 2304 gene locus_tag LOCUS_16640 1030 2304 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644782.1 protein_id gnl|my_center|LOCUS_16640 3500 2610 gene locus_tag LOCUS_16650 3500 2610 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958544.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence212 279 917 gene locus_tag LOCUS_16660 279 917 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516588.1 protein_id gnl|my_center|LOCUS_16660 914 1918 gene locus_tag LOCUS_16670 gene legI 914 1918 CDS product N,N'-diacetyllegionaminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864265.1 protein_id gnl|my_center|LOCUS_16670 1915 3117 gene locus_tag LOCUS_16680 gene neuC 1915 3117 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459665.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence213 1550 45 gene locus_tag LOCUS_16690 gene trpE 1550 45 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 protein_id gnl|my_center|LOCUS_16690 2283 1591 gene locus_tag LOCUS_16700 2283 1591 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113205.1 protein_id gnl|my_center|LOCUS_16700 2970 2290 gene locus_tag LOCUS_16710 gene rpe 2970 2290 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215694.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence214 232 780 gene locus_tag LOCUS_16720 gene rfbC 232 780 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_16720 767 2053 gene locus_tag LOCUS_16730 767 2053 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142200.1 protein_id gnl|my_center|LOCUS_16730 2257 2703 gene locus_tag LOCUS_16740 2257 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence215 <1 548 gene locus_tag LOCUS_16750 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010439729.1:chaperonin GroEL 1722 655 gene locus_tag LOCUS_16760 gene modC 1722 655 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_16760 2396 1719 gene locus_tag LOCUS_16770 gene modB 2396 1719 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_16770 3140 2400 gene locus_tag LOCUS_16780 gene modA 3140 2400 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808340.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence216 405 1778 gene locus_tag LOCUS_16790 405 1778 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_16790 2592 2170 gene locus_tag LOCUS_16800 gene hemJ 2592 2170 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 protein_id gnl|my_center|LOCUS_16800 3309 2605 gene locus_tag LOCUS_16810 3309 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence217 1113 316 gene locus_tag LOCUS_16820 1113 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1877 1110 gene locus_tag LOCUS_16830 1877 1110 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_16830 2854 1877 gene locus_tag LOCUS_16840 gene birA 2854 1877 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence218 6 2486 gene locus_tag LOCUS_16850 gene alaS 6 2486 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence219 <1 525 gene locus_tag LOCUS_16860 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269172.1:8-amino-7-oxononanoate synthase 522 1289 gene locus_tag LOCUS_16870 gene bioH 522 1289 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035639.1 protein_id gnl|my_center|LOCUS_16870 1282 2181 gene locus_tag LOCUS_16880 gene bioC 1282 2181 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_16880 2178 2885 gene locus_tag LOCUS_16890 gene bioD 2178 2885 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103336.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence220 1539 949 gene locus_tag LOCUS_16900 gene rlmE 1539 949 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_16900 1831 1550 gene locus_tag LOCUS_16910 1831 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2810 2055 gene locus_tag LOCUS_16920 2810 2055 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence221 898 614 gene locus_tag LOCUS_16930 898 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2313 1396 gene locus_tag LOCUS_16940 2313 1396 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449622.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence222 <1 541 gene locus_tag LOCUS_16950 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943285.1:SDR family oxidoreductase 568 2244 gene locus_tag LOCUS_16960 568 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 <3233 2305 gene locus_tag LOCUS_16970 <3233 2305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001909664.1:DNA polymerase III subunit alpha >Feature sequence223 1407 271 gene locus_tag LOCUS_16980 1407 271 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444330.1 protein_id gnl|my_center|LOCUS_16980 1661 1419 gene locus_tag LOCUS_16990 1661 1419 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035794.1 protein_id gnl|my_center|LOCUS_16990 2704 1649 gene locus_tag LOCUS_17000 2704 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence224 >Feature sequence225 391 86 gene locus_tag LOCUS_17010 391 86 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957951.1 protein_id gnl|my_center|LOCUS_17010 762 388 gene locus_tag LOCUS_17020 gene crcB 762 388 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_17020 2321 987 gene locus_tag LOCUS_17030 2321 987 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_17030 2963 2334 gene locus_tag LOCUS_17040 gene lolA 2963 2334 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162301084.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence226 1886 345 gene locus_tag LOCUS_17050 gene atpA 1886 345 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_17050 2450 1914 gene locus_tag LOCUS_17060 2450 1914 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105592.1 protein_id gnl|my_center|LOCUS_17060 2942 2472 gene locus_tag LOCUS_17070 gene atpF 2942 2472 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458451.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence227 1929 1531 gene locus_tag LOCUS_17080 1929 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2443 1970 gene locus_tag LOCUS_17090 2443 1970 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 protein_id gnl|my_center|LOCUS_17090 <3073 2473 gene locus_tag LOCUS_17100 <3073 2473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083094.1:chemotaxis protein CheW >Feature sequence228 175 789 gene locus_tag LOCUS_17110 175 789 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039104.1 protein_id gnl|my_center|LOCUS_17110 2230 806 gene locus_tag LOCUS_17120 2230 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2414 2752 gene locus_tag LOCUS_17130 2414 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence229 405 34 gene locus_tag LOCUS_17140 405 34 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_17140 1519 449 gene locus_tag LOCUS_17150 1519 449 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_17150 2440 1898 gene locus_tag LOCUS_17160 2440 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2527 2602 gene locus_tag LOCUS_t00360 2527 2602 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence230 796 1215 gene locus_tag LOCUS_17170 gene mscL 796 1215 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 protein_id gnl|my_center|LOCUS_17170 <2988 1467 gene locus_tag LOCUS_17180 <2988 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528037.1:dihydroxy-acid dehydratase >Feature sequence231 <1 2283 gene locus_tag LOCUS_17190 <1 2283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176758209.1:S8 family peptidase 2292 2771 gene locus_tag LOCUS_17200 2292 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence232 82 1572 gene locus_tag LOCUS_17210 gene rng 82 1572 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence233 640 392 gene locus_tag LOCUS_17220 gene groES 640 392 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_17220 1344 880 gene locus_tag LOCUS_17230 gene fxsA 1344 880 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_17230 1425 1751 gene locus_tag LOCUS_17240 1425 1751 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence234 889 461 gene locus_tag LOCUS_17250 889 461 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948665.1 protein_id gnl|my_center|LOCUS_17250 2244 904 gene locus_tag LOCUS_17260 gene atpD 2244 904 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948666.1 protein_id gnl|my_center|LOCUS_17260 <2935 2349 gene locus_tag LOCUS_17270 <2935 2349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097132.1:F0F1 ATP synthase subunit gamma >Feature sequence235 <1 1437 gene locus_tag LOCUS_17280 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003317954.1:ATP-dependent Clp protease ATP-binding subunit ClpA 1952 1734 gene locus_tag LOCUS_17290 gene infA 1952 1734 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 protein_id gnl|my_center|LOCUS_17290 <2914 2065 gene locus_tag LOCUS_17300 <2914 2065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124524.1:glycoside hydrolase 100 family protein >Feature sequence236 2131 992 gene locus_tag LOCUS_17310 gene aepY 2131 992 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530031.1 protein_id gnl|my_center|LOCUS_17310 <2906 2132 gene locus_tag LOCUS_17320 <2906 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188554.1:phosphoenolpyruvate mutase >Feature sequence237 1447 392 gene locus_tag LOCUS_17330 gene pdhA 1447 392 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_17330 2084 1464 gene locus_tag LOCUS_17340 2084 1464 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216918.1 protein_id gnl|my_center|LOCUS_17340 2438 2097 gene locus_tag LOCUS_17350 2438 2097 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250924.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence238 2306 1335 gene locus_tag LOCUS_17360 2306 1335 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence239 2322 250 gene locus_tag LOCUS_17370 gene ppk1 2322 250 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_17370 2543 2794 gene locus_tag LOCUS_17380 2543 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence240 1200 232 gene locus_tag LOCUS_17390 1200 232 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence241 294 1484 gene locus_tag LOCUS_17400 294 1484 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_17400 1486 2397 gene locus_tag LOCUS_17410 gene argF 1486 2397 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence242 1771 1295 gene locus_tag LOCUS_17420 1771 1295 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 protein_id gnl|my_center|LOCUS_17420 <2755 1775 gene locus_tag LOCUS_17430 <2755 1775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064703.1:DNA-processing protein DprA >Feature sequence243 411 259 gene locus_tag LOCUS_17440 411 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1356 1183 gene locus_tag LOCUS_17450 1356 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1940 1374 gene locus_tag LOCUS_17460 gene ampD 1940 1374 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936326.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence244 387 4 gene locus_tag LOCUS_17470 387 4 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_17470 863 387 gene locus_tag LOCUS_17480 863 387 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 protein_id gnl|my_center|LOCUS_17480 1366 854 gene locus_tag LOCUS_17490 1366 854 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 protein_id gnl|my_center|LOCUS_17490 2549 1368 gene locus_tag LOCUS_17500 gene nirF 2549 1368 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence245 1237 161 gene locus_tag LOCUS_17510 gene pheA 1237 161 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_17510 2524 1343 gene locus_tag LOCUS_17520 2524 1343 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence246 847 227 gene locus_tag LOCUS_17530 847 227 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_17530 1347 850 gene locus_tag LOCUS_17540 1347 850 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_17540 2108 1344 gene locus_tag LOCUS_17550 gene ubiE 2108 1344 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_17550 <2666 2108 gene locus_tag LOCUS_17560 <2666 2108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707776.1:HslU--HslV peptidase ATPase subunit >Feature sequence247 1691 603 gene locus_tag LOCUS_17570 1691 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1802 2203 gene locus_tag LOCUS_17580 1802 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence248 937 2277 gene locus_tag LOCUS_17590 937 2277 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_17590 2640 2308 gene locus_tag LOCUS_17600 2640 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence249 <2635 1172 gene locus_tag LOCUS_17610 <2635 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_190973259.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence250 1979 1566 gene locus_tag LOCUS_17620 1979 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence251 2012 1680 gene locus_tag LOCUS_17630 2012 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence252 >Feature sequence253 1053 310 gene locus_tag LOCUS_17640 1053 310 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104813.1 protein_id gnl|my_center|LOCUS_17640 2419 1325 gene locus_tag LOCUS_17650 gene nadA 2419 1325 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence254 494 1417 gene locus_tag LOCUS_17660 494 1417 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence255 2549 1611 gene locus_tag LOCUS_17670 2549 1611 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812755.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence256 87 491 gene locus_tag LOCUS_17680 gene cueR 87 491 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613681.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence257 1395 556 gene locus_tag LOCUS_17690 gene cheR 1395 556 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_17690 1427 2179 gene locus_tag LOCUS_17700 gene flgA 1427 2179 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037118.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence258 <1 732 gene locus_tag LOCUS_17710 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095687.1:DNA topoisomerase IV subunit A >Feature sequence259 874 32 gene locus_tag LOCUS_17720 gene serB 874 32 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_17720 1246 932 gene locus_tag LOCUS_17730 1246 932 CDS product DUF2288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_17730 2169 1333 gene locus_tag LOCUS_17740 2169 1333 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881719.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence260 <1 1080 gene locus_tag LOCUS_17750 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162006391.1:heavy metal translocating P-type ATPase 1644 1832 gene locus_tag LOCUS_17760 1644 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1846 2262 gene locus_tag LOCUS_17770 1846 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090713.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence261 791 216 gene locus_tag LOCUS_17780 791 216 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_17780 1507 848 gene locus_tag LOCUS_17790 1507 848 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_17790 2253 1504 gene locus_tag LOCUS_17800 gene surE 2253 1504 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770587.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence262 834 1382 gene locus_tag LOCUS_17810 834 1382 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_17810 1375 1737 gene locus_tag LOCUS_17820 1375 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1740 1970 gene locus_tag LOCUS_17830 1740 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence263 431 1246 gene locus_tag LOCUS_17840 gene dapB 431 1246 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400159.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence264 54 1436 gene locus_tag LOCUS_17850 gene glmM 54 1436 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_17850 1496 2245 gene locus_tag LOCUS_17860 gene tpiA 1496 2245 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739097.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence265 877 539 gene locus_tag LOCUS_17870 877 539 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_17870 1894 893 gene locus_tag LOCUS_17880 1894 893 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence266 >Feature sequence267 374 1189 gene locus_tag LOCUS_17890 gene mutM 374 1189 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_17890 1646 1221 gene locus_tag LOCUS_17900 1646 1221 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_17900 <2308 1750 gene locus_tag LOCUS_17910 <2308 1750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895678.1:glycine oxidase ThiO >Feature sequence268 1081 428 gene locus_tag LOCUS_17920 gene rlmE 1081 428 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438562.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence269 125 211 gene locus_tag LOCUS_t00370 125 211 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1270 278 gene locus_tag LOCUS_17930 1270 278 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_17930 2178 1267 gene locus_tag LOCUS_17940 gene znuA 2178 1267 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971688.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence270 410 1786 gene locus_tag LOCUS_17950 410 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence271 >Feature sequence272 879 31 gene locus_tag LOCUS_17960 gene folP 879 31 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105022.1 protein_id gnl|my_center|LOCUS_17960 <2193 886 gene locus_tag LOCUS_17970 <2193 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015443940.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence273 1039 293 gene locus_tag LOCUS_17980 1039 293 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036479.1 protein_id gnl|my_center|LOCUS_17980 1595 1032 gene locus_tag LOCUS_17990 1595 1032 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_17990 1963 1595 gene locus_tag LOCUS_18000 1963 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence274 255 1067 gene locus_tag LOCUS_18010 gene rluB 255 1067 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072841.1 protein_id gnl|my_center|LOCUS_18010 1852 1085 gene locus_tag LOCUS_18020 1852 1085 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence275 1241 318 gene locus_tag LOCUS_18030 1241 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1799 1548 gene locus_tag LOCUS_18040 1799 1548 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence276 1820 633 gene locus_tag LOCUS_18050 gene nirJ 1820 633 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence277 632 189 gene locus_tag LOCUS_18060 632 189 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932326.1 protein_id gnl|my_center|LOCUS_18060 1685 639 gene locus_tag LOCUS_18070 gene mtnA 1685 639 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091449.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence278 1138 92 gene locus_tag LOCUS_18080 1138 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence279 1588 962 gene locus_tag LOCUS_18090 1588 962 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389275.1 protein_id gnl|my_center|LOCUS_18090 1986 1597 gene locus_tag LOCUS_18100 1986 1597 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707404.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence280 934 332 gene locus_tag LOCUS_18110 934 332 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482459.1 protein_id gnl|my_center|LOCUS_18110 1652 936 gene locus_tag LOCUS_18120 gene rph 1652 936 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence281 1847 1014 gene locus_tag LOCUS_18130 gene pabC 1847 1014 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_18130