>Feature sequence001 462 1010 gene locus_tag LOCUS_00010 gene pyrR 462 1010 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460661.1 protein_id gnl|my_center|LOCUS_00010 1251 2174 gene locus_tag LOCUS_00020 1251 2174 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_00020 2286 3587 gene locus_tag LOCUS_00030 2286 3587 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_00030 3677 4822 gene locus_tag LOCUS_00040 gene carA 3677 4822 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_00040 4863 8174 gene locus_tag LOCUS_00050 gene carB 4863 8174 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_00050 8210 10678 gene locus_tag LOCUS_00060 gene recG 8210 10678 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_00060 10982 12028 gene locus_tag LOCUS_00070 10982 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022977.1 protein_id gnl|my_center|LOCUS_00070 12280 12035 gene locus_tag LOCUS_00080 12280 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12481 13905 gene locus_tag LOCUS_00090 12481 13905 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338202.1 protein_id gnl|my_center|LOCUS_00090 16737 14035 gene locus_tag LOCUS_00100 16737 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 16889 16737 gene locus_tag LOCUS_00110 16889 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 17182 16979 gene locus_tag LOCUS_00120 17182 16979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 18613 17582 gene locus_tag LOCUS_00130 18613 17582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 20083 18857 gene locus_tag LOCUS_00140 gene dinB 20083 18857 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_00140 20378 20085 gene locus_tag LOCUS_00150 20378 20085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940719.1 protein_id gnl|my_center|LOCUS_00150 21158 20529 gene locus_tag LOCUS_00160 gene lexA 21158 20529 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940718.1 protein_id gnl|my_center|LOCUS_00160 21520 21302 gene locus_tag LOCUS_00170 21520 21302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21667 22596 gene locus_tag LOCUS_00180 21667 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22589 23275 gene locus_tag LOCUS_00190 22589 23275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23344 23559 gene locus_tag LOCUS_00200 23344 23559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23556 23990 gene locus_tag LOCUS_00210 23556 23990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24143 24808 gene locus_tag LOCUS_00220 24143 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24830 25705 gene locus_tag LOCUS_00230 24830 25705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26085 26882 gene locus_tag LOCUS_00240 26085 26882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26919 27155 gene locus_tag LOCUS_00250 26919 27155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27181 27381 gene locus_tag LOCUS_00260 27181 27381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 27557 27862 gene locus_tag LOCUS_00270 27557 27862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27888 28583 gene locus_tag LOCUS_00280 27888 28583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29171 28749 gene locus_tag LOCUS_00290 29171 28749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30429 30908 gene locus_tag LOCUS_00300 30429 30908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 30913 32766 gene locus_tag LOCUS_00310 30913 32766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32837 35614 gene locus_tag LOCUS_00320 32837 35614 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_00320 35611 36546 gene locus_tag LOCUS_00330 35611 36546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36543 36848 gene locus_tag LOCUS_00340 36543 36848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36855 37493 gene locus_tag LOCUS_00350 36855 37493 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 protein_id gnl|my_center|LOCUS_00350 37519 37968 gene locus_tag LOCUS_00360 37519 37968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37973 38467 gene locus_tag LOCUS_00370 37973 38467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 38511 39866 gene locus_tag LOCUS_00380 38511 39866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40518 40069 gene locus_tag LOCUS_00390 40518 40069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41765 40830 gene locus_tag LOCUS_00400 gene pfkB 41765 40830 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640859.1 protein_id gnl|my_center|LOCUS_00400 43421 41994 gene locus_tag LOCUS_00410 43421 41994 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799194.1 protein_id gnl|my_center|LOCUS_00410 45480 43582 gene locus_tag LOCUS_00420 gene ftsH 45480 43582 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_00420 46818 45559 gene locus_tag LOCUS_00430 46818 45559 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_00430 49922 47214 gene locus_tag LOCUS_00440 49922 47214 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_00440 50335 49922 gene locus_tag LOCUS_00450 50335 49922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 51587 50325 gene locus_tag LOCUS_00460 51587 50325 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404081.1 protein_id gnl|my_center|LOCUS_00460 54154 51728 gene locus_tag LOCUS_00470 gene ppsA 54154 51728 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023333.1 protein_id gnl|my_center|LOCUS_00470 54546 54471 gene locus_tag LOCUS_t00010 54546 54471 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 55521 54661 gene locus_tag LOCUS_00480 55521 54661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 56578 55715 gene locus_tag LOCUS_00490 56578 55715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 56837 57487 gene locus_tag LOCUS_00500 56837 57487 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924792.1 protein_id gnl|my_center|LOCUS_00500 57484 58821 gene locus_tag LOCUS_00510 57484 58821 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545993.1 protein_id gnl|my_center|LOCUS_00510 58885 59997 gene locus_tag LOCUS_00520 58885 59997 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262874.1 protein_id gnl|my_center|LOCUS_00520 60123 63185 gene locus_tag LOCUS_00530 60123 63185 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_00530 63265 63693 gene locus_tag LOCUS_00540 gene nrdR 63265 63693 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_00540 63714 64775 gene locus_tag LOCUS_00550 gene ribD 63714 64775 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_00550 64893 65540 gene locus_tag LOCUS_00560 64893 65540 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_00560 65577 66836 gene locus_tag LOCUS_00570 65577 66836 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_00570 66846 67313 gene locus_tag LOCUS_00580 gene ribE 66846 67313 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_00580 67337 67765 gene locus_tag LOCUS_00590 gene nusB 67337 67765 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_00590 67922 69070 gene locus_tag LOCUS_00600 67922 69070 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_00600 69421 71592 gene locus_tag LOCUS_00610 69421 71592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 72448 73104 gene locus_tag LOCUS_00620 72448 73104 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_00620 >Feature sequence002 481 660 gene locus_tag LOCUS_00630 481 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 699 965 gene locus_tag LOCUS_00640 699 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 1015 1197 gene locus_tag LOCUS_00650 1015 1197 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583928.1 protein_id gnl|my_center|LOCUS_00650 1484 3985 gene locus_tag LOCUS_00660 1484 3985 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_00660 3982 4359 gene locus_tag LOCUS_00670 3982 4359 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707451.1 protein_id gnl|my_center|LOCUS_00670 4475 4702 gene locus_tag LOCUS_00680 4475 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 6930 4759 gene locus_tag LOCUS_00690 6930 4759 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085539.1 protein_id gnl|my_center|LOCUS_00690 7992 6937 gene locus_tag LOCUS_00700 7992 6937 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938929.1 protein_id gnl|my_center|LOCUS_00700 10862 8199 gene locus_tag LOCUS_00710 gene alaS 10862 8199 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_00710 11385 10876 gene locus_tag LOCUS_00720 11385 10876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 12580 11408 gene locus_tag LOCUS_00730 12580 11408 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_00730 13600 12584 gene locus_tag LOCUS_00740 gene recA 13600 12584 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_00740 14312 13743 gene locus_tag LOCUS_00750 gene thpR 14312 13743 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_00750 14794 14315 gene locus_tag LOCUS_00760 14794 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 15150 14785 gene locus_tag LOCUS_00770 15150 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 16513 15422 gene locus_tag LOCUS_00780 gene rodA 16513 15422 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_00780 18435 16510 gene locus_tag LOCUS_00790 gene mrdA 18435 16510 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_00790 18920 18432 gene locus_tag LOCUS_00800 18920 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 19834 18917 gene locus_tag LOCUS_00810 gene mreC 19834 18917 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_00810 20871 19837 gene locus_tag LOCUS_00820 20871 19837 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_00820 21108 23030 gene locus_tag LOCUS_00830 21108 23030 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_00830 23099 24814 gene locus_tag LOCUS_00840 23099 24814 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_00840 24900 25538 gene locus_tag LOCUS_00850 24900 25538 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704514.1 protein_id gnl|my_center|LOCUS_00850 25631 26146 gene locus_tag LOCUS_00860 25631 26146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 26452 27162 gene locus_tag LOCUS_00870 26452 27162 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_00870 27434 27255 gene locus_tag LOCUS_00880 27434 27255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 27503 27730 gene locus_tag LOCUS_00890 27503 27730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 27739 28899 gene locus_tag LOCUS_00900 27739 28899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 28904 31066 gene locus_tag LOCUS_00910 28904 31066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 31063 33033 gene locus_tag LOCUS_00920 31063 33033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 33240 35981 gene locus_tag LOCUS_00930 33240 35981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 36035 36463 gene locus_tag LOCUS_00940 36035 36463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 37366 39069 gene locus_tag LOCUS_00950 gene pilB 37366 39069 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_00950 39139 40257 gene locus_tag LOCUS_00960 39139 40257 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_00960 40279 41502 gene locus_tag LOCUS_00970 40279 41502 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_00970 41508 43250 gene locus_tag LOCUS_00980 41508 43250 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_00980 43254 44687 gene locus_tag LOCUS_00990 43254 44687 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_00990 44671 46950 gene locus_tag LOCUS_01000 44671 46950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 47133 47540 gene locus_tag LOCUS_01010 47133 47540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 48066 49100 gene locus_tag LOCUS_01020 48066 49100 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169951.1 protein_id gnl|my_center|LOCUS_01020 49460 49861 gene locus_tag LOCUS_01030 49460 49861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 50143 50322 gene locus_tag LOCUS_01040 50143 50322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 50527 51036 gene locus_tag LOCUS_01050 50527 51036 CDS product glycine/sarcosine/betaine reductase selenoprotein B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255959.1 protein_id gnl|my_center|LOCUS_01050 51055 51324 gene locus_tag LOCUS_01060 51055 51324 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255960.1 protein_id gnl|my_center|LOCUS_01060 52550 51381 gene locus_tag LOCUS_01070 52550 51381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 52803 53942 gene locus_tag LOCUS_01080 52803 53942 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_01080 54163 54420 gene locus_tag LOCUS_01090 54163 54420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 54588 54875 gene locus_tag LOCUS_01100 54588 54875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 57042 55684 gene locus_tag LOCUS_01110 gene merA 57042 55684 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031938.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 57500 57204 gene locus_tag LOCUS_01120 57500 57204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 57977 57627 gene locus_tag LOCUS_01130 gene merT 57977 57627 CDS product mercuric ion transporter MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294656.1 protein_id gnl|my_center|LOCUS_01130 58420 57974 gene locus_tag LOCUS_01140 gene zntR 58420 57974 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456436.1 protein_id gnl|my_center|LOCUS_01140 59051 59305 gene locus_tag LOCUS_01150 59051 59305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 59319 59801 gene locus_tag LOCUS_01160 59319 59801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 60512 59838 gene locus_tag LOCUS_01170 60512 59838 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941299.1 protein_id gnl|my_center|LOCUS_01170 61871 60522 gene locus_tag LOCUS_01180 61871 60522 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_01180 >Feature sequence003 <1 784 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaaggaacgaagaccttaaatagaagggattgagac 1049 1927 gene locus_tag LOCUS_01190 1049 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 2352 2612 gene locus_tag LOCUS_01200 gene cas2 2352 2612 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545199.1 protein_id gnl|my_center|LOCUS_01200 2686 3654 gene locus_tag LOCUS_01210 gene cas1 2686 3654 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_01210 3635 4456 gene locus_tag LOCUS_01220 3635 4456 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546877.1 protein_id gnl|my_center|LOCUS_01220 4453 4743 gene locus_tag LOCUS_01230 gene cas2 4453 4743 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546007.1 protein_id gnl|my_center|LOCUS_01230 4776 5723 gene locus_tag LOCUS_01240 gene cas6 4776 5723 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_01240 5833 6276 gene locus_tag LOCUS_01250 5833 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 6437 6562 gene locus_tag LOCUS_01260 6437 6562 CDS product desulfoferrodoxin FeS4 iron-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023638.1 protein_id gnl|my_center|LOCUS_01260 6848 7954 gene locus_tag LOCUS_01270 gene fbp 6848 7954 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881162.1 protein_id gnl|my_center|LOCUS_01270 8130 9140 gene locus_tag LOCUS_01280 8130 9140 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_01280 9356 9859 gene locus_tag LOCUS_01290 9356 9859 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943963.1 protein_id gnl|my_center|LOCUS_01290 9899 10909 gene locus_tag LOCUS_01300 gene amrS 9899 10909 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_01300 10906 11418 gene locus_tag LOCUS_01310 10906 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 11659 11967 gene locus_tag LOCUS_01320 11659 11967 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545454.1 protein_id gnl|my_center|LOCUS_01320 12036 13016 gene locus_tag LOCUS_01330 gene rtcA 12036 13016 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_01330 13223 13690 gene locus_tag LOCUS_01340 13223 13690 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880186.1 protein_id gnl|my_center|LOCUS_01340 13799 14380 gene locus_tag LOCUS_01350 13799 14380 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880943.1 protein_id gnl|my_center|LOCUS_01350 14392 14994 gene locus_tag LOCUS_01360 14392 14994 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_01360 15234 16781 gene locus_tag LOCUS_01370 15234 16781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 17621 16830 gene locus_tag LOCUS_01380 17621 16830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_01380 18358 17618 gene locus_tag LOCUS_01390 18358 17618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_01390 18542 19192 gene locus_tag LOCUS_01400 gene tmk 18542 19192 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_01400 19250 20242 gene locus_tag LOCUS_01410 gene holB 19250 20242 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_01410 20284 21012 gene locus_tag LOCUS_01420 20284 21012 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_01420 21009 22553 gene locus_tag LOCUS_01430 gene metG 21009 22553 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_01430 22766 24157 gene locus_tag LOCUS_01440 22766 24157 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943126.1 protein_id gnl|my_center|LOCUS_01440 24387 24563 gene locus_tag LOCUS_01450 24387 24563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 24755 25642 gene locus_tag LOCUS_01460 gene era 24755 25642 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_01460 25769 27079 gene locus_tag LOCUS_01470 gene der 25769 27079 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_01470 27401 29293 gene locus_tag LOCUS_01480 gene ftsH 27401 29293 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_01480 29517 30749 gene locus_tag LOCUS_01490 gene folP 29517 30749 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391658.1 protein_id gnl|my_center|LOCUS_01490 30765 31556 gene locus_tag LOCUS_01500 gene cdaA 30765 31556 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_01500 31553 32266 gene locus_tag LOCUS_01510 31553 32266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 32276 33637 gene locus_tag LOCUS_01520 gene glmM 32276 33637 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_01520 33663 34376 gene locus_tag LOCUS_01530 33663 34376 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_01530 34400 34753 gene locus_tag LOCUS_01540 34400 34753 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_01540 34820 36388 gene locus_tag LOCUS_01550 34820 36388 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_01550 36489 36950 gene locus_tag LOCUS_01560 gene tsaE 36489 36950 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_01560 36996 38387 gene locus_tag LOCUS_01570 gene lpdA 36996 38387 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_01570 38399 39637 gene locus_tag LOCUS_01580 38399 39637 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_01580 39678 41285 gene locus_tag LOCUS_01590 gene cimA 39678 41285 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_01590 41287 41769 gene locus_tag LOCUS_01600 41287 41769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 41898 42632 gene locus_tag LOCUS_01610 41898 42632 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057504658.1 protein_id gnl|my_center|LOCUS_01610 42633 43937 gene locus_tag LOCUS_01620 gene purB 42633 43937 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_01620 43997 44716 gene locus_tag LOCUS_01630 43997 44716 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_01630 44751 45302 gene locus_tag LOCUS_01640 44751 45302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 45331 45573 gene locus_tag LOCUS_01650 gene purS 45331 45573 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278823.1 protein_id gnl|my_center|LOCUS_01650 45836 45624 gene locus_tag LOCUS_01660 45836 45624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 45823 46515 gene locus_tag LOCUS_01670 gene purQ 45823 46515 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_01670 46622 47494 gene locus_tag LOCUS_01680 46622 47494 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_01680 47766 47533 gene locus_tag LOCUS_01690 47766 47533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 47866 48441 gene locus_tag LOCUS_01700 47866 48441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 48458 48967 gene locus_tag LOCUS_01710 48458 48967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 49049 49124 gene locus_tag LOCUS_t00020 49049 49124 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 50192 49167 gene locus_tag LOCUS_01720 gene namA 50192 49167 CDS product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732493.1 protein_id gnl|my_center|LOCUS_01720 50889 50221 gene locus_tag LOCUS_01730 50889 50221 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 protein_id gnl|my_center|LOCUS_01730 51139 51633 gene locus_tag LOCUS_01740 51139 51633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 51897 54338 gene locus_tag LOCUS_01750 gene gyrA 51897 54338 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_01750 54508 55305 gene locus_tag LOCUS_01760 54508 55305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 55350 56351 gene locus_tag LOCUS_01770 55350 56351 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_01770 56687 59065 gene locus_tag LOCUS_01780 56687 59065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 59114 59803 gene locus_tag LOCUS_01790 59114 59803 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_01790 59856 61199 gene locus_tag LOCUS_01800 59856 61199 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546190.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence004 946 623 gene locus_tag LOCUS_01810 946 623 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_01810 2144 951 gene locus_tag LOCUS_01820 2144 951 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175675.1 protein_id gnl|my_center|LOCUS_01820 3702 2152 gene locus_tag LOCUS_01830 3702 2152 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_01830 4840 3692 gene locus_tag LOCUS_01840 4840 3692 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142291.1 protein_id gnl|my_center|LOCUS_01840 5440 6258 gene locus_tag LOCUS_01850 5440 6258 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_01850 6259 6531 gene locus_tag LOCUS_01860 6259 6531 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_01860 6557 8200 gene locus_tag LOCUS_01870 6557 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 9614 8436 gene locus_tag LOCUS_01880 gene ftsZ 9614 8436 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943688.1 protein_id gnl|my_center|LOCUS_01880 10923 9697 gene locus_tag LOCUS_01890 gene ftsA 10923 9697 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_01890 11760 10924 gene locus_tag LOCUS_01900 11760 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 12689 11763 gene locus_tag LOCUS_01910 12689 11763 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_01910 13652 12744 gene locus_tag LOCUS_01920 gene murB 13652 12744 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_01920 15104 13689 gene locus_tag LOCUS_01930 gene murC 15104 13689 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_01930 16194 15106 gene locus_tag LOCUS_01940 gene murG 16194 15106 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_01940 17291 16191 gene locus_tag LOCUS_01950 gene ftsW 17291 16191 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_01950 18676 17288 gene locus_tag LOCUS_01960 gene murD 18676 17288 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_01960 19746 18673 gene locus_tag LOCUS_01970 gene mraY 19746 18673 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_01970 21169 19754 gene locus_tag LOCUS_01980 21169 19754 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_01980 22992 21469 gene locus_tag LOCUS_01990 22992 21469 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_01990 24978 23020 gene locus_tag LOCUS_02000 24978 23020 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_02000 25319 24975 gene locus_tag LOCUS_02010 25319 24975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 26272 25331 gene locus_tag LOCUS_02020 gene rsmH 26272 25331 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_02020 26709 26275 gene locus_tag LOCUS_02030 gene mraZ 26709 26275 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_02030 27991 27857 gene locus_tag LOCUS_02040 27991 27857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 28811 28251 gene locus_tag LOCUS_02050 28811 28251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 29564 28815 gene locus_tag LOCUS_02060 29564 28815 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_02060 29693 29618 gene locus_tag LOCUS_t00030 29693 29618 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 29858 30289 gene locus_tag LOCUS_02070 29858 30289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 30378 30812 gene locus_tag LOCUS_02080 30378 30812 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257725.1 protein_id gnl|my_center|LOCUS_02080 30822 31754 gene locus_tag LOCUS_02090 30822 31754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 31914 33188 gene locus_tag LOCUS_02100 31914 33188 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_02100 33211 34881 gene locus_tag LOCUS_02110 33211 34881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 35058 38195 gene locus_tag LOCUS_02120 35058 38195 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706761.1 protein_id gnl|my_center|LOCUS_02120 38209 38574 gene locus_tag LOCUS_02130 38209 38574 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_02130 38637 38975 gene locus_tag LOCUS_02140 38637 38975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 39055 39492 gene locus_tag LOCUS_02150 39055 39492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 39513 39842 gene locus_tag LOCUS_02160 39513 39842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 39770 40030 gene locus_tag LOCUS_02170 39770 40030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 40027 40233 gene locus_tag LOCUS_02180 40027 40233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 40507 40289 gene locus_tag LOCUS_02190 40507 40289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 40539 40715 gene locus_tag LOCUS_02200 40539 40715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 40867 43518 gene locus_tag LOCUS_02210 40867 43518 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_02210 43607 44689 gene locus_tag LOCUS_02220 43607 44689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 44902 45258 gene locus_tag LOCUS_02230 44902 45258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 45351 46394 gene locus_tag LOCUS_02240 45351 46394 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763430.1 protein_id gnl|my_center|LOCUS_02240 46489 46833 gene locus_tag LOCUS_02250 46489 46833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 48882 46840 gene locus_tag LOCUS_02260 48882 46840 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086001.1 protein_id gnl|my_center|LOCUS_02260 49728 48901 gene locus_tag LOCUS_02270 49728 48901 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086000.1 protein_id gnl|my_center|LOCUS_02270 51060 49729 gene locus_tag LOCUS_02280 gene norB 51060 49729 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_02280 51523 51107 gene locus_tag LOCUS_02290 gene norC 51523 51107 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_02290 52524 51847 gene locus_tag LOCUS_02300 52524 51847 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_02300 53346 52528 gene locus_tag LOCUS_02310 53346 52528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 54176 53361 gene locus_tag LOCUS_02320 54176 53361 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_02320 55163 54186 gene locus_tag LOCUS_02330 55163 54186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 55633 55184 gene locus_tag LOCUS_02340 55633 55184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 56653 55982 gene locus_tag LOCUS_02350 56653 55982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 >Feature sequence005 260 185 gene locus_tag LOCUS_t00040 260 185 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 375 302 gene locus_tag LOCUS_t00050 375 302 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 904 820 gene locus_tag LOCUS_t00060 904 820 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1107 1032 gene locus_tag LOCUS_t00070 1107 1032 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2350 1322 gene locus_tag LOCUS_02360 gene prfB 2350 1322 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_02360 4003 2462 gene locus_tag LOCUS_02370 gene lnt 4003 2462 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_02370 4743 4000 gene locus_tag LOCUS_02380 4743 4000 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648148.1 protein_id gnl|my_center|LOCUS_02380 5301 4870 gene locus_tag LOCUS_02390 gene ybeY 5301 4870 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880869.1 protein_id gnl|my_center|LOCUS_02390 6293 5298 gene locus_tag LOCUS_02400 6293 5298 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_02400 8092 6347 gene locus_tag LOCUS_02410 8092 6347 CDS product 1,4-alpha-glucan branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250387.1 protein_id gnl|my_center|LOCUS_02410 8402 8557 gene locus_tag LOCUS_02420 8402 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 9470 8547 gene locus_tag LOCUS_02430 gene lpxC 9470 8547 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073895.1 protein_id gnl|my_center|LOCUS_02430 9834 9601 gene locus_tag LOCUS_02440 9834 9601 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941743.1 protein_id gnl|my_center|LOCUS_02440 10522 11016 gene locus_tag LOCUS_02450 10522 11016 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_02450 11009 11263 gene locus_tag LOCUS_02460 11009 11263 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_02460 11263 11613 gene locus_tag LOCUS_02470 gene mnhG 11263 11613 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942974.1 protein_id gnl|my_center|LOCUS_02470 11642 12205 gene locus_tag LOCUS_02480 11642 12205 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_02480 12202 12651 gene locus_tag LOCUS_02490 12202 12651 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_02490 12644 13030 gene locus_tag LOCUS_02500 12644 13030 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_02500 13039 14535 gene locus_tag LOCUS_02510 13039 14535 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_02510 14540 16009 gene locus_tag LOCUS_02520 14540 16009 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969265.1 protein_id gnl|my_center|LOCUS_02520 16006 16224 gene locus_tag LOCUS_02530 16006 16224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396786.1 protein_id gnl|my_center|LOCUS_02530 16217 17998 gene locus_tag LOCUS_02540 16217 17998 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396787.1 protein_id gnl|my_center|LOCUS_02540 18097 19263 gene locus_tag LOCUS_02550 gene hemW 18097 19263 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_02550 19344 20420 gene locus_tag LOCUS_02560 gene hrcA 19344 20420 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_02560 20483 21091 gene locus_tag LOCUS_02570 gene grpE 20483 21091 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546170.1 protein_id gnl|my_center|LOCUS_02570 21203 22297 gene locus_tag LOCUS_02580 gene dnaJ 21203 22297 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_02580 22294 23904 gene locus_tag LOCUS_02590 22294 23904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 23982 24350 gene locus_tag LOCUS_02600 gene dksA 23982 24350 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_02600 24489 25490 gene locus_tag LOCUS_02610 gene galT 24489 25490 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_02610 25573 26793 gene locus_tag LOCUS_02620 25573 26793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 26827 27189 gene locus_tag LOCUS_02630 26827 27189 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081556.1 protein_id gnl|my_center|LOCUS_02630 27235 27310 gene locus_tag LOCUS_t00080 27235 27310 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27690 28292 gene locus_tag LOCUS_02640 27690 28292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 28276 28707 gene locus_tag LOCUS_02650 28276 28707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 30048 30899 gene locus_tag LOCUS_02660 30048 30899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 33243 31144 gene locus_tag LOCUS_02670 33243 31144 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_02670 34939 33413 gene locus_tag LOCUS_02680 34939 33413 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_02680 36338 35037 gene locus_tag LOCUS_02690 gene thiC 36338 35037 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943635.1 protein_id gnl|my_center|LOCUS_02690 37127 36492 gene locus_tag LOCUS_02700 gene cobC 37127 36492 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 protein_id gnl|my_center|LOCUS_02700 37876 37124 gene locus_tag LOCUS_02710 gene cobS 37876 37124 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943638.1 protein_id gnl|my_center|LOCUS_02710 38937 37873 gene locus_tag LOCUS_02720 gene cobT 38937 37873 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_02720 39776 39237 gene locus_tag LOCUS_02730 gene cobU 39776 39237 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316292.1 protein_id gnl|my_center|LOCUS_02730 40360 39785 gene locus_tag LOCUS_02740 gene cobO 40360 39785 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392864.1 protein_id gnl|my_center|LOCUS_02740 42220 40625 gene locus_tag LOCUS_02750 gene rpoD 42220 40625 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_02750 44010 42277 gene locus_tag LOCUS_02760 gene dnaG 44010 42277 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_02760 46326 44014 gene locus_tag LOCUS_02770 46326 44014 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_02770 47534 46584 gene locus_tag LOCUS_02780 47534 46584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545019.1 protein_id gnl|my_center|LOCUS_02780 48077 47631 gene locus_tag LOCUS_02790 48077 47631 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943713.1 protein_id gnl|my_center|LOCUS_02790 48867 48280 gene locus_tag LOCUS_02800 48867 48280 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_02800 49403 48921 gene locus_tag LOCUS_02810 49403 48921 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_02810 50485 49550 gene locus_tag LOCUS_02820 50485 49550 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_02820 51697 50501 gene locus_tag LOCUS_02830 51697 50501 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_02830 51993 51700 gene locus_tag LOCUS_02840 gene porD 51993 51700 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082458.1 protein_id gnl|my_center|LOCUS_02840 52592 51996 gene locus_tag LOCUS_02850 52592 51996 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_02850 53307 52699 gene locus_tag LOCUS_02860 gene recR 53307 52699 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_02860 53766 53443 gene locus_tag LOCUS_02870 53766 53443 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_02870 55282 53759 gene locus_tag LOCUS_02880 55282 53759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 >Feature sequence006 410 198 gene locus_tag LOCUS_02890 410 198 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545632.1 protein_id gnl|my_center|LOCUS_02890 533 1441 gene locus_tag LOCUS_02900 533 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 2973 1489 gene locus_tag LOCUS_02910 gene gcvPB 2973 1489 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_02910 4365 2977 gene locus_tag LOCUS_02920 gene gcvPA 4365 2977 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_02920 4754 4368 gene locus_tag LOCUS_02930 gene gcvH 4754 4368 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026899.1 protein_id gnl|my_center|LOCUS_02930 6042 4924 gene locus_tag LOCUS_02940 gene gcvT 6042 4924 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_02940 6667 7785 gene locus_tag LOCUS_02950 6667 7785 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545303.1 protein_id gnl|my_center|LOCUS_02950 7886 8392 gene locus_tag LOCUS_02960 7886 8392 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_02960 8948 9604 gene locus_tag LOCUS_02970 8948 9604 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941342.1 protein_id gnl|my_center|LOCUS_02970 9839 10132 gene locus_tag LOCUS_02980 9839 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 10232 11482 gene locus_tag LOCUS_02990 10232 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 11583 11951 gene locus_tag LOCUS_03000 11583 11951 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 protein_id gnl|my_center|LOCUS_03000 11985 14015 gene locus_tag LOCUS_03010 11985 14015 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037054.1 protein_id gnl|my_center|LOCUS_03010 14098 14634 gene locus_tag LOCUS_03020 gene cheW 14098 14634 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210885.1 protein_id gnl|my_center|LOCUS_03020 14671 15795 gene locus_tag LOCUS_03030 14671 15795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 15971 18004 gene locus_tag LOCUS_03040 15971 18004 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063734.1 protein_id gnl|my_center|LOCUS_03040 18007 18840 gene locus_tag LOCUS_03050 18007 18840 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002145390.1 protein_id gnl|my_center|LOCUS_03050 19078 20193 gene locus_tag LOCUS_03060 19078 20193 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_03060 21422 20766 gene locus_tag LOCUS_03070 gene nreC 21422 20766 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485230.1 protein_id gnl|my_center|LOCUS_03070 24039 21427 gene locus_tag LOCUS_03080 24039 21427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 24702 25520 gene locus_tag LOCUS_03090 24702 25520 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_03090 26306 25593 gene locus_tag LOCUS_03100 26306 25593 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_03100 26557 26865 gene locus_tag LOCUS_03110 26557 26865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 27017 27844 gene locus_tag LOCUS_03120 27017 27844 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_03120 27841 29520 gene locus_tag LOCUS_03130 gene argS 27841 29520 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869400.1 protein_id gnl|my_center|LOCUS_03130 29856 30062 gene locus_tag LOCUS_03140 gene rpsU 29856 30062 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941574.1 protein_id gnl|my_center|LOCUS_03140 32048 30066 gene locus_tag LOCUS_03150 gene acs 32048 30066 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_03150 32461 32952 gene locus_tag LOCUS_03160 gene tadA 32461 32952 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_03160 32977 34434 gene locus_tag LOCUS_03170 32977 34434 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582491.1 protein_id gnl|my_center|LOCUS_03170 35276 34617 gene locus_tag LOCUS_03180 35276 34617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 37029 35263 gene locus_tag LOCUS_03190 37029 35263 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_03190 37565 37290 gene locus_tag LOCUS_03200 37565 37290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 37699 38025 gene locus_tag LOCUS_03210 gene trxA 37699 38025 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_03210 38160 38702 gene locus_tag LOCUS_03220 38160 38702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 38887 39405 gene locus_tag LOCUS_03230 38887 39405 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545049.1 protein_id gnl|my_center|LOCUS_03230 39575 41329 gene locus_tag LOCUS_03240 39575 41329 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_03240 42008 41571 gene locus_tag LOCUS_03250 42008 41571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 42754 42005 gene locus_tag LOCUS_03260 gene ubiE 42754 42005 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_03260 44447 42756 gene locus_tag LOCUS_03270 gene ubiB 44447 42756 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_03270 44865 44464 gene locus_tag LOCUS_03280 44865 44464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 45824 44919 gene locus_tag LOCUS_03290 45824 44919 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080854800.1 protein_id gnl|my_center|LOCUS_03290 46121 46678 gene locus_tag LOCUS_03300 46121 46678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 47699 46692 gene locus_tag LOCUS_03310 47699 46692 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815453.1 protein_id gnl|my_center|LOCUS_03310 48222 47806 gene locus_tag LOCUS_03320 48222 47806 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_03320 48448 49143 gene locus_tag LOCUS_03330 48448 49143 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_03330 49262 50923 gene locus_tag LOCUS_03340 49262 50923 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_03340 51188 51883 gene locus_tag LOCUS_03350 51188 51883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 52121 53233 gene locus_tag LOCUS_03360 52121 53233 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941750.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence007 26 949 gene locus_tag LOCUS_03370 26 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 1066 1938 gene locus_tag LOCUS_03380 1066 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 2579 1941 gene locus_tag LOCUS_03390 2579 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 3528 4700 gene locus_tag LOCUS_03400 3528 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 4852 6288 gene locus_tag LOCUS_03410 gene tilS 4852 6288 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_03410 6411 6902 gene locus_tag LOCUS_03420 6411 6902 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_03420 6899 7885 gene locus_tag LOCUS_03430 6899 7885 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_03430 7887 9350 gene locus_tag LOCUS_03440 gene guaB 7887 9350 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_03440 9439 10986 gene locus_tag LOCUS_03450 gene guaA 9439 10986 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_03450 10991 11671 gene locus_tag LOCUS_03460 10991 11671 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545458.1 protein_id gnl|my_center|LOCUS_03460 11745 11945 gene locus_tag LOCUS_03470 11745 11945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 12102 13085 gene locus_tag LOCUS_03480 gene sppA 12102 13085 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941487.1 protein_id gnl|my_center|LOCUS_03480 13269 13063 gene locus_tag LOCUS_03490 13269 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 13390 14874 gene locus_tag LOCUS_03500 13390 14874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 15081 16415 gene locus_tag LOCUS_03510 gene rsxC 15081 16415 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_03510 16767 17804 gene locus_tag LOCUS_03520 16767 17804 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082949.1 protein_id gnl|my_center|LOCUS_03520 17801 18409 gene locus_tag LOCUS_03530 17801 18409 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_03530 18411 19028 gene locus_tag LOCUS_03540 18411 19028 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_03540 19025 19603 gene locus_tag LOCUS_03550 gene rsxA 19025 19603 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082952.1 protein_id gnl|my_center|LOCUS_03550 19680 20537 gene locus_tag LOCUS_03560 19680 20537 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_03560 20856 21239 gene locus_tag LOCUS_03570 20856 21239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 21250 21828 gene locus_tag LOCUS_03580 21250 21828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 21864 23249 gene locus_tag LOCUS_03590 21864 23249 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_03590 23267 24169 gene locus_tag LOCUS_03600 gene ccsB 23267 24169 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_03600 24341 24928 gene locus_tag LOCUS_03610 24341 24928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 24967 25725 gene locus_tag LOCUS_03620 24967 25725 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_03620 25741 26046 gene locus_tag LOCUS_03630 25741 26046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 26519 27064 gene locus_tag LOCUS_03640 26519 27064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 27398 29626 gene locus_tag LOCUS_03650 27398 29626 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_03650 29623 30969 gene locus_tag LOCUS_03660 29623 30969 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_03660 31457 32872 gene locus_tag LOCUS_03670 31457 32872 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_03670 32926 33678 gene locus_tag LOCUS_03680 32926 33678 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_03680 33937 34443 gene locus_tag LOCUS_03690 gene ruvC 33937 34443 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_03690 34583 35188 gene locus_tag LOCUS_03700 gene ruvA 34583 35188 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_03700 35338 36369 gene locus_tag LOCUS_03710 gene ruvB 35338 36369 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_03710 36393 36938 gene locus_tag LOCUS_03720 36393 36938 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941742.1 protein_id gnl|my_center|LOCUS_03720 36993 38198 gene locus_tag LOCUS_03730 36993 38198 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941586.1 protein_id gnl|my_center|LOCUS_03730 38244 38618 gene locus_tag LOCUS_03740 38244 38618 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924922.1 protein_id gnl|my_center|LOCUS_03740 38680 39642 gene locus_tag LOCUS_03750 38680 39642 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_03750 39665 40144 gene locus_tag LOCUS_03760 39665 40144 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546746.1 protein_id gnl|my_center|LOCUS_03760 40227 42428 gene locus_tag LOCUS_03770 gene purL 40227 42428 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_03770 42456 43856 gene locus_tag LOCUS_03780 gene purF 42456 43856 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_03780 43981 44697 gene locus_tag LOCUS_03790 43981 44697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 45027 45572 gene locus_tag LOCUS_03800 45027 45572 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_03800 45569 46060 gene locus_tag LOCUS_03810 45569 46060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 48739 46088 gene locus_tag LOCUS_03820 48739 46088 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_03820 48815 49075 gene locus_tag LOCUS_03830 48815 49075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 49108 49710 gene locus_tag LOCUS_03840 gene pncA 49108 49710 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942927.1 protein_id gnl|my_center|LOCUS_03840 50149 49889 gene locus_tag LOCUS_03850 50149 49889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 50528 50325 gene locus_tag LOCUS_03860 50528 50325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 50961 50788 gene locus_tag LOCUS_03870 50961 50788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence008 222 1424 gene locus_tag LOCUS_03880 222 1424 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_03880 1894 2691 gene locus_tag LOCUS_03890 1894 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2831 3316 gene locus_tag LOCUS_03900 2831 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3817 5514 gene locus_tag LOCUS_03910 3817 5514 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060907.1 protein_id gnl|my_center|LOCUS_03910 5991 5593 gene locus_tag LOCUS_03920 5991 5593 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_03920 6420 7259 gene locus_tag LOCUS_03930 6420 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 7783 7283 gene locus_tag LOCUS_03940 7783 7283 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545624.1 protein_id gnl|my_center|LOCUS_03940 9338 7815 gene locus_tag LOCUS_03950 9338 7815 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_03950 10436 9408 gene locus_tag LOCUS_03960 10436 9408 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_03960 12084 10639 gene locus_tag LOCUS_03970 12084 10639 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_03970 12685 12131 gene locus_tag LOCUS_03980 12685 12131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 14430 13060 gene locus_tag LOCUS_03990 gene radA 14430 13060 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_03990 14738 16324 gene locus_tag LOCUS_04000 14738 16324 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940958.1 protein_id gnl|my_center|LOCUS_04000 16321 17658 gene locus_tag LOCUS_04010 16321 17658 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940959.1 protein_id gnl|my_center|LOCUS_04010 18250 17687 gene locus_tag LOCUS_04020 18250 17687 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940960.1 protein_id gnl|my_center|LOCUS_04020 19609 18260 gene locus_tag LOCUS_04030 gene trmFO 19609 18260 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_04030 19662 19949 gene locus_tag LOCUS_04040 19662 19949 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_04040 19986 20657 gene locus_tag LOCUS_04050 19986 20657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 21177 20725 gene locus_tag LOCUS_04060 21177 20725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 21891 21454 gene locus_tag LOCUS_04070 21891 21454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 22851 22030 gene locus_tag LOCUS_04080 gene rsmI 22851 22030 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_04080 23615 22854 gene locus_tag LOCUS_04090 23615 22854 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_04090 24577 23612 gene locus_tag LOCUS_04100 24577 23612 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_04100 25717 24665 gene locus_tag LOCUS_04110 25717 24665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 26412 25717 gene locus_tag LOCUS_04120 26412 25717 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_04120 26818 26414 gene locus_tag LOCUS_04130 gene arsC 26818 26414 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830465.1 protein_id gnl|my_center|LOCUS_04130 28308 26890 gene locus_tag LOCUS_04140 gene gltA 28308 26890 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926868.1 protein_id gnl|my_center|LOCUS_04140 29172 28312 gene locus_tag LOCUS_04150 29172 28312 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_04150 30117 29374 gene locus_tag LOCUS_04160 30117 29374 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_04160 31159 30146 gene locus_tag LOCUS_04170 31159 30146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04170 32041 31193 gene locus_tag LOCUS_04180 32041 31193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04180 32959 32078 gene locus_tag LOCUS_04190 32959 32078 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_04190 33415 33212 gene locus_tag LOCUS_04200 33415 33212 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941573.1 protein_id gnl|my_center|LOCUS_04200 34434 33592 gene locus_tag LOCUS_04210 34434 33592 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942413.1 protein_id gnl|my_center|LOCUS_04210 35770 34472 gene locus_tag LOCUS_04220 35770 34472 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_04220 37048 35888 gene locus_tag LOCUS_04230 37048 35888 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_04230 37960 37067 gene locus_tag LOCUS_04240 gene ftsX 37960 37067 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942418.1 protein_id gnl|my_center|LOCUS_04240 38613 37960 gene locus_tag LOCUS_04250 gene ftsE 38613 37960 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_04250 39043 38967 gene locus_tag LOCUS_t00090 39043 38967 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 39176 39101 gene locus_tag LOCUS_t00100 39176 39101 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 41811 39289 gene locus_tag LOCUS_04260 gene lon 41811 39289 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_04260 43090 41822 gene locus_tag LOCUS_04270 gene clpX 43090 41822 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_04270 43707 43126 gene locus_tag LOCUS_04280 gene clpP 43707 43126 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_04280 45029 43743 gene locus_tag LOCUS_04290 gene tig 45029 43743 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_04290 45539 45457 gene locus_tag LOCUS_t00110 45539 45457 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 47973 46576 gene locus_tag LOCUS_04300 47973 46576 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045022.1 protein_id gnl|my_center|LOCUS_04300 49215 48232 gene locus_tag LOCUS_04310 49215 48232 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_04310 50076 49237 gene locus_tag LOCUS_04320 gene kdsA 50076 49237 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence009 664 152 gene locus_tag LOCUS_04330 664 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04330 1366 1085 gene locus_tag LOCUS_04340 1366 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 2877 1369 gene locus_tag LOCUS_04350 2877 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 9961 2858 gene locus_tag LOCUS_04360 9961 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 10395 11057 gene locus_tag LOCUS_04370 10395 11057 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140230840.1 protein_id gnl|my_center|LOCUS_04370 11974 11384 gene locus_tag LOCUS_04380 11974 11384 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_04380 13538 12045 gene locus_tag LOCUS_04390 13538 12045 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881416.1 protein_id gnl|my_center|LOCUS_04390 15481 13535 gene locus_tag LOCUS_04400 15481 13535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 16294 15485 gene locus_tag LOCUS_04410 16294 15485 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_04410 17807 16362 gene locus_tag LOCUS_04420 gene accC 17807 16362 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_04420 18446 18006 gene locus_tag LOCUS_04430 gene accB 18446 18006 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 protein_id gnl|my_center|LOCUS_04430 19555 18455 gene locus_tag LOCUS_04440 19555 18455 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942664.1 protein_id gnl|my_center|LOCUS_04440 19932 19552 gene locus_tag LOCUS_04450 19932 19552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 20159 19944 gene locus_tag LOCUS_04460 20159 19944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 21352 20243 gene locus_tag LOCUS_04470 gene aroB 21352 20243 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_04470 21886 21371 gene locus_tag LOCUS_04480 21886 21371 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_04480 23134 21932 gene locus_tag LOCUS_04490 gene aroC 23134 21932 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_04490 26856 23590 gene locus_tag LOCUS_04500 26856 23590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 27437 26931 gene locus_tag LOCUS_04510 27437 26931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 28056 27439 gene locus_tag LOCUS_04520 28056 27439 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_04520 28603 28061 gene locus_tag LOCUS_04530 28603 28061 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_04530 29664 28600 gene locus_tag LOCUS_04540 gene pilM 29664 28600 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_04540 30008 29805 gene locus_tag LOCUS_04550 30008 29805 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_04550 30736 30251 gene locus_tag LOCUS_04560 30736 30251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 31679 30741 gene locus_tag LOCUS_04570 31679 30741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 32063 31692 gene locus_tag LOCUS_04580 32063 31692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 35248 32066 gene locus_tag LOCUS_04590 35248 32066 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_04590 35723 35262 gene locus_tag LOCUS_04600 35723 35262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 36673 35723 gene locus_tag LOCUS_04610 36673 35723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 37088 36684 gene locus_tag LOCUS_04620 37088 36684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 38607 37267 gene locus_tag LOCUS_04630 38607 37267 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_04630 40136 38604 gene locus_tag LOCUS_04640 40136 38604 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942685.1 protein_id gnl|my_center|LOCUS_04640 40933 40133 gene locus_tag LOCUS_04650 40933 40133 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_04650 41404 40982 gene locus_tag LOCUS_04660 41404 40982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 42655 41441 gene locus_tag LOCUS_04670 gene argJ 42655 41441 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_04670 45365 42657 gene locus_tag LOCUS_04680 gene secA 45365 42657 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545108.1 protein_id gnl|my_center|LOCUS_04680 46603 45695 gene locus_tag LOCUS_04690 46603 45695 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_04690 46949 47683 gene locus_tag LOCUS_04700 gene tolQ 46949 47683 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_04700 47687 48091 gene locus_tag LOCUS_04710 gene tolR 47687 48091 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_04710 48101 48982 gene locus_tag LOCUS_04720 48101 48982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 >Feature sequence010 201 1685 gene locus_tag LOCUS_04730 gene trpE 201 1685 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_04730 1699 2274 gene locus_tag LOCUS_04740 1699 2274 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_04740 2278 3288 gene locus_tag LOCUS_04750 gene trpD 2278 3288 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_04750 3297 4085 gene locus_tag LOCUS_04760 gene trpC 3297 4085 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_04760 4097 4723 gene locus_tag LOCUS_04770 4097 4723 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_04770 4716 5924 gene locus_tag LOCUS_04780 gene trpB 4716 5924 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_04780 5921 6733 gene locus_tag LOCUS_04790 gene trpA 5921 6733 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_04790 7049 7888 gene locus_tag LOCUS_04800 gene accD 7049 7888 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_04800 8005 9297 gene locus_tag LOCUS_04810 8005 9297 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_04810 9483 11681 gene locus_tag LOCUS_04820 gene lptD 9483 11681 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_04820 11713 12516 gene locus_tag LOCUS_04830 11713 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811766.1 protein_id gnl|my_center|LOCUS_04830 12513 13541 gene locus_tag LOCUS_04840 gene mtaA 12513 13541 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021625.1 protein_id gnl|my_center|LOCUS_04840 13703 15349 gene locus_tag LOCUS_04850 13703 15349 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940448.1 protein_id gnl|my_center|LOCUS_04850 15372 15448 gene locus_tag LOCUS_t00120 15372 15448 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15777 17027 gene locus_tag LOCUS_04860 15777 17027 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_04860 17377 19098 gene locus_tag LOCUS_04870 gene gspE 17377 19098 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_04870 19109 20341 gene locus_tag LOCUS_04880 19109 20341 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938567.1 protein_id gnl|my_center|LOCUS_04880 20349 20834 gene locus_tag LOCUS_04890 gene gspG 20349 20834 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_04890 20844 21305 gene locus_tag LOCUS_04900 20844 21305 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411575.1 protein_id gnl|my_center|LOCUS_04900 21302 21703 gene locus_tag LOCUS_04910 21302 21703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 21715 22410 gene locus_tag LOCUS_04920 21715 22410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 22407 23372 gene locus_tag LOCUS_04930 22407 23372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 23396 24775 gene locus_tag LOCUS_04940 23396 24775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 24759 25361 gene locus_tag LOCUS_04950 24759 25361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 25406 26035 gene locus_tag LOCUS_04960 25406 26035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 26090 28186 gene locus_tag LOCUS_04970 gene gspD 26090 28186 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_04970 28137 28295 gene locus_tag LOCUS_04980 28137 28295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 28538 28849 gene locus_tag LOCUS_04990 gene rplU 28538 28849 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_04990 28863 29114 gene locus_tag LOCUS_05000 gene rpmA 28863 29114 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_05000 29327 30346 gene locus_tag LOCUS_05010 gene obgE 29327 30346 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_05010 30343 31476 gene locus_tag LOCUS_05020 gene proB 30343 31476 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_05020 31586 32842 gene locus_tag LOCUS_05030 31586 32842 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_05030 33010 33426 gene locus_tag LOCUS_05040 33010 33426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 33423 33602 gene locus_tag LOCUS_05050 33423 33602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 33620 35689 gene locus_tag LOCUS_05060 33620 35689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 36589 35741 gene locus_tag LOCUS_05070 36589 35741 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_05070 37912 36614 gene locus_tag LOCUS_05080 37912 36614 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_05080 39247 37961 gene locus_tag LOCUS_05090 39247 37961 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518834.1 protein_id gnl|my_center|LOCUS_05090 39502 39254 gene locus_tag LOCUS_05100 39502 39254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 40023 39529 gene locus_tag LOCUS_05110 40023 39529 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583144.1 protein_id gnl|my_center|LOCUS_05110 41618 40128 gene locus_tag LOCUS_05120 41618 40128 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153932.1 protein_id gnl|my_center|LOCUS_05120 42301 42374 gene locus_tag LOCUS_t00130 42301 42374 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 42455 42874 gene locus_tag LOCUS_05130 42455 42874 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_05130 42878 43690 gene locus_tag LOCUS_05140 42878 43690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 43724 44173 gene locus_tag LOCUS_05150 gene dtd 43724 44173 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_05150 44244 44699 gene locus_tag LOCUS_05160 44244 44699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 45120 44767 gene locus_tag LOCUS_05170 45120 44767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 46295 45273 gene locus_tag LOCUS_05180 46295 45273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence011 2424 514 gene locus_tag LOCUS_05190 2424 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3098 2856 gene locus_tag LOCUS_05200 3098 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 3359 3204 gene locus_tag LOCUS_05210 3359 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 4268 3471 gene locus_tag LOCUS_05220 4268 3471 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_05220 5337 4252 gene locus_tag LOCUS_05230 5337 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 6200 5343 gene locus_tag LOCUS_05240 6200 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 7773 6187 gene locus_tag LOCUS_05250 7773 6187 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_05250 8483 7776 gene locus_tag LOCUS_05260 8483 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 10101 8740 gene locus_tag LOCUS_05270 10101 8740 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_05270 11960 10098 gene locus_tag LOCUS_05280 11960 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 12399 11968 gene locus_tag LOCUS_05290 12399 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 13476 12403 gene locus_tag LOCUS_05300 13476 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 13475 13702 gene locus_tag LOCUS_05310 13475 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 13960 14217 gene locus_tag LOCUS_05320 13960 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 14533 15204 gene locus_tag LOCUS_05330 14533 15204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 15191 16735 gene locus_tag LOCUS_05340 15191 16735 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_05340 17269 18063 gene locus_tag LOCUS_05350 17269 18063 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_05350 18229 19098 gene locus_tag LOCUS_05360 18229 19098 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_05360 19384 19749 gene locus_tag LOCUS_05370 19384 19749 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708735.1 protein_id gnl|my_center|LOCUS_05370 19777 20322 gene locus_tag LOCUS_05380 19777 20322 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967801.1 protein_id gnl|my_center|LOCUS_05380 20319 20819 gene locus_tag LOCUS_05390 20319 20819 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396799.1 protein_id gnl|my_center|LOCUS_05390 20823 22052 gene locus_tag LOCUS_05400 gene nuoD 20823 22052 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396802.1 protein_id gnl|my_center|LOCUS_05400 22107 22574 gene locus_tag LOCUS_05410 gene nuoE 22107 22574 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967798.1 protein_id gnl|my_center|LOCUS_05410 22596 23852 gene locus_tag LOCUS_05420 gene nuoF 22596 23852 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_05420 23930 26449 gene locus_tag LOCUS_05430 gene nuoG 23930 26449 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396812.1 protein_id gnl|my_center|LOCUS_05430 26501 26977 gene locus_tag LOCUS_05440 26501 26977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 27153 28184 gene locus_tag LOCUS_05450 gene nuoH 27153 28184 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396819.1 protein_id gnl|my_center|LOCUS_05450 28181 28774 gene locus_tag LOCUS_05460 28181 28774 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396815.1 protein_id gnl|my_center|LOCUS_05460 28818 29318 gene locus_tag LOCUS_05470 28818 29318 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329056.1 protein_id gnl|my_center|LOCUS_05470 29323 29625 gene locus_tag LOCUS_05480 gene nuoK 29323 29625 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969266.1 protein_id gnl|my_center|LOCUS_05480 29642 31195 gene locus_tag LOCUS_05490 29642 31195 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396789.1 protein_id gnl|my_center|LOCUS_05490 31192 32640 gene locus_tag LOCUS_05500 31192 32640 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396790.1 protein_id gnl|my_center|LOCUS_05500 32648 34117 gene locus_tag LOCUS_05510 32648 34117 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_05510 34114 34365 gene locus_tag LOCUS_05520 34114 34365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969264.1 protein_id gnl|my_center|LOCUS_05520 34358 36115 gene locus_tag LOCUS_05530 34358 36115 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396787.1 protein_id gnl|my_center|LOCUS_05530 36195 37115 gene locus_tag LOCUS_05540 gene ispE 36195 37115 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_05540 37349 37423 gene locus_tag LOCUS_t00140 37349 37423 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 37606 38544 gene locus_tag LOCUS_05550 37606 38544 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_05550 38570 39226 gene locus_tag LOCUS_05560 38570 39226 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_05560 39438 40004 gene locus_tag LOCUS_05570 gene pth 39438 40004 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_05570 40029 42050 gene locus_tag LOCUS_05580 40029 42050 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_05580 42281 43369 gene locus_tag LOCUS_05590 gene ychF 42281 43369 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_05590 43592 43969 gene locus_tag LOCUS_05600 43592 43969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 43962 44270 gene locus_tag LOCUS_05610 gene rpsR 43962 44270 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941327.1 protein_id gnl|my_center|LOCUS_05610 44346 44789 gene locus_tag LOCUS_05620 gene rplI 44346 44789 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_05620 44855 46231 gene locus_tag LOCUS_05630 gene dnaB 44855 46231 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence012 295 846 gene locus_tag LOCUS_05640 295 846 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_05640 1792 1022 gene locus_tag LOCUS_05650 gene xth 1792 1022 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_05650 3504 1834 gene locus_tag LOCUS_05660 3504 1834 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546358.1 protein_id gnl|my_center|LOCUS_05660 4478 3603 gene locus_tag LOCUS_05670 4478 3603 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250768.1 protein_id gnl|my_center|LOCUS_05670 5791 4538 gene locus_tag LOCUS_05680 5791 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6782 5898 gene locus_tag LOCUS_05690 6782 5898 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_05690 7173 7640 gene locus_tag LOCUS_05700 7173 7640 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880795.1 protein_id gnl|my_center|LOCUS_05700 7823 7563 gene locus_tag LOCUS_05710 7823 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 7750 8229 gene locus_tag LOCUS_05720 7750 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 9236 8289 gene locus_tag LOCUS_05730 9236 8289 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_05730 9635 9363 gene locus_tag LOCUS_05740 9635 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 10267 12717 gene locus_tag LOCUS_05750 gene nirB 10267 12717 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195264.1 protein_id gnl|my_center|LOCUS_05750 12714 13019 gene locus_tag LOCUS_05760 gene nirD 12714 13019 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_05760 15946 13148 gene locus_tag LOCUS_05770 15946 13148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 16518 15943 gene locus_tag LOCUS_05780 16518 15943 CDS product 4Fe-4S single cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230227.1 protein_id gnl|my_center|LOCUS_05780 16715 16530 gene locus_tag LOCUS_05790 16715 16530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 17084 16743 gene locus_tag LOCUS_05800 17084 16743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 19230 17095 gene locus_tag LOCUS_05810 19230 17095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 19589 20224 gene locus_tag LOCUS_05820 19589 20224 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941288.1 protein_id gnl|my_center|LOCUS_05820 20221 21564 gene locus_tag LOCUS_05830 gene wbpA 20221 21564 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_05830 21592 22161 gene locus_tag LOCUS_05840 21592 22161 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_05840 22205 23677 gene locus_tag LOCUS_05850 22205 23677 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_05850 23682 24755 gene locus_tag LOCUS_05860 23682 24755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 24759 25550 gene locus_tag LOCUS_05870 24759 25550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 25721 26278 gene locus_tag LOCUS_05880 25721 26278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 26281 27366 gene locus_tag LOCUS_05890 26281 27366 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141176.1 protein_id gnl|my_center|LOCUS_05890 27363 28325 gene locus_tag LOCUS_05900 27363 28325 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_05900 28322 29275 gene locus_tag LOCUS_05910 28322 29275 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_05910 29288 30220 gene locus_tag LOCUS_05920 29288 30220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 30217 31344 gene locus_tag LOCUS_05930 30217 31344 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_05930 31417 32484 gene locus_tag LOCUS_05940 31417 32484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 32773 34224 gene locus_tag LOCUS_05950 32773 34224 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_05950 34233 35666 gene locus_tag LOCUS_05960 34233 35666 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_05960 36067 39558 gene locus_tag LOCUS_05970 36067 39558 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_05970 39539 40651 gene locus_tag LOCUS_05980 39539 40651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 40654 42393 gene locus_tag LOCUS_05990 40654 42393 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_05990 42652 43680 gene locus_tag LOCUS_06000 42652 43680 CDS product DUF3644 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933110.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence013 382 606 gene locus_tag LOCUS_06010 382 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 1474 773 gene locus_tag LOCUS_06020 gene radC 1474 773 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328269.1 protein_id gnl|my_center|LOCUS_06020 2610 1807 gene locus_tag LOCUS_06030 2610 1807 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_06030 3995 2658 gene locus_tag LOCUS_06040 3995 2658 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_06040 4732 4082 gene locus_tag LOCUS_06050 4732 4082 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_06050 4756 5625 gene locus_tag LOCUS_06060 4756 5625 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941786.1 protein_id gnl|my_center|LOCUS_06060 6821 5640 gene locus_tag LOCUS_06070 gene coaBC 6821 5640 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_06070 7502 6828 gene locus_tag LOCUS_06080 7502 6828 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_06080 10189 7667 gene locus_tag LOCUS_06090 10189 7667 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943866.1 protein_id gnl|my_center|LOCUS_06090 11907 10651 gene locus_tag LOCUS_06100 gene ahcY 11907 10651 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_06100 13235 12072 gene locus_tag LOCUS_06110 gene metK 13235 12072 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_06110 15108 13366 gene locus_tag LOCUS_06120 gene ptsP 15108 13366 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_06120 15424 15131 gene locus_tag LOCUS_06130 15424 15131 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_06130 15946 15464 gene locus_tag LOCUS_06140 15946 15464 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938924.1 protein_id gnl|my_center|LOCUS_06140 16620 16216 gene locus_tag LOCUS_06150 16620 16216 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_06150 17538 16675 gene locus_tag LOCUS_06160 gene rapZ 17538 16675 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_06160 18470 17541 gene locus_tag LOCUS_06170 gene hprK 18470 17541 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_06170 18991 18515 gene locus_tag LOCUS_06180 18991 18515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 19569 19033 gene locus_tag LOCUS_06190 gene raiA 19569 19033 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_06190 21094 19655 gene locus_tag LOCUS_06200 gene rpoN 21094 19655 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_06200 22039 21317 gene locus_tag LOCUS_06210 gene lptB 22039 21317 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_06210 22517 22008 gene locus_tag LOCUS_06220 22517 22008 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923319.1 protein_id gnl|my_center|LOCUS_06220 23139 22585 gene locus_tag LOCUS_06230 23139 22585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 23841 23302 gene locus_tag LOCUS_06240 23841 23302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 25980 23860 gene locus_tag LOCUS_06250 25980 23860 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250760.1 protein_id gnl|my_center|LOCUS_06250 27209 25977 gene locus_tag LOCUS_06260 27209 25977 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943909.1 protein_id gnl|my_center|LOCUS_06260 28675 27266 gene locus_tag LOCUS_06270 28675 27266 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_06270 29396 28722 gene locus_tag LOCUS_06280 29396 28722 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_06280 30675 29410 gene locus_tag LOCUS_06290 30675 29410 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_06290 33065 30969 gene locus_tag LOCUS_06300 gene pnp 33065 30969 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_06300 33502 33236 gene locus_tag LOCUS_06310 gene rpsO 33502 33236 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_06310 34313 33585 gene locus_tag LOCUS_06320 34313 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 35320 34310 gene locus_tag LOCUS_06330 35320 34310 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_06330 35676 35317 gene locus_tag LOCUS_06340 35676 35317 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942234.1 protein_id gnl|my_center|LOCUS_06340 36052 35753 gene locus_tag LOCUS_06350 36052 35753 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_06350 38398 36140 gene locus_tag LOCUS_06360 38398 36140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 40077 38776 gene locus_tag LOCUS_06370 gene nusA 40077 38776 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_06370 40708 40244 gene locus_tag LOCUS_06380 40708 40244 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_06380 41837 40830 gene locus_tag LOCUS_06390 41837 40830 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_06390 42821 42390 gene locus_tag LOCUS_06400 gene tnpA 42821 42390 CDS product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence014 460 2685 gene locus_tag LOCUS_06410 460 2685 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932043.1 protein_id gnl|my_center|LOCUS_06410 2753 4045 gene locus_tag LOCUS_06420 2753 4045 CDS product succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880832.1 protein_id gnl|my_center|LOCUS_06420 4066 6777 gene locus_tag LOCUS_06430 4066 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 7017 7640 gene locus_tag LOCUS_06440 7017 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 7680 9011 gene locus_tag LOCUS_06450 gene miaB 7680 9011 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_06450 9031 9531 gene locus_tag LOCUS_06460 9031 9531 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_06460 9604 10629 gene locus_tag LOCUS_06470 9604 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 10629 12200 gene locus_tag LOCUS_06480 10629 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 12197 12847 gene locus_tag LOCUS_06490 12197 12847 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_06490 12813 14066 gene locus_tag LOCUS_06500 12813 14066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 14072 16300 gene locus_tag LOCUS_06510 14072 16300 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545008.1 protein_id gnl|my_center|LOCUS_06510 16303 18960 gene locus_tag LOCUS_06520 gene mutS 16303 18960 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_06520 18962 20161 gene locus_tag LOCUS_06530 18962 20161 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942466.1 protein_id gnl|my_center|LOCUS_06530 20177 22804 gene locus_tag LOCUS_06540 gene glnD 20177 22804 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_06540 22811 23731 gene locus_tag LOCUS_06550 gene xerD 22811 23731 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209933.1 protein_id gnl|my_center|LOCUS_06550 24084 23851 gene locus_tag LOCUS_06560 24084 23851 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_06560 25746 24376 gene locus_tag LOCUS_06570 25746 24376 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_06570 26453 25833 gene locus_tag LOCUS_06580 26453 25833 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081572.1 protein_id gnl|my_center|LOCUS_06580 27167 26475 gene locus_tag LOCUS_06590 27167 26475 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774263.1 protein_id gnl|my_center|LOCUS_06590 28153 27164 gene locus_tag LOCUS_06600 28153 27164 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_06600 29319 28150 gene locus_tag LOCUS_06610 29319 28150 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227270.1 protein_id gnl|my_center|LOCUS_06610 30851 29790 gene locus_tag LOCUS_06620 gene exoA 30851 29790 CDS product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061866.1 protein_id gnl|my_center|LOCUS_06620 31764 30895 gene locus_tag LOCUS_06630 31764 30895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 32231 31884 gene locus_tag LOCUS_06640 32231 31884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 35116 34205 gene locus_tag LOCUS_06650 35116 34205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 35428 35210 gene locus_tag LOCUS_06660 35428 35210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 35624 35812 gene locus_tag LOCUS_06670 35624 35812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 36878 36141 gene locus_tag LOCUS_06680 36878 36141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 39633 38704 gene locus_tag LOCUS_06690 39633 38704 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_06690 40586 39645 gene locus_tag LOCUS_06700 40586 39645 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_06700 40803 40600 gene locus_tag LOCUS_06710 40803 40600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 <41630 40852 gene locus_tag LOCUS_06720 <41630 40852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250770.1:flippase >Feature sequence015 344 1297 gene locus_tag LOCUS_06730 gene rpsB 344 1297 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_06730 1416 2030 gene locus_tag LOCUS_06740 gene tsf 1416 2030 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_06740 2177 2890 gene locus_tag LOCUS_06750 gene pyrH 2177 2890 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_06750 2893 3453 gene locus_tag LOCUS_06760 gene frr 2893 3453 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_06760 3500 4243 gene locus_tag LOCUS_06770 3500 4243 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_06770 4446 5117 gene locus_tag LOCUS_06780 4446 5117 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_06780 5135 6280 gene locus_tag LOCUS_06790 5135 6280 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_06790 6293 7594 gene locus_tag LOCUS_06800 gene rseP 6293 7594 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_06800 7607 8308 gene locus_tag LOCUS_06810 gene tsaB 7607 8308 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_06810 8400 8618 gene locus_tag LOCUS_06820 8400 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 8637 10292 gene locus_tag LOCUS_06830 gene ilvD 8637 10292 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942557.1 protein_id gnl|my_center|LOCUS_06830 10633 12327 gene locus_tag LOCUS_06840 gene ilvB 10633 12327 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_06840 12410 12895 gene locus_tag LOCUS_06850 gene ilvN 12410 12895 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_06850 12949 13965 gene locus_tag LOCUS_06860 gene ilvC 12949 13965 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_06860 13987 14664 gene locus_tag LOCUS_06870 13987 14664 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_06870 14685 15473 gene locus_tag LOCUS_06880 gene pssA 14685 15473 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_06880 15551 17089 gene locus_tag LOCUS_06890 15551 17089 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_06890 17156 18442 gene locus_tag LOCUS_06900 gene leuC 17156 18442 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545762.1 protein_id gnl|my_center|LOCUS_06900 18497 18991 gene locus_tag LOCUS_06910 gene leuD 18497 18991 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_06910 18988 19266 gene locus_tag LOCUS_06920 18988 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 19267 20358 gene locus_tag LOCUS_06930 gene leuB 19267 20358 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_06930 21695 20448 gene locus_tag LOCUS_06940 21695 20448 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080989.1 protein_id gnl|my_center|LOCUS_06940 24120 21880 gene locus_tag LOCUS_06950 24120 21880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 25547 24144 gene locus_tag LOCUS_06960 25547 24144 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546737.1 protein_id gnl|my_center|LOCUS_06960 26435 25551 gene locus_tag LOCUS_06970 gene ccsB 26435 25551 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_06970 26586 26894 gene locus_tag LOCUS_06980 26586 26894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 29749 26960 gene locus_tag LOCUS_06990 29749 26960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 30534 29743 gene locus_tag LOCUS_07000 30534 29743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 33217 30437 gene locus_tag LOCUS_07010 33217 30437 CDS product bifunctional glycoside hydrolase 114/ polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113950.1 protein_id gnl|my_center|LOCUS_07010 34553 33183 gene locus_tag LOCUS_07020 gene pelG 34553 33183 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 protein_id gnl|my_center|LOCUS_07020 36051 34534 gene locus_tag LOCUS_07030 gene pelF 36051 34534 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_07030 37025 36012 gene locus_tag LOCUS_07040 37025 36012 CDS product pellicle/biofilm biosynthesis protein PelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113953.1 protein_id gnl|my_center|LOCUS_07040 38251 37022 gene locus_tag LOCUS_07050 38251 37022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 38787 38296 gene locus_tag LOCUS_07060 38787 38296 CDS product pellicle/biofilm biosynthesis outer membrane protein PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091288.1 protein_id gnl|my_center|LOCUS_07060 40105 39371 gene locus_tag LOCUS_07070 40105 39371 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583447.1 protein_id gnl|my_center|LOCUS_07070 <41521 40126 gene locus_tag LOCUS_07080 <41521 40126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937936.1:PBP1A family penicillin-binding protein >Feature sequence016 1605 958 gene locus_tag LOCUS_07090 1605 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 3119 1899 gene locus_tag LOCUS_07100 3119 1899 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942363.1 protein_id gnl|my_center|LOCUS_07100 3938 3135 gene locus_tag LOCUS_07110 3938 3135 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942362.1 protein_id gnl|my_center|LOCUS_07110 5341 3974 gene locus_tag LOCUS_07120 5341 3974 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937466.1 protein_id gnl|my_center|LOCUS_07120 5959 6369 gene locus_tag LOCUS_07130 5959 6369 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941703.1 protein_id gnl|my_center|LOCUS_07130 6589 6993 gene locus_tag LOCUS_07140 6589 6993 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943560.1 protein_id gnl|my_center|LOCUS_07140 8376 7036 gene locus_tag LOCUS_07150 8376 7036 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_07150 10087 8357 gene locus_tag LOCUS_07160 10087 8357 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545979.1 protein_id gnl|my_center|LOCUS_07160 10482 10892 gene locus_tag LOCUS_07170 10482 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 12355 11072 gene locus_tag LOCUS_07180 gene hemL 12355 11072 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_07180 13004 13222 gene locus_tag LOCUS_07190 13004 13222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 13209 13466 gene locus_tag LOCUS_07200 13209 13466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 13927 14361 gene locus_tag LOCUS_07210 13927 14361 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941761.1 protein_id gnl|my_center|LOCUS_07210 14358 14576 gene locus_tag LOCUS_07220 14358 14576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 14645 15832 gene locus_tag LOCUS_07230 14645 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 15919 16947 gene locus_tag LOCUS_07240 15919 16947 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_07240 17135 18040 gene locus_tag LOCUS_07250 gene pstC 17135 18040 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_07250 18037 18897 gene locus_tag LOCUS_07260 gene pstA 18037 18897 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140014.1 protein_id gnl|my_center|LOCUS_07260 18891 19655 gene locus_tag LOCUS_07270 gene pstB 18891 19655 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_07270 19706 20371 gene locus_tag LOCUS_07280 gene phoU 19706 20371 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_07280 21313 20420 gene locus_tag LOCUS_07290 gene glyQ 21313 20420 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_07290 22077 21310 gene locus_tag LOCUS_07300 gene recO 22077 21310 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460852.1 protein_id gnl|my_center|LOCUS_07300 23432 22074 gene locus_tag LOCUS_07310 gene mgtE 23432 22074 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_07310 24661 23825 gene locus_tag LOCUS_07320 24661 23825 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372648.1 protein_id gnl|my_center|LOCUS_07320 27260 24984 gene locus_tag LOCUS_07330 27260 24984 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_07330 28245 27349 gene locus_tag LOCUS_07340 28245 27349 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259101.1 protein_id gnl|my_center|LOCUS_07340 30257 28332 gene locus_tag LOCUS_07350 gene dnaK 30257 28332 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_07350 32024 30879 gene locus_tag LOCUS_07360 32024 30879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 32572 32045 gene locus_tag LOCUS_07370 32572 32045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 33068 32559 gene locus_tag LOCUS_07380 33068 32559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 34409 33072 gene locus_tag LOCUS_07390 gene nrfD 34409 33072 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_07390 35193 34402 gene locus_tag LOCUS_07400 35193 34402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 37464 35194 gene locus_tag LOCUS_07410 37464 35194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 38028 37513 gene locus_tag LOCUS_07420 38028 37513 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_07420 38041 38238 gene locus_tag LOCUS_07430 38041 38238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 38989 38567 gene locus_tag LOCUS_07440 38989 38567 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391610.1 protein_id gnl|my_center|LOCUS_07440 <40448 39314 gene locus_tag LOCUS_07450 <40448 39314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033492290.1:GIY-YIG nuclease family protein >Feature sequence017 640 161 gene locus_tag LOCUS_07460 gene fliW 640 161 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510650.1 protein_id gnl|my_center|LOCUS_07460 867 637 gene locus_tag LOCUS_07470 gene csrA 867 637 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943667.1 protein_id gnl|my_center|LOCUS_07470 1782 904 gene locus_tag LOCUS_07480 1782 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3446 1800 gene locus_tag LOCUS_07490 gene flgK 3446 1800 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545686.1 protein_id gnl|my_center|LOCUS_07490 3950 3453 gene locus_tag LOCUS_07500 3950 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 4293 3982 gene locus_tag LOCUS_07510 4293 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 4915 4445 gene locus_tag LOCUS_07520 4915 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 6056 4944 gene locus_tag LOCUS_07530 6056 4944 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_07530 6735 6040 gene locus_tag LOCUS_07540 6735 6040 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545249.1 protein_id gnl|my_center|LOCUS_07540 7449 6751 gene locus_tag LOCUS_07550 7449 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 8248 7460 gene locus_tag LOCUS_07560 gene flgG 8248 7460 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546478.1 protein_id gnl|my_center|LOCUS_07560 8990 8286 gene locus_tag LOCUS_07570 gene flgF 8990 8286 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919924.1 protein_id gnl|my_center|LOCUS_07570 9263 9445 gene locus_tag LOCUS_07580 9263 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 9933 9472 gene locus_tag LOCUS_07590 9933 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 10182 9973 gene locus_tag LOCUS_07600 10182 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 11141 10299 gene locus_tag LOCUS_07610 11141 10299 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_07610 11895 11401 gene locus_tag LOCUS_07620 11895 11401 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_07620 13985 11949 gene locus_tag LOCUS_07630 13985 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 15955 14909 gene locus_tag LOCUS_07640 15955 14909 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_07640 17805 15973 gene locus_tag LOCUS_07650 17805 15973 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_07650 18458 17862 gene locus_tag LOCUS_07660 18458 17862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 18931 18554 gene locus_tag LOCUS_07670 gene cheY 18931 18554 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811911.1 protein_id gnl|my_center|LOCUS_07670 19358 18981 gene locus_tag LOCUS_07680 19358 18981 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_07680 20225 19368 gene locus_tag LOCUS_07690 20225 19368 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545471.1 protein_id gnl|my_center|LOCUS_07690 22150 20207 gene locus_tag LOCUS_07700 22150 20207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 23294 22533 gene locus_tag LOCUS_07710 gene whiG 23294 22533 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_07710 24194 23310 gene locus_tag LOCUS_07720 24194 23310 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_07720 25255 24221 gene locus_tag LOCUS_07730 25255 24221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 27338 25257 gene locus_tag LOCUS_07740 gene flhA 27338 25257 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_07740 28421 27351 gene locus_tag LOCUS_07750 gene flhB 28421 27351 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545442.1 protein_id gnl|my_center|LOCUS_07750 29193 28423 gene locus_tag LOCUS_07760 gene fliR 29193 28423 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940492.1 protein_id gnl|my_center|LOCUS_07760 29476 29207 gene locus_tag LOCUS_07770 gene fliQ 29476 29207 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_07770 30265 29528 gene locus_tag LOCUS_07780 gene fliP 30265 29528 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_07780 30734 30339 gene locus_tag LOCUS_07790 30734 30339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 31285 30731 gene locus_tag LOCUS_07800 gene fliN 31285 30731 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811853.1 protein_id gnl|my_center|LOCUS_07800 32273 31278 gene locus_tag LOCUS_07810 gene fliM 32273 31278 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545847.1 protein_id gnl|my_center|LOCUS_07810 32909 32325 gene locus_tag LOCUS_07820 32909 32325 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793169.1 protein_id gnl|my_center|LOCUS_07820 34919 33273 gene locus_tag LOCUS_07830 gene flgE 34919 33273 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918786.1 protein_id gnl|my_center|LOCUS_07830 35594 34941 gene locus_tag LOCUS_07840 35594 34941 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_07840 36758 35850 gene locus_tag LOCUS_07850 36758 35850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 36915 37163 gene locus_tag LOCUS_07860 36915 37163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 38253 37687 gene locus_tag LOCUS_07870 38253 37687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 38728 38243 gene locus_tag LOCUS_07880 38728 38243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 <39874 38790 gene locus_tag LOCUS_07890 <39874 38790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870076.1:flagellar protein export ATPase FliI >Feature sequence018 326 1138 gene locus_tag LOCUS_07900 326 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1172 2395 gene locus_tag LOCUS_07910 1172 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2995 4428 gene locus_tag LOCUS_07920 2995 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 4432 5937 gene locus_tag LOCUS_07930 4432 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5930 7402 gene locus_tag LOCUS_07940 5930 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 7521 8873 gene locus_tag LOCUS_07950 7521 8873 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_07950 8873 9883 gene locus_tag LOCUS_07960 8873 9883 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_07960 9864 11012 gene locus_tag LOCUS_07970 9864 11012 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_07970 11055 12203 gene locus_tag LOCUS_07980 11055 12203 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776663.1 protein_id gnl|my_center|LOCUS_07980 12244 13257 gene locus_tag LOCUS_07990 12244 13257 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077753831.1 protein_id gnl|my_center|LOCUS_07990 13250 13993 gene locus_tag LOCUS_08000 13250 13993 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 protein_id gnl|my_center|LOCUS_08000 13971 14834 gene locus_tag LOCUS_08010 13971 14834 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_08010 14881 15921 gene locus_tag LOCUS_08020 gene siaC 14881 15921 CDS product polysialic acid capsule biosynthesis protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215299.1 protein_id gnl|my_center|LOCUS_08020 15905 16864 gene locus_tag LOCUS_08030 15905 16864 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284614.1 protein_id gnl|my_center|LOCUS_08030 16869 18059 gene locus_tag LOCUS_08040 gene neuC 16869 18059 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392276.1 protein_id gnl|my_center|LOCUS_08040 18063 19130 gene locus_tag LOCUS_08050 18063 19130 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_08050 19140 20138 gene locus_tag LOCUS_08060 19140 20138 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_08060 20217 21803 gene locus_tag LOCUS_08070 20217 21803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 21782 22837 gene locus_tag LOCUS_08080 gene neuB 21782 22837 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_08080 22831 23463 gene locus_tag LOCUS_08090 22831 23463 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946491.1 protein_id gnl|my_center|LOCUS_08090 23460 24335 gene locus_tag LOCUS_08100 23460 24335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 24314 26020 gene locus_tag LOCUS_08110 24314 26020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 26008 27030 gene locus_tag LOCUS_08120 26008 27030 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403376.1 protein_id gnl|my_center|LOCUS_08120 27027 28139 gene locus_tag LOCUS_08130 27027 28139 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_08130 28136 28837 gene locus_tag LOCUS_08140 28136 28837 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_08140 28858 30213 gene locus_tag LOCUS_08150 28858 30213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 30161 31651 gene locus_tag LOCUS_08160 30161 31651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 31551 33041 gene locus_tag LOCUS_08170 31551 33041 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_08170 33038 33895 gene locus_tag LOCUS_08180 33038 33895 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987012.1 protein_id gnl|my_center|LOCUS_08180 33898 34890 gene locus_tag LOCUS_08190 33898 34890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 34960 35826 gene locus_tag LOCUS_08200 34960 35826 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494136.1 protein_id gnl|my_center|LOCUS_08200 35894 37324 gene locus_tag LOCUS_08210 35894 37324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 37455 38471 gene locus_tag LOCUS_08220 gene neuB 37455 38471 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence019 266 724 gene locus_tag LOCUS_08230 266 724 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_08230 743 1000 gene locus_tag LOCUS_08240 743 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 1007 1735 gene locus_tag LOCUS_08250 1007 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 2572 1745 gene locus_tag LOCUS_08260 2572 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 5252 2793 gene locus_tag LOCUS_08270 gene gyrB 5252 2793 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_08270 5497 5997 gene locus_tag LOCUS_08280 5497 5997 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546838.1 protein_id gnl|my_center|LOCUS_08280 6280 6963 gene locus_tag LOCUS_08290 6280 6963 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838970.1 protein_id gnl|my_center|LOCUS_08290 7064 8680 gene locus_tag LOCUS_08300 7064 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 8981 10438 gene locus_tag LOCUS_08310 8981 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 12512 10410 gene locus_tag LOCUS_08320 gene ligA 12512 10410 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_08320 12592 13389 gene locus_tag LOCUS_08330 gene zupT 12592 13389 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176713.1 protein_id gnl|my_center|LOCUS_08330 13973 13386 gene locus_tag LOCUS_08340 13973 13386 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_08340 14629 14111 gene locus_tag LOCUS_08350 14629 14111 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886332.1 protein_id gnl|my_center|LOCUS_08350 15270 14626 gene locus_tag LOCUS_08360 15270 14626 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944038.1 protein_id gnl|my_center|LOCUS_08360 15925 15326 gene locus_tag LOCUS_08370 15925 15326 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 protein_id gnl|my_center|LOCUS_08370 16443 16024 gene locus_tag LOCUS_08380 16443 16024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 16758 17921 gene locus_tag LOCUS_08390 16758 17921 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_08390 17924 18943 gene locus_tag LOCUS_08400 gene tsaD 17924 18943 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_08400 18985 19815 gene locus_tag LOCUS_08410 gene rsmA 18985 19815 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_08410 19908 20552 gene locus_tag LOCUS_08420 19908 20552 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_08420 20720 21526 gene locus_tag LOCUS_08430 gene panB 20720 21526 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_08430 21548 22414 gene locus_tag LOCUS_08440 gene panC 21548 22414 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_08440 22482 22865 gene locus_tag LOCUS_08450 22482 22865 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948614.1 protein_id gnl|my_center|LOCUS_08450 22862 23476 gene locus_tag LOCUS_08460 22862 23476 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_08460 23590 25599 gene locus_tag LOCUS_08470 gene tkt 23590 25599 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_08470 25652 27394 gene locus_tag LOCUS_08480 25652 27394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 27540 28463 gene locus_tag LOCUS_08490 gene gnd 27540 28463 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_08490 28507 29559 gene locus_tag LOCUS_08500 gene glk 28507 29559 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259043.1 protein_id gnl|my_center|LOCUS_08500 29607 30362 gene locus_tag LOCUS_08510 gene pgl 29607 30362 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_08510 30711 30373 gene locus_tag LOCUS_08520 30711 30373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 31491 30718 gene locus_tag LOCUS_08530 31491 30718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 31859 31518 gene locus_tag LOCUS_08540 31859 31518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 32108 33889 gene locus_tag LOCUS_08550 gene aspS 32108 33889 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_08550 35033 33957 gene locus_tag LOCUS_08560 gene lptG 35033 33957 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_08560 36217 35030 gene locus_tag LOCUS_08570 gene lptF 36217 35030 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_08570 36665 37810 gene locus_tag LOCUS_08580 36665 37810 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811028.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence020 107 535 gene locus_tag LOCUS_08590 107 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 668 1393 gene locus_tag LOCUS_08600 668 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1582 1911 gene locus_tag LOCUS_08610 1582 1911 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200901.1 protein_id gnl|my_center|LOCUS_08610 2055 2729 gene locus_tag LOCUS_08620 2055 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2899 3333 gene locus_tag LOCUS_08630 2899 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3375 3611 gene locus_tag LOCUS_08640 3375 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 6336 3727 gene locus_tag LOCUS_08650 6336 3727 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_08650 6599 9334 gene locus_tag LOCUS_08660 6599 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 10345 9443 gene locus_tag LOCUS_08670 gene larE 10345 9443 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_08670 11364 10339 gene locus_tag LOCUS_08680 11364 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_08680 11670 12548 gene locus_tag LOCUS_08690 11670 12548 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_08690 12551 12784 gene locus_tag LOCUS_08700 12551 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 12856 13614 gene locus_tag LOCUS_08710 12856 13614 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_08710 13686 14063 gene locus_tag LOCUS_08720 13686 14063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 15061 14093 gene locus_tag LOCUS_08730 gene arcC 15061 14093 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_08730 16037 15129 gene locus_tag LOCUS_08740 gene trxB 16037 15129 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065103.1 protein_id gnl|my_center|LOCUS_08740 17630 16185 gene locus_tag LOCUS_08750 17630 16185 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_08750 19055 17685 gene locus_tag LOCUS_08760 gene trkA 19055 17685 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_08760 19912 19052 gene locus_tag LOCUS_08770 19912 19052 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_08770 20972 20016 gene locus_tag LOCUS_08780 20972 20016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942576.1 protein_id gnl|my_center|LOCUS_08780 23068 20969 gene locus_tag LOCUS_08790 gene fusA 23068 20969 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_08790 23667 23167 gene locus_tag LOCUS_08800 23667 23167 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941718.1 protein_id gnl|my_center|LOCUS_08800 24443 23667 gene locus_tag LOCUS_08810 24443 23667 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_08810 25433 24444 gene locus_tag LOCUS_08820 25433 24444 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_08820 26305 25430 gene locus_tag LOCUS_08830 gene nadC 26305 25430 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_08830 28968 26302 gene locus_tag LOCUS_08840 28968 26302 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_08840 30707 29244 gene locus_tag LOCUS_08850 30707 29244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 30868 31509 gene locus_tag LOCUS_08860 30868 31509 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_08860 31509 32510 gene locus_tag LOCUS_08870 gene trpS 31509 32510 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_08870 32599 33375 gene locus_tag LOCUS_08880 32599 33375 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_08880 33376 34083 gene locus_tag LOCUS_08890 33376 34083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 34037 34693 gene locus_tag LOCUS_08900 34037 34693 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_08900 34725 35390 gene locus_tag LOCUS_08910 34725 35390 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_08910 35436 37229 gene locus_tag LOCUS_08920 gene mutL 35436 37229 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence021 567 1742 gene locus_tag LOCUS_08930 567 1742 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_08930 1946 2119 gene locus_tag LOCUS_08940 1946 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2155 2703 gene locus_tag LOCUS_08950 2155 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2706 3878 gene locus_tag LOCUS_08960 2706 3878 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_08960 3904 4416 gene locus_tag LOCUS_08970 3904 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4622 4927 gene locus_tag LOCUS_08980 4622 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 6888 5368 gene locus_tag LOCUS_08990 6888 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08990 7381 6878 gene locus_tag LOCUS_09000 7381 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 7609 7534 gene locus_tag LOCUS_t00150 7609 7534 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8766 7795 gene locus_tag LOCUS_09010 gene selD 8766 7795 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_09010 9565 8870 gene locus_tag LOCUS_09020 9565 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 11518 9587 gene locus_tag LOCUS_09030 gene selB 11518 9587 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_09030 11740 12516 gene locus_tag LOCUS_09040 11740 12516 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_09040 12519 13808 gene locus_tag LOCUS_09050 12519 13808 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_09050 13831 14292 gene locus_tag LOCUS_09060 13831 14292 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525347.1 protein_id gnl|my_center|LOCUS_09060 14289 15659 gene locus_tag LOCUS_09070 14289 15659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 15873 16976 gene locus_tag LOCUS_09080 15873 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 17165 17635 gene locus_tag LOCUS_09090 17165 17635 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770670.1 protein_id gnl|my_center|LOCUS_09090 18712 17966 gene locus_tag LOCUS_09100 18712 17966 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_09100 19113 18709 gene locus_tag LOCUS_09110 19113 18709 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791660.1 protein_id gnl|my_center|LOCUS_09110 19876 19103 gene locus_tag LOCUS_09120 19876 19103 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_09120 22153 19889 gene locus_tag LOCUS_09130 22153 19889 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_09130 22990 23415 gene locus_tag LOCUS_09140 22990 23415 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545771.1 protein_id gnl|my_center|LOCUS_09140 23424 24908 gene locus_tag LOCUS_09150 23424 24908 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064301.1 protein_id gnl|my_center|LOCUS_09150 25179 25009 gene locus_tag LOCUS_09160 25179 25009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 25440 25183 gene locus_tag LOCUS_09170 25440 25183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 25584 25808 gene locus_tag LOCUS_09180 25584 25808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 27363 25834 gene locus_tag LOCUS_09190 gene gpmI 27363 25834 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_09190 28712 27360 gene locus_tag LOCUS_09200 gene lapB 28712 27360 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037337.1 protein_id gnl|my_center|LOCUS_09200 29272 28802 gene locus_tag LOCUS_09210 gene rlmH 29272 28802 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002981964.1 protein_id gnl|my_center|LOCUS_09210 29695 29318 gene locus_tag LOCUS_09220 gene rsfS 29695 29318 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_09220 30562 29885 gene locus_tag LOCUS_09230 gene nadD 30562 29885 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_09230 31569 30571 gene locus_tag LOCUS_09240 gene arsS 31569 30571 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_09240 31902 31570 gene locus_tag LOCUS_09250 31902 31570 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809059.1 protein_id gnl|my_center|LOCUS_09250 32787 32131 gene locus_tag LOCUS_09260 32787 32131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989535.1 protein_id gnl|my_center|LOCUS_09260 33124 33288 gene locus_tag LOCUS_09270 33124 33288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 34055 33393 gene locus_tag LOCUS_09280 34055 33393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 35025 33988 gene locus_tag LOCUS_09290 35025 33988 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_09290 36058 35093 gene locus_tag LOCUS_09300 36058 35093 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_09300 36791 36504 gene locus_tag LOCUS_09310 36791 36504 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence022 2732 2085 gene locus_tag LOCUS_09320 2732 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4190 2745 gene locus_tag LOCUS_09330 4190 2745 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061013.1 protein_id gnl|my_center|LOCUS_09330 4663 4187 gene locus_tag LOCUS_09340 4663 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4746 4916 gene locus_tag LOCUS_09350 4746 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4919 5782 gene locus_tag LOCUS_09360 gene folD 4919 5782 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_09360 5779 6432 gene locus_tag LOCUS_09370 5779 6432 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941525.1 protein_id gnl|my_center|LOCUS_09370 6517 7593 gene locus_tag LOCUS_09380 6517 7593 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941879.1 protein_id gnl|my_center|LOCUS_09380 8040 8339 gene locus_tag LOCUS_09390 8040 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 8618 8992 gene locus_tag LOCUS_09400 gene crcB 8618 8992 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938890.1 protein_id gnl|my_center|LOCUS_09400 9007 9351 gene locus_tag LOCUS_09410 9007 9351 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_09410 9380 10492 gene locus_tag LOCUS_09420 gene ald 9380 10492 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_09420 10761 12257 gene locus_tag LOCUS_09430 gene lysS 10761 12257 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_09430 12410 13678 gene locus_tag LOCUS_09440 12410 13678 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_09440 13877 14551 gene locus_tag LOCUS_09450 13877 14551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_09450 14587 17265 gene locus_tag LOCUS_09460 gene bamA 14587 17265 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_09460 17432 17950 gene locus_tag LOCUS_09470 17432 17950 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_09470 17992 19032 gene locus_tag LOCUS_09480 gene lpxD 17992 19032 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_09480 19094 19555 gene locus_tag LOCUS_09490 gene fabZ 19094 19555 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545346.1 protein_id gnl|my_center|LOCUS_09490 19576 20418 gene locus_tag LOCUS_09500 gene lpxA 19576 20418 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_09500 20637 21668 gene locus_tag LOCUS_09510 20637 21668 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_09510 21741 22901 gene locus_tag LOCUS_09520 gene lpxB 21741 22901 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_09520 22996 24789 gene locus_tag LOCUS_09530 gene msbA 22996 24789 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_09530 24800 25354 gene locus_tag LOCUS_09540 24800 25354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 25615 26931 gene locus_tag LOCUS_09550 25615 26931 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_09550 26935 28005 gene locus_tag LOCUS_09560 gene lpxK 26935 28005 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_09560 28348 28444 gene locus_tag LOCUS_t00160 28348 28444 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 29350 28445 gene locus_tag LOCUS_09570 29350 28445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 30627 29407 gene locus_tag LOCUS_09580 30627 29407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 30851 31417 gene locus_tag LOCUS_09590 gene pyrE 30851 31417 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546400.1 protein_id gnl|my_center|LOCUS_09590 31437 32174 gene locus_tag LOCUS_09600 gene pyrF 31437 32174 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435818.1 protein_id gnl|my_center|LOCUS_09600 32464 32850 gene locus_tag LOCUS_09610 32464 32850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 33618 32929 gene locus_tag LOCUS_09620 33618 32929 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957522.1 protein_id gnl|my_center|LOCUS_09620 35120 33663 gene locus_tag LOCUS_09630 gene ubiD 35120 33663 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317344.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence023 521 1285 gene locus_tag LOCUS_09640 521 1285 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09640 1285 2307 gene locus_tag LOCUS_09650 gene waaC 1285 2307 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_09650 2300 3202 gene locus_tag LOCUS_09660 2300 3202 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937492.1 protein_id gnl|my_center|LOCUS_09660 3357 3142 gene locus_tag LOCUS_09670 3357 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3485 4543 gene locus_tag LOCUS_09680 gene waaF 3485 4543 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_09680 4548 5093 gene locus_tag LOCUS_09690 4548 5093 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391311.1 protein_id gnl|my_center|LOCUS_09690 5190 6176 gene locus_tag LOCUS_09700 5190 6176 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546047.1 protein_id gnl|my_center|LOCUS_09700 6202 7179 gene locus_tag LOCUS_09710 6202 7179 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_09710 7190 7363 gene locus_tag LOCUS_09720 7190 7363 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709672.1 protein_id gnl|my_center|LOCUS_09720 7392 8273 gene locus_tag LOCUS_09730 7392 8273 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944030.1 protein_id gnl|my_center|LOCUS_09730 8329 9516 gene locus_tag LOCUS_09740 8329 9516 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_09740 9513 10400 gene locus_tag LOCUS_09750 9513 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 10397 11350 gene locus_tag LOCUS_09760 10397 11350 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_09760 11541 12470 gene locus_tag LOCUS_09770 11541 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 12826 14316 gene locus_tag LOCUS_09780 12826 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 14319 15158 gene locus_tag LOCUS_09790 14319 15158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 15155 16156 gene locus_tag LOCUS_09800 15155 16156 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_09800 16237 17250 gene locus_tag LOCUS_09810 16237 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 17253 17795 gene locus_tag LOCUS_09820 17253 17795 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082414.1 protein_id gnl|my_center|LOCUS_09820 17797 18681 gene locus_tag LOCUS_09830 17797 18681 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_09830 18713 19327 gene locus_tag LOCUS_09840 gene gmk 18713 19327 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_09840 19347 19601 gene locus_tag LOCUS_09850 19347 19601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 19617 20066 gene locus_tag LOCUS_09860 19617 20066 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065851.1 protein_id gnl|my_center|LOCUS_09860 21079 21402 gene locus_tag LOCUS_09870 21079 21402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 23301 21433 gene locus_tag LOCUS_09880 23301 21433 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_09880 24504 23323 gene locus_tag LOCUS_09890 24504 23323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 25500 24520 gene locus_tag LOCUS_09900 25500 24520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_09900 27721 25514 gene locus_tag LOCUS_09910 27721 25514 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_09910 28388 28591 gene locus_tag LOCUS_09920 28388 28591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 28613 29431 gene locus_tag LOCUS_09930 28613 29431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 30144 30719 gene locus_tag LOCUS_09940 30144 30719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 30971 31348 gene locus_tag LOCUS_09950 30971 31348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 31369 33558 gene locus_tag LOCUS_09960 31369 33558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence024 554 1558 gene locus_tag LOCUS_09970 gene pseB 554 1558 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_09970 1524 2711 gene locus_tag LOCUS_09980 gene pseC 1524 2711 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_09980 2822 3916 gene locus_tag LOCUS_09990 2822 3916 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 protein_id gnl|my_center|LOCUS_09990 3903 4718 gene locus_tag LOCUS_10000 3903 4718 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_10000 4764 6089 gene locus_tag LOCUS_10010 4764 6089 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974175.1 protein_id gnl|my_center|LOCUS_10010 6147 7166 gene locus_tag LOCUS_10020 6147 7166 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077753831.1 protein_id gnl|my_center|LOCUS_10020 7151 8176 gene locus_tag LOCUS_10030 gene pseG 7151 8176 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920694.1 protein_id gnl|my_center|LOCUS_10030 8296 9207 gene locus_tag LOCUS_10040 8296 9207 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073150.1 protein_id gnl|my_center|LOCUS_10040 9204 10277 gene locus_tag LOCUS_10050 9204 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 10274 11254 gene locus_tag LOCUS_10060 10274 11254 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987008.1 protein_id gnl|my_center|LOCUS_10060 11257 12066 gene locus_tag LOCUS_10070 gene rfbF 11257 12066 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_10070 12073 13185 gene locus_tag LOCUS_10080 12073 13185 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972938.1 protein_id gnl|my_center|LOCUS_10080 13194 14519 gene locus_tag LOCUS_10090 13194 14519 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064256.1 protein_id gnl|my_center|LOCUS_10090 14516 15820 gene locus_tag LOCUS_10100 gene rfbH 14516 15820 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_10100 15817 16800 gene locus_tag LOCUS_10110 15817 16800 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546066.1 protein_id gnl|my_center|LOCUS_10110 16902 18326 gene locus_tag LOCUS_10120 gene hpnJ 16902 18326 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_10120 18333 19388 gene locus_tag LOCUS_10130 18333 19388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 19487 20965 gene locus_tag LOCUS_10140 19487 20965 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_10140 20920 21753 gene locus_tag LOCUS_10150 20920 21753 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_10150 21753 22703 gene locus_tag LOCUS_10160 21753 22703 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_10160 22712 23470 gene locus_tag LOCUS_10170 22712 23470 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073146.1 protein_id gnl|my_center|LOCUS_10170 23467 24705 gene locus_tag LOCUS_10180 23467 24705 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073148.1 protein_id gnl|my_center|LOCUS_10180 24702 26804 gene locus_tag LOCUS_10190 24702 26804 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073151.1 protein_id gnl|my_center|LOCUS_10190 26804 28789 gene locus_tag LOCUS_10200 26804 28789 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392283.1 protein_id gnl|my_center|LOCUS_10200 28740 29372 gene locus_tag LOCUS_10210 28740 29372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 29632 30465 gene locus_tag LOCUS_10220 29632 30465 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_10220 30517 30945 gene locus_tag LOCUS_10230 30517 30945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 31211 32545 gene locus_tag LOCUS_10240 gene fliD 31211 32545 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146784.1 protein_id gnl|my_center|LOCUS_10240 32555 32986 gene locus_tag LOCUS_10250 gene fliS 32555 32986 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199081.1 protein_id gnl|my_center|LOCUS_10250 32961 33302 gene locus_tag LOCUS_10260 32961 33302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence025 <1 1314 gene locus_tag LOCUS_10270 <1 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868901.1:[FeFe] hydrogenase H-cluster radical SAM maturase HydG 1319 1519 gene locus_tag LOCUS_10280 gene thiS 1319 1519 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_10280 1568 2338 gene locus_tag LOCUS_10290 1568 2338 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_10290 2335 2595 gene locus_tag LOCUS_10300 2335 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2576 3346 gene locus_tag LOCUS_10310 gene lgt 2576 3346 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057991.1 protein_id gnl|my_center|LOCUS_10310 3343 3993 gene locus_tag LOCUS_10320 gene thiE 3343 3993 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_10320 3990 5270 gene locus_tag LOCUS_10330 gene thiC 3990 5270 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_10330 6741 5305 gene locus_tag LOCUS_10340 6741 5305 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942302.1 protein_id gnl|my_center|LOCUS_10340 6826 6900 gene locus_tag LOCUS_t00170 6826 6900 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7795 7025 gene locus_tag LOCUS_10350 7795 7025 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207575.1 protein_id gnl|my_center|LOCUS_10350 8692 7889 gene locus_tag LOCUS_10360 gene dapB 8692 7889 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_10360 9609 8737 gene locus_tag LOCUS_10370 gene dapA 9609 8737 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_10370 10503 9676 gene locus_tag LOCUS_10380 gene dapF 10503 9676 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546632.1 protein_id gnl|my_center|LOCUS_10380 11902 10643 gene locus_tag LOCUS_10390 gene lysA 11902 10643 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_10390 11783 12103 gene locus_tag LOCUS_10400 11783 12103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 13503 12109 gene locus_tag LOCUS_10410 gene argH 13503 12109 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_10410 14444 13500 gene locus_tag LOCUS_10420 14444 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_10420 15010 14441 gene locus_tag LOCUS_10430 15010 14441 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546496.1 protein_id gnl|my_center|LOCUS_10430 16607 15537 gene locus_tag LOCUS_10440 16607 15537 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837872.1 protein_id gnl|my_center|LOCUS_10440 17634 16720 gene locus_tag LOCUS_10450 17634 16720 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_10450 19084 17627 gene locus_tag LOCUS_10460 19084 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 19465 19734 gene locus_tag LOCUS_10470 19465 19734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 22952 19773 gene locus_tag LOCUS_10480 22952 19773 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804172.1 protein_id gnl|my_center|LOCUS_10480 24025 22949 gene locus_tag LOCUS_10490 24025 22949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 25958 24738 gene locus_tag LOCUS_10500 25958 24738 CDS product DUF6361 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804170.1 protein_id gnl|my_center|LOCUS_10500 26349 26218 gene locus_tag LOCUS_10510 26349 26218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 26856 26771 gene locus_tag LOCUS_t00180 26856 26771 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28191 26914 gene locus_tag LOCUS_10520 gene serS 28191 26914 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_10520 28941 28330 gene locus_tag LOCUS_10530 28941 28330 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941109.1 protein_id gnl|my_center|LOCUS_10530 30551 29058 gene locus_tag LOCUS_10540 30551 29058 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_10540 30948 30586 gene locus_tag LOCUS_10550 30948 30586 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937799.1 protein_id gnl|my_center|LOCUS_10550 31404 30958 gene locus_tag LOCUS_10560 31404 30958 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_10560 <33520 31560 gene locus_tag LOCUS_10570 <33520 31560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941319.1:ATP-dependent chaperone ClpB >Feature sequence026 546 1589 gene locus_tag LOCUS_10580 gene moaA 546 1589 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_10580 1590 1793 gene locus_tag LOCUS_10590 1590 1793 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530071.1 protein_id gnl|my_center|LOCUS_10590 1790 2554 gene locus_tag LOCUS_10600 gene modA 1790 2554 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 protein_id gnl|my_center|LOCUS_10600 2818 3501 gene locus_tag LOCUS_10610 gene modB 2818 3501 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_10610 3488 4186 gene locus_tag LOCUS_10620 3488 4186 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144265.1 protein_id gnl|my_center|LOCUS_10620 4216 4707 gene locus_tag LOCUS_10630 gene moaC 4216 4707 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_10630 4721 4960 gene locus_tag LOCUS_10640 gene moaD 4721 4960 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418589.1 protein_id gnl|my_center|LOCUS_10640 4969 5394 gene locus_tag LOCUS_10650 4969 5394 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867291.1 protein_id gnl|my_center|LOCUS_10650 5373 5915 gene locus_tag LOCUS_10660 5373 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 6022 6690 gene locus_tag LOCUS_10670 6022 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 6677 7939 gene locus_tag LOCUS_10680 6677 7939 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_10680 7932 8480 gene locus_tag LOCUS_10690 gene mog 7932 8480 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140668.1 protein_id gnl|my_center|LOCUS_10690 8880 9389 gene locus_tag LOCUS_10700 8880 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 10348 9509 gene locus_tag LOCUS_10710 10348 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 10514 10350 gene locus_tag LOCUS_10720 10514 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 11041 10706 gene locus_tag LOCUS_10730 11041 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 11928 11092 gene locus_tag LOCUS_10740 11928 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 12403 12092 gene locus_tag LOCUS_10750 12403 12092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 14393 12780 gene locus_tag LOCUS_10760 14393 12780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 15334 14627 gene locus_tag LOCUS_10770 gene narI 15334 14627 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242665.1 protein_id gnl|my_center|LOCUS_10770 16002 15403 gene locus_tag LOCUS_10780 16002 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 17405 15996 gene locus_tag LOCUS_10790 gene narH 17405 15996 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692685.1 protein_id gnl|my_center|LOCUS_10790 21267 17521 gene locus_tag LOCUS_10800 21267 17521 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243085.1 protein_id gnl|my_center|LOCUS_10800 21852 21268 gene locus_tag LOCUS_10810 21852 21268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 23635 22253 gene locus_tag LOCUS_10820 23635 22253 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_10820 24313 23636 gene locus_tag LOCUS_10830 24313 23636 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_10830 25062 24310 gene locus_tag LOCUS_10840 25062 24310 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 protein_id gnl|my_center|LOCUS_10840 25587 25168 gene locus_tag LOCUS_10850 25587 25168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 27137 26028 gene locus_tag LOCUS_10860 gene ispG 27137 26028 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_10860 27794 29191 gene locus_tag LOCUS_10870 gene pabB 27794 29191 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438631.1 protein_id gnl|my_center|LOCUS_10870 29199 30056 gene locus_tag LOCUS_10880 gene ilvE 29199 30056 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_10880 31831 30347 gene locus_tag LOCUS_10890 31831 30347 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_10890 32329 31904 gene locus_tag LOCUS_10900 32329 31904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence027 400 1251 gene locus_tag LOCUS_10910 400 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1256 2176 gene locus_tag LOCUS_10920 gene miaA 1256 2176 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_10920 2383 3255 gene locus_tag LOCUS_10930 2383 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 3268 3900 gene locus_tag LOCUS_10940 3268 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 4145 3924 gene locus_tag LOCUS_10950 4145 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 4042 4512 gene locus_tag LOCUS_10960 4042 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 5363 4521 gene locus_tag LOCUS_10970 5363 4521 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_10970 6363 5332 gene locus_tag LOCUS_10980 6363 5332 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546086.1 protein_id gnl|my_center|LOCUS_10980 6590 8344 gene locus_tag LOCUS_10990 6590 8344 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_10990 8486 11047 gene locus_tag LOCUS_11000 8486 11047 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_11000 11143 12642 gene locus_tag LOCUS_11010 gene rng 11143 12642 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_11010 12656 13309 gene locus_tag LOCUS_11020 12656 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 13369 13563 gene locus_tag LOCUS_11030 13369 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 13560 14681 gene locus_tag LOCUS_11040 13560 14681 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_11040 14855 15889 gene locus_tag LOCUS_11050 gene queA 14855 15889 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081288.1 protein_id gnl|my_center|LOCUS_11050 15916 17028 gene locus_tag LOCUS_11060 gene tgt 15916 17028 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_11060 17051 17392 gene locus_tag LOCUS_11070 gene yajC 17051 17392 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_11070 17669 19255 gene locus_tag LOCUS_11080 gene secD 17669 19255 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_11080 19267 20175 gene locus_tag LOCUS_11090 gene secF 19267 20175 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943254.1 protein_id gnl|my_center|LOCUS_11090 20776 20480 gene locus_tag LOCUS_11100 20776 20480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 21074 20892 gene locus_tag LOCUS_11110 21074 20892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 21322 21176 gene locus_tag LOCUS_11120 21322 21176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 21712 23487 gene locus_tag LOCUS_11130 gene recJ 21712 23487 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_11130 23541 24170 gene locus_tag LOCUS_11140 23541 24170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 24170 25216 gene locus_tag LOCUS_11150 24170 25216 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_11150 25207 26112 gene locus_tag LOCUS_11160 gene speB 25207 26112 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_11160 26162 26707 gene locus_tag LOCUS_11170 26162 26707 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_11170 27393 28010 gene locus_tag LOCUS_11180 27393 28010 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_11180 28138 28587 gene locus_tag LOCUS_11190 gene rimI 28138 28587 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191864.1 protein_id gnl|my_center|LOCUS_11190 28591 29370 gene locus_tag LOCUS_11200 28591 29370 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_11200 29399 30382 gene locus_tag LOCUS_11210 29399 30382 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_11210 31421 30357 gene locus_tag LOCUS_11220 31421 30357 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_11220 31711 31511 gene locus_tag LOCUS_11230 31711 31511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 31942 31724 gene locus_tag LOCUS_11240 31942 31724 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_11240 32375 31962 gene locus_tag LOCUS_11250 32375 31962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328788.1 protein_id gnl|my_center|LOCUS_11250 32638 32462 gene locus_tag LOCUS_11260 32638 32462 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_11260 32950 32723 gene locus_tag LOCUS_11270 32950 32723 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015102.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence028 467 12 gene locus_tag LOCUS_11280 467 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 969 502 gene locus_tag LOCUS_11290 969 502 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_11290 2996 1023 gene locus_tag LOCUS_11300 2996 1023 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_11300 3937 3071 gene locus_tag LOCUS_11310 3937 3071 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_11310 4429 4022 gene locus_tag LOCUS_11320 4429 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5050 4493 gene locus_tag LOCUS_11330 5050 4493 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393765.1 protein_id gnl|my_center|LOCUS_11330 5959 5123 gene locus_tag LOCUS_11340 5959 5123 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881157.1 protein_id gnl|my_center|LOCUS_11340 6973 6044 gene locus_tag LOCUS_11350 gene mdh 6973 6044 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942112.1 protein_id gnl|my_center|LOCUS_11350 7392 8543 gene locus_tag LOCUS_11360 7392 8543 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545576.1 protein_id gnl|my_center|LOCUS_11360 8583 10166 gene locus_tag LOCUS_11370 gene serA 8583 10166 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_11370 10231 11232 gene locus_tag LOCUS_11380 10231 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 11278 12600 gene locus_tag LOCUS_11390 11278 12600 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_11390 12740 12982 gene locus_tag LOCUS_11400 12740 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 12996 13367 gene locus_tag LOCUS_11410 12996 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 13369 14025 gene locus_tag LOCUS_11420 13369 14025 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_11420 14104 14457 gene locus_tag LOCUS_11430 14104 14457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 14785 15633 gene locus_tag LOCUS_11440 gene rpoH 14785 15633 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941316.1 protein_id gnl|my_center|LOCUS_11440 15785 16900 gene locus_tag LOCUS_11450 gene alr 15785 16900 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_11450 16897 17667 gene locus_tag LOCUS_11460 16897 17667 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_11460 17691 18437 gene locus_tag LOCUS_11470 17691 18437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_11470 18485 19918 gene locus_tag LOCUS_11480 18485 19918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 19936 21216 gene locus_tag LOCUS_11490 19936 21216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 21239 22807 gene locus_tag LOCUS_11500 gene purH 21239 22807 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358883.1 protein_id gnl|my_center|LOCUS_11500 22854 24125 gene locus_tag LOCUS_11510 gene purD 22854 24125 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_11510 24141 24653 gene locus_tag LOCUS_11520 gene purE 24141 24653 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_11520 24650 25273 gene locus_tag LOCUS_11530 24650 25273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 25470 25814 gene locus_tag LOCUS_11540 25470 25814 CDS product flagellar basal body rod C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940153.1 protein_id gnl|my_center|LOCUS_11540 26216 25902 gene locus_tag LOCUS_11550 26216 25902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 27664 26273 gene locus_tag LOCUS_11560 gene rsmB 27664 26273 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_11560 27904 28335 gene locus_tag LOCUS_11570 27904 28335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 28362 28889 gene locus_tag LOCUS_11580 gene smpB 28362 28889 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_11580 32180 29037 gene locus_tag LOCUS_11590 32180 29037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence029 1762 3180 gene locus_tag LOCUS_11600 1762 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3209 5287 gene locus_tag LOCUS_11610 3209 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 5337 5930 gene locus_tag LOCUS_11620 5337 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 5996 7576 gene locus_tag LOCUS_11630 5996 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 7736 8752 gene locus_tag LOCUS_11640 7736 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 8836 9378 gene locus_tag LOCUS_11650 8836 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 9375 9941 gene locus_tag LOCUS_11660 9375 9941 CDS product DUF799 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943135.1 protein_id gnl|my_center|LOCUS_11660 10207 10001 gene locus_tag LOCUS_11670 10207 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 10145 11425 gene locus_tag LOCUS_11680 10145 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 11442 13385 gene locus_tag LOCUS_11690 11442 13385 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_11690 13436 14701 gene locus_tag LOCUS_11700 13436 14701 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643456.1 protein_id gnl|my_center|LOCUS_11700 14722 15633 gene locus_tag LOCUS_11710 14722 15633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 15630 16319 gene locus_tag LOCUS_11720 15630 16319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 16581 17627 gene locus_tag LOCUS_11730 16581 17627 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228360.1 protein_id gnl|my_center|LOCUS_11730 17991 19268 gene locus_tag LOCUS_11740 17991 19268 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941362.1 protein_id gnl|my_center|LOCUS_11740 19538 19377 gene locus_tag LOCUS_11750 19538 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 19504 20505 gene locus_tag LOCUS_11760 19504 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 20702 21511 gene locus_tag LOCUS_11770 20702 21511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 21650 22393 gene locus_tag LOCUS_11780 21650 22393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 22469 23119 gene locus_tag LOCUS_11790 22469 23119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 23140 24057 gene locus_tag LOCUS_11800 23140 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 24314 25324 gene locus_tag LOCUS_11810 24314 25324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 25588 26364 gene locus_tag LOCUS_11820 25588 26364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence030 3028 1517 gene locus_tag LOCUS_11830 3028 1517 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_11830 3668 3012 gene locus_tag LOCUS_11840 3668 3012 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_11840 4488 3706 gene locus_tag LOCUS_11850 4488 3706 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_11850 5473 4478 gene locus_tag LOCUS_11860 5473 4478 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 protein_id gnl|my_center|LOCUS_11860 5795 6601 gene locus_tag LOCUS_11870 5795 6601 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_11870 6665 8098 gene locus_tag LOCUS_11880 6665 8098 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_11880 8813 8738 gene locus_tag LOCUS_t00190 8813 8738 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9041 9334 gene locus_tag LOCUS_11890 9041 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 10092 9490 gene locus_tag LOCUS_11900 10092 9490 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_11900 11261 10164 gene locus_tag LOCUS_11910 11261 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 11886 11290 gene locus_tag LOCUS_11920 gene plsY 11886 11290 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_11920 13919 12102 gene locus_tag LOCUS_11930 gene glmS 13919 12102 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_11930 15385 13979 gene locus_tag LOCUS_11940 15385 13979 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940944.1 protein_id gnl|my_center|LOCUS_11940 15560 16147 gene locus_tag LOCUS_11950 15560 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940945.1 protein_id gnl|my_center|LOCUS_11950 16959 16552 gene locus_tag LOCUS_11960 16959 16552 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940790.1 protein_id gnl|my_center|LOCUS_11960 18414 16996 gene locus_tag LOCUS_11970 gene atpD 18414 16996 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_11970 19401 18523 gene locus_tag LOCUS_11980 gene atpG 19401 18523 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_11980 20959 19445 gene locus_tag LOCUS_11990 gene atpA 20959 19445 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_11990 21510 20962 gene locus_tag LOCUS_12000 21510 20962 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_12000 22475 21510 gene locus_tag LOCUS_12010 22475 21510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 23824 22697 gene locus_tag LOCUS_12020 23824 22697 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_12020 24905 23874 gene locus_tag LOCUS_12030 gene argC 24905 23874 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_12030 25462 25070 gene locus_tag LOCUS_12040 gene rpsI 25462 25070 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_12040 25920 25492 gene locus_tag LOCUS_12050 gene rplM 25920 25492 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence031 475 1419 gene locus_tag LOCUS_12060 475 1419 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_12060 1423 2472 gene locus_tag LOCUS_12070 1423 2472 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880980.1 protein_id gnl|my_center|LOCUS_12070 2509 4557 gene locus_tag LOCUS_12080 2509 4557 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544993.1 protein_id gnl|my_center|LOCUS_12080 4952 4554 gene locus_tag LOCUS_12090 4952 4554 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537642.1 protein_id gnl|my_center|LOCUS_12090 7884 4942 gene locus_tag LOCUS_12100 7884 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 9577 7922 gene locus_tag LOCUS_12110 9577 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 10245 9673 gene locus_tag LOCUS_12120 10245 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 13092 10465 gene locus_tag LOCUS_12130 gene polA 13092 10465 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_12130 13208 13741 gene locus_tag LOCUS_12140 13208 13741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 14182 13766 gene locus_tag LOCUS_12150 14182 13766 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_12150 14833 14219 gene locus_tag LOCUS_12160 14833 14219 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_12160 15566 15222 gene locus_tag LOCUS_12170 gene rplS 15566 15222 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_12170 16367 15615 gene locus_tag LOCUS_12180 gene trmD 16367 15615 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_12180 17280 16729 gene locus_tag LOCUS_12190 gene rimM 17280 16729 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_12190 17503 17273 gene locus_tag LOCUS_12200 17503 17273 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_12200 17833 17537 gene locus_tag LOCUS_12210 gene rpsP 17833 17537 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642952.1 protein_id gnl|my_center|LOCUS_12210 19269 17944 gene locus_tag LOCUS_12220 gene ffh 19269 17944 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081977.1 protein_id gnl|my_center|LOCUS_12220 20278 19508 gene locus_tag LOCUS_12230 20278 19508 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943982.1 protein_id gnl|my_center|LOCUS_12230 20471 21178 gene locus_tag LOCUS_12240 20471 21178 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_12240 21156 21422 gene locus_tag LOCUS_12250 21156 21422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940758.1 protein_id gnl|my_center|LOCUS_12250 21542 22504 gene locus_tag LOCUS_12260 21542 22504 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_12260 22501 23274 gene locus_tag LOCUS_12270 gene pgeF 22501 23274 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_12270 23287 23880 gene locus_tag LOCUS_12280 gene coaE 23287 23880 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence032 1912 485 gene locus_tag LOCUS_12290 1912 485 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_12290 2540 1938 gene locus_tag LOCUS_12300 2540 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3349 2543 gene locus_tag LOCUS_12310 gene murI 3349 2543 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_12310 3691 4158 gene locus_tag LOCUS_12320 3691 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 4289 6034 gene locus_tag LOCUS_12330 gene polX 4289 6034 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_12330 7521 6181 gene locus_tag LOCUS_12340 7521 6181 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941517.1 protein_id gnl|my_center|LOCUS_12340 8087 7746 gene locus_tag LOCUS_12350 8087 7746 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877543.1 protein_id gnl|my_center|LOCUS_12350 9395 8124 gene locus_tag LOCUS_12360 gene eno 9395 8124 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103949.1 protein_id gnl|my_center|LOCUS_12360 9881 11461 gene locus_tag LOCUS_12370 9881 11461 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087216.1 protein_id gnl|my_center|LOCUS_12370 11528 12916 gene locus_tag LOCUS_12380 gene sthA 11528 12916 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877481.1 protein_id gnl|my_center|LOCUS_12380 12920 13447 gene locus_tag LOCUS_12390 12920 13447 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880396.1 protein_id gnl|my_center|LOCUS_12390 13419 15758 gene locus_tag LOCUS_12400 gene hypF 13419 15758 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_12400 15843 16031 gene locus_tag LOCUS_12410 15843 16031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 16037 17164 gene locus_tag LOCUS_12420 gene hypD 16037 17164 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_12420 17166 18179 gene locus_tag LOCUS_12430 gene hypE 17166 18179 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_12430 19099 18296 gene locus_tag LOCUS_12440 19099 18296 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_12440 19382 20209 gene locus_tag LOCUS_12450 gene surE 19382 20209 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545452.1 protein_id gnl|my_center|LOCUS_12450 20388 21053 gene locus_tag LOCUS_12460 20388 21053 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_12460 21100 21684 gene locus_tag LOCUS_12470 21100 21684 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_12470 21684 22145 gene locus_tag LOCUS_12480 21684 22145 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_12480 22435 23100 gene locus_tag LOCUS_12490 22435 23100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence033 <1 543 gene locus_tag LOCUS_12500 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546576.1:ATP-binding protein 999 760 gene locus_tag LOCUS_12510 999 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1224 1033 gene locus_tag LOCUS_12520 1224 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12520 2836 1481 gene locus_tag LOCUS_12530 2836 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4519 3257 gene locus_tag LOCUS_12540 4519 3257 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_12540 5739 4798 gene locus_tag LOCUS_12550 5739 4798 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_12550 6722 6141 gene locus_tag LOCUS_12560 6722 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8037 6715 gene locus_tag LOCUS_12570 8037 6715 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868152.1 protein_id gnl|my_center|LOCUS_12570 9154 7988 gene locus_tag LOCUS_12580 9154 7988 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065345.1 protein_id gnl|my_center|LOCUS_12580 10557 9685 gene locus_tag LOCUS_12590 10557 9685 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_12590 11529 10561 gene locus_tag LOCUS_12600 11529 10561 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142938.1 protein_id gnl|my_center|LOCUS_12600 13263 11593 gene locus_tag LOCUS_12610 13263 11593 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_12610 14073 13516 gene locus_tag LOCUS_12620 14073 13516 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_12620 15011 14151 gene locus_tag LOCUS_12630 15011 14151 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_12630 16191 15058 gene locus_tag LOCUS_12640 16191 15058 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_12640 16475 16272 gene locus_tag LOCUS_12650 16475 16272 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942113.1 protein_id gnl|my_center|LOCUS_12650 17589 16714 gene locus_tag LOCUS_12660 gene sucD 17589 16714 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025475.1 protein_id gnl|my_center|LOCUS_12660 18902 17733 gene locus_tag LOCUS_12670 gene sucC 18902 17733 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_12670 20680 19031 gene locus_tag LOCUS_12680 20680 19031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 21531 20740 gene locus_tag LOCUS_12690 21531 20740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 22398 21565 gene locus_tag LOCUS_12700 22398 21565 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_12700 23167 22490 gene locus_tag LOCUS_12710 23167 22490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence034 335 1846 gene locus_tag LOCUS_12720 335 1846 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_12720 1853 3280 gene locus_tag LOCUS_12730 1853 3280 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941675.1 protein_id gnl|my_center|LOCUS_12730 3302 4336 gene locus_tag LOCUS_12740 gene mtnA 3302 4336 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_12740 4730 5821 gene locus_tag LOCUS_12750 gene gnfL 4730 5821 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_12750 5818 7245 gene locus_tag LOCUS_12760 gene gnfM 5818 7245 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_12760 7295 8866 gene locus_tag LOCUS_12770 7295 8866 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541618.1 protein_id gnl|my_center|LOCUS_12770 9972 8947 gene locus_tag LOCUS_12780 9972 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 10455 11087 gene locus_tag LOCUS_12790 10455 11087 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146546.1 protein_id gnl|my_center|LOCUS_12790 12212 11070 gene locus_tag LOCUS_12800 12212 11070 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250496.1 protein_id gnl|my_center|LOCUS_12800 14255 12438 gene locus_tag LOCUS_12810 14255 12438 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038616.1 protein_id gnl|my_center|LOCUS_12810 14627 15289 gene locus_tag LOCUS_12820 gene thiE 14627 15289 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584007.1 protein_id gnl|my_center|LOCUS_12820 16629 15313 gene locus_tag LOCUS_12830 16629 15313 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405103.1 protein_id gnl|my_center|LOCUS_12830 17010 16672 gene locus_tag LOCUS_12840 17010 16672 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975544.1 protein_id gnl|my_center|LOCUS_12840 18592 17297 gene locus_tag LOCUS_12850 18592 17297 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_12850 19557 18706 gene locus_tag LOCUS_12860 19557 18706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546145.1 protein_id gnl|my_center|LOCUS_12860 20302 19589 gene locus_tag LOCUS_12870 20302 19589 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545422.1 protein_id gnl|my_center|LOCUS_12870 20888 20307 gene locus_tag LOCUS_12880 20888 20307 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408045.1 protein_id gnl|my_center|LOCUS_12880 22487 21018 gene locus_tag LOCUS_12890 gene glgA 22487 21018 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence035 891 262 gene locus_tag LOCUS_12900 891 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1888 884 gene locus_tag LOCUS_12910 gene fliG 1888 884 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037091.1 protein_id gnl|my_center|LOCUS_12910 3491 1890 gene locus_tag LOCUS_12920 gene fliF 3491 1890 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546552.1 protein_id gnl|my_center|LOCUS_12920 3803 3501 gene locus_tag LOCUS_12930 gene fliE 3803 3501 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941077.1 protein_id gnl|my_center|LOCUS_12930 4266 3829 gene locus_tag LOCUS_12940 gene flgC 4266 3829 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_12940 4673 4263 gene locus_tag LOCUS_12950 gene flgB 4673 4263 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941075.1 protein_id gnl|my_center|LOCUS_12950 6124 4808 gene locus_tag LOCUS_12960 6124 4808 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842237.1 protein_id gnl|my_center|LOCUS_12960 6956 6117 gene locus_tag LOCUS_12970 6956 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 9423 6964 gene locus_tag LOCUS_12980 9423 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 11074 9704 gene locus_tag LOCUS_12990 11074 9704 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_12990 11965 11339 gene locus_tag LOCUS_13000 11965 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 12692 12504 gene locus_tag LOCUS_13010 12692 12504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13010 12832 12638 gene locus_tag LOCUS_13020 12832 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 14252 13056 gene locus_tag LOCUS_13030 14252 13056 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_13030 15372 14302 gene locus_tag LOCUS_13040 gene thrC 15372 14302 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880238.1 protein_id gnl|my_center|LOCUS_13040 16678 15359 gene locus_tag LOCUS_13050 16678 15359 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_13050 17889 16699 gene locus_tag LOCUS_13060 gene alaC 17889 16699 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_13060 18844 17963 gene locus_tag LOCUS_13070 gene lipA 18844 17963 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_13070 19942 19271 gene locus_tag LOCUS_13080 19942 19271 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_13080 20636 20274 gene locus_tag LOCUS_13090 20636 20274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 21855 20848 gene locus_tag LOCUS_13100 21855 20848 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408265.1 protein_id gnl|my_center|LOCUS_13100 22200 22027 gene locus_tag LOCUS_13110 22200 22027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 22432 22187 gene locus_tag LOCUS_13120 22432 22187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence036 1810 851 gene locus_tag LOCUS_13130 gene hemC 1810 851 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_13130 3166 1865 gene locus_tag LOCUS_13140 gene hemA 3166 1865 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_13140 4031 3213 gene locus_tag LOCUS_13150 gene ccsB 4031 3213 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_13150 4842 4165 gene locus_tag LOCUS_13160 4842 4165 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_13160 5272 8703 gene locus_tag LOCUS_13170 gene mfd 5272 8703 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_13170 8697 9689 gene locus_tag LOCUS_13180 8697 9689 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_13180 9691 10668 gene locus_tag LOCUS_13190 9691 10668 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_13190 10694 11695 gene locus_tag LOCUS_13200 gene pdxA 10694 11695 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_13200 11735 14584 gene locus_tag LOCUS_13210 gene uvrA 11735 14584 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_13210 14874 15551 gene locus_tag LOCUS_13220 14874 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 17223 15661 gene locus_tag LOCUS_13230 17223 15661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 17496 18155 gene locus_tag LOCUS_13240 17496 18155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 18849 18103 gene locus_tag LOCUS_13250 18849 18103 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267286.1 protein_id gnl|my_center|LOCUS_13250 19439 18873 gene locus_tag LOCUS_13260 19439 18873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 19993 22281 gene locus_tag LOCUS_13270 19993 22281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence037 287 362 gene locus_tag LOCUS_t00200 287 362 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 682 757 gene locus_tag LOCUS_t00210 682 757 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2112 979 gene locus_tag LOCUS_13280 2112 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2549 2145 gene locus_tag LOCUS_13290 2549 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3302 3502 gene locus_tag LOCUS_13300 3302 3502 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941244.1 protein_id gnl|my_center|LOCUS_13300 3845 3630 gene locus_tag LOCUS_13310 3845 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4184 3870 gene locus_tag LOCUS_13320 gene glnB 4184 3870 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_13320 7377 4285 gene locus_tag LOCUS_13330 7377 4285 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_13330 8600 7395 gene locus_tag LOCUS_13340 8600 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 10716 8608 gene locus_tag LOCUS_13350 10716 8608 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_13350 11981 10713 gene locus_tag LOCUS_13360 11981 10713 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944009.1 protein_id gnl|my_center|LOCUS_13360 12501 12127 gene locus_tag LOCUS_13370 12501 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 14095 12668 gene locus_tag LOCUS_13380 14095 12668 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_13380 14441 14100 gene locus_tag LOCUS_13390 14441 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 15222 14419 gene locus_tag LOCUS_13400 15222 14419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 15923 15150 gene locus_tag LOCUS_13410 15923 15150 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274383.1 protein_id gnl|my_center|LOCUS_13410 16672 15920 gene locus_tag LOCUS_13420 gene cobM 16672 15920 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_13420 17385 16669 gene locus_tag LOCUS_13430 gene cobI 17385 16669 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258426.1 protein_id gnl|my_center|LOCUS_13430 18013 17378 gene locus_tag LOCUS_13440 gene cbiE 18013 17378 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393631.1 protein_id gnl|my_center|LOCUS_13440 19071 17992 gene locus_tag LOCUS_13450 gene cbiD 19071 17992 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876443.1 protein_id gnl|my_center|LOCUS_13450 19551 19126 gene locus_tag LOCUS_13460 19551 19126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 19774 19589 gene locus_tag LOCUS_13470 19774 19589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 20510 19854 gene locus_tag LOCUS_13480 20510 19854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 21623 20562 gene locus_tag LOCUS_13490 21623 20562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence038 114 980 gene locus_tag LOCUS_13500 114 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2734 1316 gene locus_tag LOCUS_13510 2734 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2930 4405 gene locus_tag LOCUS_13520 2930 4405 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_13520 4648 5670 gene locus_tag LOCUS_13530 4648 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 5800 6288 gene locus_tag LOCUS_13540 gene bcp 5800 6288 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880283.1 protein_id gnl|my_center|LOCUS_13540 6709 9876 gene locus_tag LOCUS_13550 gene glnE 6709 9876 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_13550 10163 11419 gene locus_tag LOCUS_13560 10163 11419 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_13560 11665 13020 gene locus_tag LOCUS_13570 gene dnaA 11665 13020 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940678.1 protein_id gnl|my_center|LOCUS_13570 13233 14336 gene locus_tag LOCUS_13580 gene dnaN 13233 14336 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_13580 14516 14668 gene locus_tag LOCUS_13590 gene rpmH 14516 14668 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944078.1 protein_id gnl|my_center|LOCUS_13590 14673 15017 gene locus_tag LOCUS_13600 gene rnpA 14673 15017 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944077.1 protein_id gnl|my_center|LOCUS_13600 15072 15332 gene locus_tag LOCUS_13610 gene yidD 15072 15332 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582538.1 protein_id gnl|my_center|LOCUS_13610 15434 17113 gene locus_tag LOCUS_13620 gene yidC 15434 17113 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_13620 17145 18551 gene locus_tag LOCUS_13630 gene mnmE 17145 18551 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_13630 18987 20216 gene locus_tag LOCUS_13640 18987 20216 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_13640 20499 21722 gene locus_tag LOCUS_13650 20499 21722 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence039 <1 1164 gene locus_tag LOCUS_13660 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021995751.1:group II intron reverse transcriptase/maturase 1452 2804 gene locus_tag LOCUS_13670 1452 2804 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_13670 2788 3552 gene locus_tag LOCUS_13680 2788 3552 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544934.1 protein_id gnl|my_center|LOCUS_13680 3867 4901 gene locus_tag LOCUS_13690 gene hemE 3867 4901 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_13690 4902 5843 gene locus_tag LOCUS_13700 gene hemH 4902 5843 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887774.1 protein_id gnl|my_center|LOCUS_13700 5840 7285 gene locus_tag LOCUS_13710 gene hemG 5840 7285 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_13710 7568 7484 gene locus_tag LOCUS_t00220 7568 7484 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8066 7629 gene locus_tag LOCUS_13720 8066 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 8967 8191 gene locus_tag LOCUS_13730 gene tpiA 8967 8191 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_13730 10279 8981 gene locus_tag LOCUS_13740 gene pgk 10279 8981 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_13740 11226 10219 gene locus_tag LOCUS_13750 gene gap 11226 10219 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_13750 11965 11267 gene locus_tag LOCUS_13760 gene aroD 11965 11267 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879937.1 protein_id gnl|my_center|LOCUS_13760 12196 13152 gene locus_tag LOCUS_13770 12196 13152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 13730 14413 gene locus_tag LOCUS_13780 13730 14413 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_13780 14723 14935 gene locus_tag LOCUS_13790 14723 14935 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_13790 14932 17229 gene locus_tag LOCUS_13800 14932 17229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 17253 18056 gene locus_tag LOCUS_13810 17253 18056 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_13810 18044 19324 gene locus_tag LOCUS_13820 18044 19324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 20611 19955 gene locus_tag LOCUS_13830 20611 19955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence040 1433 450 gene locus_tag LOCUS_13840 1433 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 2764 1628 gene locus_tag LOCUS_13850 2764 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 4155 2785 gene locus_tag LOCUS_13860 4155 2785 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_13860 5685 4231 gene locus_tag LOCUS_13870 5685 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 7128 5686 gene locus_tag LOCUS_13880 7128 5686 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_13880 8084 7125 gene locus_tag LOCUS_13890 8084 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 8478 8089 gene locus_tag LOCUS_13900 8478 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 9496 8594 gene locus_tag LOCUS_13910 9496 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 10544 9504 gene locus_tag LOCUS_13920 10544 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 12444 10549 gene locus_tag LOCUS_13930 12444 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 13843 12530 gene locus_tag LOCUS_13940 13843 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 14811 13816 gene locus_tag LOCUS_13950 14811 13816 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_13950 16294 14735 gene locus_tag LOCUS_13960 16294 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 18080 16299 gene locus_tag LOCUS_13970 18080 16299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 19630 18092 gene locus_tag LOCUS_13980 19630 18092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 19811 19653 gene locus_tag LOCUS_13990 19811 19653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 20200 19808 gene locus_tag LOCUS_14000 20200 19808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 <20899 20216 gene locus_tag LOCUS_14010 <20899 20216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338122.1:magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase note possible pseudo, internal stop codon >Feature sequence041 1044 334 gene locus_tag LOCUS_14020 1044 334 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021473.1 protein_id gnl|my_center|LOCUS_14020 1328 1243 gene locus_tag LOCUS_t00230 1328 1243 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1618 2262 gene locus_tag LOCUS_14030 gene fsa 1618 2262 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_14030 2291 4054 gene locus_tag LOCUS_14040 2291 4054 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_14040 4095 4238 gene locus_tag LOCUS_14050 4095 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 4328 4984 gene locus_tag LOCUS_14060 4328 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 5004 5726 gene locus_tag LOCUS_14070 5004 5726 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_14070 5899 8052 gene locus_tag LOCUS_14080 gene rnr 5899 8052 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_14080 8052 9737 gene locus_tag LOCUS_14090 8052 9737 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_14090 9757 10701 gene locus_tag LOCUS_14100 9757 10701 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_14100 10757 11617 gene locus_tag LOCUS_14110 gene aroE 10757 11617 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942136.1 protein_id gnl|my_center|LOCUS_14110 11614 12396 gene locus_tag LOCUS_14120 11614 12396 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943095.1 protein_id gnl|my_center|LOCUS_14120 12404 12778 gene locus_tag LOCUS_14130 12404 12778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 12974 13861 gene locus_tag LOCUS_14140 12974 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 14258 14995 gene locus_tag LOCUS_14150 14258 14995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 15838 15569 gene locus_tag LOCUS_14160 15838 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 16613 15876 gene locus_tag LOCUS_14170 16613 15876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 17023 16610 gene locus_tag LOCUS_14180 gene merR 17023 16610 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166628.1 protein_id gnl|my_center|LOCUS_14180 17481 17906 gene locus_tag LOCUS_14190 17481 17906 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_14190 18737 17958 gene locus_tag LOCUS_14200 gene udp 18737 17958 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211528.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence042 205 1014 gene locus_tag LOCUS_14210 205 1014 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_14210 1038 2273 gene locus_tag LOCUS_14220 1038 2273 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 protein_id gnl|my_center|LOCUS_14220 2572 3060 gene locus_tag LOCUS_14230 gene folK 2572 3060 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_14230 3101 3373 gene locus_tag LOCUS_14240 3101 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3644 4459 gene locus_tag LOCUS_14250 gene lsrF 3644 4459 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774174.1 protein_id gnl|my_center|LOCUS_14250 4498 5520 gene locus_tag LOCUS_14260 4498 5520 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_14260 5529 6395 gene locus_tag LOCUS_14270 5529 6395 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_14270 6422 8113 gene locus_tag LOCUS_14280 gene recN 6422 8113 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_14280 8110 8604 gene locus_tag LOCUS_14290 8110 8604 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930707.1 protein_id gnl|my_center|LOCUS_14290 8616 9971 gene locus_tag LOCUS_14300 8616 9971 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942701.1 protein_id gnl|my_center|LOCUS_14300 10377 13352 gene locus_tag LOCUS_14310 10377 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 13529 15469 gene locus_tag LOCUS_14320 13529 15469 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_14320 16155 15478 gene locus_tag LOCUS_14330 gene bioD 16155 15478 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_14330 17524 16160 gene locus_tag LOCUS_14340 gene bioA 17524 16160 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_14340 18426 17611 gene locus_tag LOCUS_14350 gene bioC 18426 17611 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943265.1 protein_id gnl|my_center|LOCUS_14350 <19128 18426 gene locus_tag LOCUS_14360 <19128 18426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943266.1:alpha/beta fold hydrolase >Feature sequence043 1001 135 gene locus_tag LOCUS_14370 gene prmA 1001 135 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_14370 1628 1140 gene locus_tag LOCUS_14380 1628 1140 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_14380 2468 1818 gene locus_tag LOCUS_14390 2468 1818 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404316.1 protein_id gnl|my_center|LOCUS_14390 4636 2465 gene locus_tag LOCUS_14400 4636 2465 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546688.1 protein_id gnl|my_center|LOCUS_14400 5902 4757 gene locus_tag LOCUS_14410 5902 4757 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530160.1 protein_id gnl|my_center|LOCUS_14410 6761 6027 gene locus_tag LOCUS_14420 6761 6027 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_14420 7566 6895 gene locus_tag LOCUS_14430 gene nfi 7566 6895 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_14430 8755 7841 gene locus_tag LOCUS_14440 8755 7841 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_14440 9806 8949 gene locus_tag LOCUS_14450 9806 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 10176 9799 gene locus_tag LOCUS_14460 10176 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 11057 10224 gene locus_tag LOCUS_14470 11057 10224 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_14470 11854 11054 gene locus_tag LOCUS_14480 11854 11054 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_14480 12794 12156 gene locus_tag LOCUS_14490 gene rsmG 12794 12156 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944072.1 protein_id gnl|my_center|LOCUS_14490 14686 12791 gene locus_tag LOCUS_14500 gene mnmG 14686 12791 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_14500 15010 15558 gene locus_tag LOCUS_14510 15010 15558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 15611 16750 gene locus_tag LOCUS_14520 15611 16750 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775309.1 protein_id gnl|my_center|LOCUS_14520 17929 16910 gene locus_tag LOCUS_14530 gene mltG 17929 16910 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_14530 18487 18020 gene locus_tag LOCUS_14540 gene ruvX 18487 18020 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence044 2519 288 gene locus_tag LOCUS_14550 2519 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 3541 2729 gene locus_tag LOCUS_14560 3541 2729 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 protein_id gnl|my_center|LOCUS_14560 5821 3563 gene locus_tag LOCUS_14570 5821 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 7489 5822 gene locus_tag LOCUS_14580 7489 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 8464 7535 gene locus_tag LOCUS_14590 8464 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 9261 8461 gene locus_tag LOCUS_14600 9261 8461 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172835.1 protein_id gnl|my_center|LOCUS_14600 10138 9239 gene locus_tag LOCUS_14610 10138 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 11760 10165 gene locus_tag LOCUS_14620 11760 10165 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144207.1 protein_id gnl|my_center|LOCUS_14620 12068 11787 gene locus_tag LOCUS_14630 12068 11787 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144208.1 protein_id gnl|my_center|LOCUS_14630 16854 12094 gene locus_tag LOCUS_14640 16854 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 <18631 16836 gene locus_tag LOCUS_14650 <18631 16836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076450870.1:type I polyketide synthase >Feature sequence045 319 243 gene locus_tag LOCUS_t00240 319 243 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 712 353 gene locus_tag LOCUS_14660 712 353 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958148.1 protein_id gnl|my_center|LOCUS_14660 1036 749 gene locus_tag LOCUS_14670 1036 749 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_14670 3465 1063 gene locus_tag LOCUS_14680 gene pheT 3465 1063 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_14680 4502 3486 gene locus_tag LOCUS_14690 gene pheS 4502 3486 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_14690 4858 4499 gene locus_tag LOCUS_14700 gene rplT 4858 4499 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_14700 5266 5069 gene locus_tag LOCUS_14710 gene rpmI 5266 5069 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211834.1 protein_id gnl|my_center|LOCUS_14710 5752 5300 gene locus_tag LOCUS_14720 gene infC 5752 5300 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_14720 7794 5983 gene locus_tag LOCUS_14730 gene thrS 7794 5983 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_14730 8139 8065 gene locus_tag LOCUS_t00250 8139 8065 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9061 8375 gene locus_tag LOCUS_14740 9061 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 9779 9390 gene locus_tag LOCUS_14750 9779 9390 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_14750 10006 9779 gene locus_tag LOCUS_14760 10006 9779 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932024.1 protein_id gnl|my_center|LOCUS_14760 10855 10520 gene locus_tag LOCUS_14770 10855 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 10868 11536 gene locus_tag LOCUS_14780 10868 11536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523242.1 protein_id gnl|my_center|LOCUS_14780 11536 12756 gene locus_tag LOCUS_14790 11536 12756 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481724.1 protein_id gnl|my_center|LOCUS_14790 12782 13546 gene locus_tag LOCUS_14800 12782 13546 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704580.1 protein_id gnl|my_center|LOCUS_14800 13956 15722 gene locus_tag LOCUS_14810 13956 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 15940 15743 gene locus_tag LOCUS_14820 15940 15743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 15863 16648 gene locus_tag LOCUS_14830 15863 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14830 16652 17725 gene locus_tag LOCUS_14840 16652 17725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14840 >Feature sequence046 521 222 gene locus_tag LOCUS_14850 521 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 429 1895 gene locus_tag LOCUS_14860 gene hflX 429 1895 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545622.1 protein_id gnl|my_center|LOCUS_14860 2459 2061 gene locus_tag LOCUS_14870 2459 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 3754 2705 gene locus_tag LOCUS_14880 3754 2705 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227082.1 protein_id gnl|my_center|LOCUS_14880 3939 4682 gene locus_tag LOCUS_14890 3939 4682 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_14890 4848 5705 gene locus_tag LOCUS_14900 4848 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 6001 6792 gene locus_tag LOCUS_14910 6001 6792 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_14910 6808 7647 gene locus_tag LOCUS_14920 gene proC 6808 7647 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041305.1 protein_id gnl|my_center|LOCUS_14920 7701 8012 gene locus_tag LOCUS_14930 7701 8012 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_14930 8048 8545 gene locus_tag LOCUS_14940 8048 8545 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_14940 8551 8898 gene locus_tag LOCUS_14950 8551 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 10556 9045 gene locus_tag LOCUS_14960 10556 9045 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545267.1 protein_id gnl|my_center|LOCUS_14960 10914 13610 gene locus_tag LOCUS_14970 gene ppdK 10914 13610 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679160.1 protein_id gnl|my_center|LOCUS_14970 13792 17340 gene locus_tag LOCUS_14980 gene smc 13792 17340 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_14980 17513 17914 gene locus_tag LOCUS_14990 17513 17914 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence047 389 1639 gene locus_tag LOCUS_15000 gene rho 389 1639 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_15000 1997 2203 gene locus_tag LOCUS_15010 gene rpmE 1997 2203 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_15010 2220 2909 gene locus_tag LOCUS_15020 gene thyX 2220 2909 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_15020 3067 4152 gene locus_tag LOCUS_15030 gene prfA 3067 4152 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_15030 4221 5492 gene locus_tag LOCUS_15040 gene murA 4221 5492 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_15040 5476 6153 gene locus_tag LOCUS_15050 gene hisG 5476 6153 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_15050 6159 7442 gene locus_tag LOCUS_15060 gene hisD 6159 7442 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_15060 7529 8146 gene locus_tag LOCUS_15070 gene hisB 7529 8146 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949112.1 protein_id gnl|my_center|LOCUS_15070 8143 8766 gene locus_tag LOCUS_15080 gene hisH 8143 8766 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_15080 8825 9544 gene locus_tag LOCUS_15090 gene hisA 8825 9544 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_15090 9697 10464 gene locus_tag LOCUS_15100 gene hisF 9697 10464 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_15100 10461 10949 gene locus_tag LOCUS_15110 10461 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 11264 11878 gene locus_tag LOCUS_15120 11264 11878 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880973.1 protein_id gnl|my_center|LOCUS_15120 13172 12009 gene locus_tag LOCUS_15130 13172 12009 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943295.1 protein_id gnl|my_center|LOCUS_15130 14165 13203 gene locus_tag LOCUS_15140 14165 13203 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943294.1 protein_id gnl|my_center|LOCUS_15140 15223 14153 gene locus_tag LOCUS_15150 gene pdhA 15223 14153 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_15150 15821 15513 gene locus_tag LOCUS_15160 15821 15513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 16246 15821 gene locus_tag LOCUS_15170 16246 15821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 16612 16247 gene locus_tag LOCUS_15180 16612 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 17149 16688 gene locus_tag LOCUS_15190 17149 16688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 17538 17242 gene locus_tag LOCUS_15200 17538 17242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 17805 18017 gene locus_tag LOCUS_15210 17805 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence048 2131 926 gene locus_tag LOCUS_15220 gene tyrS 2131 926 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_15220 2939 2145 gene locus_tag LOCUS_15230 2939 2145 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_15230 4618 3062 gene locus_tag LOCUS_15240 gene rny 4618 3062 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_15240 5309 4779 gene locus_tag LOCUS_15250 5309 4779 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941797.1 protein_id gnl|my_center|LOCUS_15250 6073 5792 gene locus_tag LOCUS_15260 6073 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 6322 6083 gene locus_tag LOCUS_15270 6322 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 7239 6502 gene locus_tag LOCUS_15280 7239 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941891.1 protein_id gnl|my_center|LOCUS_15280 8822 7314 gene locus_tag LOCUS_15290 8822 7314 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941895.1 protein_id gnl|my_center|LOCUS_15290 10003 8924 gene locus_tag LOCUS_15300 10003 8924 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941892.1 protein_id gnl|my_center|LOCUS_15300 10477 10016 gene locus_tag LOCUS_15310 10477 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 11529 10582 gene locus_tag LOCUS_15320 gene hdrB 11529 10582 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877481.1 protein_id gnl|my_center|LOCUS_15320 11881 11693 gene locus_tag LOCUS_15330 11881 11693 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390530.1 protein_id gnl|my_center|LOCUS_15330 13464 12040 gene locus_tag LOCUS_15340 13464 12040 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941769.1 protein_id gnl|my_center|LOCUS_15340 14100 15167 gene locus_tag LOCUS_15350 14100 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 15218 15667 gene locus_tag LOCUS_15360 15218 15667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166845236.1 protein_id gnl|my_center|LOCUS_15360 15724 17409 gene locus_tag LOCUS_15370 15724 17409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence049 854 1678 gene locus_tag LOCUS_15380 854 1678 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_15380 1805 2230 gene locus_tag LOCUS_15390 1805 2230 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892241.1 protein_id gnl|my_center|LOCUS_15390 2404 5187 gene locus_tag LOCUS_15400 gene ileS 2404 5187 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_15400 5184 5654 gene locus_tag LOCUS_15410 gene lspA 5184 5654 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_15410 6406 5630 gene locus_tag LOCUS_15420 6406 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 8676 6559 gene locus_tag LOCUS_15430 gene topA 8676 6559 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_15430 9907 8777 gene locus_tag LOCUS_15440 gene dprA 9907 8777 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_15440 11081 9999 gene locus_tag LOCUS_15450 11081 9999 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914065.1 protein_id gnl|my_center|LOCUS_15450 11860 11141 gene locus_tag LOCUS_15460 gene ybgF 11860 11141 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943188.1 protein_id gnl|my_center|LOCUS_15460 12616 12029 gene locus_tag LOCUS_15470 gene yihA 12616 12029 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_15470 12935 12663 gene locus_tag LOCUS_15480 12935 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 14200 12932 gene locus_tag LOCUS_15490 gene hisS 14200 12932 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_15490 14843 14361 gene locus_tag LOCUS_15500 14843 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943551.1 protein_id gnl|my_center|LOCUS_15500 15347 15790 gene locus_tag LOCUS_15510 15347 15790 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_15510 16081 16419 gene locus_tag LOCUS_15520 16081 16419 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861374.1 protein_id gnl|my_center|LOCUS_15520 16628 16903 gene locus_tag LOCUS_15530 16628 16903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence050 1419 343 gene locus_tag LOCUS_15540 1419 343 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_15540 2458 1712 gene locus_tag LOCUS_15550 2458 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2572 2952 gene locus_tag LOCUS_15560 2572 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4264 3104 gene locus_tag LOCUS_15570 gene sat 4264 3104 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_15570 4999 4265 gene locus_tag LOCUS_15580 4999 4265 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_15580 5613 5002 gene locus_tag LOCUS_15590 gene cysC 5613 5002 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_15590 6163 5657 gene locus_tag LOCUS_15600 6163 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 7571 6144 gene locus_tag LOCUS_15610 7571 6144 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876425.1 protein_id gnl|my_center|LOCUS_15610 8812 7589 gene locus_tag LOCUS_15620 8812 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 9675 8857 gene locus_tag LOCUS_15630 gene thiF 9675 8857 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_15630 10152 9733 gene locus_tag LOCUS_15640 10152 9733 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_15640 11259 10300 gene locus_tag LOCUS_15650 11259 10300 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_15650 11877 11641 gene locus_tag LOCUS_15660 11877 11641 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545388.1 protein_id gnl|my_center|LOCUS_15660 12155 11874 gene locus_tag LOCUS_15670 12155 11874 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_15670 12522 12286 gene locus_tag LOCUS_15680 12522 12286 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393466.1 protein_id gnl|my_center|LOCUS_15680 13475 12519 gene locus_tag LOCUS_15690 13475 12519 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942004.1 protein_id gnl|my_center|LOCUS_15690 15053 13800 gene locus_tag LOCUS_15700 gene thrC 15053 13800 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_15700 16333 15680 gene locus_tag LOCUS_15710 16333 15680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence051 646 278 gene locus_tag LOCUS_15720 646 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1839 817 gene locus_tag LOCUS_15730 1839 817 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_15730 2638 2060 gene locus_tag LOCUS_15740 gene rpsD 2638 2060 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_15740 3084 2707 gene locus_tag LOCUS_15750 gene rpsK 3084 2707 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_15750 3485 3117 gene locus_tag LOCUS_15760 gene rpsM 3485 3117 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_15760 4008 3790 gene locus_tag LOCUS_15770 gene infA 4008 3790 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_15770 4772 4011 gene locus_tag LOCUS_15780 gene map 4772 4011 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943464.1 protein_id gnl|my_center|LOCUS_15780 5406 4765 gene locus_tag LOCUS_15790 5406 4765 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943465.1 protein_id gnl|my_center|LOCUS_15790 6723 5419 gene locus_tag LOCUS_15800 gene secY 6723 5419 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_15800 7165 6725 gene locus_tag LOCUS_15810 gene rplO 7165 6725 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_15810 7551 7363 gene locus_tag LOCUS_15820 gene rpmD 7551 7363 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_15820 8054 7548 gene locus_tag LOCUS_15830 gene rpsE 8054 7548 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_15830 8464 8096 gene locus_tag LOCUS_15840 gene rplR 8464 8096 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_15840 9022 8474 gene locus_tag LOCUS_15850 gene rplF 9022 8474 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_15850 9433 9035 gene locus_tag LOCUS_15860 gene rpsH 9433 9035 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720937.1 protein_id gnl|my_center|LOCUS_15860 9648 9463 gene locus_tag LOCUS_15870 9648 9463 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943473.1 protein_id gnl|my_center|LOCUS_15870 10209 9667 gene locus_tag LOCUS_15880 gene rplE 10209 9667 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_15880 10538 10206 gene locus_tag LOCUS_15890 gene rplX 10538 10206 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_15890 10919 10551 gene locus_tag LOCUS_15900 gene rplN 10919 10551 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390428.1 protein_id gnl|my_center|LOCUS_15900 11176 10916 gene locus_tag LOCUS_15910 gene rpsQ 11176 10916 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_15910 11373 11179 gene locus_tag LOCUS_15920 gene rpmC 11373 11179 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644429.1 protein_id gnl|my_center|LOCUS_15920 11783 11370 gene locus_tag LOCUS_15930 gene rplP 11783 11370 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_15930 12471 11803 gene locus_tag LOCUS_15940 gene rpsC 12471 11803 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_15940 12819 12487 gene locus_tag LOCUS_15950 gene rplV 12819 12487 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173710.1 protein_id gnl|my_center|LOCUS_15950 13112 12831 gene locus_tag LOCUS_15960 gene rpsS 13112 12831 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_15960 13940 13113 gene locus_tag LOCUS_15970 gene rplB 13940 13113 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_15970 14289 13996 gene locus_tag LOCUS_15980 gene rplW 14289 13996 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393935.1 protein_id gnl|my_center|LOCUS_15980 15192 14569 gene locus_tag LOCUS_15990 gene rplD 15192 14569 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_15990 15839 15207 gene locus_tag LOCUS_16000 gene rplC 15839 15207 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_16000 16173 15859 gene locus_tag LOCUS_16010 gene rpsJ 16173 15859 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence052 2263 182 gene locus_tag LOCUS_16020 gene fusA 2263 182 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_16020 2780 2310 gene locus_tag LOCUS_16030 gene rpsG 2780 2310 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_16030 3267 2896 gene locus_tag LOCUS_16040 gene rpsL 3267 2896 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_16040 7470 3337 gene locus_tag LOCUS_16050 gene rpoC 7470 3337 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_16050 11684 7530 gene locus_tag LOCUS_16060 gene rpoB 11684 7530 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_16060 12383 11895 gene locus_tag LOCUS_16070 gene rplL 12383 11895 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_16070 12918 12361 gene locus_tag LOCUS_16080 gene rplJ 12918 12361 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_16080 14094 13399 gene locus_tag LOCUS_16090 gene rplA 14094 13399 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_16090 14526 14101 gene locus_tag LOCUS_16100 gene rplK 14526 14101 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940184.1 protein_id gnl|my_center|LOCUS_16100 15149 14619 gene locus_tag LOCUS_16110 gene nusG 15149 14619 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_16110 15367 15176 gene locus_tag LOCUS_16120 gene secE 15367 15176 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943499.1 protein_id gnl|my_center|LOCUS_16120 15743 15667 gene locus_tag LOCUS_t00260 15743 15667 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 15938 15789 gene locus_tag LOCUS_16130 gene rpmG 15938 15789 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence053 309 671 gene locus_tag LOCUS_16140 gene queF 309 671 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_16140 2636 672 gene locus_tag LOCUS_16150 2636 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2903 2706 gene locus_tag LOCUS_16160 2903 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 5850 2920 gene locus_tag LOCUS_16170 5850 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 7021 5852 gene locus_tag LOCUS_16180 7021 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_16180 8759 7218 gene locus_tag LOCUS_16190 8759 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 10102 8978 gene locus_tag LOCUS_16200 gene cobD 10102 8978 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_16200 10980 10099 gene locus_tag LOCUS_16210 10980 10099 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_16210 11672 10977 gene locus_tag LOCUS_16220 11672 10977 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249420.1 protein_id gnl|my_center|LOCUS_16220 13043 11673 gene locus_tag LOCUS_16230 13043 11673 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023105.1 protein_id gnl|my_center|LOCUS_16230 13295 13089 gene locus_tag LOCUS_16240 13295 13089 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037421425.1 protein_id gnl|my_center|LOCUS_16240 13800 13336 gene locus_tag LOCUS_16250 13800 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 15280 14285 gene locus_tag LOCUS_16260 gene cbiB 15280 14285 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_16260 <15966 15297 gene locus_tag LOCUS_16270 <15966 15297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948601.1:cobyric acid synthase >Feature sequence054 239 472 gene locus_tag LOCUS_16280 gene acpP 239 472 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_16280 587 1822 gene locus_tag LOCUS_16290 gene fabF 587 1822 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_16290 1869 2336 gene locus_tag LOCUS_16300 gene rpiB 1869 2336 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942251.1 protein_id gnl|my_center|LOCUS_16300 2444 3703 gene locus_tag LOCUS_16310 2444 3703 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_16310 5452 3995 gene locus_tag LOCUS_16320 5452 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 9441 5503 gene locus_tag LOCUS_16330 9441 5503 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876975.1 protein_id gnl|my_center|LOCUS_16330 11495 9438 gene locus_tag LOCUS_16340 11495 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 11860 11492 gene locus_tag LOCUS_16350 11860 11492 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024510.1 protein_id gnl|my_center|LOCUS_16350 12471 11857 gene locus_tag LOCUS_16360 12471 11857 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 protein_id gnl|my_center|LOCUS_16360 13178 12462 gene locus_tag LOCUS_16370 13178 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 15202 13181 gene locus_tag LOCUS_16380 15202 13181 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926859.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence055 746 2731 gene locus_tag LOCUS_16390 746 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3660 2902 gene locus_tag LOCUS_16400 3660 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4405 5733 gene locus_tag LOCUS_16410 4405 5733 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941362.1 protein_id gnl|my_center|LOCUS_16410 5826 7064 gene locus_tag LOCUS_16420 5826 7064 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943138.1 protein_id gnl|my_center|LOCUS_16420 7319 9721 gene locus_tag LOCUS_16430 7319 9721 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_16430 9830 10198 gene locus_tag LOCUS_16440 gene queD 9830 10198 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_16440 10201 10992 gene locus_tag LOCUS_16450 gene folE2 10201 10992 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_16450 11664 11041 gene locus_tag LOCUS_16460 11664 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 12242 12961 gene locus_tag LOCUS_16470 gene kdsB 12242 12961 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_16470 12980 14668 gene locus_tag LOCUS_16480 12980 14668 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence056 182 258 gene locus_tag LOCUS_t00270 182 258 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 858 1814 gene locus_tag LOCUS_16490 858 1814 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921808.1 protein_id gnl|my_center|LOCUS_16490 2072 2608 gene locus_tag LOCUS_16500 2072 2608 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878776.1 protein_id gnl|my_center|LOCUS_16500 3063 2626 gene locus_tag LOCUS_16510 3063 2626 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_16510 4168 3170 gene locus_tag LOCUS_16520 4168 3170 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546734.1 protein_id gnl|my_center|LOCUS_16520 4862 6586 gene locus_tag LOCUS_16530 4862 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 6570 7109 gene locus_tag LOCUS_16540 6570 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 7111 7881 gene locus_tag LOCUS_16550 7111 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 7878 9383 gene locus_tag LOCUS_16560 7878 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 9576 9388 gene locus_tag LOCUS_16570 9576 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 10787 9573 gene locus_tag LOCUS_16580 gene nirJ2 10787 9573 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966080.1 protein_id gnl|my_center|LOCUS_16580 11965 10784 gene locus_tag LOCUS_16590 11965 10784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 12092 12907 gene locus_tag LOCUS_16600 12092 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 13807 12920 gene locus_tag LOCUS_16610 13807 12920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 14262 13804 gene locus_tag LOCUS_16620 14262 13804 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941718.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence057 578 207 gene locus_tag LOCUS_16630 578 207 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_16630 1956 802 gene locus_tag LOCUS_16640 1956 802 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_16640 3825 2431 gene locus_tag LOCUS_16650 3825 2431 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_16650 5130 4594 gene locus_tag LOCUS_16660 gene rfaH 5130 4594 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268290.1 protein_id gnl|my_center|LOCUS_16660 6078 5182 gene locus_tag LOCUS_16670 6078 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 7767 6616 gene locus_tag LOCUS_16680 7767 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 8590 7778 gene locus_tag LOCUS_16690 8590 7778 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_16690 10163 8592 gene locus_tag LOCUS_16700 10163 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 11015 10164 gene locus_tag LOCUS_16710 11015 10164 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942629.1 protein_id gnl|my_center|LOCUS_16710 13990 11216 gene locus_tag LOCUS_16720 13990 11216 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence058 946 870 gene locus_tag LOCUS_t00280 946 870 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1667 1056 gene locus_tag LOCUS_16730 1667 1056 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392057.1 protein_id gnl|my_center|LOCUS_16730 2425 1694 gene locus_tag LOCUS_16740 gene rph 2425 1694 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_16740 3261 2425 gene locus_tag LOCUS_16750 3261 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 3484 4494 gene locus_tag LOCUS_16760 3484 4494 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162457.1 protein_id gnl|my_center|LOCUS_16760 4491 5309 gene locus_tag LOCUS_16770 gene mpgP 4491 5309 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228324.1 protein_id gnl|my_center|LOCUS_16770 5359 6630 gene locus_tag LOCUS_16780 5359 6630 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_16780 7242 7811 gene locus_tag LOCUS_16790 7242 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 7932 8981 gene locus_tag LOCUS_16800 7932 8981 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_16800 9123 9773 gene locus_tag LOCUS_16810 9123 9773 CDS product DUF5752 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978371.1 protein_id gnl|my_center|LOCUS_16810 9770 10984 gene locus_tag LOCUS_16820 9770 10984 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_16820 11094 12416 gene locus_tag LOCUS_16830 11094 12416 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173996.1 protein_id gnl|my_center|LOCUS_16830 12413 13261 gene locus_tag LOCUS_16840 12413 13261 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_16840 13273 14109 gene locus_tag LOCUS_16850 13273 14109 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266611.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence059 775 326 gene locus_tag LOCUS_16860 775 326 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249295.1 protein_id gnl|my_center|LOCUS_16860 1304 759 gene locus_tag LOCUS_16870 1304 759 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249296.1 protein_id gnl|my_center|LOCUS_16870 1971 1558 gene locus_tag LOCUS_16880 1971 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2356 2060 gene locus_tag LOCUS_16890 2356 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2523 2954 gene locus_tag LOCUS_16900 gene tnpA 2523 2954 CDS product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 protein_id gnl|my_center|LOCUS_16900 3051 7289 gene locus_tag LOCUS_16910 3051 7289 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200903603.1 protein_id gnl|my_center|LOCUS_16910 7291 8418 gene locus_tag LOCUS_16920 7291 8418 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_16920 8821 9846 gene locus_tag LOCUS_16930 8821 9846 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_16930 9856 10593 gene locus_tag LOCUS_16940 gene truA 9856 10593 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_16940 10790 12157 gene locus_tag LOCUS_16950 10790 12157 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963764.1 protein_id gnl|my_center|LOCUS_16950 12293 12568 gene locus_tag LOCUS_16960 12293 12568 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941527.1 protein_id gnl|my_center|LOCUS_16960 12656 13438 gene locus_tag LOCUS_16970 12656 13438 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_16970 13478 13816 gene locus_tag LOCUS_16980 13478 13816 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence060 299 165 gene locus_tag LOCUS_16990 299 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 841 1755 gene locus_tag LOCUS_17000 841 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1994 2857 gene locus_tag LOCUS_17010 1994 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2867 3745 gene locus_tag LOCUS_17020 2867 3745 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176621.1 protein_id gnl|my_center|LOCUS_17020 3904 4713 gene locus_tag LOCUS_17030 3904 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 4717 5862 gene locus_tag LOCUS_17040 4717 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 5869 7017 gene locus_tag LOCUS_17050 5869 7017 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_17050 7030 8316 gene locus_tag LOCUS_17060 7030 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 8273 9550 gene locus_tag LOCUS_17070 8273 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 9564 10505 gene locus_tag LOCUS_17080 9564 10505 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965470.1 protein_id gnl|my_center|LOCUS_17080 10644 11690 gene locus_tag LOCUS_17090 10644 11690 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_17090 11687 12187 gene locus_tag LOCUS_17100 11687 12187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence061 219 128 gene locus_tag LOCUS_t00290 219 128 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 927 352 gene locus_tag LOCUS_17110 927 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2116 1403 gene locus_tag LOCUS_17120 2116 1403 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941777.1 protein_id gnl|my_center|LOCUS_17120 2338 2150 gene locus_tag LOCUS_17130 2338 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3135 2335 gene locus_tag LOCUS_17140 3135 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3898 3149 gene locus_tag LOCUS_17150 3898 3149 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941775.1 protein_id gnl|my_center|LOCUS_17150 4935 4027 gene locus_tag LOCUS_17160 4935 4027 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_17160 6002 5124 gene locus_tag LOCUS_17170 gene mtnP 6002 5124 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_17170 7488 6490 gene locus_tag LOCUS_17180 gene rlmN 7488 6490 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_17180 8796 7903 gene locus_tag LOCUS_17190 8796 7903 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943923.1 protein_id gnl|my_center|LOCUS_17190 9234 8809 gene locus_tag LOCUS_17200 gene ndk 9234 8809 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939606.1 protein_id gnl|my_center|LOCUS_17200 10211 11044 gene locus_tag LOCUS_17210 10211 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 11809 11153 gene locus_tag LOCUS_17220 11809 11153 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_17220 13552 11912 gene locus_tag LOCUS_17230 gene groL 13552 11912 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_17230 13890 13600 gene locus_tag LOCUS_17240 gene groES 13890 13600 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975443.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence062 <1 1084 gene locus_tag LOCUS_17250 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940703.1:Tol-Pal system beta propeller repeat protein TolB 1116 2018 gene locus_tag LOCUS_17260 gene ybgF 1116 2018 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940701.1 protein_id gnl|my_center|LOCUS_17260 2083 3219 gene locus_tag LOCUS_17270 2083 3219 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941162.1 protein_id gnl|my_center|LOCUS_17270 3504 6518 gene locus_tag LOCUS_17280 3504 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6539 7321 gene locus_tag LOCUS_17290 6539 7321 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021151.1 protein_id gnl|my_center|LOCUS_17290 7696 8457 gene locus_tag LOCUS_17300 7696 8457 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937943.1 protein_id gnl|my_center|LOCUS_17300 8510 9340 gene locus_tag LOCUS_17310 8510 9340 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943655.1 protein_id gnl|my_center|LOCUS_17310 10162 9371 gene locus_tag LOCUS_17320 gene ccsA 10162 9371 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943928.1 protein_id gnl|my_center|LOCUS_17320 10891 10238 gene locus_tag LOCUS_17330 10891 10238 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_17330 13349 10902 gene locus_tag LOCUS_17340 13349 10902 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence063 2448 1672 gene locus_tag LOCUS_17350 2448 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3830 2703 gene locus_tag LOCUS_17360 3830 2703 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_17360 4275 4970 gene locus_tag LOCUS_17370 4275 4970 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_17370 5080 5586 gene locus_tag LOCUS_17380 5080 5586 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_17380 5600 6637 gene locus_tag LOCUS_17390 5600 6637 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_17390 6769 7494 gene locus_tag LOCUS_17400 gene ispD 6769 7494 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_17400 7689 8180 gene locus_tag LOCUS_17410 gene ispF 7689 8180 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393963.1 protein_id gnl|my_center|LOCUS_17410 8183 9583 gene locus_tag LOCUS_17420 gene gltX 8183 9583 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880773.1 protein_id gnl|my_center|LOCUS_17420 9583 11010 gene locus_tag LOCUS_17430 gene cysS 9583 11010 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546384.1 protein_id gnl|my_center|LOCUS_17430 11597 11142 gene locus_tag LOCUS_17440 11597 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 12166 11591 gene locus_tag LOCUS_17450 12166 11591 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_17450 13072 12182 gene locus_tag LOCUS_17460 gene ftsY 13072 12182 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence064 1258 665 gene locus_tag LOCUS_17470 1258 665 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943859.1 protein_id gnl|my_center|LOCUS_17470 2347 1337 gene locus_tag LOCUS_17480 2347 1337 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_17480 2778 2368 gene locus_tag LOCUS_17490 2778 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3182 3661 gene locus_tag LOCUS_17500 3182 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 4218 3652 gene locus_tag LOCUS_17510 4218 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 4277 4672 gene locus_tag LOCUS_17520 4277 4672 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228235.1 protein_id gnl|my_center|LOCUS_17520 6110 4716 gene locus_tag LOCUS_17530 6110 4716 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401947.1 protein_id gnl|my_center|LOCUS_17530 6484 8631 gene locus_tag LOCUS_17540 6484 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 10964 9258 gene locus_tag LOCUS_17550 10964 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 12126 10990 gene locus_tag LOCUS_17560 12126 10990 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058225.1 protein_id gnl|my_center|LOCUS_17560 12458 12868 gene locus_tag LOCUS_17570 12458 12868 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245462.1 protein_id gnl|my_center|LOCUS_17570 13183 12983 gene locus_tag LOCUS_17580 13183 12983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence065 192 455 gene locus_tag LOCUS_17590 192 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 588 1319 gene locus_tag LOCUS_17600 588 1319 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_17600 1433 1855 gene locus_tag LOCUS_17610 1433 1855 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870191.1 protein_id gnl|my_center|LOCUS_17610 1926 2477 gene locus_tag LOCUS_17620 gene rsmD 1926 2477 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_17620 2485 2970 gene locus_tag LOCUS_17630 gene coaD 2485 2970 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545514.1 protein_id gnl|my_center|LOCUS_17630 3002 4198 gene locus_tag LOCUS_17640 3002 4198 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_17640 4822 4277 gene locus_tag LOCUS_17650 gene amrA 4822 4277 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_17650 4939 5856 gene locus_tag LOCUS_17660 gene nadA 4939 5856 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_17660 6080 6820 gene locus_tag LOCUS_17670 6080 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 6965 7825 gene locus_tag LOCUS_17680 6965 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 8883 8095 gene locus_tag LOCUS_17690 8883 8095 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881421.1 protein_id gnl|my_center|LOCUS_17690 9794 8880 gene locus_tag LOCUS_17700 9794 8880 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_17700 11091 9808 gene locus_tag LOCUS_17710 11091 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881423.1 protein_id gnl|my_center|LOCUS_17710 11094 11300 gene locus_tag LOCUS_17720 11094 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence066 2223 1237 gene locus_tag LOCUS_17730 2223 1237 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_17730 4130 2631 gene locus_tag LOCUS_17740 4130 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 4363 4287 gene locus_tag LOCUS_t00300 4363 4287 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5230 7989 gene locus_tag LOCUS_17750 5230 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 8113 9249 gene locus_tag LOCUS_17760 8113 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 9278 10720 gene locus_tag LOCUS_17770 9278 10720 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942302.1 protein_id gnl|my_center|LOCUS_17770 10717 11199 gene locus_tag LOCUS_17780 10717 11199 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_17780 11860 11342 gene locus_tag LOCUS_17790 11860 11342 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942173.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence067 270 2438 gene locus_tag LOCUS_17800 gene glyS 270 2438 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_17800 3027 2518 gene locus_tag LOCUS_17810 3027 2518 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544998.1 protein_id gnl|my_center|LOCUS_17810 3401 3739 gene locus_tag LOCUS_17820 3401 3739 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_17820 3818 5230 gene locus_tag LOCUS_17830 gene glnA 3818 5230 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_17830 5450 5953 gene locus_tag LOCUS_17840 5450 5953 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_17840 5968 6504 gene locus_tag LOCUS_17850 5968 6504 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 protein_id gnl|my_center|LOCUS_17850 7278 6544 gene locus_tag LOCUS_17860 gene cysQ 7278 6544 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_17860 7912 7388 gene locus_tag LOCUS_17870 7912 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 8695 7967 gene locus_tag LOCUS_17880 8695 7967 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_17880 10335 8701 gene locus_tag LOCUS_17890 10335 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 11637 10399 gene locus_tag LOCUS_17900 11637 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence068 <1 2388 gene locus_tag LOCUS_17910 <1 2388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940804.1:primosomal protein N' 2998 2789 gene locus_tag LOCUS_17920 2998 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 3409 3014 gene locus_tag LOCUS_17930 3409 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3728 4051 gene locus_tag LOCUS_17940 3728 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5069 4218 gene locus_tag LOCUS_17950 5069 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17950 5801 6046 gene locus_tag LOCUS_17960 5801 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 7333 6071 gene locus_tag LOCUS_17970 7333 6071 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545257.1 protein_id gnl|my_center|LOCUS_17970 8153 7383 gene locus_tag LOCUS_17980 8153 7383 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941673.1 protein_id gnl|my_center|LOCUS_17980 8957 8319 gene locus_tag LOCUS_17990 gene nth 8957 8319 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_17990 10004 9030 gene locus_tag LOCUS_18000 10004 9030 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_18000 11053 10109 gene locus_tag LOCUS_18010 11053 10109 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence069 377 724 gene locus_tag LOCUS_18020 377 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2501 942 gene locus_tag LOCUS_18030 2501 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3396 2515 gene locus_tag LOCUS_18040 3396 2515 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_18040 5307 3430 gene locus_tag LOCUS_18050 gene oadA 5307 3430 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545036.1 protein_id gnl|my_center|LOCUS_18050 6740 5322 gene locus_tag LOCUS_18060 6740 5322 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546372.1 protein_id gnl|my_center|LOCUS_18060 8295 6877 gene locus_tag LOCUS_18070 gene gltX 8295 6877 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_18070 9356 8550 gene locus_tag LOCUS_18080 gene amrB 9356 8550 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942474.1 protein_id gnl|my_center|LOCUS_18080 9540 10190 gene locus_tag LOCUS_18090 9540 10190 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942832.1 protein_id gnl|my_center|LOCUS_18090 10944 10792 gene locus_tag LOCUS_18100 10944 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence070 339 1547 gene locus_tag LOCUS_18110 339 1547 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_18110 1796 1882 gene locus_tag LOCUS_t00310 1796 1882 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2371 2129 gene locus_tag LOCUS_18120 2371 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2370 3341 gene locus_tag LOCUS_18130 2370 3341 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940727.1 protein_id gnl|my_center|LOCUS_18130 3978 5645 gene locus_tag LOCUS_18140 3978 5645 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_18140 5660 6319 gene locus_tag LOCUS_18150 gene cas5c 5660 6319 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_18150 6320 7978 gene locus_tag LOCUS_18160 gene cas8c 6320 7978 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392033.1 protein_id gnl|my_center|LOCUS_18160 8021 8920 gene locus_tag LOCUS_18170 gene cas7c 8021 8920 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392032.1 protein_id gnl|my_center|LOCUS_18170 9267 8956 gene locus_tag LOCUS_18180 9267 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 9872 9657 gene locus_tag LOCUS_18190 9872 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 10437 10619 gene locus_tag LOCUS_18200 10437 10619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 10634 10924 gene locus_tag LOCUS_18210 gene cas2 10634 10924 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence071 <1 775 gene locus_tag LOCUS_18220 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971045.1:inorganic phosphate transporter 856 1278 gene locus_tag LOCUS_18230 856 1278 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868448.1 protein_id gnl|my_center|LOCUS_18230 1313 2233 gene locus_tag LOCUS_18240 1313 2233 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_18240 2558 3229 gene locus_tag LOCUS_18250 2558 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3314 3706 gene locus_tag LOCUS_18260 3314 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 4520 3693 gene locus_tag LOCUS_18270 4520 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 5299 4571 gene locus_tag LOCUS_18280 gene rncS 5299 4571 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_18280 6816 5473 gene locus_tag LOCUS_18290 gene mtaB 6816 5473 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_18290 7906 6839 gene locus_tag LOCUS_18300 gene mnmA 7906 6839 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_18300 8450 8076 gene locus_tag LOCUS_18310 gene nifU 8450 8076 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_18310 9799 8588 gene locus_tag LOCUS_18320 9799 8588 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_18320 10290 9832 gene locus_tag LOCUS_18330 10290 9832 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943207.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence072 338 637 gene locus_tag LOCUS_18340 338 637 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013194.1 protein_id gnl|my_center|LOCUS_18340 634 906 gene locus_tag LOCUS_18350 634 906 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943949.1 protein_id gnl|my_center|LOCUS_18350 1173 1781 gene locus_tag LOCUS_18360 1173 1781 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393261.1 protein_id gnl|my_center|LOCUS_18360 1937 2671 gene locus_tag LOCUS_18370 gene thiD 1937 2671 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035802.1 protein_id gnl|my_center|LOCUS_18370 2964 3110 gene locus_tag LOCUS_18380 2964 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 4308 3454 gene locus_tag LOCUS_18390 4308 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7690 4493 gene locus_tag LOCUS_18400 7690 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 9198 7819 gene locus_tag LOCUS_18410 gene selA 9198 7819 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_18410 9345 9569 gene locus_tag LOCUS_18420 9345 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 9566 10393 gene locus_tag LOCUS_18430 gene mazG 9566 10393 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence073 <1 884 gene locus_tag LOCUS_18440 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941693.1:methyl-accepting chemotaxis protein 952 1443 gene locus_tag LOCUS_18450 952 1443 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_18450 1563 1638 gene locus_tag LOCUS_t00320 1563 1638 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1855 2250 gene locus_tag LOCUS_18460 1855 2250 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_18460 2280 4280 gene locus_tag LOCUS_18470 gene feoB 2280 4280 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_18470 4290 4952 gene locus_tag LOCUS_18480 4290 4952 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274356.1 protein_id gnl|my_center|LOCUS_18480 5094 8615 gene locus_tag LOCUS_18490 gene dnaE 5094 8615 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_18490 8627 9595 gene locus_tag LOCUS_18500 8627 9595 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence074 487 1176 gene locus_tag LOCUS_18510 487 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1302 1667 gene locus_tag LOCUS_18520 1302 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2108 2347 gene locus_tag LOCUS_18530 2108 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2344 2748 gene locus_tag LOCUS_18540 2344 2748 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_18540 2956 4656 gene locus_tag LOCUS_18550 2956 4656 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_18550 5192 4725 gene locus_tag LOCUS_18560 5192 4725 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_18560 6432 5530 gene locus_tag LOCUS_18570 6432 5530 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_18570 6631 7668 gene locus_tag LOCUS_18580 6631 7668 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393686.1 protein_id gnl|my_center|LOCUS_18580 7857 9014 gene locus_tag LOCUS_18590 7857 9014 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 protein_id gnl|my_center|LOCUS_18590 10265 9084 gene locus_tag LOCUS_18600 10265 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence075 1561 167 gene locus_tag LOCUS_18610 1561 167 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941561.1 protein_id gnl|my_center|LOCUS_18610 2234 3559 gene locus_tag LOCUS_18620 2234 3559 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 protein_id gnl|my_center|LOCUS_18620 4665 3613 gene locus_tag LOCUS_18630 4665 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 5176 6456 gene locus_tag LOCUS_18640 5176 6456 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_18640 6469 7008 gene locus_tag LOCUS_18650 6469 7008 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_18650 7030 7521 gene locus_tag LOCUS_18660 gene def 7030 7521 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_18660 7599 8579 gene locus_tag LOCUS_18670 gene bioB 7599 8579 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_18670 8621 9784 gene locus_tag LOCUS_18680 gene bioF 8621 9784 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence076 574 95 gene locus_tag LOCUS_18690 574 95 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_18690 879 586 gene locus_tag LOCUS_18700 gene ihfB 879 586 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339437.1 protein_id gnl|my_center|LOCUS_18700 1776 895 gene locus_tag LOCUS_18710 gene sppA 1776 895 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_18710 3587 1782 gene locus_tag LOCUS_18720 3587 1782 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_18720 4616 3687 gene locus_tag LOCUS_18730 gene ispH 4616 3687 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_18730 5280 4591 gene locus_tag LOCUS_18740 gene cmk 5280 4591 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_18740 6581 5277 gene locus_tag LOCUS_18750 gene aroA 6581 5277 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_18750 7510 6635 gene locus_tag LOCUS_18760 7510 6635 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_18760 8558 7545 gene locus_tag LOCUS_18770 gene aroF 8558 7545 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_18770 9726 8611 gene locus_tag LOCUS_18780 gene hisC 9726 8611 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence077 201 590 gene locus_tag LOCUS_18790 201 590 CDS product PA2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545038.1 protein_id gnl|my_center|LOCUS_18790 822 1418 gene locus_tag LOCUS_18800 822 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1415 2065 gene locus_tag LOCUS_18810 1415 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2281 3045 gene locus_tag LOCUS_18820 gene rlmB 2281 3045 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_18820 3065 4288 gene locus_tag LOCUS_18830 gene ilvA 3065 4288 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 protein_id gnl|my_center|LOCUS_18830 4620 4285 gene locus_tag LOCUS_18840 4620 4285 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 protein_id gnl|my_center|LOCUS_18840 5291 4623 gene locus_tag LOCUS_18850 gene hisIE 5291 4623 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_18850 6206 5448 gene locus_tag LOCUS_18860 6206 5448 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 protein_id gnl|my_center|LOCUS_18860 6722 6360 gene locus_tag LOCUS_18870 6722 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 8386 6719 gene locus_tag LOCUS_18880 8386 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 9000 8386 gene locus_tag LOCUS_18890 9000 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 9946 9011 gene locus_tag LOCUS_18900 9946 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence078 1333 173 gene locus_tag LOCUS_18910 1333 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1902 2423 gene locus_tag LOCUS_18920 gene hpt 1902 2423 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642086.1 protein_id gnl|my_center|LOCUS_18920 2424 3995 gene locus_tag LOCUS_18930 2424 3995 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546491.1 protein_id gnl|my_center|LOCUS_18930 4094 4795 gene locus_tag LOCUS_18940 gene queC 4094 4795 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_18940 4792 4929 gene locus_tag LOCUS_18950 4792 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 5520 4981 gene locus_tag LOCUS_18960 5520 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 5632 6783 gene locus_tag LOCUS_18970 5632 6783 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_18970 7447 7947 gene locus_tag LOCUS_18980 7447 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 8335 8826 gene locus_tag LOCUS_18990 8335 8826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 8862 9749 gene locus_tag LOCUS_19000 gene ubiA 8862 9749 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035644.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence079 2506 80 gene locus_tag LOCUS_19010 gene lon 2506 80 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_19010 2982 2524 gene locus_tag LOCUS_19020 2982 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 3821 3057 gene locus_tag LOCUS_19030 gene galU 3821 3057 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_19030 4854 4168 gene locus_tag LOCUS_19040 4854 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19040 5058 4873 gene locus_tag LOCUS_19050 5058 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 6488 5478 gene locus_tag LOCUS_19060 6488 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 9102 6913 gene locus_tag LOCUS_19070 9102 6913 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence080 277 627 gene locus_tag LOCUS_19080 gene ychN 277 627 CDS product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169659.1 protein_id gnl|my_center|LOCUS_19080 1933 1094 gene locus_tag LOCUS_19090 1933 1094 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972415.1 protein_id gnl|my_center|LOCUS_19090 3200 2043 gene locus_tag LOCUS_19100 gene larC 3200 2043 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_19100 4045 3290 gene locus_tag LOCUS_19110 gene larB 4045 3290 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_19110 5696 4077 gene locus_tag LOCUS_19120 5696 4077 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943817.1 protein_id gnl|my_center|LOCUS_19120 6311 5838 gene locus_tag LOCUS_19130 6311 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 7580 6315 gene locus_tag LOCUS_19140 7580 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 8639 7632 gene locus_tag LOCUS_19150 gene thiL 8639 7632 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence081 915 439 gene locus_tag LOCUS_19160 915 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1470 1306 gene locus_tag LOCUS_19170 1470 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19170 2270 1824 gene locus_tag LOCUS_19180 2270 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 3550 2294 gene locus_tag LOCUS_19190 3550 2294 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_19190 4095 3637 gene locus_tag LOCUS_19200 4095 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 6517 4229 gene locus_tag LOCUS_19210 6517 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 7400 6681 gene locus_tag LOCUS_19220 7400 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 8457 7999 gene locus_tag LOCUS_19230 8457 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence082 873 199 gene locus_tag LOCUS_19240 gene deoC 873 199 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583678.1 protein_id gnl|my_center|LOCUS_19240 1020 1337 gene locus_tag LOCUS_19250 1020 1337 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940862.1 protein_id gnl|my_center|LOCUS_19250 1419 1940 gene locus_tag LOCUS_19260 1419 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1937 3667 gene locus_tag LOCUS_19270 1937 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 3865 4593 gene locus_tag LOCUS_19280 3865 4593 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_19280 5676 4684 gene locus_tag LOCUS_19290 gene fbp 5676 4684 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_19290 6406 5738 gene locus_tag LOCUS_19300 6406 5738 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687047.1 protein_id gnl|my_center|LOCUS_19300 6702 6789 gene locus_tag LOCUS_t00330 6702 6789 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7281 6880 gene locus_tag LOCUS_19310 7281 6880 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940930.1 protein_id gnl|my_center|LOCUS_19310 7910 8407 gene locus_tag LOCUS_19320 7910 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence083 1974 1498 gene locus_tag LOCUS_19330 1974 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 3373 2030 gene locus_tag LOCUS_19340 gene ccoG 3373 2030 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_19340 3926 3417 gene locus_tag LOCUS_19350 3926 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 4392 4252 gene locus_tag LOCUS_19360 4392 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 5001 4396 gene locus_tag LOCUS_19370 gene ccoO 5001 4396 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_19370 6401 4998 gene locus_tag LOCUS_19380 gene ccoN 6401 4998 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_19380 7991 7806 gene locus_tag LOCUS_19390 7991 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 8177 8464 gene locus_tag LOCUS_19400 8177 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence084 1453 3654 gene locus_tag LOCUS_19410 1453 3654 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_19410 3686 4075 gene locus_tag LOCUS_19420 3686 4075 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_19420 4605 4414 gene locus_tag LOCUS_19430 gene rpmB 4605 4414 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_19430 5614 4952 gene locus_tag LOCUS_19440 5614 4952 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_19440 6133 5678 gene locus_tag LOCUS_19450 6133 5678 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083256.1 protein_id gnl|my_center|LOCUS_19450 6865 6200 gene locus_tag LOCUS_19460 gene purN 6865 6200 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_19460 7977 6910 gene locus_tag LOCUS_19470 gene purM 7977 6910 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence085 <1 1287 gene locus_tag LOCUS_19480 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948919.1:heavy metal translocating P-type ATPase 1303 1515 gene locus_tag LOCUS_19490 1303 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1508 2182 gene locus_tag LOCUS_19500 1508 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2757 2284 gene locus_tag LOCUS_19510 2757 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2963 2775 gene locus_tag LOCUS_19520 2963 2775 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941208.1 protein_id gnl|my_center|LOCUS_19520 3739 3014 gene locus_tag LOCUS_19530 3739 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 4897 3770 gene locus_tag LOCUS_19540 gene ahbD 4897 3770 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_19540 5910 4993 gene locus_tag LOCUS_19550 gene hemB 5910 4993 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_19550 7609 6077 gene locus_tag LOCUS_19560 gene cobA 7609 6077 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence086 3370 1478 gene locus_tag LOCUS_19570 3370 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 5244 4249 gene locus_tag LOCUS_19580 5244 4249 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_19580 5314 5550 gene locus_tag LOCUS_19590 5314 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 5845 6075 gene locus_tag LOCUS_19600 5845 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 6072 6476 gene locus_tag LOCUS_19610 6072 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence087 528 1901 gene locus_tag LOCUS_19620 gene prsR 528 1901 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_19620 2476 3234 gene locus_tag LOCUS_19630 2476 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3424 3816 gene locus_tag LOCUS_19640 3424 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 4328 5029 gene locus_tag LOCUS_19650 4328 5029 CDS product CAAX prenyl protease-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942635.1 protein_id gnl|my_center|LOCUS_19650 5233 5481 gene locus_tag LOCUS_19660 5233 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 5478 5882 gene locus_tag LOCUS_19670 5478 5882 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_19670 5967 6125 gene locus_tag LOCUS_19680 5967 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence088 99 2129 gene locus_tag LOCUS_19690 gene uvrB 99 2129 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_19690 2642 2190 gene locus_tag LOCUS_19700 2642 2190 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957571.1 protein_id gnl|my_center|LOCUS_19700 3014 5428 gene locus_tag LOCUS_19710 3014 5428 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_19710 5528 6793 gene locus_tag LOCUS_19720 gene rlmD 5528 6793 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046812.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence089 410 2971 gene locus_tag LOCUS_19730 gene leuS 410 2971 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_19730 2982 3512 gene locus_tag LOCUS_19740 2982 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3545 4537 gene locus_tag LOCUS_19750 gene holA 3545 4537 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_19750 4868 4599 gene locus_tag LOCUS_19760 gene rpsT 4868 4599 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_19760 5143 5307 gene locus_tag LOCUS_19770 5143 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence090 376 684 gene locus_tag LOCUS_19780 gene spoVG 376 684 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722726.1 protein_id gnl|my_center|LOCUS_19780 1074 1808 gene locus_tag LOCUS_19790 1074 1808 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023677.1 protein_id gnl|my_center|LOCUS_19790 1871 2728 gene locus_tag LOCUS_19800 gene rfbD 1871 2728 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_19800 2725 3183 gene locus_tag LOCUS_19810 2725 3183 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_19810 3386 4444 gene locus_tag LOCUS_19820 gene rfbB 3386 4444 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723092.1 protein_id gnl|my_center|LOCUS_19820 4451 5752 gene locus_tag LOCUS_19830 4451 5752 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_19830 5886 6275 gene locus_tag LOCUS_19840 5886 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence091 1030 290 gene locus_tag LOCUS_19850 gene fabG 1030 290 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_19850 2007 1087 gene locus_tag LOCUS_19860 gene fabD 2007 1087 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_19860 3077 2094 gene locus_tag LOCUS_19870 3077 2094 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_19870 4086 3094 gene locus_tag LOCUS_19880 gene plsX 4086 3094 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_19880 4804 4619 gene locus_tag LOCUS_19890 gene rpmF 4804 4619 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_19890 5610 5083 gene locus_tag LOCUS_19900 5610 5083 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_19900 6190 6263 gene locus_tag LOCUS_t00340 6190 6263 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence092 242 502 gene locus_tag LOCUS_19910 242 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1326 526 gene locus_tag LOCUS_19920 1326 526 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390203.1 protein_id gnl|my_center|LOCUS_19920 2134 1478 gene locus_tag LOCUS_19930 gene cysZ 2134 1478 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408742.1 protein_id gnl|my_center|LOCUS_19930 2248 2529 gene locus_tag LOCUS_19940 2248 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2552 3910 gene locus_tag LOCUS_19950 2552 3910 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546645.1 protein_id gnl|my_center|LOCUS_19950 3894 4478 gene locus_tag LOCUS_19960 3894 4478 CDS product MjaI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545491.1 protein_id gnl|my_center|LOCUS_19960 6307 4937 gene locus_tag LOCUS_19970 6307 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence093 236 523 gene locus_tag LOCUS_19980 gene gatC 236 523 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_19980 767 2227 gene locus_tag LOCUS_19990 gene gatA 767 2227 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_19990 2317 3630 gene locus_tag LOCUS_20000 2317 3630 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_20000 3700 5136 gene locus_tag LOCUS_20010 gene gatB 3700 5136 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_20010 5971 5423 gene locus_tag LOCUS_20020 5971 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 6119 5949 gene locus_tag LOCUS_20030 6119 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 6393 6214 gene locus_tag LOCUS_20040 6393 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 6490 6414 gene locus_tag LOCUS_t00350 6490 6414 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence094 <1 612 gene locus_tag LOCUS_20050 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583472.1:response regulator 3318 661 gene locus_tag LOCUS_20060 3318 661 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 protein_id gnl|my_center|LOCUS_20060 3700 3775 gene locus_tag LOCUS_t00360 3700 3775 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4499 4236 gene locus_tag LOCUS_20070 4499 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 4791 5336 gene locus_tag LOCUS_20080 4791 5336 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870236.1 protein_id gnl|my_center|LOCUS_20080 5358 6254 gene locus_tag LOCUS_20090 5358 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence095 578 1006 gene locus_tag LOCUS_20100 578 1006 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_20100 1107 1433 gene locus_tag LOCUS_20110 1107 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2199 1480 gene locus_tag LOCUS_20120 2199 1480 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942367.1 protein_id gnl|my_center|LOCUS_20120 2590 2204 gene locus_tag LOCUS_20130 2590 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 3412 2609 gene locus_tag LOCUS_20140 3412 2609 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023915.1 protein_id gnl|my_center|LOCUS_20140 4324 3425 gene locus_tag LOCUS_20150 gene cbiQ 4324 3425 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023916.1 protein_id gnl|my_center|LOCUS_20150 5277 4312 gene locus_tag LOCUS_20160 gene cbiM 5277 4312 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393363.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence096 495 103 gene locus_tag LOCUS_20170 495 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2067 601 gene locus_tag LOCUS_20180 gene pyk 2067 601 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943944.1 protein_id gnl|my_center|LOCUS_20180 3087 2434 gene locus_tag LOCUS_20190 3087 2434 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461647.1 protein_id gnl|my_center|LOCUS_20190 3179 4858 gene locus_tag LOCUS_20200 gene hcp 3179 4858 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_20200 4973 5155 gene locus_tag LOCUS_20210 4973 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 5584 5507 gene locus_tag LOCUS_t00370 5584 5507 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence097 >Feature sequence098 243 2042 gene locus_tag LOCUS_20220 gene lepA 243 2042 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_20220 2098 2817 gene locus_tag LOCUS_20230 gene lepB 2098 2817 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_20230 2925 3884 gene locus_tag LOCUS_20240 gene xerC 2925 3884 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_20240 4006 4542 gene locus_tag LOCUS_20250 gene hslV 4006 4542 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546241.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence099 1840 653 gene locus_tag LOCUS_20260 1840 653 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_20260 2759 1851 gene locus_tag LOCUS_20270 gene prmC 2759 1851 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_20270 3622 2765 gene locus_tag LOCUS_20280 gene argB 3622 2765 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121716.1 protein_id gnl|my_center|LOCUS_20280 <4853 3653 gene locus_tag LOCUS_20290 <4853 3653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181406033.1:ATP-dependent protease ATPase subunit HslU >Feature sequence100 3020 159 gene locus_tag LOCUS_20300 gene uvrA 3020 159 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_20300 3886 3302 gene locus_tag LOCUS_20310 3886 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence101 1346 570 gene locus_tag LOCUS_20320 1346 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2755 1343 gene locus_tag LOCUS_20330 2755 1343 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392880.1 protein_id gnl|my_center|LOCUS_20330 4070 3006 gene locus_tag LOCUS_20340 4070 3006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250726.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence102 1669 980 gene locus_tag LOCUS_20350 1669 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3435 1729 gene locus_tag LOCUS_20360 3435 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence103 2795 1230 gene locus_tag LOCUS_20370 2795 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 3263 2862 gene locus_tag LOCUS_20380 3263 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 3648 3884 gene locus_tag LOCUS_20390 3648 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence104 1177 1665 gene locus_tag LOCUS_20400 1177 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1610 2173 gene locus_tag LOCUS_20410 1610 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2386 2877 gene locus_tag LOCUS_20420 2386 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 3656 2919 gene locus_tag LOCUS_20430 3656 2919 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941114.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence105 547 1404 gene locus_tag LOCUS_20440 gene fmt 547 1404 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_20440 1379 2215 gene locus_tag LOCUS_20450 1379 2215 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_20450 2486 3340 gene locus_tag LOCUS_20460 gene htpX 2486 3340 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545548.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence106 1989 778 gene locus_tag LOCUS_20470 1989 778 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_20470 2952 2035 gene locus_tag LOCUS_20480 gene argF 2952 2035 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence107 <2966 1024 gene locus_tag LOCUS_20490 <2966 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942586.1:PEP-CTERM system histidine kinase PrsK >Feature sequence108 >Feature sequence109 745 179 gene locus_tag LOCUS_20500 gene pgsA 745 179 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_20500 1362 769 gene locus_tag LOCUS_20510 1362 769 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence110 2339 687 gene locus_tag LOCUS_20520 2339 687 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence111 1802 2482 gene locus_tag LOCUS_20530 1802 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence112 220 624 gene locus_tag LOCUS_20540 220 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 963 1622 gene locus_tag LOCUS_20550 gene rpe 963 1622 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_20550 2143 1649 gene locus_tag LOCUS_20560 2143 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560