>Feature sequence001 180 1184 gene locus_tag LOCUS_00010 gene glpX 180 1184 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869760.1 protein_id gnl|my_center|LOCUS_00010 1214 2167 gene locus_tag LOCUS_00020 1214 2167 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_00020 2266 3465 gene locus_tag LOCUS_00030 2266 3465 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211175379.1 protein_id gnl|my_center|LOCUS_00030 4637 3411 gene locus_tag LOCUS_00040 gene ugpC 4637 3411 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_00040 4789 5904 gene locus_tag LOCUS_00050 4789 5904 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 protein_id gnl|my_center|LOCUS_00050 5901 6617 gene locus_tag LOCUS_00060 5901 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6959 7180 gene locus_tag LOCUS_00070 gene secG 6959 7180 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258195.1 protein_id gnl|my_center|LOCUS_00070 7241 8896 gene locus_tag LOCUS_00080 7241 8896 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_00080 8922 9308 gene locus_tag LOCUS_00090 8922 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9305 10162 gene locus_tag LOCUS_00100 9305 10162 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_00100 10780 10133 gene locus_tag LOCUS_00110 gene rimI 10780 10133 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258576.1 protein_id gnl|my_center|LOCUS_00110 11459 10794 gene locus_tag LOCUS_00120 gene tsaB 11459 10794 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_00120 11960 11460 gene locus_tag LOCUS_00130 gene tsaE 11960 11460 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257860.1 protein_id gnl|my_center|LOCUS_00130 13655 11979 gene locus_tag LOCUS_00140 13655 11979 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_00140 15083 13941 gene locus_tag LOCUS_00150 15083 13941 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_00150 15046 15195 gene locus_tag LOCUS_00160 15046 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16223 15666 gene locus_tag LOCUS_00170 gene dcd 16223 15666 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404183.1 protein_id gnl|my_center|LOCUS_00170 17023 16292 gene locus_tag LOCUS_00180 17023 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17159 18493 gene locus_tag LOCUS_00190 17159 18493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18493 19353 gene locus_tag LOCUS_00200 18493 19353 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868073.1 protein_id gnl|my_center|LOCUS_00200 21185 19314 gene locus_tag LOCUS_00210 21185 19314 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259247.1 protein_id gnl|my_center|LOCUS_00210 21290 21850 gene locus_tag LOCUS_00220 21290 21850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22029 22616 gene locus_tag LOCUS_00230 22029 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22613 23038 gene locus_tag LOCUS_00240 22613 23038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23422 26964 gene locus_tag LOCUS_00250 23422 26964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27253 32439 gene locus_tag LOCUS_00260 27253 32439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 34925 32586 gene locus_tag LOCUS_00270 34925 32586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 36111 34927 gene locus_tag LOCUS_00280 36111 34927 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257466.1 protein_id gnl|my_center|LOCUS_00280 37082 36093 gene locus_tag LOCUS_00290 37082 36093 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259392.1 protein_id gnl|my_center|LOCUS_00290 38052 37060 gene locus_tag LOCUS_00300 38052 37060 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392766.1 protein_id gnl|my_center|LOCUS_00300 38886 38065 gene locus_tag LOCUS_00310 38886 38065 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_00310 39365 38883 gene locus_tag LOCUS_00320 39365 38883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 40580 39381 gene locus_tag LOCUS_00330 40580 39381 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_00330 42044 40614 gene locus_tag LOCUS_00340 42044 40614 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_00340 45441 42037 gene locus_tag LOCUS_00350 45441 42037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 46447 45473 gene locus_tag LOCUS_00360 46447 45473 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_00360 48139 46595 gene locus_tag LOCUS_00370 48139 46595 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256102.1 protein_id gnl|my_center|LOCUS_00370 48316 49191 gene locus_tag LOCUS_00380 gene ubiA 48316 49191 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_00380 49279 50226 gene locus_tag LOCUS_00390 49279 50226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 51326 50235 gene locus_tag LOCUS_00400 51326 50235 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_00400 >Feature sequence002 3139 1715 gene locus_tag LOCUS_00410 3139 1715 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258666.1 protein_id gnl|my_center|LOCUS_00410 3769 3164 gene locus_tag LOCUS_00420 3769 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 4988 3762 gene locus_tag LOCUS_00430 4988 3762 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_00430 5932 4994 gene locus_tag LOCUS_00440 5932 4994 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258665.1 protein_id gnl|my_center|LOCUS_00440 6860 6021 gene locus_tag LOCUS_00450 6860 6021 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_00450 8547 7087 gene locus_tag LOCUS_00460 8547 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 9356 8652 gene locus_tag LOCUS_00470 9356 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 10553 9378 gene locus_tag LOCUS_00480 10553 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 11160 11603 gene locus_tag LOCUS_00490 11160 11603 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_00490 11605 12636 gene locus_tag LOCUS_00500 11605 12636 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812034.1 protein_id gnl|my_center|LOCUS_00500 12641 13462 gene locus_tag LOCUS_00510 12641 13462 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458882.1 protein_id gnl|my_center|LOCUS_00510 13459 14298 gene locus_tag LOCUS_00520 13459 14298 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_00520 14693 16417 gene locus_tag LOCUS_00530 14693 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 18362 16563 gene locus_tag LOCUS_00540 18362 16563 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_00540 19935 18568 gene locus_tag LOCUS_00550 19935 18568 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_00550 21063 19981 gene locus_tag LOCUS_00560 21063 19981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 21701 21099 gene locus_tag LOCUS_00570 21701 21099 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392990.1 protein_id gnl|my_center|LOCUS_00570 22071 21709 gene locus_tag LOCUS_00580 22071 21709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 23044 24537 gene locus_tag LOCUS_00590 23044 24537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 27122 24642 gene locus_tag LOCUS_00600 27122 24642 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_00600 28292 27135 gene locus_tag LOCUS_00610 28292 27135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 28758 28597 gene locus_tag LOCUS_00620 28758 28597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 29634 28807 gene locus_tag LOCUS_00630 29634 28807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 30028 31149 gene locus_tag LOCUS_00640 30028 31149 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_00640 31289 33046 gene locus_tag LOCUS_00650 31289 33046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 33148 33540 gene locus_tag LOCUS_00660 33148 33540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 33851 34939 gene locus_tag LOCUS_00670 33851 34939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 35377 37230 gene locus_tag LOCUS_00680 35377 37230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 37230 38102 gene locus_tag LOCUS_00690 37230 38102 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_00690 38099 39001 gene locus_tag LOCUS_00700 38099 39001 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_00700 38971 39822 gene locus_tag LOCUS_00710 38971 39822 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_00710 39864 40706 gene locus_tag LOCUS_00720 gene panC 39864 40706 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258070.1 protein_id gnl|my_center|LOCUS_00720 40703 41671 gene locus_tag LOCUS_00730 40703 41671 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_00730 >Feature sequence003 2630 1611 gene locus_tag LOCUS_00740 2630 1611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582509.1 protein_id gnl|my_center|LOCUS_00740 3702 2692 gene locus_tag LOCUS_00750 3702 2692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_00750 4628 3699 gene locus_tag LOCUS_00760 4628 3699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868060.1 protein_id gnl|my_center|LOCUS_00760 5646 4636 gene locus_tag LOCUS_00770 5646 4636 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197536754.1 protein_id gnl|my_center|LOCUS_00770 7695 5809 gene locus_tag LOCUS_00780 7695 5809 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582578.1 protein_id gnl|my_center|LOCUS_00780 8846 7830 gene locus_tag LOCUS_00790 8846 7830 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_00790 9144 10694 gene locus_tag LOCUS_00800 9144 10694 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808649.1 protein_id gnl|my_center|LOCUS_00800 11048 12421 gene locus_tag LOCUS_00810 gene radA 11048 12421 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_00810 13120 12527 gene locus_tag LOCUS_00820 13120 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 14364 13384 gene locus_tag LOCUS_00830 14364 13384 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229044.1 protein_id gnl|my_center|LOCUS_00830 14672 14469 gene locus_tag LOCUS_00840 14672 14469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 16777 14828 gene locus_tag LOCUS_00850 16777 14828 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229043.1 protein_id gnl|my_center|LOCUS_00850 17512 18345 gene locus_tag LOCUS_00860 17512 18345 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583414.1 protein_id gnl|my_center|LOCUS_00860 18465 19253 gene locus_tag LOCUS_00870 18465 19253 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944016.1 protein_id gnl|my_center|LOCUS_00870 21706 19391 gene locus_tag LOCUS_00880 21706 19391 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_00880 22252 23217 gene locus_tag LOCUS_00890 22252 23217 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339003.1 protein_id gnl|my_center|LOCUS_00890 23296 24192 gene locus_tag LOCUS_00900 23296 24192 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009839.1 protein_id gnl|my_center|LOCUS_00900 24257 27367 gene locus_tag LOCUS_00910 24257 27367 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406189.1 protein_id gnl|my_center|LOCUS_00910 27499 29520 gene locus_tag LOCUS_00920 gene tkt 27499 29520 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_00920 29539 31065 gene locus_tag LOCUS_00930 gene zwf 29539 31065 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_00930 31074 32243 gene locus_tag LOCUS_00940 31074 32243 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143171.1 protein_id gnl|my_center|LOCUS_00940 33643 32285 gene locus_tag LOCUS_00950 33643 32285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 34430 38113 gene locus_tag LOCUS_00960 34430 38113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 38118 39287 gene locus_tag LOCUS_00970 38118 39287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 40713 39568 gene locus_tag LOCUS_00980 40713 39568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 >Feature sequence004 687 469 gene locus_tag LOCUS_00990 687 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258117.1 protein_id gnl|my_center|LOCUS_00990 1998 760 gene locus_tag LOCUS_01000 gene tgt 1998 760 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878982.1 protein_id gnl|my_center|LOCUS_01000 2485 2027 gene locus_tag LOCUS_01010 2485 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 3453 2521 gene locus_tag LOCUS_01020 3453 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 4454 3459 gene locus_tag LOCUS_01030 4454 3459 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880854.1 protein_id gnl|my_center|LOCUS_01030 4694 4476 gene locus_tag LOCUS_01040 4694 4476 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879942.1 protein_id gnl|my_center|LOCUS_01040 6432 4930 gene locus_tag LOCUS_01050 6432 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 7705 6614 gene locus_tag LOCUS_01060 7705 6614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083278.1 protein_id gnl|my_center|LOCUS_01060 8636 7740 gene locus_tag LOCUS_01070 8636 7740 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015918758.1 protein_id gnl|my_center|LOCUS_01070 9686 8664 gene locus_tag LOCUS_01080 9686 8664 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083273.1 protein_id gnl|my_center|LOCUS_01080 11250 9763 gene locus_tag LOCUS_01090 11250 9763 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083271.1 protein_id gnl|my_center|LOCUS_01090 11679 12845 gene locus_tag LOCUS_01100 11679 12845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 12842 14107 gene locus_tag LOCUS_01110 12842 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 14159 16261 gene locus_tag LOCUS_01120 14159 16261 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027257.1 protein_id gnl|my_center|LOCUS_01120 16264 16701 gene locus_tag LOCUS_01130 16264 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 16914 18071 gene locus_tag LOCUS_01140 16914 18071 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173212.1 protein_id gnl|my_center|LOCUS_01140 18100 18882 gene locus_tag LOCUS_01150 18100 18882 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460372.1 protein_id gnl|my_center|LOCUS_01150 18955 19950 gene locus_tag LOCUS_01160 18955 19950 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817156.1 protein_id gnl|my_center|LOCUS_01160 20182 19964 gene locus_tag LOCUS_01170 20182 19964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 20843 20439 gene locus_tag LOCUS_01180 gene rpsI 20843 20439 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258262.1 protein_id gnl|my_center|LOCUS_01180 21291 20857 gene locus_tag LOCUS_01190 gene rplM 21291 20857 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881226.1 protein_id gnl|my_center|LOCUS_01190 22079 21288 gene locus_tag LOCUS_01200 gene truA 22079 21288 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199179.1 protein_id gnl|my_center|LOCUS_01200 22473 22102 gene locus_tag LOCUS_01210 gene rplQ 22473 22102 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_01210 23477 22470 gene locus_tag LOCUS_01220 23477 22470 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258258.1 protein_id gnl|my_center|LOCUS_01220 24267 23632 gene locus_tag LOCUS_01230 gene rpsD 24267 23632 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_01230 24772 24383 gene locus_tag LOCUS_01240 gene rpsK 24772 24383 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055956.1 protein_id gnl|my_center|LOCUS_01240 25253 24870 gene locus_tag LOCUS_01250 gene rpsM 25253 24870 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_01250 26288 25542 gene locus_tag LOCUS_01260 gene map 26288 25542 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_01260 26965 26285 gene locus_tag LOCUS_01270 26965 26285 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_01270 28556 27228 gene locus_tag LOCUS_01280 gene secY 28556 27228 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_01280 29172 28702 gene locus_tag LOCUS_01290 gene rplO 29172 28702 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081797.1 protein_id gnl|my_center|LOCUS_01290 29391 29176 gene locus_tag LOCUS_01300 gene rpmD 29391 29176 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_01300 29933 29406 gene locus_tag LOCUS_01310 gene rpsE 29933 29406 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_01310 30339 29950 gene locus_tag LOCUS_01320 gene rplR 30339 29950 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_01320 31026 30484 gene locus_tag LOCUS_01330 gene rplF 31026 30484 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723683.1 protein_id gnl|my_center|LOCUS_01330 31467 31072 gene locus_tag LOCUS_01340 gene rpsH 31467 31072 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966398.1 protein_id gnl|my_center|LOCUS_01340 31678 31496 gene locus_tag LOCUS_01350 31678 31496 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356214.1 protein_id gnl|my_center|LOCUS_01350 32285 31740 gene locus_tag LOCUS_01360 gene rplE 32285 31740 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393925.1 protein_id gnl|my_center|LOCUS_01360 32708 32349 gene locus_tag LOCUS_01370 gene rplX 32708 32349 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_01370 33114 32746 gene locus_tag LOCUS_01380 gene rplN 33114 32746 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776366.1 protein_id gnl|my_center|LOCUS_01380 33374 33117 gene locus_tag LOCUS_01390 33374 33117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 33620 33378 gene locus_tag LOCUS_01400 gene rpmC 33620 33378 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_01400 34051 33617 gene locus_tag LOCUS_01410 gene rplP 34051 33617 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_01410 34772 34092 gene locus_tag LOCUS_01420 gene rpsC 34772 34092 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258237.1 protein_id gnl|my_center|LOCUS_01420 35146 34793 gene locus_tag LOCUS_01430 35146 34793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 35463 35182 gene locus_tag LOCUS_01440 gene rpsS 35463 35182 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583236.1 protein_id gnl|my_center|LOCUS_01440 36438 35614 gene locus_tag LOCUS_01450 gene rplB 36438 35614 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258234.1 protein_id gnl|my_center|LOCUS_01450 36806 36480 gene locus_tag LOCUS_01460 36806 36480 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810158.1 protein_id gnl|my_center|LOCUS_01460 37440 36814 gene locus_tag LOCUS_01470 gene rplD 37440 36814 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258232.1 protein_id gnl|my_center|LOCUS_01470 38102 37437 gene locus_tag LOCUS_01480 gene rplC 38102 37437 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_01480 38525 38217 gene locus_tag LOCUS_01490 gene rpsJ 38525 38217 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258230.1 protein_id gnl|my_center|LOCUS_01490 >Feature sequence005 2671 962 gene locus_tag LOCUS_01500 2671 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 2817 3077 gene locus_tag LOCUS_01510 2817 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 3586 3173 gene locus_tag LOCUS_01520 3586 3173 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250078.1 protein_id gnl|my_center|LOCUS_01520 3488 3949 gene locus_tag LOCUS_01530 3488 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 4259 7207 gene locus_tag LOCUS_01540 gene secA 4259 7207 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228548.1 protein_id gnl|my_center|LOCUS_01540 7234 7572 gene locus_tag LOCUS_01550 7234 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 7569 8633 gene locus_tag LOCUS_01560 gene add 7569 8633 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259176.1 protein_id gnl|my_center|LOCUS_01560 9566 8607 gene locus_tag LOCUS_01570 9566 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 10002 9787 gene locus_tag LOCUS_01580 10002 9787 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_01580 10918 10472 gene locus_tag LOCUS_01590 10918 10472 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229164.1 protein_id gnl|my_center|LOCUS_01590 11194 10922 gene locus_tag LOCUS_01600 11194 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 12554 11331 gene locus_tag LOCUS_01610 12554 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 15111 12979 gene locus_tag LOCUS_01620 15111 12979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 16344 15181 gene locus_tag LOCUS_01630 16344 15181 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256755.1 protein_id gnl|my_center|LOCUS_01630 17159 16344 gene locus_tag LOCUS_01640 17159 16344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 17454 20525 gene locus_tag LOCUS_01650 17454 20525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 20528 21559 gene locus_tag LOCUS_01660 20528 21559 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_01660 21588 21662 gene locus_tag LOCUS_t00010 21588 21662 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 21668 21741 gene locus_tag LOCUS_t00020 21668 21741 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21752 21824 gene locus_tag LOCUS_t00030 21752 21824 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 21897 22262 gene locus_tag LOCUS_01670 21897 22262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 22464 22970 gene locus_tag LOCUS_01680 22464 22970 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_01680 24101 22986 gene locus_tag LOCUS_01690 24101 22986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 25869 24088 gene locus_tag LOCUS_01700 25869 24088 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_01700 26422 25913 gene locus_tag LOCUS_01710 26422 25913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 26664 27080 gene locus_tag LOCUS_01720 26664 27080 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810241.1 protein_id gnl|my_center|LOCUS_01720 27690 27073 gene locus_tag LOCUS_01730 gene rdgB 27690 27073 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256394.1 protein_id gnl|my_center|LOCUS_01730 27909 28274 gene locus_tag LOCUS_01740 27909 28274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 29401 28286 gene locus_tag LOCUS_01750 gene tsaD 29401 28286 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_01750 31150 29819 gene locus_tag LOCUS_01760 gene mazG 31150 29819 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014237.1 protein_id gnl|my_center|LOCUS_01760 32968 31175 gene locus_tag LOCUS_01770 32968 31175 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_01770 34302 32971 gene locus_tag LOCUS_01780 34302 32971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 35939 34386 gene locus_tag LOCUS_01790 gene guaA 35939 34386 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_01790 36934 35948 gene locus_tag LOCUS_01800 36934 35948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 37127 36903 gene locus_tag LOCUS_01810 37127 36903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 37746 37120 gene locus_tag LOCUS_01820 gene coaE 37746 37120 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_01820 >Feature sequence006 1926 694 gene locus_tag LOCUS_01830 gene mrfB 1926 694 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_01830 3077 1935 gene locus_tag LOCUS_01840 3077 1935 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393538.1 protein_id gnl|my_center|LOCUS_01840 3717 3133 gene locus_tag LOCUS_01850 3717 3133 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_01850 4099 4863 gene locus_tag LOCUS_01860 gene rfbD 4099 4863 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_01860 4949 5674 gene locus_tag LOCUS_01870 4949 5674 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906362.1 protein_id gnl|my_center|LOCUS_01870 5662 6639 gene locus_tag LOCUS_01880 5662 6639 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256314.1 protein_id gnl|my_center|LOCUS_01880 7726 6650 gene locus_tag LOCUS_01890 7726 6650 CDS product lipoate protein ligase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881270.1 protein_id gnl|my_center|LOCUS_01890 8201 7755 gene locus_tag LOCUS_01900 8201 7755 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 protein_id gnl|my_center|LOCUS_01900 8657 8217 gene locus_tag LOCUS_01910 8657 8217 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 protein_id gnl|my_center|LOCUS_01910 9047 8718 gene locus_tag LOCUS_01920 9047 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 9499 9026 gene locus_tag LOCUS_01930 9499 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 11504 9477 gene locus_tag LOCUS_01940 11504 9477 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228453.1 protein_id gnl|my_center|LOCUS_01940 12545 11586 gene locus_tag LOCUS_01950 12545 11586 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_01950 13329 12556 gene locus_tag LOCUS_01960 13329 12556 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_01960 14658 13375 gene locus_tag LOCUS_01970 14658 13375 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_01970 15506 14721 gene locus_tag LOCUS_01980 15506 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880214.1 protein_id gnl|my_center|LOCUS_01980 16612 15545 gene locus_tag LOCUS_01990 16612 15545 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_01990 17942 16722 gene locus_tag LOCUS_02000 17942 16722 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_02000 18640 17942 gene locus_tag LOCUS_02010 18640 17942 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880210.1 protein_id gnl|my_center|LOCUS_02010 18956 18696 gene locus_tag LOCUS_02020 18956 18696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 19484 19011 gene locus_tag LOCUS_02030 19484 19011 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 protein_id gnl|my_center|LOCUS_02030 19884 19498 gene locus_tag LOCUS_02040 19884 19498 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318897.1 protein_id gnl|my_center|LOCUS_02040 20517 20008 gene locus_tag LOCUS_02050 20517 20008 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_02050 20769 20530 gene locus_tag LOCUS_02060 gene tusA 20769 20530 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_02060 21230 22960 gene locus_tag LOCUS_02070 21230 22960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 22953 23603 gene locus_tag LOCUS_02080 22953 23603 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227223.1 protein_id gnl|my_center|LOCUS_02080 23787 24908 gene locus_tag LOCUS_02090 23787 24908 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_02090 24922 25932 gene locus_tag LOCUS_02100 24922 25932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_02100 26073 27002 gene locus_tag LOCUS_02110 26073 27002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_02110 27015 28397 gene locus_tag LOCUS_02120 27015 28397 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928915.1 protein_id gnl|my_center|LOCUS_02120 28505 29638 gene locus_tag LOCUS_02130 28505 29638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 29882 30634 gene locus_tag LOCUS_02140 29882 30634 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_02140 30706 33309 gene locus_tag LOCUS_02150 30706 33309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 34867 33371 gene locus_tag LOCUS_02160 34867 33371 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143113.1 protein_id gnl|my_center|LOCUS_02160 36395 34884 gene locus_tag LOCUS_02170 36395 34884 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_02170 <37622 36649 gene locus_tag LOCUS_02180 <37622 36649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258759.1:NADH-quinone oxidoreductase subunit L >Feature sequence007 887 153 gene locus_tag LOCUS_02190 887 153 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_02190 1975 884 gene locus_tag LOCUS_02200 gene gap 1975 884 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459734.1 protein_id gnl|my_center|LOCUS_02200 2770 2087 gene locus_tag LOCUS_02210 gene rpe 2770 2087 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837854.1 protein_id gnl|my_center|LOCUS_02210 3479 2730 gene locus_tag LOCUS_02220 gene rpiA 3479 2730 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259045.1 protein_id gnl|my_center|LOCUS_02220 4431 3487 gene locus_tag LOCUS_02230 4431 3487 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144407.1 protein_id gnl|my_center|LOCUS_02230 4898 4584 gene locus_tag LOCUS_02240 4898 4584 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142155.1 protein_id gnl|my_center|LOCUS_02240 6341 4914 gene locus_tag LOCUS_02250 6341 4914 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057346.1 protein_id gnl|my_center|LOCUS_02250 7036 6359 gene locus_tag LOCUS_02260 gene fsa 7036 6359 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258657.1 protein_id gnl|my_center|LOCUS_02260 9146 7062 gene locus_tag LOCUS_02270 gene tkt 9146 7062 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_02270 10320 9139 gene locus_tag LOCUS_02280 gene fbp 10320 9139 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393749.1 protein_id gnl|my_center|LOCUS_02280 11473 10802 gene locus_tag LOCUS_02290 11473 10802 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_02290 13554 11545 gene locus_tag LOCUS_02300 13554 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 14560 13580 gene locus_tag LOCUS_02310 14560 13580 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_02310 16371 14599 gene locus_tag LOCUS_02320 16371 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 17138 16368 gene locus_tag LOCUS_02330 17138 16368 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_02330 17428 18453 gene locus_tag LOCUS_02340 17428 18453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 19565 18450 gene locus_tag LOCUS_02350 19565 18450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 20697 19573 gene locus_tag LOCUS_02360 20697 19573 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_02360 21203 20799 gene locus_tag LOCUS_02370 21203 20799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256095.1 protein_id gnl|my_center|LOCUS_02370 22258 21218 gene locus_tag LOCUS_02380 22258 21218 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257726.1 protein_id gnl|my_center|LOCUS_02380 23415 22321 gene locus_tag LOCUS_02390 23415 22321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 24662 23460 gene locus_tag LOCUS_02400 gene rlmI 24662 23460 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 protein_id gnl|my_center|LOCUS_02400 25570 24695 gene locus_tag LOCUS_02410 25570 24695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 26127 25579 gene locus_tag LOCUS_02420 26127 25579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 26959 26108 gene locus_tag LOCUS_02430 26959 26108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 28365 27427 gene locus_tag LOCUS_02440 gene lgt 28365 27427 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_02440 29707 28460 gene locus_tag LOCUS_02450 29707 28460 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_02450 29907 29816 gene locus_tag LOCUS_t00040 29907 29816 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30970 29954 gene locus_tag LOCUS_02460 30970 29954 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257470.1 protein_id gnl|my_center|LOCUS_02460 31853 30963 gene locus_tag LOCUS_02470 31853 30963 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707170.1 protein_id gnl|my_center|LOCUS_02470 32798 31869 gene locus_tag LOCUS_02480 32798 31869 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818717.1 protein_id gnl|my_center|LOCUS_02480 33943 32798 gene locus_tag LOCUS_02490 33943 32798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 35351 33951 gene locus_tag LOCUS_02500 35351 33951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 36118 35360 gene locus_tag LOCUS_02510 gene phnC 36118 35360 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_02510 <37022 36261 gene locus_tag LOCUS_02520 <37022 36261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201626171.1:phosphate/phosphite/phosphonate ABC transporter substrate-binding protein >Feature sequence008 221 907 gene locus_tag LOCUS_02530 221 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 1151 2998 gene locus_tag LOCUS_02540 gene uvrC 1151 2998 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_02540 3014 3685 gene locus_tag LOCUS_02550 3014 3685 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403906.1 protein_id gnl|my_center|LOCUS_02550 3682 4452 gene locus_tag LOCUS_02560 3682 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 7673 4476 gene locus_tag LOCUS_02570 7673 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 8890 7757 gene locus_tag LOCUS_02580 8890 7757 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_02580 9925 8906 gene locus_tag LOCUS_02590 9925 8906 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_02590 10062 10871 gene locus_tag LOCUS_02600 10062 10871 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878408.1 protein_id gnl|my_center|LOCUS_02600 11471 10884 gene locus_tag LOCUS_02610 11471 10884 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259017.1 protein_id gnl|my_center|LOCUS_02610 11783 12331 gene locus_tag LOCUS_02620 11783 12331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 14862 12343 gene locus_tag LOCUS_02630 14862 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 15234 15773 gene locus_tag LOCUS_02640 15234 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 17308 15839 gene locus_tag LOCUS_02650 17308 15839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 18288 17461 gene locus_tag LOCUS_02660 18288 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 18594 18370 gene locus_tag LOCUS_02670 18594 18370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 19469 19002 gene locus_tag LOCUS_02680 19469 19002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 19953 19480 gene locus_tag LOCUS_02690 19953 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 20701 19979 gene locus_tag LOCUS_02700 20701 19979 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228223.1 protein_id gnl|my_center|LOCUS_02700 21987 20704 gene locus_tag LOCUS_02710 21987 20704 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_02710 22452 22072 gene locus_tag LOCUS_02720 22452 22072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 22677 23075 gene locus_tag LOCUS_02730 22677 23075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 23228 23410 gene locus_tag LOCUS_02740 23228 23410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 24372 23503 gene locus_tag LOCUS_02750 24372 23503 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_02750 26745 24391 gene locus_tag LOCUS_02760 26745 24391 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_02760 27232 26774 gene locus_tag LOCUS_02770 gene cutC 27232 26774 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_02770 27832 27392 gene locus_tag LOCUS_02780 27832 27392 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088412.1 protein_id gnl|my_center|LOCUS_02780 32798 28368 gene locus_tag LOCUS_02790 gene gltB 32798 28368 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_02790 33583 34440 gene locus_tag LOCUS_02800 33583 34440 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030050.1 protein_id gnl|my_center|LOCUS_02800 34819 35538 gene locus_tag LOCUS_02810 gene alaXM 34819 35538 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence009 4718 2376 gene locus_tag LOCUS_02820 4718 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5587 4952 gene locus_tag LOCUS_02830 5587 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 5840 7726 gene locus_tag LOCUS_02840 5840 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 9749 7782 gene locus_tag LOCUS_02850 9749 7782 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_02850 12184 9833 gene locus_tag LOCUS_02860 12184 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 14976 12181 gene locus_tag LOCUS_02870 14976 12181 CDS product interleukin-like EMT inducer domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141609734.1 protein_id gnl|my_center|LOCUS_02870 15232 16401 gene locus_tag LOCUS_02880 15232 16401 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144027.1 protein_id gnl|my_center|LOCUS_02880 16416 17237 gene locus_tag LOCUS_02890 gene thiD 16416 17237 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_02890 18955 17276 gene locus_tag LOCUS_02900 18955 17276 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259629.1 protein_id gnl|my_center|LOCUS_02900 21978 19207 gene locus_tag LOCUS_02910 gene polA 21978 19207 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256248.1 protein_id gnl|my_center|LOCUS_02910 23333 21975 gene locus_tag LOCUS_02920 23333 21975 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_02920 24387 23458 gene locus_tag LOCUS_02930 24387 23458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 25039 24419 gene locus_tag LOCUS_02940 25039 24419 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_02940 27014 25758 gene locus_tag LOCUS_02950 27014 25758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 27944 27225 gene locus_tag LOCUS_02960 gene cmk 27944 27225 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_02960 29030 27948 gene locus_tag LOCUS_02970 gene rodA 29030 27948 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_02970 29293 29039 gene locus_tag LOCUS_02980 gene minE 29293 29039 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392080.1 protein_id gnl|my_center|LOCUS_02980 30197 29403 gene locus_tag LOCUS_02990 gene minD 30197 29403 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255922.1 protein_id gnl|my_center|LOCUS_02990 30970 30314 gene locus_tag LOCUS_03000 gene minC 30970 30314 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255923.1 protein_id gnl|my_center|LOCUS_03000 <32876 31164 gene locus_tag LOCUS_03010 <32876 31164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 >Feature sequence010 731 162 gene locus_tag LOCUS_03020 731 162 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_03020 1292 750 gene locus_tag LOCUS_03030 1292 750 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_03030 1444 2088 gene locus_tag LOCUS_03040 1444 2088 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_03040 2096 2632 gene locus_tag LOCUS_03050 2096 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 2688 3638 gene locus_tag LOCUS_03060 2688 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 3789 4949 gene locus_tag LOCUS_03070 3789 4949 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_03070 4991 6376 gene locus_tag LOCUS_03080 4991 6376 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_03080 6429 6827 gene locus_tag LOCUS_03090 6429 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 7907 6924 gene locus_tag LOCUS_03100 7907 6924 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173431.1 protein_id gnl|my_center|LOCUS_03100 8837 7914 gene locus_tag LOCUS_03110 8837 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 9706 8735 gene locus_tag LOCUS_03120 9706 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 9930 11888 gene locus_tag LOCUS_03130 9930 11888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 11915 12643 gene locus_tag LOCUS_03140 11915 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 12674 14290 gene locus_tag LOCUS_03150 12674 14290 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144388.1 protein_id gnl|my_center|LOCUS_03150 14287 15045 gene locus_tag LOCUS_03160 14287 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 15196 16137 gene locus_tag LOCUS_03170 15196 16137 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975888.1 protein_id gnl|my_center|LOCUS_03170 17133 16147 gene locus_tag LOCUS_03180 17133 16147 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259483.1 protein_id gnl|my_center|LOCUS_03180 18154 17153 gene locus_tag LOCUS_03190 18154 17153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 19149 18196 gene locus_tag LOCUS_03200 19149 18196 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_03200 19885 19166 gene locus_tag LOCUS_03210 19885 19166 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259617.1 protein_id gnl|my_center|LOCUS_03210 21546 19897 gene locus_tag LOCUS_03220 21546 19897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 21818 21561 gene locus_tag LOCUS_03230 21818 21561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 22257 21877 gene locus_tag LOCUS_03240 22257 21877 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233882.1 protein_id gnl|my_center|LOCUS_03240 22454 23227 gene locus_tag LOCUS_03250 gene fabG 22454 23227 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_03250 23912 23250 gene locus_tag LOCUS_03260 23912 23250 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660596.1 protein_id gnl|my_center|LOCUS_03260 26638 23945 gene locus_tag LOCUS_03270 26638 23945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 27380 26694 gene locus_tag LOCUS_03280 27380 26694 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257704.1 protein_id gnl|my_center|LOCUS_03280 28754 27495 gene locus_tag LOCUS_03290 28754 27495 CDS product glucose-1-phosphate adenylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258381.1 protein_id gnl|my_center|LOCUS_03290 30027 28765 gene locus_tag LOCUS_03300 30027 28765 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258382.1 protein_id gnl|my_center|LOCUS_03300 31001 30126 gene locus_tag LOCUS_03310 31001 30126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 31522 31097 gene locus_tag LOCUS_03320 31522 31097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 >Feature sequence011 1033 539 gene locus_tag LOCUS_03330 1033 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 1492 1055 gene locus_tag LOCUS_03340 1492 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1732 2187 gene locus_tag LOCUS_03350 1732 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2210 4558 gene locus_tag LOCUS_03360 2210 4558 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_03360 4615 5778 gene locus_tag LOCUS_03370 4615 5778 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816850.1 protein_id gnl|my_center|LOCUS_03370 6159 7328 gene locus_tag LOCUS_03380 gene sat 6159 7328 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_03380 7392 8267 gene locus_tag LOCUS_03390 7392 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 8264 9103 gene locus_tag LOCUS_03400 gene cobA 8264 9103 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258423.1 protein_id gnl|my_center|LOCUS_03400 9929 9120 gene locus_tag LOCUS_03410 gene fdhE 9929 9120 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880651.1 protein_id gnl|my_center|LOCUS_03410 10633 9977 gene locus_tag LOCUS_03420 10633 9977 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816420.1 protein_id gnl|my_center|LOCUS_03420 11441 10635 gene locus_tag LOCUS_03430 gene fdxH 11441 10635 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070510.1 protein_id gnl|my_center|LOCUS_03430 14568 11566 gene locus_tag LOCUS_03440 gene fdnG 14568 11566 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 transl_except (pos:complement(14008..14010),aa:Sec) note codon on position 187 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_03440 15430 14792 gene locus_tag LOCUS_03450 15430 14792 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257096.1 protein_id gnl|my_center|LOCUS_03450 16938 15427 gene locus_tag LOCUS_03460 16938 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 17241 17945 gene locus_tag LOCUS_03470 17241 17945 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_03470 17964 18542 gene locus_tag LOCUS_03480 17964 18542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 18573 20333 gene locus_tag LOCUS_03490 gene mutL 18573 20333 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_03490 23976 20377 gene locus_tag LOCUS_03500 23976 20377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 24486 25640 gene locus_tag LOCUS_03510 gene rpoD 24486 25640 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258920.1 protein_id gnl|my_center|LOCUS_03510 26339 25740 gene locus_tag LOCUS_03520 26339 25740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_03520 27239 26343 gene locus_tag LOCUS_03530 gene htpX 27239 26343 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392235.1 protein_id gnl|my_center|LOCUS_03530 29279 27657 gene locus_tag LOCUS_03540 29279 27657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 29802 29314 gene locus_tag LOCUS_03550 29802 29314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence012 223 738 gene locus_tag LOCUS_03560 223 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 804 2000 gene locus_tag LOCUS_03570 804 2000 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064155.1 protein_id gnl|my_center|LOCUS_03570 2045 2833 gene locus_tag LOCUS_03580 2045 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 2850 4526 gene locus_tag LOCUS_03590 2850 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257782.1 protein_id gnl|my_center|LOCUS_03590 4523 6922 gene locus_tag LOCUS_03600 4523 6922 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_03600 6941 7513 gene locus_tag LOCUS_03610 6941 7513 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_03610 7506 9221 gene locus_tag LOCUS_03620 7506 9221 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_03620 9832 9194 gene locus_tag LOCUS_03630 9832 9194 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256419.1 protein_id gnl|my_center|LOCUS_03630 11106 9940 gene locus_tag LOCUS_03640 11106 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 11568 14291 gene locus_tag LOCUS_03650 11568 14291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 14294 15370 gene locus_tag LOCUS_03660 14294 15370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 15593 16183 gene locus_tag LOCUS_03670 15593 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 16468 18927 gene locus_tag LOCUS_03680 16468 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 19137 19877 gene locus_tag LOCUS_03690 19137 19877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 19874 20470 gene locus_tag LOCUS_03700 19874 20470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 20512 21852 gene locus_tag LOCUS_03710 20512 21852 CDS product putative glycosyltransferase, exosortase G system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965817.1 protein_id gnl|my_center|LOCUS_03710 22855 21875 gene locus_tag LOCUS_03720 gene selD 22855 21875 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011344950.1 protein_id gnl|my_center|LOCUS_03720 23298 25007 gene locus_tag LOCUS_03730 23298 25007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 25004 25690 gene locus_tag LOCUS_03740 25004 25690 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_03740 25687 27243 gene locus_tag LOCUS_03750 25687 27243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 27369 28484 gene locus_tag LOCUS_03760 27369 28484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 28484 29218 gene locus_tag LOCUS_03770 gene rsmG 28484 29218 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393994.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence013 1926 997 gene locus_tag LOCUS_03780 1926 997 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_03780 2492 1938 gene locus_tag LOCUS_03790 2492 1938 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081283.1 protein_id gnl|my_center|LOCUS_03790 3288 2494 gene locus_tag LOCUS_03800 3288 2494 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257148.1 protein_id gnl|my_center|LOCUS_03800 5421 3307 gene locus_tag LOCUS_03810 5421 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 5972 5418 gene locus_tag LOCUS_03820 5972 5418 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_03820 6785 5991 gene locus_tag LOCUS_03830 6785 5991 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_03830 7729 6890 gene locus_tag LOCUS_03840 7729 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 8251 7901 gene locus_tag LOCUS_03850 gene rplT 8251 7901 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393257.1 protein_id gnl|my_center|LOCUS_03850 8541 8335 gene locus_tag LOCUS_03860 gene rpmI 8541 8335 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_03860 9042 8572 gene locus_tag LOCUS_03870 9042 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 9667 10620 gene locus_tag LOCUS_03880 9667 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 10716 11381 gene locus_tag LOCUS_03890 10716 11381 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_03890 11413 13338 gene locus_tag LOCUS_03900 11413 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 13357 14667 gene locus_tag LOCUS_03910 13357 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 14615 15931 gene locus_tag LOCUS_03920 14615 15931 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215505108.1 protein_id gnl|my_center|LOCUS_03920 15931 17091 gene locus_tag LOCUS_03930 15931 17091 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_03930 17135 18649 gene locus_tag LOCUS_03940 17135 18649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 18851 20317 gene locus_tag LOCUS_03950 18851 20317 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048165814.1 protein_id gnl|my_center|LOCUS_03950 20326 22122 gene locus_tag LOCUS_03960 20326 22122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 22137 23555 gene locus_tag LOCUS_03970 22137 23555 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_03970 23587 24966 gene locus_tag LOCUS_03980 23587 24966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 24963 26162 gene locus_tag LOCUS_03990 24963 26162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 26210 26851 gene locus_tag LOCUS_04000 26210 26851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 26851 27882 gene locus_tag LOCUS_04010 26851 27882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 27895 29121 gene locus_tag LOCUS_04020 27895 29121 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence014 94 1347 gene locus_tag LOCUS_04030 94 1347 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259763.1 protein_id gnl|my_center|LOCUS_04030 1399 2241 gene locus_tag LOCUS_04040 1399 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 2552 2271 gene locus_tag LOCUS_04050 2552 2271 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205409681.1 protein_id gnl|my_center|LOCUS_04050 2900 2685 gene locus_tag LOCUS_04060 2900 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 3587 2925 gene locus_tag LOCUS_04070 3587 2925 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_04070 5004 3664 gene locus_tag LOCUS_04080 5004 3664 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259421.1 protein_id gnl|my_center|LOCUS_04080 5356 5087 gene locus_tag LOCUS_04090 5356 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 5961 5353 gene locus_tag LOCUS_04100 5961 5353 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_04100 6038 6439 gene locus_tag LOCUS_04110 6038 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 7120 6527 gene locus_tag LOCUS_04120 7120 6527 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583168.1 protein_id gnl|my_center|LOCUS_04120 7637 7329 gene locus_tag LOCUS_04130 7637 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 7903 7634 gene locus_tag LOCUS_04140 gene rpmA 7903 7634 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_04140 8226 7915 gene locus_tag LOCUS_04150 gene rplU 8226 7915 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 protein_id gnl|my_center|LOCUS_04150 9586 8309 gene locus_tag LOCUS_04160 9586 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 10051 10728 gene locus_tag LOCUS_04170 10051 10728 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_04170 11206 11589 gene locus_tag LOCUS_04180 11206 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 11594 14377 gene locus_tag LOCUS_04190 11594 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 14583 15515 gene locus_tag LOCUS_04200 14583 15515 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_04200 15512 17044 gene locus_tag LOCUS_04210 15512 17044 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_04210 18417 17293 gene locus_tag LOCUS_04220 18417 17293 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_04220 18657 18732 gene locus_tag LOCUS_t00050 18657 18732 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19012 20160 gene locus_tag LOCUS_04230 gene fbp 19012 20160 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393749.1 protein_id gnl|my_center|LOCUS_04230 20160 20819 gene locus_tag LOCUS_04240 20160 20819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 21780 20785 gene locus_tag LOCUS_04250 21780 20785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 26461 21962 gene locus_tag LOCUS_04260 26461 21962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 27631 26579 gene locus_tag LOCUS_04270 27631 26579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 <28789 27741 gene locus_tag LOCUS_04280 <28789 27741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030634.1:aminopeptidase P family protein >Feature sequence015 335 2542 gene locus_tag LOCUS_04290 335 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2897 4147 gene locus_tag LOCUS_04300 2897 4147 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_04300 6580 4181 gene locus_tag LOCUS_04310 6580 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 8571 6928 gene locus_tag LOCUS_04320 8571 6928 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_04320 9429 8653 gene locus_tag LOCUS_04330 9429 8653 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_04330 10578 9547 gene locus_tag LOCUS_04340 gene bfmBAA 10578 9547 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852555.1 protein_id gnl|my_center|LOCUS_04340 12008 10680 gene locus_tag LOCUS_04350 12008 10680 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_04350 12798 12058 gene locus_tag LOCUS_04360 12798 12058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_04360 13644 12823 gene locus_tag LOCUS_04370 13644 12823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525179.1 protein_id gnl|my_center|LOCUS_04370 14744 13671 gene locus_tag LOCUS_04380 14744 13671 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_04380 15829 14915 gene locus_tag LOCUS_04390 15829 14915 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_04390 17194 15914 gene locus_tag LOCUS_04400 17194 15914 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_04400 19176 17602 gene locus_tag LOCUS_04410 19176 17602 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_04410 20265 19387 gene locus_tag LOCUS_04420 20265 19387 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979652.1 protein_id gnl|my_center|LOCUS_04420 21043 20288 gene locus_tag LOCUS_04430 21043 20288 CDS product glutaconate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272325.1 protein_id gnl|my_center|LOCUS_04430 21214 21519 gene locus_tag LOCUS_04440 21214 21519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 21587 21958 gene locus_tag LOCUS_04450 21587 21958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 23421 21988 gene locus_tag LOCUS_04460 23421 21988 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589538.1 protein_id gnl|my_center|LOCUS_04460 24444 23524 gene locus_tag LOCUS_04470 24444 23524 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_04470 24985 24410 gene locus_tag LOCUS_04480 24985 24410 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419208.1 protein_id gnl|my_center|LOCUS_04480 25803 25021 gene locus_tag LOCUS_04490 25803 25021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 26645 25863 gene locus_tag LOCUS_04500 26645 25863 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence016 119 1933 gene locus_tag LOCUS_04510 119 1933 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567123.1 protein_id gnl|my_center|LOCUS_04510 1930 2595 gene locus_tag LOCUS_04520 1930 2595 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_04520 2836 4233 gene locus_tag LOCUS_04530 2836 4233 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879242.1 protein_id gnl|my_center|LOCUS_04530 6041 4473 gene locus_tag LOCUS_04540 6041 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 6513 7868 gene locus_tag LOCUS_04550 gene dnaA 6513 7868 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_04550 9084 8098 gene locus_tag LOCUS_04560 9084 8098 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_04560 10310 9087 gene locus_tag LOCUS_04570 10310 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 10641 10363 gene locus_tag LOCUS_04580 10641 10363 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_04580 11637 10762 gene locus_tag LOCUS_04590 11637 10762 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_04590 12795 12088 gene locus_tag LOCUS_04600 12795 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04600 14355 12994 gene locus_tag LOCUS_04610 14355 12994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 15071 14352 gene locus_tag LOCUS_04620 15071 14352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 16656 15085 gene locus_tag LOCUS_04630 16656 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 17001 19106 gene locus_tag LOCUS_04640 17001 19106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 19135 20544 gene locus_tag LOCUS_04650 gene gndA 19135 20544 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141117.1 protein_id gnl|my_center|LOCUS_04650 20972 22036 gene locus_tag LOCUS_04660 gene mtnA 20972 22036 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_04660 22042 23022 gene locus_tag LOCUS_04670 22042 23022 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_04670 23056 24321 gene locus_tag LOCUS_04680 gene ahcY 23056 24321 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258873.1 protein_id gnl|my_center|LOCUS_04680 24417 25649 gene locus_tag LOCUS_04690 gene metK 24417 25649 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258872.1 protein_id gnl|my_center|LOCUS_04690 26036 25719 gene locus_tag LOCUS_04700 26036 25719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 26425 26099 gene locus_tag LOCUS_04710 26425 26099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence017 2146 1289 gene locus_tag LOCUS_04720 2146 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 4605 2161 gene locus_tag LOCUS_04730 4605 2161 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_04730 4732 6693 gene locus_tag LOCUS_04740 4732 6693 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_04740 7367 6969 gene locus_tag LOCUS_04750 7367 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 7860 8258 gene locus_tag LOCUS_04760 7860 8258 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_04760 8420 9919 gene locus_tag LOCUS_04770 gene gltX 8420 9919 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257408.1 protein_id gnl|my_center|LOCUS_04770 9922 11169 gene locus_tag LOCUS_04780 9922 11169 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_04780 11487 11251 gene locus_tag LOCUS_04790 gene infA 11487 11251 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403816.1 protein_id gnl|my_center|LOCUS_04790 12051 11590 gene locus_tag LOCUS_04800 12051 11590 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680499.1 protein_id gnl|my_center|LOCUS_04800 12253 12017 gene locus_tag LOCUS_04810 12253 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 12600 12298 gene locus_tag LOCUS_04820 12600 12298 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_04820 12921 12784 gene locus_tag LOCUS_04830 12921 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 15397 12935 gene locus_tag LOCUS_04840 gene topA 15397 12935 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813282.1 protein_id gnl|my_center|LOCUS_04840 16179 15460 gene locus_tag LOCUS_04850 16179 15460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 17305 16217 gene locus_tag LOCUS_04860 17305 16217 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_04860 18427 17441 gene locus_tag LOCUS_04870 18427 17441 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_04870 19578 18487 gene locus_tag LOCUS_04880 gene dprA 19578 18487 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_04880 20097 19591 gene locus_tag LOCUS_04890 gene rimM 20097 19591 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_04890 20326 20099 gene locus_tag LOCUS_04900 20326 20099 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_04900 20674 20354 gene locus_tag LOCUS_04910 20674 20354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 21098 23809 gene locus_tag LOCUS_04920 21098 23809 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_04920 24307 24089 gene locus_tag LOCUS_04930 24307 24089 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079900.1 protein_id gnl|my_center|LOCUS_04930 24493 24972 gene locus_tag LOCUS_04940 24493 24972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence018 1476 1661 gene locus_tag LOCUS_04950 1476 1661 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_04950 1690 2001 gene locus_tag LOCUS_04960 1690 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2017 2244 gene locus_tag LOCUS_04970 2017 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 2863 4800 gene locus_tag LOCUS_04980 2863 4800 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119621.1 protein_id gnl|my_center|LOCUS_04980 4841 5674 gene locus_tag LOCUS_04990 4841 5674 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_04990 5664 6137 gene locus_tag LOCUS_05000 5664 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 6303 7361 gene locus_tag LOCUS_05010 6303 7361 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009927050.1 protein_id gnl|my_center|LOCUS_05010 7433 8809 gene locus_tag LOCUS_05020 7433 8809 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337812.1 protein_id gnl|my_center|LOCUS_05020 8885 9754 gene locus_tag LOCUS_05030 8885 9754 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313059.1 protein_id gnl|my_center|LOCUS_05030 9751 10668 gene locus_tag LOCUS_05040 9751 10668 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_05040 10916 12115 gene locus_tag LOCUS_05050 10916 12115 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258328.1 protein_id gnl|my_center|LOCUS_05050 12133 13083 gene locus_tag LOCUS_05060 12133 13083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_05060 13067 14074 gene locus_tag LOCUS_05070 13067 14074 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258330.1 protein_id gnl|my_center|LOCUS_05070 16167 14128 gene locus_tag LOCUS_05080 16167 14128 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256027.1 protein_id gnl|my_center|LOCUS_05080 16390 17391 gene locus_tag LOCUS_05090 16390 17391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 18827 17475 gene locus_tag LOCUS_05100 18827 17475 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257786.1 protein_id gnl|my_center|LOCUS_05100 19547 19729 gene locus_tag LOCUS_05110 19547 19729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 19828 20661 gene locus_tag LOCUS_05120 19828 20661 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940312.1 protein_id gnl|my_center|LOCUS_05120 22425 20716 gene locus_tag LOCUS_05130 22425 20716 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_05130 24322 22688 gene locus_tag LOCUS_05140 24322 22688 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015845.1 protein_id gnl|my_center|LOCUS_05140 <25239 24319 gene locus_tag LOCUS_05150 <25239 24319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162015845.1:M1 family metallopeptidase >Feature sequence019 99 890 gene locus_tag LOCUS_05160 99 890 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_05160 850 2301 gene locus_tag LOCUS_05170 850 2301 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_05170 3047 2313 gene locus_tag LOCUS_05180 3047 2313 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_05180 4015 3044 gene locus_tag LOCUS_05190 gene mvk 4015 3044 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_05190 4712 4017 gene locus_tag LOCUS_05200 4712 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 7476 4918 gene locus_tag LOCUS_05210 7476 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 8074 7571 gene locus_tag LOCUS_05220 8074 7571 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870109.1 protein_id gnl|my_center|LOCUS_05220 9186 8095 gene locus_tag LOCUS_05230 9186 8095 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_05230 10518 9202 gene locus_tag LOCUS_05240 10518 9202 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870108.1 protein_id gnl|my_center|LOCUS_05240 11075 10524 gene locus_tag LOCUS_05250 11075 10524 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_05250 11576 12610 gene locus_tag LOCUS_05260 11576 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 12607 13257 gene locus_tag LOCUS_05270 12607 13257 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 protein_id gnl|my_center|LOCUS_05270 13721 14035 gene locus_tag LOCUS_05280 13721 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 14047 16266 gene locus_tag LOCUS_05290 14047 16266 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_05290 16306 17016 gene locus_tag LOCUS_05300 16306 17016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 17099 18424 gene locus_tag LOCUS_05310 gene nrfD 17099 18424 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_05310 18438 18980 gene locus_tag LOCUS_05320 18438 18980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 18977 19492 gene locus_tag LOCUS_05330 18977 19492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 19514 19900 gene locus_tag LOCUS_05340 19514 19900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 20344 20982 gene locus_tag LOCUS_05350 20344 20982 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_05350 20987 22708 gene locus_tag LOCUS_05360 20987 22708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_05360 22872 23339 gene locus_tag LOCUS_05370 22872 23339 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920944.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence020 2298 1843 gene locus_tag LOCUS_05380 2298 1843 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_05380 2671 2315 gene locus_tag LOCUS_05390 2671 2315 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_05390 4346 2799 gene locus_tag LOCUS_05400 4346 2799 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259158.1 protein_id gnl|my_center|LOCUS_05400 6569 4353 gene locus_tag LOCUS_05410 6569 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 9351 6571 gene locus_tag LOCUS_05420 9351 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 10444 9425 gene locus_tag LOCUS_05430 10444 9425 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088662.1 protein_id gnl|my_center|LOCUS_05430 10720 11613 gene locus_tag LOCUS_05440 10720 11613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 11630 12592 gene locus_tag LOCUS_05450 11630 12592 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259096.1 protein_id gnl|my_center|LOCUS_05450 12606 13937 gene locus_tag LOCUS_05460 12606 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 13968 16247 gene locus_tag LOCUS_05470 13968 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 16240 17595 gene locus_tag LOCUS_05480 gene mgtE 16240 17595 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_05480 18842 17592 gene locus_tag LOCUS_05490 18842 17592 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_05490 19632 18853 gene locus_tag LOCUS_05500 19632 18853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_05500 20061 21194 gene locus_tag LOCUS_05510 gene prf1 20061 21194 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_05510 22378 21197 gene locus_tag LOCUS_05520 22378 21197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence021 2365 146 gene locus_tag LOCUS_05530 2365 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 3365 2319 gene locus_tag LOCUS_05540 3365 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 3739 4740 gene locus_tag LOCUS_05550 gene cbiB 3739 4740 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258432.1 protein_id gnl|my_center|LOCUS_05550 4771 5946 gene locus_tag LOCUS_05560 4771 5946 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258420.1 protein_id gnl|my_center|LOCUS_05560 6014 6550 gene locus_tag LOCUS_05570 gene def 6014 6550 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174028.1 protein_id gnl|my_center|LOCUS_05570 7445 6624 gene locus_tag LOCUS_05580 7445 6624 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_05580 8218 7442 gene locus_tag LOCUS_05590 8218 7442 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_05590 9129 8215 gene locus_tag LOCUS_05600 9129 8215 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966160.1 protein_id gnl|my_center|LOCUS_05600 9600 9169 gene locus_tag LOCUS_05610 9600 9169 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_05610 10339 9857 gene locus_tag LOCUS_05620 10339 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 10383 10742 gene locus_tag LOCUS_05630 10383 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 11279 11533 gene locus_tag LOCUS_05640 11279 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 12099 11506 gene locus_tag LOCUS_05650 12099 11506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 12847 12227 gene locus_tag LOCUS_05660 12847 12227 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_05660 13430 13155 gene locus_tag LOCUS_05670 13430 13155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 14811 13504 gene locus_tag LOCUS_05680 14811 13504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 15039 14830 gene locus_tag LOCUS_05690 15039 14830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 17722 15425 gene locus_tag LOCUS_05700 17722 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 18054 17731 gene locus_tag LOCUS_05710 18054 17731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 18237 19847 gene locus_tag LOCUS_05720 18237 19847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 19832 22279 gene locus_tag LOCUS_05730 19832 22279 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142684.1 protein_id gnl|my_center|LOCUS_05730 22283 23326 gene locus_tag LOCUS_05740 22283 23326 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_05740 23415 23759 gene locus_tag LOCUS_05750 23415 23759 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251104.1 protein_id gnl|my_center|LOCUS_05750 23762 24184 gene locus_tag LOCUS_05760 23762 24184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence022 1104 3620 gene locus_tag LOCUS_05770 1104 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 4305 3700 gene locus_tag LOCUS_05780 4305 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 4981 4337 gene locus_tag LOCUS_05790 4981 4337 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_05790 5367 6386 gene locus_tag LOCUS_05800 5367 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 6420 7037 gene locus_tag LOCUS_05810 6420 7037 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_05810 7048 7482 gene locus_tag LOCUS_05820 7048 7482 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_05820 7569 8492 gene locus_tag LOCUS_05830 7569 8492 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_05830 8682 9926 gene locus_tag LOCUS_05840 8682 9926 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_05840 9923 10678 gene locus_tag LOCUS_05850 9923 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 10675 10998 gene locus_tag LOCUS_05860 10675 10998 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_05860 11052 11516 gene locus_tag LOCUS_05870 11052 11516 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_05870 11669 12250 gene locus_tag LOCUS_05880 11669 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 12263 13501 gene locus_tag LOCUS_05890 12263 13501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 13494 14477 gene locus_tag LOCUS_05900 13494 14477 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266349.1 protein_id gnl|my_center|LOCUS_05900 14495 15199 gene locus_tag LOCUS_05910 14495 15199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 15339 16361 gene locus_tag LOCUS_05920 15339 16361 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_05920 16415 19264 gene locus_tag LOCUS_05930 16415 19264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 19451 20809 gene locus_tag LOCUS_05940 19451 20809 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_05940 20882 21757 gene locus_tag LOCUS_05950 20882 21757 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_05950 21789 22676 gene locus_tag LOCUS_05960 21789 22676 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257889.1 protein_id gnl|my_center|LOCUS_05960 22952 23203 gene locus_tag LOCUS_05970 22952 23203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 23187 23603 gene locus_tag LOCUS_05980 23187 23603 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094558.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence023 296 973 gene locus_tag LOCUS_05990 296 973 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_05990 1196 2668 gene locus_tag LOCUS_06000 1196 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2691 4571 gene locus_tag LOCUS_06010 gene ctaD 2691 4571 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140742.1 protein_id gnl|my_center|LOCUS_06010 4593 4799 gene locus_tag LOCUS_06020 4593 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4796 5377 gene locus_tag LOCUS_06030 4796 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 5687 6289 gene locus_tag LOCUS_06040 5687 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06040 6530 7372 gene locus_tag LOCUS_06050 6530 7372 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230331.1 protein_id gnl|my_center|LOCUS_06050 7599 8963 gene locus_tag LOCUS_06060 7599 8963 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_06060 9048 9908 gene locus_tag LOCUS_06070 gene sbnI 9048 9908 CDS product bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015549.1 protein_id gnl|my_center|LOCUS_06070 9937 11793 gene locus_tag LOCUS_06080 9937 11793 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942696.1 protein_id gnl|my_center|LOCUS_06080 11878 12495 gene locus_tag LOCUS_06090 11878 12495 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942695.1 protein_id gnl|my_center|LOCUS_06090 12492 13358 gene locus_tag LOCUS_06100 12492 13358 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_06100 13451 13933 gene locus_tag LOCUS_06110 13451 13933 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_06110 13923 14141 gene locus_tag LOCUS_06120 13923 14141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 14195 16477 gene locus_tag LOCUS_06130 14195 16477 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_06130 16548 17708 gene locus_tag LOCUS_06140 gene hisC 16548 17708 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897361.1 protein_id gnl|my_center|LOCUS_06140 17718 18914 gene locus_tag LOCUS_06150 17718 18914 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259183.1 protein_id gnl|my_center|LOCUS_06150 18928 19185 gene locus_tag LOCUS_06160 18928 19185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 19209 20351 gene locus_tag LOCUS_06170 19209 20351 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_06170 20385 20837 gene locus_tag LOCUS_06180 20385 20837 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_06180 21032 21808 gene locus_tag LOCUS_06190 gene fabG 21032 21808 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence024 283 516 gene locus_tag LOCUS_06200 283 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 521 910 gene locus_tag LOCUS_06210 521 910 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681772.1 protein_id gnl|my_center|LOCUS_06210 1014 1253 gene locus_tag LOCUS_06220 1014 1253 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096582717.1 protein_id gnl|my_center|LOCUS_06220 1250 1630 gene locus_tag LOCUS_06230 1250 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1758 2015 gene locus_tag LOCUS_06240 1758 2015 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_06240 1981 2298 gene locus_tag LOCUS_06250 1981 2298 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_06250 2582 2283 gene locus_tag LOCUS_06260 2582 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3001 4041 gene locus_tag LOCUS_06270 gene tdh 3001 4041 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 protein_id gnl|my_center|LOCUS_06270 4055 5233 gene locus_tag LOCUS_06280 4055 5233 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_06280 5295 5756 gene locus_tag LOCUS_06290 5295 5756 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_06290 6267 5968 gene locus_tag LOCUS_06300 6267 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 7460 6351 gene locus_tag LOCUS_06310 7460 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 7510 7857 gene locus_tag LOCUS_06320 7510 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 8204 8665 gene locus_tag LOCUS_06330 8204 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 8693 9472 gene locus_tag LOCUS_06340 8693 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 9474 10133 gene locus_tag LOCUS_06350 9474 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 10147 10812 gene locus_tag LOCUS_06360 10147 10812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 11209 10823 gene locus_tag LOCUS_06370 11209 10823 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_06370 11462 14383 gene locus_tag LOCUS_06380 11462 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 17040 14506 gene locus_tag LOCUS_06390 gene leuS 17040 14506 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583912.1 protein_id gnl|my_center|LOCUS_06390 17552 17061 gene locus_tag LOCUS_06400 17552 17061 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_06400 17995 17921 gene locus_tag LOCUS_t00060 17995 17921 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18092 18018 gene locus_tag LOCUS_t00070 18092 18018 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19274 18321 gene locus_tag LOCUS_06410 19274 18321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 21779 19278 gene locus_tag LOCUS_06420 gene mrfA 21779 19278 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_06420 22422 21784 gene locus_tag LOCUS_06430 gene clpP 22422 21784 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631995.1 protein_id gnl|my_center|LOCUS_06430 22922 22461 gene locus_tag LOCUS_06440 22922 22461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence025 835 1320 gene locus_tag LOCUS_06450 835 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 1250 1552 gene locus_tag LOCUS_06460 1250 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 1731 4631 gene locus_tag LOCUS_06470 1731 4631 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258962.1 protein_id gnl|my_center|LOCUS_06470 4767 8039 gene locus_tag LOCUS_06480 4767 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 8196 10106 gene locus_tag LOCUS_06490 8196 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 11844 10243 gene locus_tag LOCUS_06500 11844 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 12223 12903 gene locus_tag LOCUS_06510 12223 12903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 12974 14155 gene locus_tag LOCUS_06520 12974 14155 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_06520 14175 15611 gene locus_tag LOCUS_06530 14175 15611 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123146.1 protein_id gnl|my_center|LOCUS_06530 16133 17560 gene locus_tag LOCUS_06540 16133 17560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 17612 18856 gene locus_tag LOCUS_06550 17612 18856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 18864 20786 gene locus_tag LOCUS_06560 gene selB 18864 20786 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_06560 21165 20818 gene locus_tag LOCUS_06570 21165 20818 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972760.1 protein_id gnl|my_center|LOCUS_06570 22123 21203 gene locus_tag LOCUS_06580 22123 21203 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_06580 22707 22120 gene locus_tag LOCUS_06590 22707 22120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence026 1600 2457 gene locus_tag LOCUS_06600 1600 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2457 3776 gene locus_tag LOCUS_06610 2457 3776 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242311.1 protein_id gnl|my_center|LOCUS_06610 5141 3873 gene locus_tag LOCUS_06620 5141 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 6227 5427 gene locus_tag LOCUS_06630 6227 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6741 7964 gene locus_tag LOCUS_06640 6741 7964 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_06640 8010 9224 gene locus_tag LOCUS_06650 8010 9224 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_06650 9221 9682 gene locus_tag LOCUS_06660 gene smpB 9221 9682 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_06660 9938 9693 gene locus_tag LOCUS_06670 9938 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259644.1 protein_id gnl|my_center|LOCUS_06670 11198 10203 gene locus_tag LOCUS_06680 11198 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 12712 11213 gene locus_tag LOCUS_06690 12712 11213 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259646.1 protein_id gnl|my_center|LOCUS_06690 14629 12731 gene locus_tag LOCUS_06700 14629 12731 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259648.1 protein_id gnl|my_center|LOCUS_06700 15325 15996 gene locus_tag LOCUS_06710 15325 15996 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_06710 16014 17540 gene locus_tag LOCUS_06720 gene rny 16014 17540 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258580.1 protein_id gnl|my_center|LOCUS_06720 18752 17712 gene locus_tag LOCUS_06730 18752 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 19537 18770 gene locus_tag LOCUS_06740 19537 18770 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728711.1 protein_id gnl|my_center|LOCUS_06740 20957 19557 gene locus_tag LOCUS_06750 20957 19557 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 protein_id gnl|my_center|LOCUS_06750 21995 21207 gene locus_tag LOCUS_06760 21995 21207 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140506.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence027 461 1456 gene locus_tag LOCUS_06770 461 1456 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256990.1 protein_id gnl|my_center|LOCUS_06770 1466 2452 gene locus_tag LOCUS_06780 1466 2452 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_06780 2570 3979 gene locus_tag LOCUS_06790 2570 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4230 5378 gene locus_tag LOCUS_06800 4230 5378 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225105.1 protein_id gnl|my_center|LOCUS_06800 5375 6307 gene locus_tag LOCUS_06810 5375 6307 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_06810 6310 7899 gene locus_tag LOCUS_06820 6310 7899 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256997.1 protein_id gnl|my_center|LOCUS_06820 8591 8752 gene locus_tag LOCUS_06830 8591 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 8757 9857 gene locus_tag LOCUS_06840 8757 9857 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224340.1 protein_id gnl|my_center|LOCUS_06840 10228 11454 gene locus_tag LOCUS_06850 gene nagA 10228 11454 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722368.1 protein_id gnl|my_center|LOCUS_06850 11451 12488 gene locus_tag LOCUS_06860 11451 12488 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256998.1 protein_id gnl|my_center|LOCUS_06860 12664 13089 gene locus_tag LOCUS_06870 12664 13089 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_06870 13127 16102 gene locus_tag LOCUS_06880 13127 16102 CDS product intein-containing RctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870187.1 protein_id gnl|my_center|LOCUS_06880 16102 16968 gene locus_tag LOCUS_06890 gene rsmI 16102 16968 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_06890 17061 18143 gene locus_tag LOCUS_06900 17061 18143 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_06900 18726 18307 gene locus_tag LOCUS_06910 18726 18307 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409273.1 protein_id gnl|my_center|LOCUS_06910 18977 18729 gene locus_tag LOCUS_06920 18977 18729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 19183 20622 gene locus_tag LOCUS_06930 19183 20622 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421588.1 protein_id gnl|my_center|LOCUS_06930 20639 21799 gene locus_tag LOCUS_06940 20639 21799 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence028 352 1998 gene locus_tag LOCUS_06950 352 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2044 3048 gene locus_tag LOCUS_06960 2044 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 4229 3084 gene locus_tag LOCUS_06970 4229 3084 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_06970 4706 4236 gene locus_tag LOCUS_06980 4706 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 5458 4727 gene locus_tag LOCUS_06990 5458 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 5927 5469 gene locus_tag LOCUS_07000 5927 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 6391 5939 gene locus_tag LOCUS_07010 6391 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 6782 6378 gene locus_tag LOCUS_07020 6782 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 7159 7404 gene locus_tag LOCUS_07030 7159 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 7398 9737 gene locus_tag LOCUS_07040 gene napA 7398 9737 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895543.1 protein_id gnl|my_center|LOCUS_07040 9734 10489 gene locus_tag LOCUS_07050 9734 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 10486 11172 gene locus_tag LOCUS_07060 10486 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 11169 12365 gene locus_tag LOCUS_07070 11169 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 12392 13684 gene locus_tag LOCUS_07080 gene nrfD 12392 13684 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541886.1 protein_id gnl|my_center|LOCUS_07080 14618 13695 gene locus_tag LOCUS_07090 14618 13695 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551623.1 protein_id gnl|my_center|LOCUS_07090 15004 15492 gene locus_tag LOCUS_07100 gene dps 15004 15492 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_07100 15806 16588 gene locus_tag LOCUS_07110 15806 16588 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228731.1 protein_id gnl|my_center|LOCUS_07110 16585 17838 gene locus_tag LOCUS_07120 16585 17838 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809839.1 protein_id gnl|my_center|LOCUS_07120 17915 18781 gene locus_tag LOCUS_07130 17915 18781 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_07130 18785 19801 gene locus_tag LOCUS_07140 18785 19801 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_07140 19773 20513 gene locus_tag LOCUS_07150 19773 20513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809845.1 protein_id gnl|my_center|LOCUS_07150 20526 21224 gene locus_tag LOCUS_07160 20526 21224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_07160 21284 21601 gene locus_tag LOCUS_07170 21284 21601 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259346.1 protein_id gnl|my_center|LOCUS_07170 21585 21935 gene locus_tag LOCUS_07180 21585 21935 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence029 3003 421 gene locus_tag LOCUS_07190 gene recG 3003 421 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256170.1 protein_id gnl|my_center|LOCUS_07190 3848 3003 gene locus_tag LOCUS_07200 3848 3003 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_07200 4822 3953 gene locus_tag LOCUS_07210 4822 3953 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_07210 5936 5097 gene locus_tag LOCUS_07220 5936 5097 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_07220 6838 5951 gene locus_tag LOCUS_07230 6838 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 8614 6920 gene locus_tag LOCUS_07240 8614 6920 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272451.1 protein_id gnl|my_center|LOCUS_07240 9039 8638 gene locus_tag LOCUS_07250 9039 8638 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171418.1 protein_id gnl|my_center|LOCUS_07250 9177 9359 gene locus_tag LOCUS_07260 gene rpmB 9177 9359 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256168.1 protein_id gnl|my_center|LOCUS_07260 10899 9424 gene locus_tag LOCUS_07270 10899 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 12047 10920 gene locus_tag LOCUS_07280 gene rlmN 12047 10920 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_07280 13012 12215 gene locus_tag LOCUS_07290 13012 12215 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_07290 13751 13332 gene locus_tag LOCUS_07300 13751 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 14009 13752 gene locus_tag LOCUS_07310 14009 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 14262 15839 gene locus_tag LOCUS_07320 gene tig 14262 15839 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723884.1 protein_id gnl|my_center|LOCUS_07320 15972 16595 gene locus_tag LOCUS_07330 gene clpP 15972 16595 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631995.1 protein_id gnl|my_center|LOCUS_07330 16585 17892 gene locus_tag LOCUS_07340 gene clpX 16585 17892 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_07340 20875 17924 gene locus_tag LOCUS_07350 20875 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 21651 20914 gene locus_tag LOCUS_07360 21651 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence030 <1 564 gene locus_tag LOCUS_07370 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941297.1:glycosyltransferase family 4 protein 947 552 gene locus_tag LOCUS_07380 947 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 1448 1023 gene locus_tag LOCUS_07390 1448 1023 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_07390 1739 2554 gene locus_tag LOCUS_07400 1739 2554 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807577.1 protein_id gnl|my_center|LOCUS_07400 2954 4057 gene locus_tag LOCUS_07410 2954 4057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_07410 4163 4546 gene locus_tag LOCUS_07420 gene rsfS 4163 4546 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926804.1 protein_id gnl|my_center|LOCUS_07420 5200 4742 gene locus_tag LOCUS_07430 gene ndk 5200 4742 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_07430 6882 5227 gene locus_tag LOCUS_07440 6882 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 7906 6902 gene locus_tag LOCUS_07450 7906 6902 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289638.1 protein_id gnl|my_center|LOCUS_07450 9543 7966 gene locus_tag LOCUS_07460 9543 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 9971 9714 gene locus_tag LOCUS_07470 gene rpsR 9971 9714 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_07470 10490 9975 gene locus_tag LOCUS_07480 10490 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 10672 12408 gene locus_tag LOCUS_07490 10672 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 14856 12415 gene locus_tag LOCUS_07500 14856 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 15295 14945 gene locus_tag LOCUS_07510 15295 14945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 16604 15579 gene locus_tag LOCUS_07520 16604 15579 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257829.1 protein_id gnl|my_center|LOCUS_07520 17188 16718 gene locus_tag LOCUS_07530 gene greA 17188 16718 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257112.1 protein_id gnl|my_center|LOCUS_07530 17339 18952 gene locus_tag LOCUS_07540 17339 18952 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_07540 19964 19011 gene locus_tag LOCUS_07550 gene cysK 19964 19011 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_07550 21337 20051 gene locus_tag LOCUS_07560 21337 20051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence031 1383 262 gene locus_tag LOCUS_07570 gene ftsZ 1383 262 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_07570 2661 1423 gene locus_tag LOCUS_07580 gene ftsA 2661 1423 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_07580 3377 2706 gene locus_tag LOCUS_07590 3377 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4711 3566 gene locus_tag LOCUS_07600 4711 3566 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_07600 5742 4708 gene locus_tag LOCUS_07610 gene murB 5742 4708 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_07610 5945 5739 gene locus_tag LOCUS_07620 5945 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 7387 5942 gene locus_tag LOCUS_07630 gene murC 7387 5942 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729655.1 protein_id gnl|my_center|LOCUS_07630 8032 7400 gene locus_tag LOCUS_07640 8032 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 9254 8049 gene locus_tag LOCUS_07650 9254 8049 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_07650 10423 9254 gene locus_tag LOCUS_07660 gene ftsW 10423 9254 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256650.1 protein_id gnl|my_center|LOCUS_07660 11979 10525 gene locus_tag LOCUS_07670 gene murD 11979 10525 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_07670 12972 12001 gene locus_tag LOCUS_07680 gene mraY 12972 12001 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_07680 14420 12981 gene locus_tag LOCUS_07690 14420 12981 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_07690 16180 14435 gene locus_tag LOCUS_07700 16180 14435 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256655.1 protein_id gnl|my_center|LOCUS_07700 16737 16369 gene locus_tag LOCUS_07710 16737 16369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 17783 16860 gene locus_tag LOCUS_07720 gene rsmH 17783 16860 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_07720 18223 17783 gene locus_tag LOCUS_07730 gene mraZ 18223 17783 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_07730 19380 18520 gene locus_tag LOCUS_07740 19380 18520 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence032 264 791 gene locus_tag LOCUS_07750 264 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 898 2196 gene locus_tag LOCUS_07760 gene nuoF 898 2196 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909320.1 protein_id gnl|my_center|LOCUS_07760 2268 2636 gene locus_tag LOCUS_07770 2268 2636 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259332.1 protein_id gnl|my_center|LOCUS_07770 2590 5295 gene locus_tag LOCUS_07780 gene nuoG 2590 5295 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258754.1 protein_id gnl|my_center|LOCUS_07780 5292 6317 gene locus_tag LOCUS_07790 gene nuoH 5292 6317 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_07790 6388 6645 gene locus_tag LOCUS_07800 6388 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 6652 6966 gene locus_tag LOCUS_07810 6652 6966 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_07810 6976 7332 gene locus_tag LOCUS_07820 6976 7332 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_07820 7350 7976 gene locus_tag LOCUS_07830 7350 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 7989 8546 gene locus_tag LOCUS_07840 7989 8546 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_07840 8543 8848 gene locus_tag LOCUS_07850 gene nuoK 8543 8848 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_07850 8850 10784 gene locus_tag LOCUS_07860 gene nuoL 8850 10784 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_07860 10828 12345 gene locus_tag LOCUS_07870 10828 12345 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_07870 12353 13798 gene locus_tag LOCUS_07880 12353 13798 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258761.1 protein_id gnl|my_center|LOCUS_07880 13804 14223 gene locus_tag LOCUS_07890 13804 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 15876 14263 gene locus_tag LOCUS_07900 15876 14263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 17373 15952 gene locus_tag LOCUS_07910 17373 15952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 17785 20013 gene locus_tag LOCUS_07920 17785 20013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence033 2125 1268 gene locus_tag LOCUS_07930 gene murI 2125 1268 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166466071.1 protein_id gnl|my_center|LOCUS_07930 2399 2139 gene locus_tag LOCUS_07940 2399 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2874 2461 gene locus_tag LOCUS_07950 2874 2461 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_07950 3250 3534 gene locus_tag LOCUS_07960 3250 3534 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869489.1 protein_id gnl|my_center|LOCUS_07960 4290 3568 gene locus_tag LOCUS_07970 4290 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 5561 4287 gene locus_tag LOCUS_07980 gene fabF 5561 4287 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583310.1 protein_id gnl|my_center|LOCUS_07980 6626 5604 gene locus_tag LOCUS_07990 gene plsX 6626 5604 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_07990 6907 7326 gene locus_tag LOCUS_08000 6907 7326 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173262.1 protein_id gnl|my_center|LOCUS_08000 7604 8548 gene locus_tag LOCUS_08010 7604 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 8711 11515 gene locus_tag LOCUS_08020 8711 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 11591 12814 gene locus_tag LOCUS_08030 11591 12814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257476.1 protein_id gnl|my_center|LOCUS_08030 12804 13454 gene locus_tag LOCUS_08040 12804 13454 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_08040 14815 15570 gene locus_tag LOCUS_08050 14815 15570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 16489 16986 gene locus_tag LOCUS_08060 16489 16986 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_08060 16976 17983 gene locus_tag LOCUS_08070 gene meaB 16976 17983 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255953.1 protein_id gnl|my_center|LOCUS_08070 19531 18260 gene locus_tag LOCUS_08080 19531 18260 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259083.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence034 4353 7058 gene locus_tag LOCUS_08090 4353 7058 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530065.1 protein_id gnl|my_center|LOCUS_08090 7362 9788 gene locus_tag LOCUS_08100 7362 9788 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_08100 9881 10069 gene locus_tag LOCUS_08110 9881 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 10073 11146 gene locus_tag LOCUS_08120 10073 11146 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057244.1 protein_id gnl|my_center|LOCUS_08120 11143 13131 gene locus_tag LOCUS_08130 11143 13131 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142013.1 protein_id gnl|my_center|LOCUS_08130 13128 14264 gene locus_tag LOCUS_08140 13128 14264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545696.1 protein_id gnl|my_center|LOCUS_08140 14264 15394 gene locus_tag LOCUS_08150 14264 15394 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_08150 15414 16415 gene locus_tag LOCUS_08160 15414 16415 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_08160 16555 17415 gene locus_tag LOCUS_08170 16555 17415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 17744 18367 gene locus_tag LOCUS_08180 17744 18367 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391567.1 protein_id gnl|my_center|LOCUS_08180 19052 18348 gene locus_tag LOCUS_08190 19052 18348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence035 74 460 gene locus_tag LOCUS_08200 74 460 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258819.1 protein_id gnl|my_center|LOCUS_08200 2004 751 gene locus_tag LOCUS_08210 2004 751 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_08210 3127 2027 gene locus_tag LOCUS_08220 3127 2027 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020242.1 protein_id gnl|my_center|LOCUS_08220 3360 3151 gene locus_tag LOCUS_08230 3360 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3628 4095 gene locus_tag LOCUS_08240 3628 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 4410 4156 gene locus_tag LOCUS_08250 4410 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 6260 4473 gene locus_tag LOCUS_08260 6260 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 6796 7428 gene locus_tag LOCUS_08270 6796 7428 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_08270 7835 7449 gene locus_tag LOCUS_08280 7835 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 8557 7961 gene locus_tag LOCUS_08290 8557 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 8803 9141 gene locus_tag LOCUS_08300 8803 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 9346 9158 gene locus_tag LOCUS_08310 9346 9158 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583928.1 protein_id gnl|my_center|LOCUS_08310 9753 9373 gene locus_tag LOCUS_08320 9753 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 11502 9850 gene locus_tag LOCUS_08330 11502 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 12156 11506 gene locus_tag LOCUS_08340 12156 11506 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_08340 12743 12237 gene locus_tag LOCUS_08350 12743 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 13198 12740 gene locus_tag LOCUS_08360 13198 12740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 15184 13238 gene locus_tag LOCUS_08370 15184 13238 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_08370 15191 15475 gene locus_tag LOCUS_08380 15191 15475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 15885 15472 gene locus_tag LOCUS_08390 15885 15472 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065851.1 protein_id gnl|my_center|LOCUS_08390 16438 15995 gene locus_tag LOCUS_08400 16438 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 19309 16748 gene locus_tag LOCUS_08410 19309 16748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence036 650 435 gene locus_tag LOCUS_08420 650 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2967 685 gene locus_tag LOCUS_08430 2967 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 3430 3017 gene locus_tag LOCUS_08440 3430 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 5618 3447 gene locus_tag LOCUS_08450 5618 3447 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_08450 5822 6715 gene locus_tag LOCUS_08460 5822 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 6705 8081 gene locus_tag LOCUS_08470 6705 8081 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_08470 8097 9185 gene locus_tag LOCUS_08480 8097 9185 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227985.1 protein_id gnl|my_center|LOCUS_08480 9186 10457 gene locus_tag LOCUS_08490 gene glcF 9186 10457 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227984.1 protein_id gnl|my_center|LOCUS_08490 11712 10504 gene locus_tag LOCUS_08500 11712 10504 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_08500 12503 11724 gene locus_tag LOCUS_08510 12503 11724 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_08510 13378 12500 gene locus_tag LOCUS_08520 13378 12500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 13693 14127 gene locus_tag LOCUS_08530 13693 14127 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140723.1 protein_id gnl|my_center|LOCUS_08530 14943 14149 gene locus_tag LOCUS_08540 gene paaG 14943 14149 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 protein_id gnl|my_center|LOCUS_08540 15810 15037 gene locus_tag LOCUS_08550 15810 15037 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_08550 16232 15954 gene locus_tag LOCUS_08560 16232 15954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 16543 16229 gene locus_tag LOCUS_08570 16543 16229 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083228.1 protein_id gnl|my_center|LOCUS_08570 18030 16729 gene locus_tag LOCUS_08580 18030 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 18754 18146 gene locus_tag LOCUS_08590 18754 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence037 1114 704 gene locus_tag LOCUS_08600 1114 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1574 1164 gene locus_tag LOCUS_08610 1574 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2340 1558 gene locus_tag LOCUS_08620 2340 1558 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052303786.1 protein_id gnl|my_center|LOCUS_08620 4103 2385 gene locus_tag LOCUS_08630 4103 2385 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056187.1 protein_id gnl|my_center|LOCUS_08630 4392 4126 gene locus_tag LOCUS_08640 4392 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4753 4535 gene locus_tag LOCUS_08650 4753 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5710 4835 gene locus_tag LOCUS_08660 5710 4835 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250352.1 protein_id gnl|my_center|LOCUS_08660 6219 5710 gene locus_tag LOCUS_08670 6219 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 8558 6240 gene locus_tag LOCUS_08680 8558 6240 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_08680 8966 8577 gene locus_tag LOCUS_08690 8966 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 10508 9006 gene locus_tag LOCUS_08700 10508 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 11383 10571 gene locus_tag LOCUS_08710 11383 10571 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142969.1 protein_id gnl|my_center|LOCUS_08710 11673 12161 gene locus_tag LOCUS_08720 11673 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 12372 13229 gene locus_tag LOCUS_08730 gene rnz 12372 13229 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086661.1 protein_id gnl|my_center|LOCUS_08730 14711 13434 gene locus_tag LOCUS_08740 14711 13434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 15132 14722 gene locus_tag LOCUS_08750 15132 14722 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358536.1 protein_id gnl|my_center|LOCUS_08750 16603 15248 gene locus_tag LOCUS_08760 16603 15248 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_08760 17388 16702 gene locus_tag LOCUS_08770 17388 16702 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980655.1 protein_id gnl|my_center|LOCUS_08770 18432 17407 gene locus_tag LOCUS_08780 18432 17407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence038 454 1728 gene locus_tag LOCUS_08790 gene cysS 454 1728 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256641.1 protein_id gnl|my_center|LOCUS_08790 1764 2570 gene locus_tag LOCUS_08800 1764 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2755 3405 gene locus_tag LOCUS_08810 2755 3405 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_08810 3427 5292 gene locus_tag LOCUS_08820 gene glmS 3427 5292 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_08820 5350 6600 gene locus_tag LOCUS_08830 5350 6600 CDS product 2-phospho-L-lactate transferase CofD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257392.1 protein_id gnl|my_center|LOCUS_08830 6616 8121 gene locus_tag LOCUS_08840 gene glmM 6616 8121 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_08840 8118 9392 gene locus_tag LOCUS_08850 8118 9392 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933230.1 protein_id gnl|my_center|LOCUS_08850 9398 9778 gene locus_tag LOCUS_08860 9398 9778 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460983.1 protein_id gnl|my_center|LOCUS_08860 9962 11002 gene locus_tag LOCUS_08870 9962 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258388.1 protein_id gnl|my_center|LOCUS_08870 11239 12066 gene locus_tag LOCUS_08880 11239 12066 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258389.1 protein_id gnl|my_center|LOCUS_08880 12080 14749 gene locus_tag LOCUS_08890 gene mutS 12080 14749 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_08890 14810 15514 gene locus_tag LOCUS_08900 14810 15514 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 protein_id gnl|my_center|LOCUS_08900 16342 15518 gene locus_tag LOCUS_08910 16342 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 17583 16339 gene locus_tag LOCUS_08920 gene tyrS 17583 16339 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_08920 17957 17703 gene locus_tag LOCUS_08930 17957 17703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence039 961 215 gene locus_tag LOCUS_08940 961 215 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966508.1 protein_id gnl|my_center|LOCUS_08940 1569 946 gene locus_tag LOCUS_08950 1569 946 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404292.1 protein_id gnl|my_center|LOCUS_08950 2866 1658 gene locus_tag LOCUS_08960 2866 1658 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 protein_id gnl|my_center|LOCUS_08960 3821 2916 gene locus_tag LOCUS_08970 3821 2916 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081221.1 protein_id gnl|my_center|LOCUS_08970 4645 3818 gene locus_tag LOCUS_08980 4645 3818 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258574.1 protein_id gnl|my_center|LOCUS_08980 5404 4661 gene locus_tag LOCUS_08990 gene ubiE 5404 4661 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_08990 6039 5539 gene locus_tag LOCUS_09000 gene paaJ 6039 5539 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618854.1 protein_id gnl|my_center|LOCUS_09000 6827 6033 gene locus_tag LOCUS_09010 gene paaC 6827 6033 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228337.1 protein_id gnl|my_center|LOCUS_09010 7203 6820 gene locus_tag LOCUS_09020 gene paaB 7203 6820 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_09020 8208 7219 gene locus_tag LOCUS_09030 gene paaA 8208 7219 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_09030 8854 8237 gene locus_tag LOCUS_09040 8854 8237 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_09040 9246 10757 gene locus_tag LOCUS_09050 9246 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 10848 12119 gene locus_tag LOCUS_09060 10848 12119 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_09060 12224 13183 gene locus_tag LOCUS_09070 12224 13183 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_09070 13195 13752 gene locus_tag LOCUS_09080 13195 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 13763 14647 gene locus_tag LOCUS_09090 13763 14647 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_09090 14644 15669 gene locus_tag LOCUS_09100 14644 15669 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039247.1 protein_id gnl|my_center|LOCUS_09100 15666 16409 gene locus_tag LOCUS_09110 15666 16409 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243767.1 protein_id gnl|my_center|LOCUS_09110 16440 17204 gene locus_tag LOCUS_09120 16440 17204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence040 2261 177 gene locus_tag LOCUS_09130 gene fusA 2261 177 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_09130 2763 2326 gene locus_tag LOCUS_09140 gene rpsG 2763 2326 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_09140 3439 3020 gene locus_tag LOCUS_09150 gene rpsL 3439 3020 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_09150 7514 3636 gene locus_tag LOCUS_09160 7514 3636 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256763.1 protein_id gnl|my_center|LOCUS_09160 8926 7970 gene locus_tag LOCUS_09170 8926 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 9121 9591 gene locus_tag LOCUS_09180 9121 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 10949 9588 gene locus_tag LOCUS_09190 10949 9588 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_09190 11054 11563 gene locus_tag LOCUS_09200 11054 11563 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846827.1 protein_id gnl|my_center|LOCUS_09200 11560 11985 gene locus_tag LOCUS_09210 11560 11985 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846630.1 protein_id gnl|my_center|LOCUS_09210 11982 13838 gene locus_tag LOCUS_09220 11982 13838 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 protein_id gnl|my_center|LOCUS_09220 13885 13969 gene locus_tag LOCUS_t00080 13885 13969 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14255 14061 gene locus_tag LOCUS_09230 14255 14061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 14599 15720 gene locus_tag LOCUS_09240 14599 15720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 15794 16348 gene locus_tag LOCUS_09250 15794 16348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 16510 17766 gene locus_tag LOCUS_09260 16510 17766 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence041 <1 2062 gene locus_tag LOCUS_09270 <1 2062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259672.1:primosomal protein N' 2256 2489 gene locus_tag LOCUS_09280 2256 2489 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_09280 3501 2602 gene locus_tag LOCUS_09290 gene speB 3501 2602 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_09290 4585 3494 gene locus_tag LOCUS_09300 gene speY 4585 3494 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_09300 5149 4604 gene locus_tag LOCUS_09310 5149 4604 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_09310 6035 5442 gene locus_tag LOCUS_09320 gene purN 6035 5442 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679594.1 protein_id gnl|my_center|LOCUS_09320 8787 6310 gene locus_tag LOCUS_09330 gene gyrA 8787 6310 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_09330 9321 9992 gene locus_tag LOCUS_09340 9321 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 10401 13058 gene locus_tag LOCUS_09350 10401 13058 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027789.1 protein_id gnl|my_center|LOCUS_09350 13304 14959 gene locus_tag LOCUS_09360 13304 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 15426 15109 gene locus_tag LOCUS_09370 15426 15109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 15621 17759 gene locus_tag LOCUS_09380 gene mrdA 15621 17759 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583753.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence042 180 2195 gene locus_tag LOCUS_09390 180 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2282 3370 gene locus_tag LOCUS_09400 2282 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3769 6291 gene locus_tag LOCUS_09410 3769 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 6508 7536 gene locus_tag LOCUS_09420 gene argC 6508 7536 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259290.1 protein_id gnl|my_center|LOCUS_09420 7552 8334 gene locus_tag LOCUS_09430 gene argB 7552 8334 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259245.1 protein_id gnl|my_center|LOCUS_09430 8331 9551 gene locus_tag LOCUS_09440 8331 9551 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257809.1 protein_id gnl|my_center|LOCUS_09440 9566 10168 gene locus_tag LOCUS_09450 9566 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 10165 10980 gene locus_tag LOCUS_09460 10165 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 11030 11482 gene locus_tag LOCUS_09470 11030 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 11482 12276 gene locus_tag LOCUS_09480 11482 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 12427 13614 gene locus_tag LOCUS_09490 gene carA 12427 13614 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_09490 13616 14740 gene locus_tag LOCUS_09500 13616 14740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence043 222 1805 gene locus_tag LOCUS_09510 222 1805 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111376.1 protein_id gnl|my_center|LOCUS_09510 2518 1895 gene locus_tag LOCUS_09520 2518 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 3105 2575 gene locus_tag LOCUS_09530 3105 2575 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256561.1 protein_id gnl|my_center|LOCUS_09530 4100 3234 gene locus_tag LOCUS_09540 4100 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4466 5365 gene locus_tag LOCUS_09550 4466 5365 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_09550 8822 5385 gene locus_tag LOCUS_09560 8822 5385 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189169828.1 protein_id gnl|my_center|LOCUS_09560 9454 8819 gene locus_tag LOCUS_09570 9454 8819 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705602.1 protein_id gnl|my_center|LOCUS_09570 10504 9557 gene locus_tag LOCUS_09580 10504 9557 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_09580 11422 10535 gene locus_tag LOCUS_09590 gene truB 11422 10535 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_09590 12502 11516 gene locus_tag LOCUS_09600 12502 11516 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258868.1 protein_id gnl|my_center|LOCUS_09600 12878 12495 gene locus_tag LOCUS_09610 gene rbfA 12878 12495 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719600.1 protein_id gnl|my_center|LOCUS_09610 14714 12882 gene locus_tag LOCUS_09620 14714 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 15197 14916 gene locus_tag LOCUS_09630 15197 14916 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583568.1 protein_id gnl|my_center|LOCUS_09630 16861 15221 gene locus_tag LOCUS_09640 16861 15221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 17453 17070 gene locus_tag LOCUS_09650 17453 17070 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence044 3036 286 gene locus_tag LOCUS_09660 gene ppc 3036 286 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_09660 3249 5243 gene locus_tag LOCUS_09670 3249 5243 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839420.1 protein_id gnl|my_center|LOCUS_09670 5712 5266 gene locus_tag LOCUS_09680 5712 5266 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_09680 6755 5709 gene locus_tag LOCUS_09690 gene asd 6755 5709 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_09690 7391 6837 gene locus_tag LOCUS_09700 7391 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8908 7556 gene locus_tag LOCUS_09710 gene rsmF 8908 7556 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_09710 9543 8959 gene locus_tag LOCUS_09720 9543 8959 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_09720 10494 9556 gene locus_tag LOCUS_09730 10494 9556 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_09730 10861 11490 gene locus_tag LOCUS_09740 10861 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 11578 13029 gene locus_tag LOCUS_09750 gene floT 11578 13029 CDS product flotillin lipid rafts scaffold protein FloT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228960.1 protein_id gnl|my_center|LOCUS_09750 13121 15640 gene locus_tag LOCUS_09760 13121 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_09760 15959 16468 gene locus_tag LOCUS_09770 15959 16468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence045 <1 1529 gene locus_tag LOCUS_09780 <1 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258859.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 1616 2416 gene locus_tag LOCUS_09790 gene larB 1616 2416 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_09790 2406 3260 gene locus_tag LOCUS_09800 gene larE 2406 3260 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_09800 4191 4430 gene locus_tag LOCUS_09810 4191 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4427 4663 gene locus_tag LOCUS_09820 4427 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4798 4995 gene locus_tag LOCUS_09830 4798 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 5008 5244 gene locus_tag LOCUS_09840 5008 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 6861 5530 gene locus_tag LOCUS_09850 6861 5530 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258451.1 protein_id gnl|my_center|LOCUS_09850 7390 8079 gene locus_tag LOCUS_09860 7390 8079 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_09860 8365 9624 gene locus_tag LOCUS_09870 gene nhaA 8365 9624 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_09870 9637 11553 gene locus_tag LOCUS_09880 9637 11553 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146467.1 protein_id gnl|my_center|LOCUS_09880 11601 12605 gene locus_tag LOCUS_09890 11601 12605 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_09890 12635 13801 gene locus_tag LOCUS_09900 gene lysA 12635 13801 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084201.1 protein_id gnl|my_center|LOCUS_09900 13920 14573 gene locus_tag LOCUS_09910 13920 14573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 14648 15292 gene locus_tag LOCUS_09920 14648 15292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 15503 15243 gene locus_tag LOCUS_09930 15503 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 15556 16413 gene locus_tag LOCUS_09940 15556 16413 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228457.1 protein_id gnl|my_center|LOCUS_09940 16528 17229 gene locus_tag LOCUS_09950 gene sfsA 16528 17229 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391969.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence046 295 690 gene locus_tag LOCUS_09960 295 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 705 2084 gene locus_tag LOCUS_09970 gene der 705 2084 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_09970 2202 2489 gene locus_tag LOCUS_09980 2202 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2499 4043 gene locus_tag LOCUS_09990 gene purH 2499 4043 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_09990 4119 5204 gene locus_tag LOCUS_10000 4119 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 6404 5220 gene locus_tag LOCUS_10010 6404 5220 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257079.1 protein_id gnl|my_center|LOCUS_10010 7452 6409 gene locus_tag LOCUS_10020 7452 6409 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_10020 7877 7449 gene locus_tag LOCUS_10030 gene tsaA 7877 7449 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064869.1 protein_id gnl|my_center|LOCUS_10030 8299 7874 gene locus_tag LOCUS_10040 8299 7874 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_10040 9017 8337 gene locus_tag LOCUS_10050 9017 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 11435 9033 gene locus_tag LOCUS_10060 11435 9033 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879109.1 protein_id gnl|my_center|LOCUS_10060 13197 11584 gene locus_tag LOCUS_10070 13197 11584 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389949.1 protein_id gnl|my_center|LOCUS_10070 14993 13563 gene locus_tag LOCUS_10080 gene guaB 14993 13563 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227931.1 protein_id gnl|my_center|LOCUS_10080 15281 15069 gene locus_tag LOCUS_10090 15281 15069 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_10090 16249 15338 gene locus_tag LOCUS_10100 gene cyoE 16249 15338 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846973.1 protein_id gnl|my_center|LOCUS_10100 16411 17157 gene locus_tag LOCUS_10110 16411 17157 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257858.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence047 2578 812 gene locus_tag LOCUS_10120 2578 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2637 3767 gene locus_tag LOCUS_10130 2637 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 4043 3759 gene locus_tag LOCUS_10140 4043 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5807 4056 gene locus_tag LOCUS_10150 5807 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 7246 5804 gene locus_tag LOCUS_10160 7246 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7489 8562 gene locus_tag LOCUS_10170 7489 8562 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405523.1 protein_id gnl|my_center|LOCUS_10170 9507 8575 gene locus_tag LOCUS_10180 9507 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 10558 9866 gene locus_tag LOCUS_10190 10558 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 10763 13096 gene locus_tag LOCUS_10200 10763 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 13266 14111 gene locus_tag LOCUS_10210 13266 14111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 14262 14969 gene locus_tag LOCUS_10220 14262 14969 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_10220 14981 16444 gene locus_tag LOCUS_10230 14981 16444 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence048 2392 2604 gene locus_tag LOCUS_10240 2392 2604 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064941.1 protein_id gnl|my_center|LOCUS_10240 2706 3539 gene locus_tag LOCUS_10250 2706 3539 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_10250 3713 4855 gene locus_tag LOCUS_10260 3713 4855 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404125.1 protein_id gnl|my_center|LOCUS_10260 4991 5437 gene locus_tag LOCUS_10270 gene aroQ 4991 5437 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_10270 5437 6243 gene locus_tag LOCUS_10280 gene pgl 5437 6243 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_10280 6929 6171 gene locus_tag LOCUS_10290 gene cobB 6929 6171 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_10290 7942 6989 gene locus_tag LOCUS_10300 7942 6989 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_10300 8570 7956 gene locus_tag LOCUS_10310 8570 7956 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_10310 9399 8578 gene locus_tag LOCUS_10320 9399 8578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_10320 10769 9402 gene locus_tag LOCUS_10330 10769 9402 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992486.1 protein_id gnl|my_center|LOCUS_10330 11877 10795 gene locus_tag LOCUS_10340 11877 10795 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_10340 12767 11883 gene locus_tag LOCUS_10350 12767 11883 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227944.1 protein_id gnl|my_center|LOCUS_10350 13550 12777 gene locus_tag LOCUS_10360 13550 12777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088703.1 protein_id gnl|my_center|LOCUS_10360 15509 13578 gene locus_tag LOCUS_10370 15509 13578 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_10370 15871 16590 gene locus_tag LOCUS_10380 15871 16590 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence049 1886 1017 gene locus_tag LOCUS_10390 1886 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 3283 1952 gene locus_tag LOCUS_10400 3283 1952 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_10400 3446 3925 gene locus_tag LOCUS_10410 3446 3925 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887882.1 protein_id gnl|my_center|LOCUS_10410 3927 4787 gene locus_tag LOCUS_10420 3927 4787 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869093.1 protein_id gnl|my_center|LOCUS_10420 4894 5187 gene locus_tag LOCUS_10430 4894 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 5175 5609 gene locus_tag LOCUS_10440 5175 5609 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146462.1 protein_id gnl|my_center|LOCUS_10440 6093 5611 gene locus_tag LOCUS_10450 6093 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10450 7629 6118 gene locus_tag LOCUS_10460 7629 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7831 9936 gene locus_tag LOCUS_10470 7831 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 9933 10361 gene locus_tag LOCUS_10480 9933 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 11107 10388 gene locus_tag LOCUS_10490 11107 10388 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438215.1 protein_id gnl|my_center|LOCUS_10490 11697 11107 gene locus_tag LOCUS_10500 gene folE 11697 11107 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258500.1 protein_id gnl|my_center|LOCUS_10500 11870 12622 gene locus_tag LOCUS_10510 11870 12622 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_10510 12690 13058 gene locus_tag LOCUS_10520 gene folX 12690 13058 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316983.1 protein_id gnl|my_center|LOCUS_10520 13055 13570 gene locus_tag LOCUS_10530 gene folK 13055 13570 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221222.1 protein_id gnl|my_center|LOCUS_10530 14417 13635 gene locus_tag LOCUS_10540 14417 13635 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933431.1 protein_id gnl|my_center|LOCUS_10540 15505 14579 gene locus_tag LOCUS_10550 15505 14579 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141460.1 protein_id gnl|my_center|LOCUS_10550 16147 15836 gene locus_tag LOCUS_10560 16147 15836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 16028 16372 gene locus_tag LOCUS_10570 16028 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence050 59 334 gene locus_tag LOCUS_10580 59 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 383 940 gene locus_tag LOCUS_10590 383 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 937 2502 gene locus_tag LOCUS_10600 937 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5144 2538 gene locus_tag LOCUS_10610 5144 2538 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460226.1 protein_id gnl|my_center|LOCUS_10610 7991 5166 gene locus_tag LOCUS_10620 7991 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 10361 8142 gene locus_tag LOCUS_10630 10361 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 11268 10363 gene locus_tag LOCUS_10640 11268 10363 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257667.1 protein_id gnl|my_center|LOCUS_10640 11592 12203 gene locus_tag LOCUS_10650 11592 12203 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_10650 12387 15386 gene locus_tag LOCUS_10660 12387 15386 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_10660 <16391 15390 gene locus_tag LOCUS_10670 <16391 15390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265693.1:phytase >Feature sequence051 20 1447 gene locus_tag LOCUS_10680 gene purB 20 1447 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438353.1 protein_id gnl|my_center|LOCUS_10680 1749 2033 gene locus_tag LOCUS_10690 1749 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2030 2647 gene locus_tag LOCUS_10700 2030 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3188 2658 gene locus_tag LOCUS_10710 3188 2658 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932755.1 protein_id gnl|my_center|LOCUS_10710 4722 3160 gene locus_tag LOCUS_10720 gene nadB 4722 3160 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939096.1 protein_id gnl|my_center|LOCUS_10720 5809 4727 gene locus_tag LOCUS_10730 gene nadA 5809 4727 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404647.1 protein_id gnl|my_center|LOCUS_10730 6719 5787 gene locus_tag LOCUS_10740 gene nadC 6719 5787 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840153.1 protein_id gnl|my_center|LOCUS_10740 7237 6923 gene locus_tag LOCUS_10750 7237 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 7128 8408 gene locus_tag LOCUS_10760 gene fabF 7128 8408 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_10760 8368 8805 gene locus_tag LOCUS_10770 8368 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 8826 10016 gene locus_tag LOCUS_10780 8826 10016 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_10780 10341 10129 gene locus_tag LOCUS_10790 10341 10129 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064941.1 protein_id gnl|my_center|LOCUS_10790 10680 11627 gene locus_tag LOCUS_10800 10680 11627 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393454.1 protein_id gnl|my_center|LOCUS_10800 11678 14458 gene locus_tag LOCUS_10810 gene xdh 11678 14458 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356597.1 protein_id gnl|my_center|LOCUS_10810 14876 14508 gene locus_tag LOCUS_10820 14876 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 15487 14876 gene locus_tag LOCUS_10830 gene recR 15487 14876 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256424.1 protein_id gnl|my_center|LOCUS_10830 15902 15513 gene locus_tag LOCUS_10840 15902 15513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence052 <1 3897 gene locus_tag LOCUS_10850 <1 3897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106007160.1:PocR ligand-binding domain-containing protein 5011 3935 gene locus_tag LOCUS_10860 5011 3935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391617.1 protein_id gnl|my_center|LOCUS_10860 5790 5089 gene locus_tag LOCUS_10870 5790 5089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_10870 7163 5799 gene locus_tag LOCUS_10880 7163 5799 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_10880 10523 7182 gene locus_tag LOCUS_10890 10523 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 11574 10750 gene locus_tag LOCUS_10900 11574 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 <16203 11650 gene locus_tag LOCUS_10910 <16203 11650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014625869.1:alpha-2-macroglobulin >Feature sequence053 <1 1154 gene locus_tag LOCUS_10920 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106007160.1:PocR ligand-binding domain-containing protein 2629 1187 gene locus_tag LOCUS_10930 2629 1187 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941769.1 protein_id gnl|my_center|LOCUS_10930 3788 2622 gene locus_tag LOCUS_10940 3788 2622 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086606.1 protein_id gnl|my_center|LOCUS_10940 4199 4912 gene locus_tag LOCUS_10950 4199 4912 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089821.1 protein_id gnl|my_center|LOCUS_10950 5053 7101 gene locus_tag LOCUS_10960 gene nosZ 5053 7101 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_10960 7440 9365 gene locus_tag LOCUS_10970 gene nirS 7440 9365 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_10970 9550 10254 gene locus_tag LOCUS_10980 9550 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_10980 10365 12656 gene locus_tag LOCUS_10990 10365 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 12656 13486 gene locus_tag LOCUS_11000 12656 13486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 13483 13974 gene locus_tag LOCUS_11010 13483 13974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 14161 14889 gene locus_tag LOCUS_11020 14161 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 14946 15575 gene locus_tag LOCUS_11030 14946 15575 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence054 2934 154 gene locus_tag LOCUS_11040 gene acnA 2934 154 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_11040 3379 3945 gene locus_tag LOCUS_11050 3379 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4320 5069 gene locus_tag LOCUS_11060 4320 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 5090 5713 gene locus_tag LOCUS_11070 5090 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 5741 7165 gene locus_tag LOCUS_11080 gene pknB 5741 7165 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_11080 10297 7175 gene locus_tag LOCUS_11090 10297 7175 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394238.1 protein_id gnl|my_center|LOCUS_11090 11528 10941 gene locus_tag LOCUS_11100 11528 10941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 12984 11542 gene locus_tag LOCUS_11110 12984 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 13402 12995 gene locus_tag LOCUS_11120 13402 12995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 13881 13399 gene locus_tag LOCUS_11130 13881 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 14495 13917 gene locus_tag LOCUS_11140 14495 13917 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256468.1 protein_id gnl|my_center|LOCUS_11140 15097 14492 gene locus_tag LOCUS_11150 gene ycnK 15097 14492 CDS product copper uptake transcriptional regulator YcnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246724.1 protein_id gnl|my_center|LOCUS_11150 15362 15808 gene locus_tag LOCUS_11160 15362 15808 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence055 361 137 gene locus_tag LOCUS_11170 361 137 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811628.1 protein_id gnl|my_center|LOCUS_11170 1221 358 gene locus_tag LOCUS_11180 1221 358 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878705.1 protein_id gnl|my_center|LOCUS_11180 2791 1238 gene locus_tag LOCUS_11190 2791 1238 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250573.1 protein_id gnl|my_center|LOCUS_11190 3543 2788 gene locus_tag LOCUS_11200 3543 2788 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259458.1 protein_id gnl|my_center|LOCUS_11200 3939 3577 gene locus_tag LOCUS_11210 3939 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4282 3884 gene locus_tag LOCUS_11220 4282 3884 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257377.1 protein_id gnl|my_center|LOCUS_11220 5152 4385 gene locus_tag LOCUS_11230 5152 4385 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_11230 6610 5258 gene locus_tag LOCUS_11240 6610 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 7287 6607 gene locus_tag LOCUS_11250 7287 6607 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_11250 7605 7396 gene locus_tag LOCUS_11260 7605 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 9953 7602 gene locus_tag LOCUS_11270 9953 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 11188 9965 gene locus_tag LOCUS_11280 11188 9965 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256967.1 protein_id gnl|my_center|LOCUS_11280 12103 11309 gene locus_tag LOCUS_11290 12103 11309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_11290 13544 12171 gene locus_tag LOCUS_11300 13544 12171 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256969.1 protein_id gnl|my_center|LOCUS_11300 14704 13646 gene locus_tag LOCUS_11310 14704 13646 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391254.1 protein_id gnl|my_center|LOCUS_11310 15644 14727 gene locus_tag LOCUS_11320 15644 14727 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088705.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence056 1667 471 gene locus_tag LOCUS_11330 1667 471 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256134.1 protein_id gnl|my_center|LOCUS_11330 1999 3114 gene locus_tag LOCUS_11340 gene ald 1999 3114 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_11340 3533 4012 gene locus_tag LOCUS_11350 3533 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4015 4560 gene locus_tag LOCUS_11360 4015 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 4573 5850 gene locus_tag LOCUS_11370 4573 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 5978 7447 gene locus_tag LOCUS_11380 5978 7447 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_11380 8537 7506 gene locus_tag LOCUS_11390 gene gap 8537 7506 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_11390 10024 8642 gene locus_tag LOCUS_11400 10024 8642 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404619.1 protein_id gnl|my_center|LOCUS_11400 11432 10275 gene locus_tag LOCUS_11410 gene dnaN 11432 10275 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_11410 12497 11601 gene locus_tag LOCUS_11420 12497 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 13384 12515 gene locus_tag LOCUS_11430 13384 12515 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_11430 14250 13399 gene locus_tag LOCUS_11440 14250 13399 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 protein_id gnl|my_center|LOCUS_11440 15068 14226 gene locus_tag LOCUS_11450 15068 14226 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_11450 15541 15614 gene locus_tag LOCUS_t00090 15541 15614 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence057 675 1568 gene locus_tag LOCUS_11460 gene pdxS 675 1568 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_11460 1570 2181 gene locus_tag LOCUS_11470 gene pdxT 1570 2181 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_11470 2739 3872 gene locus_tag LOCUS_11480 gene ribD 2739 3872 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_11480 3865 4491 gene locus_tag LOCUS_11490 gene ribE 3865 4491 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258063.1 protein_id gnl|my_center|LOCUS_11490 4509 5735 gene locus_tag LOCUS_11500 4509 5735 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_11500 5787 6254 gene locus_tag LOCUS_11510 gene ribE 5787 6254 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_11510 7251 6259 gene locus_tag LOCUS_11520 7251 6259 CDS product fructose-bisphosphatase class II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257119.1 protein_id gnl|my_center|LOCUS_11520 7614 8507 gene locus_tag LOCUS_11530 7614 8507 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227788.1 protein_id gnl|my_center|LOCUS_11530 8634 9068 gene locus_tag LOCUS_11540 8634 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 9694 9131 gene locus_tag LOCUS_11550 9694 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 9918 10241 gene locus_tag LOCUS_11560 9918 10241 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986887.1 protein_id gnl|my_center|LOCUS_11560 10274 12640 gene locus_tag LOCUS_11570 10274 12640 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_11570 12851 14494 gene locus_tag LOCUS_11580 12851 14494 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660573.1 protein_id gnl|my_center|LOCUS_11580 15695 14508 gene locus_tag LOCUS_11590 15695 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence058 2050 194 gene locus_tag LOCUS_11600 2050 194 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544192.1 protein_id gnl|my_center|LOCUS_11600 4049 2112 gene locus_tag LOCUS_11610 4049 2112 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259450.1 protein_id gnl|my_center|LOCUS_11610 5619 4069 gene locus_tag LOCUS_11620 5619 4069 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522967.1 protein_id gnl|my_center|LOCUS_11620 6667 5636 gene locus_tag LOCUS_11630 gene holA 6667 5636 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258281.1 protein_id gnl|my_center|LOCUS_11630 7191 6664 gene locus_tag LOCUS_11640 7191 6664 CDS product DUF6391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 protein_id gnl|my_center|LOCUS_11640 7923 7258 gene locus_tag LOCUS_11650 gene fsa 7923 7258 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_11650 9526 7985 gene locus_tag LOCUS_11660 9526 7985 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_11660 9771 9523 gene locus_tag LOCUS_11670 9771 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 10266 9778 gene locus_tag LOCUS_11680 10266 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 11218 10334 gene locus_tag LOCUS_11690 11218 10334 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760477.1 protein_id gnl|my_center|LOCUS_11690 13426 11231 gene locus_tag LOCUS_11700 13426 11231 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_11700 13809 15380 gene locus_tag LOCUS_11710 gene pruA 13809 15380 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257665.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence059 <1 2106 gene locus_tag LOCUS_11720 <1 2106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989870.1:alpha-mannosidase 2599 2126 gene locus_tag LOCUS_11730 2599 2126 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135782.1 protein_id gnl|my_center|LOCUS_11730 3762 2596 gene locus_tag LOCUS_11740 3762 2596 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_11740 4022 5308 gene locus_tag LOCUS_11750 gene thiI 4022 5308 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173822.1 protein_id gnl|my_center|LOCUS_11750 5319 5810 gene locus_tag LOCUS_11760 5319 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5866 7329 gene locus_tag LOCUS_11770 5866 7329 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391571.1 protein_id gnl|my_center|LOCUS_11770 7277 7960 gene locus_tag LOCUS_11780 7277 7960 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_11780 8850 8080 gene locus_tag LOCUS_11790 8850 8080 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_11790 9418 8966 gene locus_tag LOCUS_11800 9418 8966 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228706.1 protein_id gnl|my_center|LOCUS_11800 12126 9502 gene locus_tag LOCUS_11810 gene clpB 12126 9502 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_11810 13006 12167 gene locus_tag LOCUS_11820 13006 12167 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228704.1 protein_id gnl|my_center|LOCUS_11820 13756 13058 gene locus_tag LOCUS_11830 13756 13058 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_11830 15212 13956 gene locus_tag LOCUS_11840 15212 13956 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255920.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence060 366 130 gene locus_tag LOCUS_11850 366 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3872 525 gene locus_tag LOCUS_11860 3872 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 4712 3942 gene locus_tag LOCUS_11870 4712 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 5532 5017 gene locus_tag LOCUS_11880 5532 5017 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258738.1 protein_id gnl|my_center|LOCUS_11880 6011 5655 gene locus_tag LOCUS_11890 6011 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 6424 6149 gene locus_tag LOCUS_11900 6424 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256207.1 protein_id gnl|my_center|LOCUS_11900 8409 6421 gene locus_tag LOCUS_11910 8409 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 8890 9114 gene locus_tag LOCUS_11920 8890 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 10124 9162 gene locus_tag LOCUS_11930 10124 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 11344 10136 gene locus_tag LOCUS_11940 11344 10136 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_11940 11536 11943 gene locus_tag LOCUS_11950 11536 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 11986 13200 gene locus_tag LOCUS_11960 gene rnd 11986 13200 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532283.1 protein_id gnl|my_center|LOCUS_11960 13400 13681 gene locus_tag LOCUS_11970 13400 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 13656 14126 gene locus_tag LOCUS_11980 13656 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 15343 14144 gene locus_tag LOCUS_11990 15343 14144 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence061 <1 3398 gene locus_tag LOCUS_12000 <1 3398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399688.1:DNA-directed RNA polymerase subunit beta' 3607 4659 gene locus_tag LOCUS_12010 3607 4659 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974786.1 protein_id gnl|my_center|LOCUS_12010 5286 4714 gene locus_tag LOCUS_12020 gene amrA 5286 4714 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081947.1 protein_id gnl|my_center|LOCUS_12020 6172 5273 gene locus_tag LOCUS_12030 6172 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 6580 6242 gene locus_tag LOCUS_12040 6580 6242 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_12040 6810 6577 gene locus_tag LOCUS_12050 6810 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 7247 6807 gene locus_tag LOCUS_12060 7247 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 9082 7367 gene locus_tag LOCUS_12070 gene recJ 9082 7367 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_12070 10463 9189 gene locus_tag LOCUS_12080 10463 9189 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_12080 11778 10564 gene locus_tag LOCUS_12090 gene trxB 11778 10564 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_12090 13138 11990 gene locus_tag LOCUS_12100 13138 11990 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_12100 14734 13475 gene locus_tag LOCUS_12110 gene fabF 14734 13475 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence062 <1 600 gene locus_tag LOCUS_12120 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000124001.1:ECF transporter S component 604 1395 gene locus_tag LOCUS_12130 604 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1407 3095 gene locus_tag LOCUS_12140 1407 3095 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_12140 3136 4023 gene locus_tag LOCUS_12150 3136 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4027 5058 gene locus_tag LOCUS_12160 4027 5058 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_12160 6191 5286 gene locus_tag LOCUS_12170 6191 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7967 6339 gene locus_tag LOCUS_12180 7967 6339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021751.1 protein_id gnl|my_center|LOCUS_12180 8347 9264 gene locus_tag LOCUS_12190 8347 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 9357 9968 gene locus_tag LOCUS_12200 gene tsf 9357 9968 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_12200 10082 10798 gene locus_tag LOCUS_12210 gene pyrH 10082 10798 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_12210 10862 11419 gene locus_tag LOCUS_12220 gene frr 10862 11419 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_12220 11670 12395 gene locus_tag LOCUS_12230 11670 12395 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027219.1 protein_id gnl|my_center|LOCUS_12230 12665 13312 gene locus_tag LOCUS_12240 12665 13312 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618925.1 protein_id gnl|my_center|LOCUS_12240 13359 13850 gene locus_tag LOCUS_12250 13359 13850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 13870 14865 gene locus_tag LOCUS_12260 13870 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence063 3324 775 gene locus_tag LOCUS_12270 3324 775 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258038.1 protein_id gnl|my_center|LOCUS_12270 5874 3340 gene locus_tag LOCUS_12280 5874 3340 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_12280 6232 5876 gene locus_tag LOCUS_12290 6232 5876 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_12290 6616 6293 gene locus_tag LOCUS_12300 6616 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258035.1 protein_id gnl|my_center|LOCUS_12300 7101 6616 gene locus_tag LOCUS_12310 7101 6616 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258034.1 protein_id gnl|my_center|LOCUS_12310 8234 7098 gene locus_tag LOCUS_12320 8234 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_12320 8527 8231 gene locus_tag LOCUS_12330 8527 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_12330 9171 8545 gene locus_tag LOCUS_12340 9171 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_12340 10862 9186 gene locus_tag LOCUS_12350 10862 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 11131 10859 gene locus_tag LOCUS_12360 11131 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 13140 11128 gene locus_tag LOCUS_12370 13140 11128 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095509668.1 protein_id gnl|my_center|LOCUS_12370 14498 13137 gene locus_tag LOCUS_12380 14498 13137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence064 <1 3125 gene locus_tag LOCUS_12390 <1 3125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227759.1:DNA polymerase III subunit alpha 3324 4325 gene locus_tag LOCUS_12400 gene pfkA 3324 4325 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082880.1 protein_id gnl|my_center|LOCUS_12400 4678 4439 gene locus_tag LOCUS_12410 gene acpP 4678 4439 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_12410 4923 5558 gene locus_tag LOCUS_12420 4923 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 5590 6747 gene locus_tag LOCUS_12430 5590 6747 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_12430 6858 7877 gene locus_tag LOCUS_12440 6858 7877 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_12440 7950 9221 gene locus_tag LOCUS_12450 gene fabF 7950 9221 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244890.1 protein_id gnl|my_center|LOCUS_12450 9252 9989 gene locus_tag LOCUS_12460 gene rnc 9252 9989 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257002.1 protein_id gnl|my_center|LOCUS_12460 9986 10846 gene locus_tag LOCUS_12470 9986 10846 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257001.1 protein_id gnl|my_center|LOCUS_12470 11964 10879 gene locus_tag LOCUS_12480 gene ychF 11964 10879 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_12480 12467 11961 gene locus_tag LOCUS_12490 12467 11961 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880613.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence065 684 1517 gene locus_tag LOCUS_12500 gene pheA 684 1517 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_12500 1574 2101 gene locus_tag LOCUS_12510 1574 2101 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_12510 2109 2930 gene locus_tag LOCUS_12520 2109 2930 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257732.1 protein_id gnl|my_center|LOCUS_12520 4131 2878 gene locus_tag LOCUS_12530 4131 2878 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887866.1 protein_id gnl|my_center|LOCUS_12530 5170 4193 gene locus_tag LOCUS_12540 5170 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 5558 5163 gene locus_tag LOCUS_12550 gene acpS 5558 5163 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882961.1 protein_id gnl|my_center|LOCUS_12550 6886 5591 gene locus_tag LOCUS_12560 6886 5591 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390721.1 protein_id gnl|my_center|LOCUS_12560 8212 6911 gene locus_tag LOCUS_12570 8212 6911 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421521.1 protein_id gnl|my_center|LOCUS_12570 9537 8215 gene locus_tag LOCUS_12580 9537 8215 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_12580 11031 9676 gene locus_tag LOCUS_12590 11031 9676 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_12590 12400 11396 gene locus_tag LOCUS_12600 12400 11396 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_12600 12792 13748 gene locus_tag LOCUS_12610 12792 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 <14490 13804 gene locus_tag LOCUS_12620 <14490 13804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256851.1:dynamin family protein >Feature sequence066 114 857 gene locus_tag LOCUS_12630 114 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1430 909 gene locus_tag LOCUS_12640 1430 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1575 2591 gene locus_tag LOCUS_12650 1575 2591 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_12650 2660 3319 gene locus_tag LOCUS_12660 2660 3319 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_12660 3316 3885 gene locus_tag LOCUS_12670 3316 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3931 5025 gene locus_tag LOCUS_12680 3931 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 7155 5176 gene locus_tag LOCUS_12690 7155 5176 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258923.1 protein_id gnl|my_center|LOCUS_12690 7831 7220 gene locus_tag LOCUS_12700 gene plsY 7831 7220 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 protein_id gnl|my_center|LOCUS_12700 9161 8055 gene locus_tag LOCUS_12710 9161 8055 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943657.1 protein_id gnl|my_center|LOCUS_12710 10677 9235 gene locus_tag LOCUS_12720 10677 9235 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_12720 12232 10775 gene locus_tag LOCUS_12730 12232 10775 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_12730 13821 12322 gene locus_tag LOCUS_12740 13821 12322 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_12740 14330 13929 gene locus_tag LOCUS_12750 14330 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence067 <1 520 gene locus_tag LOCUS_12760 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929061.1:Uma2 family endonuclease 564 1175 gene locus_tag LOCUS_12770 564 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1192 2421 gene locus_tag LOCUS_12780 1192 2421 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909096.1 protein_id gnl|my_center|LOCUS_12780 2469 4907 gene locus_tag LOCUS_12790 2469 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4904 6274 gene locus_tag LOCUS_12800 gene argH 4904 6274 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259187.1 protein_id gnl|my_center|LOCUS_12800 8131 6278 gene locus_tag LOCUS_12810 8131 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 11316 8299 gene locus_tag LOCUS_12820 11316 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 12332 11313 gene locus_tag LOCUS_12830 12332 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 12496 13044 gene locus_tag LOCUS_12840 gene sigW 12496 13044 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_12840 13037 13609 gene locus_tag LOCUS_12850 13037 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence068 2647 338 gene locus_tag LOCUS_12860 2647 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 5610 2695 gene locus_tag LOCUS_12870 5610 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 7867 5795 gene locus_tag LOCUS_12880 gene fusA 7867 5795 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258549.1 protein_id gnl|my_center|LOCUS_12880 8143 9141 gene locus_tag LOCUS_12890 8143 9141 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582579.1 protein_id gnl|my_center|LOCUS_12890 9271 10626 gene locus_tag LOCUS_12900 9271 10626 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258588.1 protein_id gnl|my_center|LOCUS_12900 10848 11960 gene locus_tag LOCUS_12910 10848 11960 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258587.1 protein_id gnl|my_center|LOCUS_12910 11957 12865 gene locus_tag LOCUS_12920 11957 12865 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence069 817 2727 gene locus_tag LOCUS_12930 gene gyrB 817 2727 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_12930 2993 3637 gene locus_tag LOCUS_12940 2993 3637 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_12940 5020 3638 gene locus_tag LOCUS_12950 gene mnmE 5020 3638 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_12950 5788 5030 gene locus_tag LOCUS_12960 5788 5030 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_12960 6766 5807 gene locus_tag LOCUS_12970 gene trxB 6766 5807 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_12970 7746 6976 gene locus_tag LOCUS_12980 7746 6976 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258918.1 protein_id gnl|my_center|LOCUS_12980 8628 7957 gene locus_tag LOCUS_12990 8628 7957 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_12990 9004 9432 gene locus_tag LOCUS_13000 9004 9432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 10539 9481 gene locus_tag LOCUS_13010 10539 9481 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_13010 11261 10536 gene locus_tag LOCUS_13020 11261 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 12355 11249 gene locus_tag LOCUS_13030 gene waaF 12355 11249 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_13030 13047 12352 gene locus_tag LOCUS_13040 13047 12352 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence070 2040 3290 gene locus_tag LOCUS_13050 2040 3290 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869553.1 protein_id gnl|my_center|LOCUS_13050 3577 3981 gene locus_tag LOCUS_13060 3577 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3986 5059 gene locus_tag LOCUS_13070 3986 5059 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_13070 5078 6907 gene locus_tag LOCUS_13080 5078 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 6911 7696 gene locus_tag LOCUS_13090 6911 7696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_13090 7693 8421 gene locus_tag LOCUS_13100 7693 8421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_13100 11907 8674 gene locus_tag LOCUS_13110 11907 8674 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259651.1 protein_id gnl|my_center|LOCUS_13110 12066 12215 gene locus_tag LOCUS_13120 12066 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 12504 13325 gene locus_tag LOCUS_13130 12504 13325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence071 1118 1792 gene locus_tag LOCUS_13140 1118 1792 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338483.1 protein_id gnl|my_center|LOCUS_13140 1792 2550 gene locus_tag LOCUS_13150 1792 2550 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_13150 2576 3646 gene locus_tag LOCUS_13160 2576 3646 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_13160 3726 4790 gene locus_tag LOCUS_13170 gene rfbB 3726 4790 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258175.1 protein_id gnl|my_center|LOCUS_13170 4957 5625 gene locus_tag LOCUS_13180 4957 5625 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257526.1 protein_id gnl|my_center|LOCUS_13180 5622 6173 gene locus_tag LOCUS_13190 5622 6173 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_13190 6196 7971 gene locus_tag LOCUS_13200 6196 7971 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140819.1 protein_id gnl|my_center|LOCUS_13200 8046 8717 gene locus_tag LOCUS_13210 8046 8717 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_13210 10263 8731 gene locus_tag LOCUS_13220 gene malQ 10263 8731 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_13220 12278 10638 gene locus_tag LOCUS_13230 12278 10638 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932359.1 protein_id gnl|my_center|LOCUS_13230 12988 12539 gene locus_tag LOCUS_13240 12988 12539 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228403.1 protein_id gnl|my_center|LOCUS_13240 13316 12954 gene locus_tag LOCUS_13250 13316 12954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence072 459 4 gene locus_tag LOCUS_13260 459 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2410 548 gene locus_tag LOCUS_13270 2410 548 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_13270 2679 3956 gene locus_tag LOCUS_13280 2679 3956 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_13280 4084 5091 gene locus_tag LOCUS_13290 4084 5091 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545765.1 protein_id gnl|my_center|LOCUS_13290 6126 5092 gene locus_tag LOCUS_13300 6126 5092 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_13300 6714 6142 gene locus_tag LOCUS_13310 gene ruvA 6714 6142 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460360.1 protein_id gnl|my_center|LOCUS_13310 8260 6716 gene locus_tag LOCUS_13320 8260 6716 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_13320 9387 8257 gene locus_tag LOCUS_13330 9387 8257 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_13330 9752 9438 gene locus_tag LOCUS_13340 9752 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 10789 9869 gene locus_tag LOCUS_13350 10789 9869 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_13350 11469 10846 gene locus_tag LOCUS_13360 11469 10846 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174021.1 protein_id gnl|my_center|LOCUS_13360 11676 12650 gene locus_tag LOCUS_13370 11676 12650 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256099.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence073 810 475 gene locus_tag LOCUS_13380 810 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1789 992 gene locus_tag LOCUS_13390 1789 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 2517 1786 gene locus_tag LOCUS_13400 2517 1786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_13400 4145 2529 gene locus_tag LOCUS_13410 4145 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 5071 4145 gene locus_tag LOCUS_13420 5071 4145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403518.1 protein_id gnl|my_center|LOCUS_13420 6055 5222 gene locus_tag LOCUS_13430 6055 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 7237 6263 gene locus_tag LOCUS_13440 7237 6263 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837553.1 protein_id gnl|my_center|LOCUS_13440 7611 7234 gene locus_tag LOCUS_13450 7611 7234 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228286.1 protein_id gnl|my_center|LOCUS_13450 7880 9406 gene locus_tag LOCUS_13460 7880 9406 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_13460 10136 9429 gene locus_tag LOCUS_13470 10136 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 10293 10871 gene locus_tag LOCUS_13480 10293 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 11261 10875 gene locus_tag LOCUS_13490 11261 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 12212 11277 gene locus_tag LOCUS_13500 12212 11277 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_13500 13160 12240 gene locus_tag LOCUS_13510 13160 12240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence074 1561 1965 gene locus_tag LOCUS_13520 1561 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2940 2140 gene locus_tag LOCUS_13530 2940 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 3638 2949 gene locus_tag LOCUS_13540 3638 2949 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_13540 3991 4401 gene locus_tag LOCUS_13550 3991 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 5049 4402 gene locus_tag LOCUS_13560 gene tmk 5049 4402 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_13560 6935 5349 gene locus_tag LOCUS_13570 6935 5349 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583152.1 protein_id gnl|my_center|LOCUS_13570 8020 6941 gene locus_tag LOCUS_13580 8020 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 8779 8204 gene locus_tag LOCUS_13590 8779 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 9117 8776 gene locus_tag LOCUS_13600 9117 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 9355 9834 gene locus_tag LOCUS_13610 9355 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 9831 10610 gene locus_tag LOCUS_13620 9831 10610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966824.1 protein_id gnl|my_center|LOCUS_13620 10597 13254 gene locus_tag LOCUS_13630 10597 13254 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence075 486 1277 gene locus_tag LOCUS_13640 gene pgeF 486 1277 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839662.1 protein_id gnl|my_center|LOCUS_13640 4046 1296 gene locus_tag LOCUS_13650 4046 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 4881 4171 gene locus_tag LOCUS_13660 4881 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 7947 4996 gene locus_tag LOCUS_13670 7947 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 8571 9629 gene locus_tag LOCUS_13680 8571 9629 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256144.1 protein_id gnl|my_center|LOCUS_13680 9659 10822 gene locus_tag LOCUS_13690 9659 10822 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_13690 10835 11233 gene locus_tag LOCUS_13700 10835 11233 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_13700 11830 11288 gene locus_tag LOCUS_13710 11830 11288 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_13710 12483 11839 gene locus_tag LOCUS_13720 12483 11839 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_13720 12631 12977 gene locus_tag LOCUS_tm00010 12631 12977 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence076 2163 2846 gene locus_tag LOCUS_13730 2163 2846 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_13730 2936 4549 gene locus_tag LOCUS_13740 gene pckA 2936 4549 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_13740 4684 6003 gene locus_tag LOCUS_13750 4684 6003 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_13750 6020 6805 gene locus_tag LOCUS_13760 6020 6805 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_13760 6896 6968 gene locus_tag LOCUS_t00100 6896 6968 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7203 7964 gene locus_tag LOCUS_13770 7203 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 8025 8456 gene locus_tag LOCUS_13780 8025 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 8654 9793 gene locus_tag LOCUS_13790 8654 9793 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257163.1 protein_id gnl|my_center|LOCUS_13790 11197 9902 gene locus_tag LOCUS_13800 gene eno 11197 9902 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_13800 11338 11790 gene locus_tag LOCUS_13810 gene dtd 11338 11790 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_13810 12832 11819 gene locus_tag LOCUS_13820 12832 11819 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_13820 13251 13099 gene locus_tag LOCUS_13830 13251 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence077 701 312 gene locus_tag LOCUS_13840 gene sdhC 701 312 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173507.1 protein_id gnl|my_center|LOCUS_13840 854 1003 gene locus_tag LOCUS_13850 854 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13850 1004 2749 gene locus_tag LOCUS_13860 1004 2749 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_13860 2777 4063 gene locus_tag LOCUS_13870 gene hemL 2777 4063 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_13870 4232 4489 gene locus_tag LOCUS_13880 4232 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 4486 4986 gene locus_tag LOCUS_13890 4486 4986 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_13890 5150 5839 gene locus_tag LOCUS_13900 5150 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 6316 5906 gene locus_tag LOCUS_13910 6316 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 6488 7087 gene locus_tag LOCUS_13920 6488 7087 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258339.1 protein_id gnl|my_center|LOCUS_13920 7709 7095 gene locus_tag LOCUS_13930 7709 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 8411 7722 gene locus_tag LOCUS_13940 8411 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10195 8408 gene locus_tag LOCUS_13950 10195 8408 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257484.1 protein_id gnl|my_center|LOCUS_13950 10739 11077 gene locus_tag LOCUS_13960 10739 11077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 11070 11570 gene locus_tag LOCUS_13970 11070 11570 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_13970 11579 12937 gene locus_tag LOCUS_13980 gene ssnA 11579 12937 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence078 737 664 gene locus_tag LOCUS_t00110 737 664 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1022 1861 gene locus_tag LOCUS_13990 1022 1861 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259513.1 protein_id gnl|my_center|LOCUS_13990 1854 2303 gene locus_tag LOCUS_14000 1854 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2396 3166 gene locus_tag LOCUS_14010 2396 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3226 4218 gene locus_tag LOCUS_14020 3226 4218 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_14020 4229 4963 gene locus_tag LOCUS_14030 4229 4963 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_14030 5013 5795 gene locus_tag LOCUS_14040 5013 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 5816 7759 gene locus_tag LOCUS_14050 5816 7759 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258668.1 protein_id gnl|my_center|LOCUS_14050 8358 7969 gene locus_tag LOCUS_14060 8358 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 8561 9811 gene locus_tag LOCUS_14070 8561 9811 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256145.1 protein_id gnl|my_center|LOCUS_14070 9911 10483 gene locus_tag LOCUS_14080 9911 10483 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_14080 10683 11459 gene locus_tag LOCUS_14090 gene modA 10683 11459 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258350.1 protein_id gnl|my_center|LOCUS_14090 11456 12097 gene locus_tag LOCUS_14100 gene modB 11456 12097 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258351.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence079 927 562 gene locus_tag LOCUS_14110 927 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1721 945 gene locus_tag LOCUS_14120 1721 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258540.1 protein_id gnl|my_center|LOCUS_14120 2802 1696 gene locus_tag LOCUS_14130 2802 1696 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256149.1 protein_id gnl|my_center|LOCUS_14130 4313 2817 gene locus_tag LOCUS_14140 4313 2817 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065546.1 protein_id gnl|my_center|LOCUS_14140 4665 7163 gene locus_tag LOCUS_14150 4665 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 9912 7129 gene locus_tag LOCUS_14160 9912 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 12054 9934 gene locus_tag LOCUS_14170 12054 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 <13100 12051 gene locus_tag LOCUS_14180 <13100 12051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942440.1:DHHA1 domain-containing protein >Feature sequence080 567 295 gene locus_tag LOCUS_14190 567 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 869 573 gene locus_tag LOCUS_14200 gene gatC 869 573 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461445.1 protein_id gnl|my_center|LOCUS_14200 1101 2831 gene locus_tag LOCUS_14210 1101 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3010 4089 gene locus_tag LOCUS_14220 3010 4089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 protein_id gnl|my_center|LOCUS_14220 4093 5028 gene locus_tag LOCUS_14230 4093 5028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_14230 5042 6088 gene locus_tag LOCUS_14240 5042 6088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 protein_id gnl|my_center|LOCUS_14240 6085 7122 gene locus_tag LOCUS_14250 6085 7122 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_14250 7550 9259 gene locus_tag LOCUS_14260 gene ilvB 7550 9259 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393739.1 protein_id gnl|my_center|LOCUS_14260 9256 9777 gene locus_tag LOCUS_14270 gene ilvN 9256 9777 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_14270 9826 10830 gene locus_tag LOCUS_14280 gene ilvC 9826 10830 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256075.1 protein_id gnl|my_center|LOCUS_14280 10835 11956 gene locus_tag LOCUS_14290 10835 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence081 442 1596 gene locus_tag LOCUS_14300 gene queG 442 1596 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227970.1 protein_id gnl|my_center|LOCUS_14300 1728 3140 gene locus_tag LOCUS_14310 1728 3140 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_14310 3195 3713 gene locus_tag LOCUS_14320 3195 3713 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938916.1 protein_id gnl|my_center|LOCUS_14320 3854 5299 gene locus_tag LOCUS_14330 3854 5299 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167861.1 protein_id gnl|my_center|LOCUS_14330 5315 5569 gene locus_tag LOCUS_14340 5315 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 5572 6936 gene locus_tag LOCUS_14350 5572 6936 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_14350 7081 8922 gene locus_tag LOCUS_14360 7081 8922 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013724.1 protein_id gnl|my_center|LOCUS_14360 9062 10156 gene locus_tag LOCUS_14370 9062 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14370 10180 10896 gene locus_tag LOCUS_14380 10180 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 10878 11399 gene locus_tag LOCUS_14390 10878 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 11414 11983 gene locus_tag LOCUS_14400 11414 11983 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706171.1 protein_id gnl|my_center|LOCUS_14400 12028 12483 gene locus_tag LOCUS_14410 12028 12483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 12471 12878 gene locus_tag LOCUS_14420 12471 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence082 <1 593 gene locus_tag LOCUS_14430 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393499.1:molybdenum cofactor cytidylyltransferase 1904 696 gene locus_tag LOCUS_14440 1904 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3011 1995 gene locus_tag LOCUS_14450 gene ltaE 3011 1995 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_14450 3558 3034 gene locus_tag LOCUS_14460 3558 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 4560 3655 gene locus_tag LOCUS_14470 4560 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4575 4778 gene locus_tag LOCUS_14480 4575 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5125 6447 gene locus_tag LOCUS_14490 5125 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 6511 9417 gene locus_tag LOCUS_14500 6511 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 9753 11219 gene locus_tag LOCUS_14510 9753 11219 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_14510 11249 11842 gene locus_tag LOCUS_14520 11249 11842 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257866.1 protein_id gnl|my_center|LOCUS_14520 11876 11958 gene locus_tag LOCUS_t00120 11876 11958 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12061 12744 gene locus_tag LOCUS_14530 12061 12744 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence083 627 133 gene locus_tag LOCUS_14540 627 133 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903704.1 protein_id gnl|my_center|LOCUS_14540 1815 640 gene locus_tag LOCUS_14550 1815 640 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064994.1 protein_id gnl|my_center|LOCUS_14550 3221 1962 gene locus_tag LOCUS_14560 3221 1962 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949164.1 protein_id gnl|my_center|LOCUS_14560 4342 3332 gene locus_tag LOCUS_14570 4342 3332 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_14570 5359 4364 gene locus_tag LOCUS_14580 gene pdhA 5359 4364 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_14580 6494 5484 gene locus_tag LOCUS_14590 6494 5484 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 protein_id gnl|my_center|LOCUS_14590 7338 6466 gene locus_tag LOCUS_14600 7338 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 7693 8445 gene locus_tag LOCUS_14610 gene recO 7693 8445 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_14610 8467 8889 gene locus_tag LOCUS_14620 8467 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 8912 11902 gene locus_tag LOCUS_14630 8912 11902 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725349.1 protein_id gnl|my_center|LOCUS_14630 12676 11918 gene locus_tag LOCUS_14640 gene lexA 12676 11918 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256381.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence084 155 907 gene locus_tag LOCUS_14650 155 907 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393206.1 protein_id gnl|my_center|LOCUS_14650 904 1380 gene locus_tag LOCUS_14660 gene ruvC 904 1380 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_14660 2341 1349 gene locus_tag LOCUS_14670 2341 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2524 3651 gene locus_tag LOCUS_14680 2524 3651 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258205.1 protein_id gnl|my_center|LOCUS_14680 3667 4575 gene locus_tag LOCUS_14690 3667 4575 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_14690 4638 5255 gene locus_tag LOCUS_14700 4638 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 5426 6475 gene locus_tag LOCUS_14710 gene thrC 5426 6475 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392819.1 protein_id gnl|my_center|LOCUS_14710 6489 7919 gene locus_tag LOCUS_14720 6489 7919 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257833.1 protein_id gnl|my_center|LOCUS_14720 7926 9002 gene locus_tag LOCUS_14730 7926 9002 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259177.1 protein_id gnl|my_center|LOCUS_14730 9301 9558 gene locus_tag LOCUS_14740 9301 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 9570 9998 gene locus_tag LOCUS_14750 9570 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 10149 10496 gene locus_tag LOCUS_14760 10149 10496 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_14760 10530 11261 gene locus_tag LOCUS_14770 10530 11261 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_14770 11334 12863 gene locus_tag LOCUS_14780 11334 12863 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence085 1458 469 gene locus_tag LOCUS_14790 1458 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 2686 1805 gene locus_tag LOCUS_14800 2686 1805 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_14800 3568 2882 gene locus_tag LOCUS_14810 3568 2882 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_14810 4008 4769 gene locus_tag LOCUS_14820 4008 4769 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_14820 4772 8974 gene locus_tag LOCUS_14830 4772 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 9116 9514 gene locus_tag LOCUS_14840 9116 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228220.1 protein_id gnl|my_center|LOCUS_14840 9573 11303 gene locus_tag LOCUS_14850 9573 11303 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228219.1 protein_id gnl|my_center|LOCUS_14850 11339 11539 gene locus_tag LOCUS_14860 11339 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence086 2875 1406 gene locus_tag LOCUS_14870 2875 1406 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946542.1 protein_id gnl|my_center|LOCUS_14870 3877 3077 gene locus_tag LOCUS_14880 3877 3077 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256663.1 protein_id gnl|my_center|LOCUS_14880 4227 3874 gene locus_tag LOCUS_14890 4227 3874 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088407.1 protein_id gnl|my_center|LOCUS_14890 5416 4220 gene locus_tag LOCUS_14900 5416 4220 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_14900 6094 5423 gene locus_tag LOCUS_14910 6094 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255961.1 protein_id gnl|my_center|LOCUS_14910 7008 6091 gene locus_tag LOCUS_14920 7008 6091 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_14920 8220 7048 gene locus_tag LOCUS_14930 8220 7048 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022198.1 protein_id gnl|my_center|LOCUS_14930 8504 10216 gene locus_tag LOCUS_14940 8504 10216 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945404.1 protein_id gnl|my_center|LOCUS_14940 10687 11880 gene locus_tag LOCUS_14950 gene rpoD 10687 11880 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258920.1 protein_id gnl|my_center|LOCUS_14950 12429 11959 gene locus_tag LOCUS_14960 12429 11959 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403485.1 protein_id gnl|my_center|LOCUS_14960 12724 12560 gene locus_tag LOCUS_14970 12724 12560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence087 1937 987 gene locus_tag LOCUS_14980 1937 987 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_14980 3228 2008 gene locus_tag LOCUS_14990 gene coaBC 3228 2008 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_14990 4221 3340 gene locus_tag LOCUS_15000 4221 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 6154 4223 gene locus_tag LOCUS_15010 6154 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 7632 6310 gene locus_tag LOCUS_15020 7632 6310 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_15020 9090 7855 gene locus_tag LOCUS_15030 9090 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 9600 10265 gene locus_tag LOCUS_15040 9600 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 10249 11901 gene locus_tag LOCUS_15050 10249 11901 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256598.1 protein_id gnl|my_center|LOCUS_15050 11945 12496 gene locus_tag LOCUS_15060 11945 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence088 1131 91 gene locus_tag LOCUS_15070 1131 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 4729 1760 gene locus_tag LOCUS_15080 4729 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 5190 6761 gene locus_tag LOCUS_15090 5190 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 6799 8091 gene locus_tag LOCUS_15100 6799 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 8179 8991 gene locus_tag LOCUS_15110 8179 8991 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258574.1 protein_id gnl|my_center|LOCUS_15110 8988 10835 gene locus_tag LOCUS_15120 8988 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 10877 11392 gene locus_tag LOCUS_15130 10877 11392 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256182.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence089 2937 1213 gene locus_tag LOCUS_15140 2937 1213 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932359.1 protein_id gnl|my_center|LOCUS_15140 4189 3062 gene locus_tag LOCUS_15150 gene alr 4189 3062 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_15150 5194 4208 gene locus_tag LOCUS_15160 5194 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 5436 5209 gene locus_tag LOCUS_15170 5436 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 5847 6533 gene locus_tag LOCUS_15180 5847 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 6530 7579 gene locus_tag LOCUS_15190 6530 7579 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_15190 7650 9434 gene locus_tag LOCUS_15200 7650 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 10409 9450 gene locus_tag LOCUS_15210 10409 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 11176 10406 gene locus_tag LOCUS_15220 11176 10406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 11657 11277 gene locus_tag LOCUS_15230 11657 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 12400 11687 gene locus_tag LOCUS_15240 12400 11687 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909121.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence090 17 481 gene locus_tag LOCUS_15250 17 481 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880795.1 protein_id gnl|my_center|LOCUS_15250 494 1543 gene locus_tag LOCUS_15260 494 1543 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902811.1 protein_id gnl|my_center|LOCUS_15260 1568 2593 gene locus_tag LOCUS_15270 1568 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 4901 2694 gene locus_tag LOCUS_15280 4901 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 5036 6274 gene locus_tag LOCUS_15290 5036 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 6747 7244 gene locus_tag LOCUS_15300 6747 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 7531 8943 gene locus_tag LOCUS_15310 7531 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 9280 9825 gene locus_tag LOCUS_15320 9280 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 10141 10929 gene locus_tag LOCUS_15330 10141 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 11050 11772 gene locus_tag LOCUS_15340 11050 11772 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence091 1194 2903 gene locus_tag LOCUS_15350 1194 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 3402 4484 gene locus_tag LOCUS_15360 gene hrcA 3402 4484 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_15360 4481 5122 gene locus_tag LOCUS_15370 gene grpE 4481 5122 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257941.1 protein_id gnl|my_center|LOCUS_15370 5385 7220 gene locus_tag LOCUS_15380 gene dnaK 5385 7220 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257940.1 protein_id gnl|my_center|LOCUS_15380 7271 8392 gene locus_tag LOCUS_15390 gene dnaJ 7271 8392 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_15390 8438 9388 gene locus_tag LOCUS_15400 8438 9388 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_15400 9394 10164 gene locus_tag LOCUS_15410 9394 10164 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257708.1 protein_id gnl|my_center|LOCUS_15410 10321 10227 gene locus_tag LOCUS_t00130 10321 10227 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10423 10338 gene locus_tag LOCUS_t00140 10423 10338 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11837 10500 gene locus_tag LOCUS_15420 11837 10500 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence092 1007 105 gene locus_tag LOCUS_15430 1007 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1747 1043 gene locus_tag LOCUS_15440 1747 1043 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320694.1 protein_id gnl|my_center|LOCUS_15440 4658 1815 gene locus_tag LOCUS_15450 4658 1815 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879871.1 protein_id gnl|my_center|LOCUS_15450 5007 4738 gene locus_tag LOCUS_15460 5007 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 5930 5064 gene locus_tag LOCUS_15470 5930 5064 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_15470 6742 5933 gene locus_tag LOCUS_15480 6742 5933 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_15480 8084 6783 gene locus_tag LOCUS_15490 gene fldB 8084 6783 CDS product phenyllactyl-CoA dehydratase subunit FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048237.1 protein_id gnl|my_center|LOCUS_15490 9305 8130 gene locus_tag LOCUS_15500 gene hadC 9305 8130 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_15500 10094 9327 gene locus_tag LOCUS_15510 10094 9327 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847037.1 protein_id gnl|my_center|LOCUS_15510 11161 10265 gene locus_tag LOCUS_15520 11161 10265 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_15520 11559 12074 gene locus_tag LOCUS_15530 11559 12074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence093 380 33 gene locus_tag LOCUS_15540 380 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 334 2829 gene locus_tag LOCUS_15550 334 2829 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_15550 2940 3182 gene locus_tag LOCUS_15560 2940 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3203 7681 gene locus_tag LOCUS_15570 3203 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 7678 10098 gene locus_tag LOCUS_15580 7678 10098 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141612405.1 protein_id gnl|my_center|LOCUS_15580 10113 11915 gene locus_tag LOCUS_15590 10113 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence094 328 1440 gene locus_tag LOCUS_15600 328 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1444 3291 gene locus_tag LOCUS_15610 1444 3291 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256698.1 protein_id gnl|my_center|LOCUS_15610 3288 4550 gene locus_tag LOCUS_15620 3288 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15620 4522 4899 gene locus_tag LOCUS_15630 4522 4899 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_15630 4954 5928 gene locus_tag LOCUS_15640 4954 5928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257461.1 protein_id gnl|my_center|LOCUS_15640 5925 6413 gene locus_tag LOCUS_15650 5925 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 6410 7945 gene locus_tag LOCUS_15660 6410 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 7945 8709 gene locus_tag LOCUS_15670 7945 8709 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421595.1 protein_id gnl|my_center|LOCUS_15670 9046 8834 gene locus_tag LOCUS_15680 9046 8834 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140566.1 protein_id gnl|my_center|LOCUS_15680 9243 9043 gene locus_tag LOCUS_15690 9243 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 10382 9519 gene locus_tag LOCUS_15700 10382 9519 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_15700 10917 10705 gene locus_tag LOCUS_15710 10917 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 11231 10905 gene locus_tag LOCUS_15720 11231 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083794109.1 protein_id gnl|my_center|LOCUS_15720 11876 11388 gene locus_tag LOCUS_15730 11876 11388 CDS product DUF2321 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965246.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence095 1822 230 gene locus_tag LOCUS_15740 1822 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3420 1819 gene locus_tag LOCUS_15750 3420 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 4919 3417 gene locus_tag LOCUS_15760 4919 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 6997 4934 gene locus_tag LOCUS_15770 6997 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 8268 6994 gene locus_tag LOCUS_15780 8268 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 8827 8288 gene locus_tag LOCUS_15790 8827 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 9189 10202 gene locus_tag LOCUS_15800 9189 10202 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177617.1 protein_id gnl|my_center|LOCUS_15800 10635 11135 gene locus_tag LOCUS_15810 10635 11135 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634034.1 protein_id gnl|my_center|LOCUS_15810 <12043 11234 gene locus_tag LOCUS_15820 <12043 11234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256515.1:glycerate kinase >Feature sequence096 421 140 gene locus_tag LOCUS_15830 421 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 796 473 gene locus_tag LOCUS_15840 796 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1431 3056 gene locus_tag LOCUS_15850 1431 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 3245 4261 gene locus_tag LOCUS_15860 3245 4261 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530800.1 protein_id gnl|my_center|LOCUS_15860 4383 5795 gene locus_tag LOCUS_15870 4383 5795 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065231.1 protein_id gnl|my_center|LOCUS_15870 5922 6776 gene locus_tag LOCUS_15880 5922 6776 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228343.1 protein_id gnl|my_center|LOCUS_15880 6773 7585 gene locus_tag LOCUS_15890 6773 7585 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228342.1 protein_id gnl|my_center|LOCUS_15890 7623 8726 gene locus_tag LOCUS_15900 7623 8726 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 protein_id gnl|my_center|LOCUS_15900 8716 9756 gene locus_tag LOCUS_15910 8716 9756 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868853.1 protein_id gnl|my_center|LOCUS_15910 9753 10796 gene locus_tag LOCUS_15920 9753 10796 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868854.1 protein_id gnl|my_center|LOCUS_15920 11043 10765 gene locus_tag LOCUS_15930 11043 10765 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392380.1 protein_id gnl|my_center|LOCUS_15930 11846 11130 gene locus_tag LOCUS_15940 11846 11130 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence097 89 1264 gene locus_tag LOCUS_15950 89 1264 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036700.1 protein_id gnl|my_center|LOCUS_15950 1257 1847 gene locus_tag LOCUS_15960 1257 1847 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256008.1 protein_id gnl|my_center|LOCUS_15960 1844 3394 gene locus_tag LOCUS_15970 1844 3394 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_15970 3792 5048 gene locus_tag LOCUS_15980 3792 5048 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390742.1 protein_id gnl|my_center|LOCUS_15980 5059 6492 gene locus_tag LOCUS_15990 5059 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390741.1 protein_id gnl|my_center|LOCUS_15990 6512 8005 gene locus_tag LOCUS_16000 gene accC 6512 8005 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790279.1 protein_id gnl|my_center|LOCUS_16000 8002 8526 gene locus_tag LOCUS_16010 8002 8526 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_16010 8803 10053 gene locus_tag LOCUS_16020 8803 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 11654 10080 gene locus_tag LOCUS_16030 gene serA 11654 10080 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256188.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence098 <1 1194 gene locus_tag LOCUS_16040 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545124.1:DNA methyltransferase C1 1324 2067 gene locus_tag LOCUS_16050 1324 2067 CDS product NgoMIV family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951140.1 protein_id gnl|my_center|LOCUS_16050 2079 5165 gene locus_tag LOCUS_16060 2079 5165 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909245.1 protein_id gnl|my_center|LOCUS_16060 5605 9165 gene locus_tag LOCUS_16070 5605 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence099 956 24 gene locus_tag LOCUS_16080 956 24 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868767.1 protein_id gnl|my_center|LOCUS_16080 2689 968 gene locus_tag LOCUS_16090 2689 968 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_16090 3647 3024 gene locus_tag LOCUS_16100 gene sodA 3647 3024 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_16100 3855 3779 gene locus_tag LOCUS_t00150 3855 3779 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3936 3863 gene locus_tag LOCUS_t00160 3936 3863 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4035 3961 gene locus_tag LOCUS_t00170 4035 3961 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4112 4036 gene locus_tag LOCUS_t00180 4112 4036 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4219 4145 gene locus_tag LOCUS_t00190 4219 4145 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4807 4733 gene locus_tag LOCUS_t00200 4807 4733 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5273 5764 gene locus_tag LOCUS_16110 5273 5764 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_16110 5800 7812 gene locus_tag LOCUS_16120 5800 7812 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 protein_id gnl|my_center|LOCUS_16120 7825 8292 gene locus_tag LOCUS_16130 7825 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 8270 8989 gene locus_tag LOCUS_16140 8270 8989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_16140 8986 9663 gene locus_tag LOCUS_16150 8986 9663 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_16150 9793 10377 gene locus_tag LOCUS_16160 9793 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 10403 11347 gene locus_tag LOCUS_16170 10403 11347 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259441.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence100 121 1158 gene locus_tag LOCUS_16180 121 1158 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257043.1 protein_id gnl|my_center|LOCUS_16180 1178 3511 gene locus_tag LOCUS_16190 1178 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3648 4973 gene locus_tag LOCUS_16200 gene malE 3648 4973 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080109.1 protein_id gnl|my_center|LOCUS_16200 5073 6437 gene locus_tag LOCUS_16210 5073 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 6434 7366 gene locus_tag LOCUS_16220 gene malD 6434 7366 CDS product maltosaccharide ABC transporter permease MalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022608.1 protein_id gnl|my_center|LOCUS_16220 7408 10536 gene locus_tag LOCUS_16230 7408 10536 CDS product glucodextranase DOMON-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583045.1 protein_id gnl|my_center|LOCUS_16230 10829 11089 gene locus_tag LOCUS_16240 10829 11089 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_16240 11073 11561 gene locus_tag LOCUS_16250 11073 11561 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence101 1886 933 gene locus_tag LOCUS_16260 1886 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2229 1837 gene locus_tag LOCUS_16270 gene speD 2229 1837 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081137.1 protein_id gnl|my_center|LOCUS_16270 3482 2559 gene locus_tag LOCUS_16280 3482 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 4072 5607 gene locus_tag LOCUS_16290 4072 5607 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_16290 5670 8504 gene locus_tag LOCUS_16300 5670 8504 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_16300 8877 8593 gene locus_tag LOCUS_16310 8877 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 9315 10184 gene locus_tag LOCUS_16320 gene mtnP 9315 10184 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259453.1 protein_id gnl|my_center|LOCUS_16320 10196 11473 gene locus_tag LOCUS_16330 10196 11473 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392427.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence102 670 431 gene locus_tag LOCUS_16340 670 431 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_16340 1073 1399 gene locus_tag LOCUS_16350 1073 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2423 1461 gene locus_tag LOCUS_16360 2423 1461 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258060.1 protein_id gnl|my_center|LOCUS_16360 2912 2427 gene locus_tag LOCUS_16370 2912 2427 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_16370 3558 2935 gene locus_tag LOCUS_16380 gene thpR 3558 2935 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_16380 4397 3633 gene locus_tag LOCUS_16390 4397 3633 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_16390 6048 4543 gene locus_tag LOCUS_16400 6048 4543 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256402.1 protein_id gnl|my_center|LOCUS_16400 8612 6045 gene locus_tag LOCUS_16410 8612 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 9025 9669 gene locus_tag LOCUS_16420 9025 9669 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226486.1 protein_id gnl|my_center|LOCUS_16420 9860 10621 gene locus_tag LOCUS_16430 9860 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 10646 10930 gene locus_tag LOCUS_16440 10646 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 10964 11113 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctcataggtaggctacaa >Feature sequence103 99 1244 gene locus_tag LOCUS_16450 99 1244 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_16450 2453 1254 gene locus_tag LOCUS_16460 2453 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 3782 2685 gene locus_tag LOCUS_16470 3782 2685 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259193.1 protein_id gnl|my_center|LOCUS_16470 4373 3795 gene locus_tag LOCUS_16480 4373 3795 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_16480 5219 4389 gene locus_tag LOCUS_16490 5219 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 6610 5153 gene locus_tag LOCUS_16500 6610 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 7271 6651 gene locus_tag LOCUS_16510 7271 6651 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173701.1 protein_id gnl|my_center|LOCUS_16510 7607 8848 gene locus_tag LOCUS_16520 7607 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256254.1 protein_id gnl|my_center|LOCUS_16520 8872 10569 gene locus_tag LOCUS_16530 8872 10569 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_16530 10592 11131 gene locus_tag LOCUS_16540 10592 11131 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258700.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence104 159 1172 gene locus_tag LOCUS_16550 159 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16550 3993 1177 gene locus_tag LOCUS_16560 3993 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 6253 5477 gene locus_tag LOCUS_16570 6253 5477 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081476.1 protein_id gnl|my_center|LOCUS_16570 7035 6166 gene locus_tag LOCUS_16580 7035 6166 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_16580 7730 7032 gene locus_tag LOCUS_16590 gene nfi 7730 7032 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_16590 8868 7837 gene locus_tag LOCUS_16600 8868 7837 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310475.1 protein_id gnl|my_center|LOCUS_16600 9200 10306 gene locus_tag LOCUS_16610 9200 10306 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence105 <1 729 gene locus_tag LOCUS_16620 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258422.1:cobyrinate a,c-diamide synthase 752 2278 gene locus_tag LOCUS_16630 752 2278 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258419.1 protein_id gnl|my_center|LOCUS_16630 2400 2957 gene locus_tag LOCUS_16640 gene cobU 2400 2957 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198615.1 protein_id gnl|my_center|LOCUS_16640 3032 3814 gene locus_tag LOCUS_16650 3032 3814 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_16650 4214 3798 gene locus_tag LOCUS_16660 4214 3798 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393269.1 protein_id gnl|my_center|LOCUS_16660 4474 4214 gene locus_tag LOCUS_16670 4474 4214 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283442.1 protein_id gnl|my_center|LOCUS_16670 4625 5680 gene locus_tag LOCUS_16680 gene cobT 4625 5680 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 protein_id gnl|my_center|LOCUS_16680 5845 6603 gene locus_tag LOCUS_16690 5845 6603 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 protein_id gnl|my_center|LOCUS_16690 6736 7524 gene locus_tag LOCUS_16700 gene cas6 6736 7524 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_16700 7572 9320 gene locus_tag LOCUS_16710 7572 9320 CDS product TIGR02556 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582997.1 protein_id gnl|my_center|LOCUS_16710 9317 10237 gene locus_tag LOCUS_16720 gene cas7b 9317 10237 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence106 1743 685 gene locus_tag LOCUS_16730 1743 685 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_16730 3299 1764 gene locus_tag LOCUS_16740 3299 1764 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_16740 4149 3334 gene locus_tag LOCUS_16750 gene pcaD 4149 3334 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_16750 5179 4163 gene locus_tag LOCUS_16760 5179 4163 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_16760 8533 5300 gene locus_tag LOCUS_16770 8533 5300 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015902.1 protein_id gnl|my_center|LOCUS_16770 8884 9546 gene locus_tag LOCUS_16780 8884 9546 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228173.1 protein_id gnl|my_center|LOCUS_16780 9530 10066 gene locus_tag LOCUS_16790 9530 10066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 10655 10059 gene locus_tag LOCUS_16800 gene pth 10655 10059 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence107 988 92 gene locus_tag LOCUS_16810 gene fhcD 988 92 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334456.1 protein_id gnl|my_center|LOCUS_16810 2718 1045 gene locus_tag LOCUS_16820 2718 1045 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_16820 4050 2728 gene locus_tag LOCUS_16830 4050 2728 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_16830 4291 4079 gene locus_tag LOCUS_16840 4291 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4750 4397 gene locus_tag LOCUS_16850 4750 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 5975 4770 gene locus_tag LOCUS_16860 5975 4770 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879746.1 protein_id gnl|my_center|LOCUS_16860 6839 5976 gene locus_tag LOCUS_16870 6839 5976 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_16870 8599 7055 gene locus_tag LOCUS_16880 8599 7055 CDS product DUF2193 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878925.1 protein_id gnl|my_center|LOCUS_16880 10222 9113 gene locus_tag LOCUS_16890 10222 9113 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250249.1 protein_id gnl|my_center|LOCUS_16890 10499 10239 gene locus_tag LOCUS_16900 10499 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence108 4 1041 gene locus_tag LOCUS_16910 4 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1035 1856 gene locus_tag LOCUS_16920 1035 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1892 4507 gene locus_tag LOCUS_16930 1892 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 4575 6878 gene locus_tag LOCUS_16940 4575 6878 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_16940 6901 8025 gene locus_tag LOCUS_16950 6901 8025 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_16950 9234 8173 gene locus_tag LOCUS_16960 9234 8173 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257404.1 protein_id gnl|my_center|LOCUS_16960 9893 9231 gene locus_tag LOCUS_16970 gene upp 9893 9231 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_16970 10326 9976 gene locus_tag LOCUS_16980 10326 9976 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880109.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence109 278 1321 gene locus_tag LOCUS_16990 278 1321 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_16990 1376 2557 gene locus_tag LOCUS_17000 1376 2557 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_17000 2566 3099 gene locus_tag LOCUS_17010 2566 3099 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541057.1 protein_id gnl|my_center|LOCUS_17010 3111 3785 gene locus_tag LOCUS_17020 3111 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3798 4703 gene locus_tag LOCUS_17030 3798 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 5039 6004 gene locus_tag LOCUS_17040 5039 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 8453 6027 gene locus_tag LOCUS_17050 8453 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 8919 8557 gene locus_tag LOCUS_17060 8919 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 9158 8919 gene locus_tag LOCUS_17070 9158 8919 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_17070 9656 9453 gene locus_tag LOCUS_17080 9656 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 9917 9774 gene locus_tag LOCUS_17090 9917 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 10325 9993 gene locus_tag LOCUS_17100 10325 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence110 1242 136 gene locus_tag LOCUS_17110 1242 136 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583801.1 protein_id gnl|my_center|LOCUS_17110 2407 1124 gene locus_tag LOCUS_17120 2407 1124 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583802.1 protein_id gnl|my_center|LOCUS_17120 3449 2391 gene locus_tag LOCUS_17130 3449 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3643 5496 gene locus_tag LOCUS_17140 3643 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 5502 5897 gene locus_tag LOCUS_17150 5502 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 5894 9529 gene locus_tag LOCUS_17160 5894 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 10322 9522 gene locus_tag LOCUS_17170 10322 9522 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928758.1 protein_id gnl|my_center|LOCUS_17170 10782 10330 gene locus_tag LOCUS_17180 10782 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence111 <1 502 gene locus_tag LOCUS_17190 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222893.1:response regulator transcription factor 585 1049 gene locus_tag LOCUS_17200 585 1049 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198843.1 protein_id gnl|my_center|LOCUS_17200 1067 2344 gene locus_tag LOCUS_17210 1067 2344 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_17210 3201 2464 gene locus_tag LOCUS_17220 3201 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 3639 3923 gene locus_tag LOCUS_17230 gene rpsT 3639 3923 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326150.1 protein_id gnl|my_center|LOCUS_17230 4628 4038 gene locus_tag LOCUS_17240 4628 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 6059 4665 gene locus_tag LOCUS_17250 6059 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 7073 6366 gene locus_tag LOCUS_17260 7073 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 7158 9764 gene locus_tag LOCUS_17270 7158 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence112 149 1000 gene locus_tag LOCUS_17280 149 1000 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_17280 1040 2263 gene locus_tag LOCUS_17290 gene mqnC 1040 2263 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_17290 2442 3962 gene locus_tag LOCUS_17300 2442 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3987 4901 gene locus_tag LOCUS_17310 3987 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 5152 5649 gene locus_tag LOCUS_17320 5152 5649 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_17320 5941 7329 gene locus_tag LOCUS_17330 gene dnaB 5941 7329 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_17330 7346 8053 gene locus_tag LOCUS_17340 7346 8053 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257454.1 protein_id gnl|my_center|LOCUS_17340 8118 9398 gene locus_tag LOCUS_17350 8118 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 9461 10318 gene locus_tag LOCUS_17360 9461 10318 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence113 2541 139 gene locus_tag LOCUS_17370 2541 139 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_17370 3793 2624 gene locus_tag LOCUS_17380 3793 2624 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_17380 4745 3798 gene locus_tag LOCUS_17390 4745 3798 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102952112.1 protein_id gnl|my_center|LOCUS_17390 6338 4869 gene locus_tag LOCUS_17400 6338 4869 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897264.1 protein_id gnl|my_center|LOCUS_17400 7141 6356 gene locus_tag LOCUS_17410 7141 6356 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232495.1 protein_id gnl|my_center|LOCUS_17410 8136 7273 gene locus_tag LOCUS_17420 8136 7273 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259122.1 protein_id gnl|my_center|LOCUS_17420 8813 8175 gene locus_tag LOCUS_17430 8813 8175 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810935.1 protein_id gnl|my_center|LOCUS_17430 9003 9374 gene locus_tag LOCUS_17440 9003 9374 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356595.1 protein_id gnl|my_center|LOCUS_17440 9411 10307 gene locus_tag LOCUS_17450 9411 10307 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479988.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence114 185 997 gene locus_tag LOCUS_17460 185 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1093 2046 gene locus_tag LOCUS_17470 gene mch 1093 2046 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145084390.1 protein_id gnl|my_center|LOCUS_17470 2051 2926 gene locus_tag LOCUS_17480 2051 2926 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922006.1 protein_id gnl|my_center|LOCUS_17480 2929 3789 gene locus_tag LOCUS_17490 2929 3789 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876382.1 protein_id gnl|my_center|LOCUS_17490 3849 4388 gene locus_tag LOCUS_17500 3849 4388 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_17500 4413 5879 gene locus_tag LOCUS_17510 4413 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5925 6647 gene locus_tag LOCUS_17520 gene fabG 5925 6647 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_17520 7428 6724 gene locus_tag LOCUS_17530 7428 6724 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827384.1 protein_id gnl|my_center|LOCUS_17530 7427 8488 gene locus_tag LOCUS_17540 7427 8488 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876467.1 protein_id gnl|my_center|LOCUS_17540 8481 9149 gene locus_tag LOCUS_17550 8481 9149 CDS product amino acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021487.1 protein_id gnl|my_center|LOCUS_17550 9875 9162 gene locus_tag LOCUS_17560 9875 9162 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870611.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence115 390 1343 gene locus_tag LOCUS_17570 390 1343 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_17570 2708 1371 gene locus_tag LOCUS_17580 2708 1371 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_17580 4003 2726 gene locus_tag LOCUS_17590 4003 2726 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_17590 5510 4047 gene locus_tag LOCUS_17600 gene gatB 5510 4047 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_17600 6784 5612 gene locus_tag LOCUS_17610 6784 5612 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_17610 7981 6788 gene locus_tag LOCUS_17620 7981 6788 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_17620 8986 7997 gene locus_tag LOCUS_17630 8986 7997 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257630.1 protein_id gnl|my_center|LOCUS_17630 <10413 9067 gene locus_tag LOCUS_17640 <10413 9067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393505.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence116 328 254 gene locus_tag LOCUS_t00210 328 254 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1184 444 gene locus_tag LOCUS_17650 1184 444 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_17650 1390 2397 gene locus_tag LOCUS_17660 1390 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2449 3300 gene locus_tag LOCUS_17670 gene surE 2449 3300 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250088.1 protein_id gnl|my_center|LOCUS_17670 3306 4463 gene locus_tag LOCUS_17680 gene galK 3306 4463 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_17680 4619 5362 gene locus_tag LOCUS_17690 4619 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 5547 5984 gene locus_tag LOCUS_17700 5547 5984 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258099.1 protein_id gnl|my_center|LOCUS_17700 5989 6822 gene locus_tag LOCUS_17710 gene mutM 5989 6822 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_17710 8138 6840 gene locus_tag LOCUS_17720 8138 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 8423 8169 gene locus_tag LOCUS_17730 8423 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence117 202 1407 gene locus_tag LOCUS_17740 gene recF 202 1407 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_17740 1544 2221 gene locus_tag LOCUS_17750 1544 2221 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_17750 2360 3955 gene locus_tag LOCUS_17760 2360 3955 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_17760 4169 4561 gene locus_tag LOCUS_17770 4169 4561 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545378.1 protein_id gnl|my_center|LOCUS_17770 4610 5806 gene locus_tag LOCUS_17780 4610 5806 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257960.1 protein_id gnl|my_center|LOCUS_17780 5803 6540 gene locus_tag LOCUS_17790 5803 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 6533 7054 gene locus_tag LOCUS_17800 6533 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 7060 7821 gene locus_tag LOCUS_17810 gene rlmB 7060 7821 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459087.1 protein_id gnl|my_center|LOCUS_17810 8644 7835 gene locus_tag LOCUS_17820 8644 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 8761 9030 gene locus_tag LOCUS_17830 gene rpsO 8761 9030 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_17830 9709 9095 gene locus_tag LOCUS_17840 9709 9095 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888961.1 protein_id gnl|my_center|LOCUS_17840 <10345 9810 gene locus_tag LOCUS_17850 <10345 9810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223416.1:CapA family protein >Feature sequence118 486 1082 gene locus_tag LOCUS_17860 486 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1121 2362 gene locus_tag LOCUS_17870 1121 2362 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_17870 2957 4018 gene locus_tag LOCUS_17880 gene pheS 2957 4018 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_17880 4126 6600 gene locus_tag LOCUS_17890 gene pheT 4126 6600 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_17890 6847 6674 gene locus_tag LOCUS_17900 6847 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 7274 8686 gene locus_tag LOCUS_17910 7274 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 8931 9983 gene locus_tag LOCUS_17920 gene aroF 8931 9983 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460211.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence119 443 832 gene locus_tag LOCUS_17930 443 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1846 863 gene locus_tag LOCUS_17940 1846 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2013 3614 gene locus_tag LOCUS_17950 2013 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3656 6502 gene locus_tag LOCUS_17960 3656 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 6591 7622 gene locus_tag LOCUS_17970 6591 7622 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256253.1 protein_id gnl|my_center|LOCUS_17970 8003 9256 gene locus_tag LOCUS_17980 8003 9256 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256710.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence120 827 594 gene locus_tag LOCUS_17990 827 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1726 941 gene locus_tag LOCUS_18000 1726 941 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256343.1 protein_id gnl|my_center|LOCUS_18000 2518 1730 gene locus_tag LOCUS_18010 2518 1730 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256865.1 protein_id gnl|my_center|LOCUS_18010 3509 2508 gene locus_tag LOCUS_18020 3509 2508 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257671.1 protein_id gnl|my_center|LOCUS_18020 4508 3582 gene locus_tag LOCUS_18030 4508 3582 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038340.1 protein_id gnl|my_center|LOCUS_18030 5683 4505 gene locus_tag LOCUS_18040 5683 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 5808 6563 gene locus_tag LOCUS_18050 5808 6563 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_18050 6601 8010 gene locus_tag LOCUS_18060 6601 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 8084 8458 gene locus_tag LOCUS_18070 8084 8458 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_18070 8542 9447 gene locus_tag LOCUS_18080 gene ftcD 8542 9447 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869662.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence121 1859 222 gene locus_tag LOCUS_18090 1859 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3973 2081 gene locus_tag LOCUS_18100 gene dnaG 3973 2081 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258766.1 protein_id gnl|my_center|LOCUS_18100 4845 4144 gene locus_tag LOCUS_18110 4845 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5863 5051 gene locus_tag LOCUS_18120 5863 5051 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_18120 6035 6745 gene locus_tag LOCUS_18130 6035 6745 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_18130 6792 7667 gene locus_tag LOCUS_18140 6792 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 7664 8677 gene locus_tag LOCUS_18150 7664 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 8694 9740 gene locus_tag LOCUS_18160 gene rtcA 8694 9740 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence122 2733 307 gene locus_tag LOCUS_18170 2733 307 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259065.1 protein_id gnl|my_center|LOCUS_18170 2940 3875 gene locus_tag LOCUS_18180 2940 3875 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256581.1 protein_id gnl|my_center|LOCUS_18180 3931 6159 gene locus_tag LOCUS_18190 3931 6159 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928938.1 protein_id gnl|my_center|LOCUS_18190 6381 6917 gene locus_tag LOCUS_18200 6381 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 6985 7335 gene locus_tag LOCUS_18210 6985 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 7384 8817 gene locus_tag LOCUS_18220 7384 8817 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982280.1 protein_id gnl|my_center|LOCUS_18220 8998 9480 gene locus_tag LOCUS_18230 8998 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence123 <1 1109 gene locus_tag LOCUS_18240 <1 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256076.1:2-isopropylmalate synthase 1211 2500 gene locus_tag LOCUS_18250 1211 2500 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888413.1 protein_id gnl|my_center|LOCUS_18250 2497 2994 gene locus_tag LOCUS_18260 2497 2994 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888419.1 protein_id gnl|my_center|LOCUS_18260 3023 3166 gene locus_tag LOCUS_18270 3023 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3265 4047 gene locus_tag LOCUS_18280 3265 4047 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_18280 4129 5220 gene locus_tag LOCUS_18290 gene leuB 4129 5220 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_18290 5312 6958 gene locus_tag LOCUS_18300 gene cimA 5312 6958 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146979.1 protein_id gnl|my_center|LOCUS_18300 7081 8022 gene locus_tag LOCUS_18310 7081 8022 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence124 348 112 gene locus_tag LOCUS_18320 348 112 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_18320 1450 479 gene locus_tag LOCUS_18330 1450 479 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_18330 2513 1488 gene locus_tag LOCUS_18340 gene pdhA 2513 1488 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_18340 3480 2539 gene locus_tag LOCUS_18350 gene lipA 3480 2539 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_18350 3690 4034 gene locus_tag LOCUS_18360 3690 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 4031 4951 gene locus_tag LOCUS_18370 4031 4951 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256595.1 protein_id gnl|my_center|LOCUS_18370 4956 5696 gene locus_tag LOCUS_18380 gene fabG 4956 5696 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 protein_id gnl|my_center|LOCUS_18380 6639 5698 gene locus_tag LOCUS_18390 6639 5698 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_18390 7193 6636 gene locus_tag LOCUS_18400 7193 6636 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_18400 8608 7190 gene locus_tag LOCUS_18410 8608 7190 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118487.1 protein_id gnl|my_center|LOCUS_18410 8995 8618 gene locus_tag LOCUS_18420 8995 8618 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532029.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence125 291 530 gene locus_tag LOCUS_18430 291 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 527 712 gene locus_tag LOCUS_18440 527 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 722 1453 gene locus_tag LOCUS_18450 gene mtnP 722 1453 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_18450 2583 1519 gene locus_tag LOCUS_18460 2583 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3533 2583 gene locus_tag LOCUS_18470 3533 2583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_18470 5905 3530 gene locus_tag LOCUS_18480 5905 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256384.1 protein_id gnl|my_center|LOCUS_18480 7722 6124 gene locus_tag LOCUS_18490 7722 6124 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256867.1 protein_id gnl|my_center|LOCUS_18490 9447 7888 gene locus_tag LOCUS_18500 9447 7888 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256867.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence126 217 537 gene locus_tag LOCUS_18510 217 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 812 1537 gene locus_tag LOCUS_18520 812 1537 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_18520 1527 2996 gene locus_tag LOCUS_18530 1527 2996 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256764.1 protein_id gnl|my_center|LOCUS_18530 3119 3193 gene locus_tag LOCUS_t00220 3119 3193 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3207 3281 gene locus_tag LOCUS_t00230 3207 3281 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3287 3362 gene locus_tag LOCUS_t00240 3287 3362 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3367 3440 gene locus_tag LOCUS_t00250 3367 3440 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3446 3530 gene locus_tag LOCUS_t00260 3446 3530 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3549 3626 gene locus_tag LOCUS_t00270 3549 3626 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3666 3739 gene locus_tag LOCUS_t00280 3666 3739 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3744 3817 gene locus_tag LOCUS_t00290 3744 3817 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3830 3903 gene locus_tag LOCUS_t00300 3830 3903 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4019 5779 gene locus_tag LOCUS_18540 4019 5779 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930711.1 protein_id gnl|my_center|LOCUS_18540 7675 5840 gene locus_tag LOCUS_18550 7675 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 8038 7739 gene locus_tag LOCUS_18560 8038 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 8206 8290 gene locus_tag LOCUS_t00310 8206 8290 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 8298 8372 gene locus_tag LOCUS_t00320 8298 8372 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8379 8453 gene locus_tag LOCUS_t00330 8379 8453 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8467 8549 gene locus_tag LOCUS_t00340 8467 8549 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8574 8649 gene locus_tag LOCUS_t00350 8574 8649 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8711 9595 gene locus_tag LOCUS_18570 8711 9595 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101364.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence127 7417 4391 gene locus_tag LOCUS_18580 7417 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence128 84 1271 gene locus_tag LOCUS_18590 84 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1261 2637 gene locus_tag LOCUS_18600 1261 2637 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_18600 2965 2717 gene locus_tag LOCUS_18610 2965 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 4909 3272 gene locus_tag LOCUS_18620 4909 3272 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258288.1 protein_id gnl|my_center|LOCUS_18620 5414 4911 gene locus_tag LOCUS_18630 5414 4911 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258287.1 protein_id gnl|my_center|LOCUS_18630 5554 5420 gene locus_tag LOCUS_18640 5554 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 5804 5571 gene locus_tag LOCUS_18650 5804 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 5691 5900 gene locus_tag LOCUS_18660 5691 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 6790 5999 gene locus_tag LOCUS_18670 6790 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 7041 8198 gene locus_tag LOCUS_18680 7041 8198 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392745.1 protein_id gnl|my_center|LOCUS_18680 8191 8880 gene locus_tag LOCUS_18690 8191 8880 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence129 426 974 gene locus_tag LOCUS_18700 426 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 976 1308 gene locus_tag LOCUS_18710 976 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1728 3536 gene locus_tag LOCUS_18720 1728 3536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257645.1 protein_id gnl|my_center|LOCUS_18720 3554 5380 gene locus_tag LOCUS_18730 3554 5380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257644.1 protein_id gnl|my_center|LOCUS_18730 7018 5570 gene locus_tag LOCUS_18740 7018 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 7314 9305 gene locus_tag LOCUS_18750 7314 9305 CDS product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251118.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence130 <1 1215 gene locus_tag LOCUS_18760 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258427.1:bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase 1312 2061 gene locus_tag LOCUS_18770 gene cobI 1312 2061 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258426.1 protein_id gnl|my_center|LOCUS_18770 2058 3947 gene locus_tag LOCUS_18780 2058 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 3944 5203 gene locus_tag LOCUS_18790 3944 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18790 5285 5491 gene locus_tag LOCUS_18800 5285 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 5706 6809 gene locus_tag LOCUS_18810 5706 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 6844 7386 gene locus_tag LOCUS_18820 gene cobO 6844 7386 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258439.1 protein_id gnl|my_center|LOCUS_18820 7415 8368 gene locus_tag LOCUS_18830 7415 8368 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392617.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence131 2628 2509 gene locus_tag LOCUS_18840 2628 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 3836 2895 gene locus_tag LOCUS_18850 3836 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 5765 4134 gene locus_tag LOCUS_18860 gene murJ 5765 4134 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256387.1 protein_id gnl|my_center|LOCUS_18860 6380 5883 gene locus_tag LOCUS_18870 gene rfaE2 6380 5883 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142636.1 protein_id gnl|my_center|LOCUS_18870 7390 6392 gene locus_tag LOCUS_18880 7390 6392 CDS product bifunctional ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258219.1 protein_id gnl|my_center|LOCUS_18880 7512 7585 gene locus_tag LOCUS_t00360 7512 7585 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7647 8633 gene locus_tag LOCUS_18890 7647 8633 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256717.1 protein_id gnl|my_center|LOCUS_18890 8637 9152 gene locus_tag LOCUS_18900 8637 9152 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence132 3052 1343 gene locus_tag LOCUS_18910 3052 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 3109 3909 gene locus_tag LOCUS_18920 3109 3909 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258578.1 protein_id gnl|my_center|LOCUS_18920 4697 3822 gene locus_tag LOCUS_18930 4697 3822 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140506.1 protein_id gnl|my_center|LOCUS_18930 6372 4948 gene locus_tag LOCUS_18940 6372 4948 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055578.1 protein_id gnl|my_center|LOCUS_18940 6777 6376 gene locus_tag LOCUS_18950 6777 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 8251 6794 gene locus_tag LOCUS_18960 8251 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 <9360 8244 gene locus_tag LOCUS_18970 <9360 8244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076055578.1:radical SAM protein >Feature sequence133 235 1080 gene locus_tag LOCUS_18980 235 1080 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_18980 1154 1696 gene locus_tag LOCUS_18990 1154 1696 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_18990 1713 4166 gene locus_tag LOCUS_19000 1713 4166 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_19000 4230 5243 gene locus_tag LOCUS_19010 4230 5243 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_19010 5331 6638 gene locus_tag LOCUS_19020 5331 6638 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_19020 6806 7741 gene locus_tag LOCUS_19030 gene paaA 6806 7741 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_19030 7738 8058 gene locus_tag LOCUS_19040 7738 8058 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118979.1 protein_id gnl|my_center|LOCUS_19040 8055 8267 gene locus_tag LOCUS_19050 8055 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 8307 9059 gene locus_tag LOCUS_19060 8307 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 9056 9256 gene locus_tag LOCUS_19070 9056 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence134 248 1093 gene locus_tag LOCUS_19080 248 1093 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030940.1 protein_id gnl|my_center|LOCUS_19080 1115 3265 gene locus_tag LOCUS_19090 1115 3265 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230093.1 protein_id gnl|my_center|LOCUS_19090 3262 4047 gene locus_tag LOCUS_19100 3262 4047 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_19100 4107 4898 gene locus_tag LOCUS_19110 4107 4898 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_19110 5060 5476 gene locus_tag LOCUS_19120 5060 5476 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973036.1 protein_id gnl|my_center|LOCUS_19120 6424 5477 gene locus_tag LOCUS_19130 6424 5477 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_19130 6596 6512 gene locus_tag LOCUS_t00370 6596 6512 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6829 7674 gene locus_tag LOCUS_19140 gene amrB 6829 7674 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005130.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence135 <1 1098 gene locus_tag LOCUS_19150 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257578.1:glycosyltransferase family 1 protein 1167 1517 gene locus_tag LOCUS_19160 1167 1517 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228087.1 protein_id gnl|my_center|LOCUS_19160 1486 1902 gene locus_tag LOCUS_19170 1486 1902 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081206.1 protein_id gnl|my_center|LOCUS_19170 2001 3191 gene locus_tag LOCUS_19180 2001 3191 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_19180 3722 3192 gene locus_tag LOCUS_19190 3722 3192 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_19190 3842 4297 gene locus_tag LOCUS_19200 3842 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 4278 4718 gene locus_tag LOCUS_19210 4278 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 5555 4722 gene locus_tag LOCUS_19220 5555 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 7453 5561 gene locus_tag LOCUS_19230 7453 5561 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227894.1 protein_id gnl|my_center|LOCUS_19230 8384 7470 gene locus_tag LOCUS_19240 8384 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence136 1653 676 gene locus_tag LOCUS_19250 1653 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2820 1657 gene locus_tag LOCUS_19260 2820 1657 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_19260 2995 4260 gene locus_tag LOCUS_19270 gene rpsA 2995 4260 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_19270 4334 6871 gene locus_tag LOCUS_19280 4334 6871 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_19280 7868 7020 gene locus_tag LOCUS_19290 gene lipB 7868 7020 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405264.1 protein_id gnl|my_center|LOCUS_19290 8864 7872 gene locus_tag LOCUS_19300 gene fmt 8864 7872 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence137 2141 2755 gene locus_tag LOCUS_19310 2141 2755 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_19310 2799 4133 gene locus_tag LOCUS_19320 2799 4133 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_19320 5333 4272 gene locus_tag LOCUS_19330 5333 4272 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258191.1 protein_id gnl|my_center|LOCUS_19330 5984 7513 gene locus_tag LOCUS_19340 gene trpE 5984 7513 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_19340 7550 8029 gene locus_tag LOCUS_19350 7550 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence138 376 714 gene locus_tag LOCUS_19360 gene hisI 376 714 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879442.1 protein_id gnl|my_center|LOCUS_19360 1712 765 gene locus_tag LOCUS_19370 1712 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 4474 1874 gene locus_tag LOCUS_19380 4474 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 5763 4471 gene locus_tag LOCUS_19390 gene glcF 5763 4471 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_19390 5958 6854 gene locus_tag LOCUS_19400 gene ligD 5958 6854 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393573.1 protein_id gnl|my_center|LOCUS_19400 6986 8281 gene locus_tag LOCUS_19410 6986 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 8418 >8957 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcagtatcctcggcggatcgagtgtgggtgtggc >Feature sequence139 302 1012 gene locus_tag LOCUS_19420 302 1012 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_19420 2870 1032 gene locus_tag LOCUS_19430 2870 1032 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257113.1 protein_id gnl|my_center|LOCUS_19430 3237 3037 gene locus_tag LOCUS_19440 3237 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 3528 4130 gene locus_tag LOCUS_19450 3528 4130 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259303.1 protein_id gnl|my_center|LOCUS_19450 4328 4810 gene locus_tag LOCUS_19460 4328 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4803 5642 gene locus_tag LOCUS_19470 4803 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 5752 6318 gene locus_tag LOCUS_19480 gene sigK 5752 6318 CDS product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314022.1 protein_id gnl|my_center|LOCUS_19480 6327 7034 gene locus_tag LOCUS_19490 6327 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 7065 8678 gene locus_tag LOCUS_19500 7065 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence140 1 2187 gene locus_tag LOCUS_19510 1 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2172 2573 gene locus_tag LOCUS_19520 2172 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2586 3806 gene locus_tag LOCUS_19530 2586 3806 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_19530 5229 3814 gene locus_tag LOCUS_19540 gene rimO 5229 3814 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_19540 6158 5253 gene locus_tag LOCUS_19550 6158 5253 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144381.1 protein_id gnl|my_center|LOCUS_19550 6426 7910 gene locus_tag LOCUS_19560 6426 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 8715 7966 gene locus_tag LOCUS_19570 8715 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence141 231 2429 gene locus_tag LOCUS_19580 231 2429 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_19580 2451 2957 gene locus_tag LOCUS_19590 2451 2957 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228008.1 protein_id gnl|my_center|LOCUS_19590 4253 2973 gene locus_tag LOCUS_19600 4253 2973 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258332.1 protein_id gnl|my_center|LOCUS_19600 4633 4253 gene locus_tag LOCUS_19610 4633 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 5167 4688 gene locus_tag LOCUS_19620 5167 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 6592 5603 gene locus_tag LOCUS_19630 gene pyrB 6592 5603 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251146.1 protein_id gnl|my_center|LOCUS_19630 7668 6589 gene locus_tag LOCUS_19640 7668 6589 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056513.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence142 <1 1281 gene locus_tag LOCUS_19650 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003408265.1:transglutaminase family protein 1400 2074 gene locus_tag LOCUS_19660 1400 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2756 2088 gene locus_tag LOCUS_19670 2756 2088 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_19670 3441 4775 gene locus_tag LOCUS_19680 3441 4775 CDS product CpXC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257830.1 protein_id gnl|my_center|LOCUS_19680 4772 5374 gene locus_tag LOCUS_19690 gene hisB 4772 5374 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_19690 5387 6034 gene locus_tag LOCUS_19700 5387 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 6038 6640 gene locus_tag LOCUS_19710 gene hisH 6038 6640 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_19710 6652 7431 gene locus_tag LOCUS_19720 gene hisA 6652 7431 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_19720 7444 8205 gene locus_tag LOCUS_19730 gene hisF 7444 8205 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404312.1 protein_id gnl|my_center|LOCUS_19730 8261 8653 gene locus_tag LOCUS_19740 8261 8653 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259070.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence143 1753 1304 gene locus_tag LOCUS_19750 1753 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2216 1773 gene locus_tag LOCUS_19760 2216 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 3823 2336 gene locus_tag LOCUS_19770 3823 2336 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_19770 4696 3827 gene locus_tag LOCUS_19780 gene sucD 4696 3827 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256597.1 protein_id gnl|my_center|LOCUS_19780 6115 4760 gene locus_tag LOCUS_19790 6115 4760 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_19790 7277 6138 gene locus_tag LOCUS_19800 gene sucC 7277 6138 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_19800 7831 7490 gene locus_tag LOCUS_19810 7831 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 8091 7792 gene locus_tag LOCUS_19820 8091 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 8230 8418 gene locus_tag LOCUS_19830 8230 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence144 <1 566 gene locus_tag LOCUS_19840 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257066.1:molecular chaperone HtpG 803 1753 gene locus_tag LOCUS_19850 gene prfB 803 1753 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285053.1 protein_id gnl|my_center|LOCUS_19850 2066 1842 gene locus_tag LOCUS_19860 2066 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2264 3043 gene locus_tag LOCUS_19870 gene trmD 2264 3043 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_19870 3369 3142 gene locus_tag LOCUS_19880 3369 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 5034 3523 gene locus_tag LOCUS_19890 5034 3523 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530067.1 protein_id gnl|my_center|LOCUS_19890 5555 6568 gene locus_tag LOCUS_19900 5555 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 6644 7624 gene locus_tag LOCUS_19910 gene rpoD 6644 7624 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258920.1 protein_id gnl|my_center|LOCUS_19910 7947 7732 gene locus_tag LOCUS_19920 7947 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 8208 8008 gene locus_tag LOCUS_19930 8208 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence145 <1 1080 gene locus_tag LOCUS_19940 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259302.1:methionine--tRNA ligase 1133 2443 gene locus_tag LOCUS_19950 1133 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2456 3628 gene locus_tag LOCUS_19960 2456 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 3838 3996 gene locus_tag LOCUS_19970 3838 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 4080 4469 gene locus_tag LOCUS_19980 gene rnpA 4080 4469 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_19980 4466 4690 gene locus_tag LOCUS_19990 gene yidD 4466 4690 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_19990 4706 5572 gene locus_tag LOCUS_20000 4706 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 5532 6323 gene locus_tag LOCUS_20010 5532 6323 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_20010 7255 6434 gene locus_tag LOCUS_20020 7255 6434 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839946.1 protein_id gnl|my_center|LOCUS_20020 8215 7283 gene locus_tag LOCUS_20030 8215 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 8637 8233 gene locus_tag LOCUS_20040 8637 8233 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence146 <1 504 gene locus_tag LOCUS_20050 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583266.1:cytidylate kinase-like family protein 488 1900 gene locus_tag LOCUS_20060 gene cysS 488 1900 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257711.1 protein_id gnl|my_center|LOCUS_20060 2076 3656 gene locus_tag LOCUS_20070 2076 3656 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_20070 4625 3723 gene locus_tag LOCUS_20080 4625 3723 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_20080 8268 4855 gene locus_tag LOCUS_20090 8268 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence147 850 2262 gene locus_tag LOCUS_20100 850 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2266 3555 gene locus_tag LOCUS_20110 2266 3555 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259226.1 protein_id gnl|my_center|LOCUS_20110 6035 3693 gene locus_tag LOCUS_20120 6035 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 6346 6678 gene locus_tag LOCUS_20130 gene trxA 6346 6678 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_20130 6868 7140 gene locus_tag LOCUS_20140 6868 7140 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_20140 7156 7371 gene locus_tag LOCUS_20150 7156 7371 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228663.1 protein_id gnl|my_center|LOCUS_20150 7387 7785 gene locus_tag LOCUS_20160 7387 7785 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259070.1 protein_id gnl|my_center|LOCUS_20160 7796 8146 gene locus_tag LOCUS_20170 7796 8146 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228082.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence148 81 1337 gene locus_tag LOCUS_20180 81 1337 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259731.1 protein_id gnl|my_center|LOCUS_20180 1337 3913 gene locus_tag LOCUS_20190 1337 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 3936 6491 gene locus_tag LOCUS_20200 3936 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 6551 8104 gene locus_tag LOCUS_20210 6551 8104 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence149 2116 395 gene locus_tag LOCUS_20220 2116 395 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403093.1 protein_id gnl|my_center|LOCUS_20220 2648 2127 gene locus_tag LOCUS_20230 2648 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2825 2667 gene locus_tag LOCUS_20240 2825 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3087 5201 gene locus_tag LOCUS_20250 3087 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 5214 5477 gene locus_tag LOCUS_20260 5214 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 6777 5536 gene locus_tag LOCUS_20270 gene kynU 6777 5536 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114854.1 protein_id gnl|my_center|LOCUS_20270 7371 6790 gene locus_tag LOCUS_20280 7371 6790 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880795.1 protein_id gnl|my_center|LOCUS_20280 7549 8010 gene locus_tag LOCUS_20290 7549 8010 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081206.1 protein_id gnl|my_center|LOCUS_20290 7958 8335 gene locus_tag LOCUS_20300 7958 8335 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081204.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence150 1140 613 gene locus_tag LOCUS_20310 1140 613 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_20310 2689 1151 gene locus_tag LOCUS_20320 2689 1151 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_20320 3124 2786 gene locus_tag LOCUS_20330 3124 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 4191 3253 gene locus_tag LOCUS_20340 4191 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 4716 4402 gene locus_tag LOCUS_20350 4716 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence151 601 2268 gene locus_tag LOCUS_20360 gene merA 601 2268 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031938.1 protein_id gnl|my_center|LOCUS_20360 2311 2904 gene locus_tag LOCUS_20370 2311 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2923 3096 gene locus_tag LOCUS_20380 2923 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 5257 3101 gene locus_tag LOCUS_20390 5257 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 6341 5490 gene locus_tag LOCUS_20400 6341 5490 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245320.1 protein_id gnl|my_center|LOCUS_20400 8156 6351 gene locus_tag LOCUS_20410 8156 6351 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence152 3 1049 gene locus_tag LOCUS_20420 3 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 1471 5832 gene locus_tag LOCUS_20430 1471 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence153 709 125 gene locus_tag LOCUS_20440 gene qoxC 709 125 CDS product cytochrome aa3 quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227409.1 protein_id gnl|my_center|LOCUS_20440 2557 728 gene locus_tag LOCUS_20450 gene ctaD 2557 728 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232245.1 protein_id gnl|my_center|LOCUS_20450 3569 2568 gene locus_tag LOCUS_20460 gene coxB 3569 2568 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971124.1 protein_id gnl|my_center|LOCUS_20460 4005 3877 gene locus_tag LOCUS_20470 4005 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 4245 5585 gene locus_tag LOCUS_20480 4245 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 8030 5601 gene locus_tag LOCUS_20490 8030 5601 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence154 199 909 gene locus_tag LOCUS_20500 199 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 913 1938 gene locus_tag LOCUS_20510 913 1938 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_20510 2240 3187 gene locus_tag LOCUS_20520 2240 3187 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_20520 3207 4154 gene locus_tag LOCUS_20530 3207 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 4168 5424 gene locus_tag LOCUS_20540 4168 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 5483 6463 gene locus_tag LOCUS_20550 5483 6463 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence155 1588 788 gene locus_tag LOCUS_20560 1588 788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_20560 2967 1630 gene locus_tag LOCUS_20570 2967 1630 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_20570 4740 3067 gene locus_tag LOCUS_20580 4740 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 5334 4849 gene locus_tag LOCUS_20590 5334 4849 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528818.1 protein_id gnl|my_center|LOCUS_20590 7594 5420 gene locus_tag LOCUS_20600 7594 5420 CDS product C25 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256976.1 protein_id gnl|my_center|LOCUS_20600 7829 7608 gene locus_tag LOCUS_20610 7829 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence156 197 1108 gene locus_tag LOCUS_20620 197 1108 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655931.1 protein_id gnl|my_center|LOCUS_20620 2365 1127 gene locus_tag LOCUS_20630 2365 1127 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529943.1 protein_id gnl|my_center|LOCUS_20630 2509 2381 gene locus_tag LOCUS_20640 2509 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20640 2886 3386 gene locus_tag LOCUS_20650 2886 3386 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_20650 3383 4054 gene locus_tag LOCUS_20660 3383 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 4278 5819 gene locus_tag LOCUS_20670 4278 5819 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257054.1 protein_id gnl|my_center|LOCUS_20670 5854 6636 gene locus_tag LOCUS_20680 5854 6636 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_20680 6633 7868 gene locus_tag LOCUS_20690 6633 7868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence157 1921 2316 gene locus_tag LOCUS_20700 1921 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2418 2648 gene locus_tag LOCUS_20710 2418 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2651 2932 gene locus_tag LOCUS_20720 2651 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2925 3158 gene locus_tag LOCUS_20730 2925 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 3311 5662 gene locus_tag LOCUS_20740 3311 5662 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294690.1 protein_id gnl|my_center|LOCUS_20740 6303 7607 gene locus_tag LOCUS_20750 gene serS 6303 7607 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_20750 7746 8093 gene locus_tag LOCUS_20760 7746 8093 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393501.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence158 682 1725 gene locus_tag LOCUS_20770 gene fni 682 1725 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_20770 1804 2691 gene locus_tag LOCUS_20780 1804 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2752 3114 gene locus_tag LOCUS_20790 2752 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 3162 4373 gene locus_tag LOCUS_20800 3162 4373 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256051.1 protein_id gnl|my_center|LOCUS_20800 4380 4904 gene locus_tag LOCUS_20810 4380 4904 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926900.1 protein_id gnl|my_center|LOCUS_20810 4905 6305 gene locus_tag LOCUS_20820 4905 6305 CDS product bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_20820 6298 7272 gene locus_tag LOCUS_20830 6298 7272 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066118.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence159 1160 54 gene locus_tag LOCUS_20840 1160 54 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_20840 2874 1180 gene locus_tag LOCUS_20850 2874 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 4170 3154 gene locus_tag LOCUS_20860 4170 3154 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_20860 7965 4357 gene locus_tag LOCUS_20870 gene nifJ 7965 4357 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence160 739 206 gene locus_tag LOCUS_20880 739 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258603.1 protein_id gnl|my_center|LOCUS_20880 2814 742 gene locus_tag LOCUS_20890 2814 742 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_20890 5986 2948 gene locus_tag LOCUS_20900 5986 2948 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259651.1 protein_id gnl|my_center|LOCUS_20900 7174 6290 gene locus_tag LOCUS_20910 7174 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057419.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence161 2898 1069 gene locus_tag LOCUS_20920 2898 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 5921 2922 gene locus_tag LOCUS_20930 5921 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 7530 5956 gene locus_tag LOCUS_20940 7530 5956 CDS product polysaccharide lyase 6 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223691.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence162 <1 1092 gene locus_tag LOCUS_20950 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878180.1:acetate--CoA ligase 1227 1505 gene locus_tag LOCUS_20960 1227 1505 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072776.1 protein_id gnl|my_center|LOCUS_20960 1518 3212 gene locus_tag LOCUS_20970 1518 3212 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_20970 3381 4148 gene locus_tag LOCUS_20980 3381 4148 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258357.1 protein_id gnl|my_center|LOCUS_20980 4145 4972 gene locus_tag LOCUS_20990 4145 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4969 5718 gene locus_tag LOCUS_21000 4969 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 5721 5867 gene locus_tag LOCUS_21010 5721 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence163 220 2 gene locus_tag LOCUS_21020 220 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 367 612 gene locus_tag LOCUS_21030 367 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 609 980 gene locus_tag LOCUS_21040 609 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1842 997 gene locus_tag LOCUS_21050 1842 997 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754393.1 protein_id gnl|my_center|LOCUS_21050 2662 1847 gene locus_tag LOCUS_21060 2662 1847 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_21060 3704 2679 gene locus_tag LOCUS_21070 3704 2679 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_21070 4126 5262 gene locus_tag LOCUS_21080 gene rpoD 4126 5262 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258920.1 protein_id gnl|my_center|LOCUS_21080 <7867 5266 gene locus_tag LOCUS_21090 <7867 5266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143648.1:CHAT domain-containing protein >Feature sequence164 1126 134 gene locus_tag LOCUS_21100 1126 134 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064222.1 protein_id gnl|my_center|LOCUS_21100 2651 1191 gene locus_tag LOCUS_21110 2651 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 3761 2718 gene locus_tag LOCUS_21120 3761 2718 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_21120 5044 3827 gene locus_tag LOCUS_21130 5044 3827 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259183.1 protein_id gnl|my_center|LOCUS_21130 5847 5068 gene locus_tag LOCUS_21140 5847 5068 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_21140 7142 5958 gene locus_tag LOCUS_21150 7142 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 7445 7158 gene locus_tag LOCUS_21160 7445 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 7816 7508 gene locus_tag LOCUS_21170 7816 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence165 <1 1051 gene locus_tag LOCUS_21180 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_155321014.1:type III-B CRISPR module-associated protein Cmr3 1044 2003 gene locus_tag LOCUS_21190 gene cmr4 1044 2003 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082339.1 protein_id gnl|my_center|LOCUS_21190 2151 3335 gene locus_tag LOCUS_21200 2151 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3357 4274 gene locus_tag LOCUS_21210 gene cmr4 3357 4274 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_21210 4271 4642 gene locus_tag LOCUS_21220 gene cmr5 4271 4642 CDS product type III-B CRISPR module-associated protein Cmr5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879355.1 protein_id gnl|my_center|LOCUS_21220 4657 5418 gene locus_tag LOCUS_21230 4657 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 5841 6551 gene locus_tag LOCUS_21240 5841 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 6556 7407 gene locus_tag LOCUS_21250 6556 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 7563 7766 gene locus_tag LOCUS_21260 7563 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence166 1467 520 gene locus_tag LOCUS_21270 1467 520 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_21270 2968 1649 gene locus_tag LOCUS_21280 2968 1649 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_21280 4314 2965 gene locus_tag LOCUS_21290 4314 2965 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883977.1 protein_id gnl|my_center|LOCUS_21290 5926 4316 gene locus_tag LOCUS_21300 5926 4316 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_21300 6532 6083 gene locus_tag LOCUS_21310 6532 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 6742 6536 gene locus_tag LOCUS_21320 6742 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 7308 6814 gene locus_tag LOCUS_21330 7308 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence167 <1 657 gene locus_tag LOCUS_21340 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034350148.1:S8 family serine peptidase 747 3230 gene locus_tag LOCUS_21350 747 3230 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_21350 3293 4081 gene locus_tag LOCUS_21360 3293 4081 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_21360 6074 4086 gene locus_tag LOCUS_21370 6074 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 7724 6075 gene locus_tag LOCUS_21380 7724 6075 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence168 2898 547 gene locus_tag LOCUS_21390 2898 547 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_21390 5620 2957 gene locus_tag LOCUS_21400 gene lon 5620 2957 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_21400 6117 5701 gene locus_tag LOCUS_21410 6117 5701 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_21410 7213 6284 gene locus_tag LOCUS_21420 gene panB 7213 6284 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence169 832 167 gene locus_tag LOCUS_21430 832 167 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258536.1 protein_id gnl|my_center|LOCUS_21430 3253 1046 gene locus_tag LOCUS_21440 3253 1046 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249391.1 protein_id gnl|my_center|LOCUS_21440 4955 3258 gene locus_tag LOCUS_21450 4955 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 6970 5018 gene locus_tag LOCUS_21460 6970 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence170 237 1436 gene locus_tag LOCUS_21470 237 1436 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091593875.1 protein_id gnl|my_center|LOCUS_21470 2879 1488 gene locus_tag LOCUS_21480 gene lpdA 2879 1488 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258694.1 protein_id gnl|my_center|LOCUS_21480 4093 3164 gene locus_tag LOCUS_21490 4093 3164 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391458.1 protein_id gnl|my_center|LOCUS_21490 6292 4175 gene locus_tag LOCUS_21500 gene fdhF 6292 4175 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_21500 6991 6371 gene locus_tag LOCUS_21510 6991 6371 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111190.1 protein_id gnl|my_center|LOCUS_21510 7649 6984 gene locus_tag LOCUS_21520 7649 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence171 <1 1132 gene locus_tag LOCUS_21530 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257619.1:aminotransferase class V-fold PLP-dependent enzyme 1818 1207 gene locus_tag LOCUS_21540 gene scpB 1818 1207 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_21540 1817 2374 gene locus_tag LOCUS_21550 1817 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 3091 2528 gene locus_tag LOCUS_21560 3091 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 4503 3184 gene locus_tag LOCUS_21570 4503 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 5804 4500 gene locus_tag LOCUS_21580 5804 4500 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869244.1 protein_id gnl|my_center|LOCUS_21580 6516 5818 gene locus_tag LOCUS_21590 6516 5818 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_21590 7597 6524 gene locus_tag LOCUS_21600 gene mtnA 7597 6524 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence172 318 1694 gene locus_tag LOCUS_21610 318 1694 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811709.1 protein_id gnl|my_center|LOCUS_21610 2068 2967 gene locus_tag LOCUS_21620 2068 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 3067 3885 gene locus_tag LOCUS_21630 3067 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 4033 4557 gene locus_tag LOCUS_21640 4033 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 4574 5512 gene locus_tag LOCUS_21650 4574 5512 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259359.1 protein_id gnl|my_center|LOCUS_21650 5528 6769 gene locus_tag LOCUS_21660 5528 6769 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259357.1 protein_id gnl|my_center|LOCUS_21660 6766 7521 gene locus_tag LOCUS_21670 6766 7521 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259358.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence173 405 4652 gene locus_tag LOCUS_21680 gene essC 405 4652 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963368.1 protein_id gnl|my_center|LOCUS_21680 4649 4924 gene locus_tag LOCUS_21690 4649 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 4951 6792 gene locus_tag LOCUS_21700 4951 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 6879 7538 gene locus_tag LOCUS_21710 6879 7538 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence174 398 1393 gene locus_tag LOCUS_21720 398 1393 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_21720 1646 1410 gene locus_tag LOCUS_21730 1646 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2242 1673 gene locus_tag LOCUS_21740 gene efp 2242 1673 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_21740 5160 2332 gene locus_tag LOCUS_21750 5160 2332 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_21750 5889 5188 gene locus_tag LOCUS_21760 5889 5188 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_21760 6080 6802 gene locus_tag LOCUS_21770 6080 6802 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256017.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence175 <1 675 gene locus_tag LOCUS_21780 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929061.1:Uma2 family endonuclease 693 2087 gene locus_tag LOCUS_21790 gene selA 693 2087 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_21790 2113 3399 gene locus_tag LOCUS_21800 2113 3399 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175114.1 protein_id gnl|my_center|LOCUS_21800 5246 3396 gene locus_tag LOCUS_21810 5246 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21810 5622 5335 gene locus_tag LOCUS_21820 5622 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 5998 5633 gene locus_tag LOCUS_21830 5998 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21830 6458 7153 gene locus_tag LOCUS_21840 6458 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence176 2919 256 gene locus_tag LOCUS_21850 2919 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3326 3727 gene locus_tag LOCUS_21860 3326 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3870 4163 gene locus_tag LOCUS_21870 3870 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 5247 4174 gene locus_tag LOCUS_21880 gene hisC 5247 4174 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927011.1 protein_id gnl|my_center|LOCUS_21880 6592 5258 gene locus_tag LOCUS_21890 gene hisD 6592 5258 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258552.1 protein_id gnl|my_center|LOCUS_21890 7073 6600 gene locus_tag LOCUS_21900 7073 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 7194 7012 gene locus_tag LOCUS_21910 7194 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence177 2053 863 gene locus_tag LOCUS_21920 2053 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 4372 2213 gene locus_tag LOCUS_21930 4372 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 4883 5677 gene locus_tag LOCUS_21940 4883 5677 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933215.1 protein_id gnl|my_center|LOCUS_21940 5774 7060 gene locus_tag LOCUS_21950 gene murA 5774 7060 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257774.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence178 <1 948 gene locus_tag LOCUS_21960 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887765.1:prephenate dehydrogenase 965 2311 gene locus_tag LOCUS_21970 gene aroA 965 2311 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_21970 2308 3153 gene locus_tag LOCUS_21980 2308 3153 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_21980 3183 4364 gene locus_tag LOCUS_21990 gene aroC 3183 4364 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879991.1 protein_id gnl|my_center|LOCUS_21990 4361 5965 gene locus_tag LOCUS_22000 4361 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence179 1162 350 gene locus_tag LOCUS_22010 1162 350 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_22010 4787 1200 gene locus_tag LOCUS_22020 gene mfd 4787 1200 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_22020 <7206 4928 gene locus_tag LOCUS_22030 <7206 4928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257126.1:DNA gyrase subunit A >Feature sequence180 1672 38 gene locus_tag LOCUS_22040 1672 38 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_22040 2094 3206 gene locus_tag LOCUS_22050 gene gcvT 2094 3206 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_22050 3241 3627 gene locus_tag LOCUS_22060 gene gcvH 3241 3627 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259335.1 protein_id gnl|my_center|LOCUS_22060 3694 5049 gene locus_tag LOCUS_22070 gene gcvPA 3694 5049 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_22070 5062 6237 gene locus_tag LOCUS_22080 5062 6237 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650945.1 protein_id gnl|my_center|LOCUS_22080 6234 6659 gene locus_tag LOCUS_22090 6234 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence181 192 1532 gene locus_tag LOCUS_22100 gene sufD 192 1532 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_22100 1746 2219 gene locus_tag LOCUS_22110 1746 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2281 3504 gene locus_tag LOCUS_22120 2281 3504 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_22120 3548 3943 gene locus_tag LOCUS_22130 3548 3943 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_22130 3936 4256 gene locus_tag LOCUS_22140 3936 4256 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_22140 4466 4837 gene locus_tag LOCUS_22150 4466 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 5016 6500 gene locus_tag LOCUS_22160 gene guaB 5016 6500 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_22160 6671 7078 gene locus_tag LOCUS_22170 6671 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence182 1085 96 gene locus_tag LOCUS_22180 1085 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1644 1297 gene locus_tag LOCUS_22190 1644 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1883 1644 gene locus_tag LOCUS_22200 1883 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2175 3494 gene locus_tag LOCUS_22210 gene hemA 2175 3494 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258452.1 protein_id gnl|my_center|LOCUS_22210 3491 4450 gene locus_tag LOCUS_22220 gene hemC 3491 4450 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258453.1 protein_id gnl|my_center|LOCUS_22220 4443 5525 gene locus_tag LOCUS_22230 4443 5525 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_22230 5522 6562 gene locus_tag LOCUS_22240 gene hemB 5522 6562 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence183 471 229 gene locus_tag LOCUS_22250 471 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 1968 796 gene locus_tag LOCUS_22260 1968 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2055 2783 gene locus_tag LOCUS_22270 2055 2783 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_22270 2847 3620 gene locus_tag LOCUS_22280 2847 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 3602 5344 gene locus_tag LOCUS_22290 gene polX 3602 5344 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence184 1877 1632 gene locus_tag LOCUS_22300 1877 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2395 1901 gene locus_tag LOCUS_22310 2395 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081148.1 protein_id gnl|my_center|LOCUS_22310 2778 2392 gene locus_tag LOCUS_22320 2778 2392 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391954.1 protein_id gnl|my_center|LOCUS_22320 3866 2832 gene locus_tag LOCUS_22330 gene ruvB 3866 2832 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258937.1 protein_id gnl|my_center|LOCUS_22330 4145 3915 gene locus_tag LOCUS_22340 4145 3915 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403415.1 protein_id gnl|my_center|LOCUS_22340 5900 4236 gene locus_tag LOCUS_22350 gene argS 5900 4236 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_22350 6681 6055 gene locus_tag LOCUS_22360 6681 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence185 2059 1013 gene locus_tag LOCUS_22370 2059 1013 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_22370 3036 2098 gene locus_tag LOCUS_22380 3036 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 3413 5146 gene locus_tag LOCUS_22390 3413 5146 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_22390 5143 5604 gene locus_tag LOCUS_22400 5143 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 6094 5660 gene locus_tag LOCUS_22410 6094 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence186 331 2670 gene locus_tag LOCUS_22420 331 2670 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259434.1 protein_id gnl|my_center|LOCUS_22420 2976 2689 gene locus_tag LOCUS_22430 2976 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 4097 3075 gene locus_tag LOCUS_22440 gene iolG 4097 3075 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 protein_id gnl|my_center|LOCUS_22440 5056 4130 gene locus_tag LOCUS_22450 5056 4130 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 protein_id gnl|my_center|LOCUS_22450 6516 5068 gene locus_tag LOCUS_22460 6516 5068 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence187 3884 2478 gene locus_tag LOCUS_22470 3884 2478 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583125.1 protein_id gnl|my_center|LOCUS_22470 3985 5256 gene locus_tag LOCUS_22480 3985 5256 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_22480 5328 6227 gene locus_tag LOCUS_22490 5328 6227 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052303786.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence188 1121 465 gene locus_tag LOCUS_22500 1121 465 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_22500 2621 1323 gene locus_tag LOCUS_22510 2621 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 5218 2657 gene locus_tag LOCUS_22520 5218 2657 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258812.1 protein_id gnl|my_center|LOCUS_22520 5345 6667 gene locus_tag LOCUS_22530 5345 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence189 1082 321 gene locus_tag LOCUS_22540 1082 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 1495 1079 gene locus_tag LOCUS_22550 1495 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2696 1500 gene locus_tag LOCUS_22560 gene larC 2696 1500 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_22560 3514 2693 gene locus_tag LOCUS_22570 3514 2693 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986856.1 protein_id gnl|my_center|LOCUS_22570 3685 4950 gene locus_tag LOCUS_22580 3685 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 5015 5089 gene locus_tag LOCUS_t00380 5015 5089 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5327 5854 gene locus_tag LOCUS_22590 5327 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 5999 6499 gene locus_tag LOCUS_22600 5999 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence190 800 108 gene locus_tag LOCUS_22610 gene phoU 800 108 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_22610 1993 818 gene locus_tag LOCUS_22620 1993 818 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909314.1 protein_id gnl|my_center|LOCUS_22620 2679 1990 gene locus_tag LOCUS_22630 2679 1990 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_22630 3156 2686 gene locus_tag LOCUS_22640 3156 2686 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_22640 4005 3178 gene locus_tag LOCUS_22650 gene pstB 4005 3178 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_22650 4895 4005 gene locus_tag LOCUS_22660 gene pstA 4895 4005 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140014.1 protein_id gnl|my_center|LOCUS_22660 5859 4906 gene locus_tag LOCUS_22670 gene pstC 5859 4906 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_22670 <6605 5876 gene locus_tag LOCUS_22680 <6605 5876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259425.1:PstS family phosphate ABC transporter substrate-binding protein >Feature sequence191 1239 715 gene locus_tag LOCUS_22690 gene tpx 1239 715 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_22690 1543 2157 gene locus_tag LOCUS_22700 1543 2157 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_22700 2582 2163 gene locus_tag LOCUS_22710 2582 2163 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251148.1 protein_id gnl|my_center|LOCUS_22710 3380 2727 gene locus_tag LOCUS_22720 3380 2727 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_22720 3850 3377 gene locus_tag LOCUS_22730 3850 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 5797 4337 gene locus_tag LOCUS_22740 5797 4337 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259097.1 protein_id gnl|my_center|LOCUS_22740 6500 5928 gene locus_tag LOCUS_22750 6500 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence192 563 635 gene locus_tag LOCUS_t00390 563 635 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1090 3012 gene locus_tag LOCUS_22760 1090 3012 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_22760 3131 4114 gene locus_tag LOCUS_22770 3131 4114 CDS product initiation factor 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257268.1 protein_id gnl|my_center|LOCUS_22770 6068 4077 gene locus_tag LOCUS_22780 6068 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence193 481 1200 gene locus_tag LOCUS_22790 481 1200 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081684.1 protein_id gnl|my_center|LOCUS_22790 1320 2393 gene locus_tag LOCUS_22800 gene dhaK 1320 2393 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938278.1 protein_id gnl|my_center|LOCUS_22800 2426 3073 gene locus_tag LOCUS_22810 gene dhaL 2426 3073 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938279.1 protein_id gnl|my_center|LOCUS_22810 3120 4637 gene locus_tag LOCUS_22820 gene glpK 3120 4637 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_22820 4644 6248 gene locus_tag LOCUS_22830 gene glpA 4644 6248 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259132.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence194 173 733 gene locus_tag LOCUS_22840 173 733 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_22840 736 1701 gene locus_tag LOCUS_22850 736 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 1812 2183 gene locus_tag LOCUS_22860 1812 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2180 2674 gene locus_tag LOCUS_22870 2180 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 2940 2614 gene locus_tag LOCUS_22880 2940 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 6146 2937 gene locus_tag LOCUS_22890 6146 2937 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259651.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence195 1563 145 gene locus_tag LOCUS_22900 gene sufB 1563 145 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_22900 2344 1565 gene locus_tag LOCUS_22910 gene sufC 2344 1565 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_22910 2933 2727 gene locus_tag LOCUS_22920 2933 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 3361 3092 gene locus_tag LOCUS_22930 3361 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 4886 3459 gene locus_tag LOCUS_22940 4886 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 6020 4995 gene locus_tag LOCUS_22950 6020 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 >Feature sequence196 430 2322 gene locus_tag LOCUS_22960 430 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2423 3514 gene locus_tag LOCUS_22970 2423 3514 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence197 2 772 gene locus_tag LOCUS_22980 2 772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_22980 777 1496 gene locus_tag LOCUS_22990 777 1496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259472.1 protein_id gnl|my_center|LOCUS_22990 1493 2899 gene locus_tag LOCUS_23000 1493 2899 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259473.1 protein_id gnl|my_center|LOCUS_23000 2903 3961 gene locus_tag LOCUS_23010 2903 3961 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259474.1 protein_id gnl|my_center|LOCUS_23010 3971 5224 gene locus_tag LOCUS_23020 3971 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence198 932 30 gene locus_tag LOCUS_23030 932 30 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_23030 1757 951 gene locus_tag LOCUS_23040 1757 951 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937880.1 protein_id gnl|my_center|LOCUS_23040 2054 2968 gene locus_tag LOCUS_23050 2054 2968 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_23050 3005 4081 gene locus_tag LOCUS_23060 3005 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 4078 5295 gene locus_tag LOCUS_23070 4078 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 6079 5447 gene locus_tag LOCUS_23080 6079 5447 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227223.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence199 896 1975 gene locus_tag LOCUS_23090 896 1975 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_23090 3187 1934 gene locus_tag LOCUS_23100 3187 1934 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_23100 4653 3184 gene locus_tag LOCUS_23110 4653 3184 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057231.1 protein_id gnl|my_center|LOCUS_23110 4883 4665 gene locus_tag LOCUS_23120 4883 4665 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909342.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence200 2945 243 gene locus_tag LOCUS_23130 2945 243 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258507.1 protein_id gnl|my_center|LOCUS_23130 3708 2989 gene locus_tag LOCUS_23140 3708 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 4287 4081 gene locus_tag LOCUS_23150 4287 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 6203 4407 gene locus_tag LOCUS_23160 6203 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence201 479 991 gene locus_tag LOCUS_23170 479 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 4019 1056 gene locus_tag LOCUS_23180 gene uvrA 4019 1056 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_23180 <6311 4199 gene locus_tag LOCUS_23190 <6311 4199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938280.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence202 734 21 gene locus_tag LOCUS_23200 734 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 4517 834 gene locus_tag LOCUS_23210 4517 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 5695 4532 gene locus_tag LOCUS_23220 5695 4532 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257764.1 protein_id gnl|my_center|LOCUS_23220 5910 5710 gene locus_tag LOCUS_23230 5910 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence203 <1 1080 gene locus_tag LOCUS_23240 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986854.1:Fic family protein 1192 2550 gene locus_tag LOCUS_23250 1192 2550 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257684.1 protein_id gnl|my_center|LOCUS_23250 2547 3407 gene locus_tag LOCUS_23260 2547 3407 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_23260 3471 3686 gene locus_tag LOCUS_23270 3471 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 3763 5004 gene locus_tag LOCUS_23280 3763 5004 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_23280 5046 5636 gene locus_tag LOCUS_23290 5046 5636 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence204 163 672 gene locus_tag LOCUS_23300 163 672 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846827.1 protein_id gnl|my_center|LOCUS_23300 669 1118 gene locus_tag LOCUS_23310 669 1118 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846630.1 protein_id gnl|my_center|LOCUS_23310 1135 1392 gene locus_tag LOCUS_23320 1135 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1389 1898 gene locus_tag LOCUS_23330 1389 1898 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_23330 2005 4026 gene locus_tag LOCUS_23340 2005 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 4036 5916 gene locus_tag LOCUS_23350 4036 5916 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257388.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence205 599 108 gene locus_tag LOCUS_23360 599 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 1241 678 gene locus_tag LOCUS_23370 gene raiA 1241 678 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_23370 2041 1505 gene locus_tag LOCUS_23380 2041 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2069 2272 gene locus_tag LOCUS_23390 2069 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2606 2259 gene locus_tag LOCUS_23400 2606 2259 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922600.1 protein_id gnl|my_center|LOCUS_23400 3548 2625 gene locus_tag LOCUS_23410 3548 2625 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_23410 4534 3563 gene locus_tag LOCUS_23420 4534 3563 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_23420 5926 4553 gene locus_tag LOCUS_23430 5926 4553 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence206 <1 2548 gene locus_tag LOCUS_23440 <1 2548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258775.1:chromosome segregation protein SMC 2734 3672 gene locus_tag LOCUS_23450 gene ansA 2734 3672 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822018.1 protein_id gnl|my_center|LOCUS_23450 4655 3675 gene locus_tag LOCUS_23460 4655 3675 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258178.1 protein_id gnl|my_center|LOCUS_23460 5211 5136 gene locus_tag LOCUS_t00400 5211 5136 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5768 5271 gene locus_tag LOCUS_23470 5768 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence207 262 1212 gene locus_tag LOCUS_23480 262 1212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_23480 1209 2432 gene locus_tag LOCUS_23490 1209 2432 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_23490 2534 2830 gene locus_tag LOCUS_23500 2534 2830 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393693.1 protein_id gnl|my_center|LOCUS_23500 2852 3829 gene locus_tag LOCUS_23510 gene argF 2852 3829 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_23510 3902 4852 gene locus_tag LOCUS_23520 gene arcC 3902 4852 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence208 2418 148 gene locus_tag LOCUS_23530 2418 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 2860 2453 gene locus_tag LOCUS_23540 gene mce 2860 2453 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_23540 3232 3711 gene locus_tag LOCUS_23550 3232 3711 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089070.1 protein_id gnl|my_center|LOCUS_23550 3715 4488 gene locus_tag LOCUS_23560 3715 4488 CDS product YhfC family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013710.1 protein_id gnl|my_center|LOCUS_23560 <5859 4525 gene locus_tag LOCUS_23570 <5859 4525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228977.1:threonine--tRNA ligase >Feature sequence209 3434 126 gene locus_tag LOCUS_23580 3434 126 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390329.1 protein_id gnl|my_center|LOCUS_23580 5596 3494 gene locus_tag LOCUS_23590 gene ligA 5596 3494 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence210 1404 34 gene locus_tag LOCUS_23600 1404 34 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546631.1 protein_id gnl|my_center|LOCUS_23600 2033 1401 gene locus_tag LOCUS_23610 2033 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 4198 2297 gene locus_tag LOCUS_23620 gene dnaK 4198 2297 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_23620 5252 4305 gene locus_tag LOCUS_23630 5252 4305 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence211 <1 885 gene locus_tag LOCUS_23640 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868438.1:ornithine carbamoyltransferase 911 3115 gene locus_tag LOCUS_23650 911 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3119 3961 gene locus_tag LOCUS_23660 gene cdaA 3119 3961 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257450.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence212 1187 531 gene locus_tag LOCUS_23670 1187 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1339 2457 gene locus_tag LOCUS_23680 1339 2457 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_23680 3919 2462 gene locus_tag LOCUS_23690 3919 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 5270 4005 gene locus_tag LOCUS_23700 5270 4005 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence213 432 1967 gene locus_tag LOCUS_23710 432 1967 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_23710 1982 3301 gene locus_tag LOCUS_23720 1982 3301 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_23720 3475 5271 gene locus_tag LOCUS_23730 gene aspS 3475 5271 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence214 1281 1685 gene locus_tag LOCUS_23740 1281 1685 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_23740 1664 2083 gene locus_tag LOCUS_23750 1664 2083 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250023.1 protein_id gnl|my_center|LOCUS_23750 2365 4629 gene locus_tag LOCUS_23760 gene pnp 2365 4629 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence215 <1 2541 gene locus_tag LOCUS_23770 <1 2541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259203.1:phosphoribosylformylglycinamidine synthase subunit PurL 2562 3533 gene locus_tag LOCUS_23780 2562 3533 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681898.1 protein_id gnl|my_center|LOCUS_23780 3653 4150 gene locus_tag LOCUS_23790 3653 4150 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681904.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence216 1924 122 gene locus_tag LOCUS_23800 gene aceK 1924 122 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112397.1 protein_id gnl|my_center|LOCUS_23800 2744 2040 gene locus_tag LOCUS_23810 2744 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 <5681 2769 gene locus_tag LOCUS_23820 <5681 2769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926016.1:LAGLIDADG family homing endonuclease >Feature sequence217 2259 5447 gene locus_tag LOCUS_23830 2259 5447 CDS product DUF6519 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258040.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence218 <1 598 gene locus_tag LOCUS_23840 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005453899.1:formate dehydrogenase subunit alpha 657 1394 gene locus_tag LOCUS_23850 657 1394 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320694.1 protein_id gnl|my_center|LOCUS_23850 1398 2714 gene locus_tag LOCUS_23860 gene nrfD 1398 2714 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902582.1 protein_id gnl|my_center|LOCUS_23860 2717 2929 gene locus_tag LOCUS_23870 2717 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 3037 3690 gene locus_tag LOCUS_23880 3037 3690 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272330.1 protein_id gnl|my_center|LOCUS_23880 3926 3633 gene locus_tag LOCUS_23890 3926 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 4285 4503 gene locus_tag LOCUS_23900 4285 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 5120 4854 gene locus_tag LOCUS_23910 5120 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence219 1661 237 gene locus_tag LOCUS_23920 1661 237 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546190.1 protein_id gnl|my_center|LOCUS_23920 2306 2145 gene locus_tag LOCUS_23930 2306 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2366 2545 gene locus_tag LOCUS_23940 gene lysW 2366 2545 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_23940 2624 3514 gene locus_tag LOCUS_23950 gene lysX 2624 3514 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_23950 3508 4539 gene locus_tag LOCUS_23960 gene argC 3508 4539 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_23960 4564 5382 gene locus_tag LOCUS_23970 4564 5382 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence220 <1 976 gene locus_tag LOCUS_23980 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_121009479.1:bifunctional FO biosynthesis protein CofGH 995 2152 gene locus_tag LOCUS_23990 gene cofH 995 2152 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_23990 2344 3366 gene locus_tag LOCUS_24000 2344 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 3526 4353 gene locus_tag LOCUS_24010 3526 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 4384 5490 gene locus_tag LOCUS_24020 4384 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence221 <1 178 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cccctcaaaggtcgggtctcggttgcaag 775 461 gene locus_tag LOCUS_24030 775 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2090 843 gene locus_tag LOCUS_24040 2090 843 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_24040 2470 3072 gene locus_tag LOCUS_24050 2470 3072 CDS product DUF981 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228815.1 protein_id gnl|my_center|LOCUS_24050 3790 3104 gene locus_tag LOCUS_24060 3790 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 4069 5154 gene locus_tag LOCUS_24070 gene prfA 4069 5154 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence222 350 1339 gene locus_tag LOCUS_24080 350 1339 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_24080 1492 2349 gene locus_tag LOCUS_24090 1492 2349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_24090 2376 3263 gene locus_tag LOCUS_24100 2376 3263 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_24100 3336 3764 gene locus_tag LOCUS_24110 3336 3764 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005100764.1 protein_id gnl|my_center|LOCUS_24110 4027 5325 gene locus_tag LOCUS_24120 4027 5325 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence223 18 230 gene locus_tag LOCUS_24130 18 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 260 2644 gene locus_tag LOCUS_24140 260 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2847 4736 gene locus_tag LOCUS_24150 2847 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence224 1510 557 gene locus_tag LOCUS_24160 1510 557 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538553.1 protein_id gnl|my_center|LOCUS_24160 2976 1513 gene locus_tag LOCUS_24170 gene tilS 2976 1513 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_24170 4167 2980 gene locus_tag LOCUS_24180 4167 2980 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_24180 5018 4185 gene locus_tag LOCUS_24190 5018 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584075.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence225 698 240 gene locus_tag LOCUS_24200 698 240 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545150.1 protein_id gnl|my_center|LOCUS_24200 1171 695 gene locus_tag LOCUS_24210 1171 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 1650 1186 gene locus_tag LOCUS_24220 1650 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 3221 1662 gene locus_tag LOCUS_24230 3221 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 4382 3231 gene locus_tag LOCUS_24240 4382 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 <5373 4537 gene locus_tag LOCUS_24250 <5373 4537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259677.1:alanine--tRNA ligase >Feature sequence226 4113 1120 gene locus_tag LOCUS_24260 4113 1120 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_24260 4931 4353 gene locus_tag LOCUS_24270 4931 4353 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259093.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence227 286 1716 gene locus_tag LOCUS_24280 286 1716 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence228 1656 409 gene locus_tag LOCUS_24290 gene icd 1656 409 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878150.1 protein_id gnl|my_center|LOCUS_24290 2613 1687 gene locus_tag LOCUS_24300 2613 1687 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_24300 2922 4823 gene locus_tag LOCUS_24310 2922 4823 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257185.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence229 706 1527 gene locus_tag LOCUS_24320 706 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence230 <1 762 gene locus_tag LOCUS_24330 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881157.1:fumarate hydratase 759 1316 gene locus_tag LOCUS_24340 759 1316 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 protein_id gnl|my_center|LOCUS_24340 1340 2488 gene locus_tag LOCUS_24350 1340 2488 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_24350 2748 3662 gene locus_tag LOCUS_24360 2748 3662 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179067.1 protein_id gnl|my_center|LOCUS_24360 4208 3696 gene locus_tag LOCUS_24370 4208 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 4923 4210 gene locus_tag LOCUS_24380 4923 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence231 317 796 gene locus_tag LOCUS_24390 317 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 849 1562 gene locus_tag LOCUS_24400 849 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1559 1915 gene locus_tag LOCUS_24410 1559 1915 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_24410 1920 2288 gene locus_tag LOCUS_24420 1920 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2380 3303 gene locus_tag LOCUS_24430 gene miaA 2380 3303 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256258.1 protein_id gnl|my_center|LOCUS_24430 3284 4585 gene locus_tag LOCUS_24440 gene mtaB 3284 4585 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence232 799 497 gene locus_tag LOCUS_24450 799 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1379 837 gene locus_tag LOCUS_24460 1379 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 4696 1382 gene locus_tag LOCUS_24470 4696 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence233 1817 612 gene locus_tag LOCUS_24480 1817 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2499 1948 gene locus_tag LOCUS_24490 2499 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 3090 2572 gene locus_tag LOCUS_24500 3090 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 5080 3140 gene locus_tag LOCUS_24510 5080 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence234 659 354 gene locus_tag LOCUS_24520 659 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2933 753 gene locus_tag LOCUS_24530 gene pucD 2933 753 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223814.1 protein_id gnl|my_center|LOCUS_24530 4385 2973 gene locus_tag LOCUS_24540 4385 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 4768 4439 gene locus_tag LOCUS_24550 4768 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence235 1285 137 gene locus_tag LOCUS_24560 1285 137 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_24560 2446 1391 gene locus_tag LOCUS_24570 2446 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_24570 2652 2443 gene locus_tag LOCUS_24580 2652 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3154 2657 gene locus_tag LOCUS_24590 3154 2657 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933904.1 protein_id gnl|my_center|LOCUS_24590 4308 3154 gene locus_tag LOCUS_24600 4308 3154 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933903.1 protein_id gnl|my_center|LOCUS_24600 4553 4332 gene locus_tag LOCUS_24610 4553 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence236 <1 755 gene locus_tag LOCUS_24620 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020360.1:ABC transporter substrate-binding protein 1209 2471 gene locus_tag LOCUS_24630 gene thrC 1209 2471 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_24630 2608 4026 gene locus_tag LOCUS_24640 2608 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence237 2 556 gene locus_tag LOCUS_24650 2 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 663 2291 gene locus_tag LOCUS_24660 663 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2761 2258 gene locus_tag LOCUS_24670 2761 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 <5067 2778 gene locus_tag LOCUS_24680 <5067 2778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256856.1:SpoVR family protein >Feature sequence238 <1 705 gene locus_tag LOCUS_24690 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583296.1:asparagine--tRNA ligase 729 1955 gene locus_tag LOCUS_24700 729 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2549 2830 gene locus_tag LOCUS_24710 2549 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2827 3600 gene locus_tag LOCUS_24720 2827 3600 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228624.1 protein_id gnl|my_center|LOCUS_24720 3620 5020 gene locus_tag LOCUS_24730 3620 5020 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence239 157 3132 gene locus_tag LOCUS_24740 157 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 3250 3690 gene locus_tag LOCUS_24750 3250 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 4584 3709 gene locus_tag LOCUS_24760 4584 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence240 2362 620 gene locus_tag LOCUS_24770 gene pyk 2362 620 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_24770 3604 2420 gene locus_tag LOCUS_24780 3604 2420 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 protein_id gnl|my_center|LOCUS_24780 <4969 3660 gene locus_tag LOCUS_24790 <4969 3660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000426223.1:Tex family protein >Feature sequence241 1215 103 gene locus_tag LOCUS_24800 gene thiO 1215 103 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_24800 2069 1242 gene locus_tag LOCUS_24810 gene thiX 2069 1242 CDS product HMP/thiamine ABC transporter permease ThiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245037.1 protein_id gnl|my_center|LOCUS_24810 3788 2079 gene locus_tag LOCUS_24820 3788 2079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021751.1 protein_id gnl|my_center|LOCUS_24820 4403 3792 gene locus_tag LOCUS_24830 4403 3792 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776332.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence242 158 1864 gene locus_tag LOCUS_24840 158 1864 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263392.1 protein_id gnl|my_center|LOCUS_24840 1954 2247 gene locus_tag LOCUS_24850 1954 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2593 2904 gene locus_tag LOCUS_24860 2593 2904 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227760.1 protein_id gnl|my_center|LOCUS_24860 2901 3062 gene locus_tag LOCUS_24870 2901 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 4692 3157 gene locus_tag LOCUS_24880 gene hutH 4692 3157 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence243 465 1502 gene locus_tag LOCUS_24890 465 1502 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257087.1 protein_id gnl|my_center|LOCUS_24890 1531 2331 gene locus_tag LOCUS_24900 1531 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 2316 3434 gene locus_tag LOCUS_24910 2316 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence244 815 513 gene locus_tag LOCUS_24920 gene groES 815 513 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583188.1 protein_id gnl|my_center|LOCUS_24920 999 3239 gene locus_tag LOCUS_24930 999 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 4208 3192 gene locus_tag LOCUS_24940 4208 3192 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence245 1284 718 gene locus_tag LOCUS_24950 1284 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 3239 1281 gene locus_tag LOCUS_24960 3239 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 4679 3417 gene locus_tag LOCUS_24970 4679 3417 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392878.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence246 2782 113 gene locus_tag LOCUS_24980 2782 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 4322 2814 gene locus_tag LOCUS_24990 4322 2814 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259717.1 protein_id gnl|my_center|LOCUS_24990 4670 4326 gene locus_tag LOCUS_25000 4670 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence247 728 147 gene locus_tag LOCUS_25010 728 147 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_25010 1890 742 gene locus_tag LOCUS_25020 1890 742 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907730.1 protein_id gnl|my_center|LOCUS_25020 2785 1898 gene locus_tag LOCUS_25030 2785 1898 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227145.1 protein_id gnl|my_center|LOCUS_25030 <4739 2973 gene locus_tag LOCUS_25040 <4739 2973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974947.1:transketolase C-terminal domain-containing protein >Feature sequence248 302 93 gene locus_tag LOCUS_25050 302 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 670 392 gene locus_tag LOCUS_25060 670 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392238.1 protein_id gnl|my_center|LOCUS_25060 1420 683 gene locus_tag LOCUS_25070 1420 683 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392237.1 protein_id gnl|my_center|LOCUS_25070 1729 2598 gene locus_tag LOCUS_25080 1729 2598 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_25080 2623 3819 gene locus_tag LOCUS_25090 2623 3819 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence249 404 201 gene locus_tag LOCUS_25100 404 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 655 401 gene locus_tag LOCUS_25110 655 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 893 1927 gene locus_tag LOCUS_25120 gene bfmBAA 893 1927 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852555.1 protein_id gnl|my_center|LOCUS_25120 1992 2975 gene locus_tag LOCUS_25130 1992 2975 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257563.1 protein_id gnl|my_center|LOCUS_25130 3020 4318 gene locus_tag LOCUS_25140 3020 4318 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257562.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence250 <1 1083 gene locus_tag LOCUS_25150 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257970.1:molybdopterin molybdotransferase MoeA 2843 2655 gene locus_tag LOCUS_25160 2843 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 3073 3834 gene locus_tag LOCUS_25170 gene tpiA 3073 3834 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_25170 3838 4626 gene locus_tag LOCUS_25180 3838 4626 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259072.1 protein_id gnl|my_center|LOCUS_25180 >Feature sequence251 <1 1744 gene locus_tag LOCUS_25190 <1 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390869.1:amidotransferase 1, exosortase A system-associated 2445 1786 gene locus_tag LOCUS_25200 2445 1786 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 protein_id gnl|my_center|LOCUS_25200 3475 2456 gene locus_tag LOCUS_25210 3475 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 <4685 3487 gene locus_tag LOCUS_25220 <4685 3487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392405.1:NFACT RNA binding domain-containing protein >Feature sequence252 1946 1719 gene locus_tag LOCUS_25230 1946 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2715 3017 gene locus_tag LOCUS_25240 2715 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 3386 4264 gene locus_tag LOCUS_25250 gene xerD 3386 4264 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809554.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence253 <1 1148 gene locus_tag LOCUS_25260 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973141.1:glycosyltransferase family 4 protein 1581 1255 gene locus_tag LOCUS_25270 1581 1255 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_25270 1810 1568 gene locus_tag LOCUS_25280 1810 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 4577 1980 gene locus_tag LOCUS_25290 4577 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence254 <1 695 gene locus_tag LOCUS_25300 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227934.1:ABC transporter ATP-binding protein 688 1392 gene locus_tag LOCUS_25310 688 1392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931473.1 protein_id gnl|my_center|LOCUS_25310 2115 1399 gene locus_tag LOCUS_25320 2115 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3375 2602 gene locus_tag LOCUS_25330 3375 2602 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_25330 3674 4003 gene locus_tag LOCUS_25340 3674 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 3981 4418 gene locus_tag LOCUS_25350 3981 4418 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391728.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence255 678 91 gene locus_tag LOCUS_25360 678 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2836 1508 gene locus_tag LOCUS_25370 2836 1508 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_25370 4366 2996 gene locus_tag LOCUS_25380 4366 2996 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence256 541 1011 gene locus_tag LOCUS_25390 541 1011 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318983.1 protein_id gnl|my_center|LOCUS_25390 1023 1730 gene locus_tag LOCUS_25400 1023 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2192 1782 gene locus_tag LOCUS_25410 2192 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 2414 3472 gene locus_tag LOCUS_25420 gene cytR 2414 3472 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815292.1 protein_id gnl|my_center|LOCUS_25420 3507 4526 gene locus_tag LOCUS_25430 gene iolX 3507 4526 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence257 2042 1626 gene locus_tag LOCUS_25440 2042 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 4296 2260 gene locus_tag LOCUS_25450 gene uvrB 4296 2260 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256952.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence258 1364 582 gene locus_tag LOCUS_25460 1364 582 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338588.1 protein_id gnl|my_center|LOCUS_25460 2554 1391 gene locus_tag LOCUS_25470 2554 1391 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_25470 3546 2584 gene locus_tag LOCUS_25480 3546 2584 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665997.1 protein_id gnl|my_center|LOCUS_25480 3770 4387 gene locus_tag LOCUS_25490 3770 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence259 487 981 gene locus_tag LOCUS_25500 487 981 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259748.1 protein_id gnl|my_center|LOCUS_25500 992 2341 gene locus_tag LOCUS_25510 gene ffh 992 2341 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257918.1 protein_id gnl|my_center|LOCUS_25510 2592 3374 gene locus_tag LOCUS_25520 2592 3374 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_25520 3589 3514 gene locus_tag LOCUS_t00410 3589 3514 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3695 3623 gene locus_tag LOCUS_t00420 3695 3623 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence260 <1 1968 gene locus_tag LOCUS_25530 <1 1968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140254.1:tail fiber domain-containing protein 1965 2243 gene locus_tag LOCUS_25540 1965 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256207.1 protein_id gnl|my_center|LOCUS_25540 <4565 2325 gene locus_tag LOCUS_25550 <4565 2325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259651.1:BTAD domain-containing putative transcriptional regulator >Feature sequence261 1446 499 gene locus_tag LOCUS_25560 1446 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2211 1462 gene locus_tag LOCUS_25570 2211 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 3080 2316 gene locus_tag LOCUS_25580 3080 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 3714 3094 gene locus_tag LOCUS_25590 gene cas4 3714 3094 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259413.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence262 1607 441 gene locus_tag LOCUS_25600 gene nifS 1607 441 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_25600 2156 1935 gene locus_tag LOCUS_25610 2156 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402859.1 protein_id gnl|my_center|LOCUS_25610 2569 3525 gene locus_tag LOCUS_25620 2569 3525 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence263 1103 96 gene locus_tag LOCUS_25630 gene thiL 1103 96 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392671.1 protein_id gnl|my_center|LOCUS_25630 1934 1122 gene locus_tag LOCUS_25640 gene thiM 1934 1122 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256281.1 protein_id gnl|my_center|LOCUS_25640 2613 1951 gene locus_tag LOCUS_25650 gene thiE 2613 1951 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_25650 3250 2597 gene locus_tag LOCUS_25660 gene thiE 3250 2597 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_25660 4023 3247 gene locus_tag LOCUS_25670 4023 3247 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403988.1 protein_id gnl|my_center|LOCUS_25670 4358 4134 gene locus_tag LOCUS_25680 gene thiS 4358 4134 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015109.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence264 121 765 gene locus_tag LOCUS_25690 121 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 769 1191 gene locus_tag LOCUS_25700 769 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1214 4339 gene locus_tag LOCUS_25710 gene ileS 1214 4339 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence265 <1 640 gene locus_tag LOCUS_25720 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017869292.1:chlorite dismutase family protein 637 1689 gene locus_tag LOCUS_25730 gene hemE 637 1689 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_25730 1805 2767 gene locus_tag LOCUS_25740 gene hemH 1805 2767 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887774.1 protein_id gnl|my_center|LOCUS_25740 2767 4182 gene locus_tag LOCUS_25750 gene hemY 2767 4182 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_25750 >Feature sequence266 >Feature sequence267 2611 614 gene locus_tag LOCUS_25760 2611 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3351 2932 gene locus_tag LOCUS_25770 3351 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3994 3353 gene locus_tag LOCUS_25780 3994 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence268 1513 398 gene locus_tag LOCUS_25790 1513 398 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275375.1 protein_id gnl|my_center|LOCUS_25790 1858 1517 gene locus_tag LOCUS_25800 1858 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25800 2116 1859 gene locus_tag LOCUS_25810 2116 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2295 2588 gene locus_tag LOCUS_25820 2295 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2823 3818 gene locus_tag LOCUS_25830 2823 3818 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172623.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence269 <1 2028 gene locus_tag LOCUS_25840 <1 2028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258810.1:serine/threonine-protein kinase 2159 4000 gene locus_tag LOCUS_25850 2159 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence270 2856 430 gene locus_tag LOCUS_25860 gene cas10 2856 430 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256465.1 protein_id gnl|my_center|LOCUS_25860 3842 2853 gene locus_tag LOCUS_25870 3842 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence271 <1 564 gene locus_tag LOCUS_25880 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545765.1:DUF3782 domain-containing protein 604 1161 gene locus_tag LOCUS_25890 604 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1695 1216 gene locus_tag LOCUS_25900 1695 1216 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404877.1 protein_id gnl|my_center|LOCUS_25900 2901 1759 gene locus_tag LOCUS_25910 2901 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 3310 2918 gene locus_tag LOCUS_25920 3310 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence272 1082 1366 gene locus_tag LOCUS_25930 1082 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 1501 2148 gene locus_tag LOCUS_25940 1501 2148 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_25940 2166 3449 gene locus_tag LOCUS_25950 gene folP 2166 3449 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391658.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence273 849 202 gene locus_tag LOCUS_25960 849 202 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_25960 3792 1057 gene locus_tag LOCUS_25970 gene ppdK 3792 1057 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_25970 3993 3844 gene locus_tag LOCUS_25980 3993 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence274 448 1812 gene locus_tag LOCUS_25990 gene secD 448 1812 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258879.1 protein_id gnl|my_center|LOCUS_25990 1849 2226 gene locus_tag LOCUS_26000 1849 2226 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256912.1 protein_id gnl|my_center|LOCUS_26000 2252 3184 gene locus_tag LOCUS_26010 gene secF 2252 3184 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence275 1445 156 gene locus_tag LOCUS_26020 gene aceA 1445 156 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173860.1 protein_id gnl|my_center|LOCUS_26020 3155 1578 gene locus_tag LOCUS_26030 gene aceB 3155 1578 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227987.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence276 <1 1437 gene locus_tag LOCUS_26040 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256864.1:urocanate hydratase 1451 2350 gene locus_tag LOCUS_26050 1451 2350 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889409.1 protein_id gnl|my_center|LOCUS_26050 2359 3612 gene locus_tag LOCUS_26060 gene hutI 2359 3612 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889408.1 protein_id gnl|my_center|LOCUS_26060 3609 3926 gene locus_tag LOCUS_26070 3609 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence277 1352 180 gene locus_tag LOCUS_26080 1352 180 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_26080 1918 1340 gene locus_tag LOCUS_26090 1918 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 3159 1915 gene locus_tag LOCUS_26100 3159 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 <4126 3379 gene locus_tag LOCUS_26110 <4126 3379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257490.1:peptide chain release factor N(5)-glutamine methyltransferase >Feature sequence278 552 391 gene locus_tag LOCUS_26120 552 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence279 313 1584 gene locus_tag LOCUS_26130 313 1584 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_26130 1631 2836 gene locus_tag LOCUS_26140 gene argJ 1631 2836 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259189.1 protein_id gnl|my_center|LOCUS_26140 2851 3831 gene locus_tag LOCUS_26150 2851 3831 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035526.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence280 930 1226 gene locus_tag LOCUS_26160 930 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 1249 2112 gene locus_tag LOCUS_26170 1249 2112 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249696.1 protein_id gnl|my_center|LOCUS_26170 2129 2959 gene locus_tag LOCUS_26180 gene yqeB 2129 2959 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence281 593 240 gene locus_tag LOCUS_26190 593 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392059.1 protein_id gnl|my_center|LOCUS_26190 1121 678 gene locus_tag LOCUS_26200 1121 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1818 1183 gene locus_tag LOCUS_26210 1818 1183 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809037.1 protein_id gnl|my_center|LOCUS_26210 2006 2704 gene locus_tag LOCUS_26220 gene npdG 2006 2704 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_26220 2715 3488 gene locus_tag LOCUS_26230 gene cofE 2715 3488 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence282 3 2144 gene locus_tag LOCUS_26240 3 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2834 2235 gene locus_tag LOCUS_26250 2834 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 3941 3066 gene locus_tag LOCUS_26260 3941 3066 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256891.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence283 118 396 gene locus_tag LOCUS_26270 118 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 356 616 gene locus_tag LOCUS_26280 356 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 1905 613 gene locus_tag LOCUS_26290 1905 613 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244177.1 protein_id gnl|my_center|LOCUS_26290 3083 1908 gene locus_tag LOCUS_26300 gene lysS 3083 1908 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173924.1 protein_id gnl|my_center|LOCUS_26300 <4045 3107 gene locus_tag LOCUS_26310 <4045 3107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257089.1:[LysW]-lysine hydrolase >Feature sequence284 101 658 gene locus_tag LOCUS_26320 101 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 762 1598 gene locus_tag LOCUS_26330 762 1598 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_26330 2422 1613 gene locus_tag LOCUS_26340 2422 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 3464 2481 gene locus_tag LOCUS_26350 3464 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence285 302 769 gene locus_tag LOCUS_26360 302 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 999 1613 gene locus_tag LOCUS_26370 999 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 1603 2484 gene locus_tag LOCUS_26380 1603 2484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433732.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence286 363 1616 gene locus_tag LOCUS_26390 363 1616 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083215.1 protein_id gnl|my_center|LOCUS_26390 1801 2628 gene locus_tag LOCUS_26400 1801 2628 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125459.1 protein_id gnl|my_center|LOCUS_26400 <3962 2618 gene locus_tag LOCUS_26410 <3962 2618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228420.1:dihydropyrimidinase >Feature sequence287 <1 702 gene locus_tag LOCUS_26420 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162490285.1:FHA domain-containing protein 852 2642 gene locus_tag LOCUS_26430 852 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence288 <1 583 gene locus_tag LOCUS_26440 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258489.1:pitrilysin family protein 593 1162 gene locus_tag LOCUS_26450 593 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 1311 1955 gene locus_tag LOCUS_26460 1311 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1970 3451 gene locus_tag LOCUS_26470 1970 3451 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349591.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence289 288 713 gene locus_tag LOCUS_26480 gene csm2 288 713 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256464.1 protein_id gnl|my_center|LOCUS_26480 716 1552 gene locus_tag LOCUS_26490 gene csm3 716 1552 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021929.1 protein_id gnl|my_center|LOCUS_26490 1555 2577 gene locus_tag LOCUS_26500 gene csm4 1555 2577 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256462.1 protein_id gnl|my_center|LOCUS_26500 2574 3701 gene locus_tag LOCUS_26510 2574 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence290 3595 1616 gene locus_tag LOCUS_26520 3595 1616 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence291 1857 514 gene locus_tag LOCUS_26530 1857 514 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_26530 3362 1890 gene locus_tag LOCUS_26540 3362 1890 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence292 1421 132 gene locus_tag LOCUS_26550 1421 132 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_26550 2130 1588 gene locus_tag LOCUS_26560 2130 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence293 579 301 gene locus_tag LOCUS_26570 579 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1597 581 gene locus_tag LOCUS_26580 gene cas1 1597 581 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_26580 3065 1599 gene locus_tag LOCUS_26590 3065 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256460.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence294 <1 1118 gene locus_tag LOCUS_26600 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887975.1:beta-N-acetylhexosaminidase 1497 3482 gene locus_tag LOCUS_26610 1497 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence295 634 1602 gene locus_tag LOCUS_26620 634 1602 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257661.1 protein_id gnl|my_center|LOCUS_26620 2562 1594 gene locus_tag LOCUS_26630 gene mvaD 2562 1594 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_26630 3184 2612 gene locus_tag LOCUS_26640 3184 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence296 730 2424 gene locus_tag LOCUS_26650 730 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2464 3657 gene locus_tag LOCUS_26660 2464 3657 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228024.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence297 847 2172 gene locus_tag LOCUS_26670 847 2172 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 protein_id gnl|my_center|LOCUS_26670 3522 2182 gene locus_tag LOCUS_26680 3522 2182 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015207390.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence298 508 1530 gene locus_tag LOCUS_26690 508 1530 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967034.1 protein_id gnl|my_center|LOCUS_26690 1530 2345 gene locus_tag LOCUS_26700 1530 2345 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 protein_id gnl|my_center|LOCUS_26700 2603 3034 gene locus_tag LOCUS_26710 2603 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 3142 3492 gene locus_tag LOCUS_26720 3142 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 >Feature sequence299 580 1431 gene locus_tag LOCUS_26730 580 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 1458 2318 gene locus_tag LOCUS_26740 1458 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 2315 3619 gene locus_tag LOCUS_26750 2315 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence300 <1 1133 gene locus_tag LOCUS_26760 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000795703.1:aminomethyl-transferring glycine dehydrogenase subunit 2 1238 1822 gene locus_tag LOCUS_26770 1238 1822 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_26770 1915 3561 gene locus_tag LOCUS_26780 1915 3561 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_26780 >Feature sequence301 671 426 gene locus_tag LOCUS_26790 671 426 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257713.1 protein_id gnl|my_center|LOCUS_26790 1962 925 gene locus_tag LOCUS_26800 1962 925 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257871.1 protein_id gnl|my_center|LOCUS_26800 2960 1995 gene locus_tag LOCUS_26810 2960 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 <3643 2985 gene locus_tag LOCUS_26820 <3643 2985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542174.1:XdhC/CoxI family protein >Feature sequence302 980 393 gene locus_tag LOCUS_26830 980 393 CDS product HAS-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256340.1 protein_id gnl|my_center|LOCUS_26830 1720 1058 gene locus_tag LOCUS_26840 gene tenA 1720 1058 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144509.1 protein_id gnl|my_center|LOCUS_26840 2656 1739 gene locus_tag LOCUS_26850 gene rarD 2656 1739 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_26850 3566 3030 gene locus_tag LOCUS_26860 3566 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence303 548 1843 gene locus_tag LOCUS_26870 548 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 3546 1951 gene locus_tag LOCUS_26880 3546 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence304 28 1308 gene locus_tag LOCUS_26890 gene glpB 28 1308 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259131.1 protein_id gnl|my_center|LOCUS_26890 1309 2574 gene locus_tag LOCUS_26900 1309 2574 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259130.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence305 1218 166 gene locus_tag LOCUS_26910 1218 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26910 1664 1215 gene locus_tag LOCUS_26920 1664 1215 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213216.1 protein_id gnl|my_center|LOCUS_26920 1894 2643 gene locus_tag LOCUS_26930 1894 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2640 3407 gene locus_tag LOCUS_26940 gene istB 2640 3407 CDS product IS21-like element ISGsu6 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940725.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence306 823 2865 gene locus_tag LOCUS_26950 823 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 3012 3230 gene locus_tag LOCUS_26960 3012 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence307 <1 1923 gene locus_tag LOCUS_26970 <1 1923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228376.1:DUF499 domain-containing protein 3376 1970 gene locus_tag LOCUS_26980 gene miaB 3376 1970 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence308 873 43 gene locus_tag LOCUS_26990 873 43 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763508.1 protein_id gnl|my_center|LOCUS_26990 1927 926 gene locus_tag LOCUS_27000 gene mer 1927 926 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_27000 2757 2110 gene locus_tag LOCUS_27010 2757 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2943 3374 gene locus_tag LOCUS_27020 2943 3374 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393832.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence309 2039 174 gene locus_tag LOCUS_27030 2039 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 3225 2029 gene locus_tag LOCUS_27040 3225 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence310 894 2594 gene locus_tag LOCUS_27050 gene dnaX 894 2594 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660459.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence311 2468 822 gene locus_tag LOCUS_27060 2468 822 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence312 322 621 gene locus_tag LOCUS_27070 322 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 1134 3077 gene locus_tag LOCUS_27080 1134 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence313 1694 147 gene locus_tag LOCUS_27090 1694 147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_27090 <3470 1761 gene locus_tag LOCUS_27100 <3470 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258968.1:BMP family ABC transporter substrate-binding protein >Feature sequence314 301 1998 gene locus_tag LOCUS_27110 301 1998 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_27110 2014 2808 gene locus_tag LOCUS_27120 2014 2808 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence315 457 569 gene locus_tag LOCUS_r00010 457 569 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1433 642 gene locus_tag LOCUS_27130 1433 642 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_27130 2654 1464 gene locus_tag LOCUS_27140 2654 1464 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_27140 <3384 2658 gene locus_tag LOCUS_27150 <3384 2658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259080.1:ABC transporter permease subunit >Feature sequence316 276 1553 gene locus_tag LOCUS_27160 276 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2234 3172 gene locus_tag LOCUS_27170 gene ftsY 2234 3172 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence317 1370 165 gene locus_tag LOCUS_27180 1370 165 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258460.1 protein_id gnl|my_center|LOCUS_27180 1867 1367 gene locus_tag LOCUS_27190 1867 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1949 2206 gene locus_tag LOCUS_27200 1949 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence318 1 450 gene locus_tag LOCUS_27210 1 450 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_27210 1560 481 gene locus_tag LOCUS_27220 1560 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 1995 3158 gene locus_tag LOCUS_27230 1995 3158 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986854.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence319 507 1211 gene locus_tag LOCUS_27240 507 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 1225 2976 gene locus_tag LOCUS_27250 1225 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence320 314 1228 gene locus_tag LOCUS_27260 314 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 1212 1874 gene locus_tag LOCUS_27270 1212 1874 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258429.1 protein_id gnl|my_center|LOCUS_27270 1871 3115 gene locus_tag LOCUS_27280 1871 3115 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258428.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence321 368 1390 gene locus_tag LOCUS_27290 gene purM 368 1390 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257146.1 protein_id gnl|my_center|LOCUS_27290 1400 2026 gene locus_tag LOCUS_27300 gene purN 1400 2026 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679594.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence322 174 1598 gene locus_tag LOCUS_27310 gene glnA 174 1598 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087603.1 protein_id gnl|my_center|LOCUS_27310 1778 3130 gene locus_tag LOCUS_27320 gene glnA 1778 3130 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259233.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence323 1541 96 gene locus_tag LOCUS_27330 gene proS 1541 96 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257194.1 protein_id gnl|my_center|LOCUS_27330 2494 1538 gene locus_tag LOCUS_27340 2494 1538 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_27340 <3261 2574 gene locus_tag LOCUS_27350 <3261 2574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259716.1:metallophosphoesterase >Feature sequence324 <1 909 gene locus_tag LOCUS_27360 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258802.1:CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 942 1976 gene locus_tag LOCUS_27370 gene cas1 942 1976 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 protein_id gnl|my_center|LOCUS_27370 1985 2251 gene locus_tag LOCUS_27380 gene cas2 1985 2251 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258804.1 protein_id gnl|my_center|LOCUS_27380 2248 2910 gene locus_tag LOCUS_27390 gene cas4 2248 2910 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258805.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence325 577 2985 gene locus_tag LOCUS_27400 577 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927840.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence326 2114 1722 gene locus_tag LOCUS_27410 2114 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2443 2111 gene locus_tag LOCUS_27420 2443 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence327 776 276 gene locus_tag LOCUS_27430 776 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1514 798 gene locus_tag LOCUS_27440 1514 798 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_27440 3016 1610 gene locus_tag LOCUS_27450 3016 1610 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460522.1 protein_id gnl|my_center|LOCUS_27450 >Feature sequence328 2550 1714 gene locus_tag LOCUS_27460 2550 1714 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974811.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence329 >Feature sequence330 1221 166 gene locus_tag LOCUS_27470 1221 166 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480164.1 protein_id gnl|my_center|LOCUS_27470 1341 2732 gene locus_tag LOCUS_27480 1341 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence331 2494 23 gene locus_tag LOCUS_27490 2494 23 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450289.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence332 1097 321 gene locus_tag LOCUS_27500 1097 321 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933545.1 protein_id gnl|my_center|LOCUS_27500 1456 2193 gene locus_tag LOCUS_27510 1456 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 2967 2182 gene locus_tag LOCUS_27520 2967 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence333 51 1103 gene locus_tag LOCUS_27530 51 1103 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_27530 1119 1463 gene locus_tag LOCUS_27540 1119 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 1978 2469 gene locus_tag LOCUS_27550 gene moaC 1978 2469 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence334 1758 1102 gene locus_tag LOCUS_27560 1758 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2668 1799 gene locus_tag LOCUS_27570 2668 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence335 >Feature sequence336 618 2684 gene locus_tag LOCUS_27580 618 2684 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_27580 >Feature sequence337 796 260 gene locus_tag LOCUS_27590 796 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 <2880 826 gene locus_tag LOCUS_27600 <2880 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083471740.1:helix-turn-helix domain-containing protein >Feature sequence338 2877 1885 gene locus_tag LOCUS_27610 2877 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057419.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence339 2646 1093 gene locus_tag LOCUS_27620 2646 1093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_27620 >Feature sequence340 493 1512 gene locus_tag LOCUS_27630 gene trpS 493 1512 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257293.1 protein_id gnl|my_center|LOCUS_27630 1553 2143 gene locus_tag LOCUS_27640 1553 2143 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence341 268 2706 gene locus_tag LOCUS_27650 268 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence342 147 2735 gene locus_tag LOCUS_27660 147 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence343 1490 282 gene locus_tag LOCUS_27670 1490 282 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_27670 2433 2035 gene locus_tag LOCUS_27680 2433 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence344 1138 317 gene locus_tag LOCUS_27690 1138 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence345 217 1686 gene locus_tag LOCUS_27700 217 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence346 1831 530 gene locus_tag LOCUS_27710 1831 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 2182 1964 gene locus_tag LOCUS_27720 2182 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence347 2408 432 gene locus_tag LOCUS_27730 2408 432 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888825.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence348 1315 62 gene locus_tag LOCUS_27740 1315 62 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259142.1 protein_id gnl|my_center|LOCUS_27740 2203 1613 gene locus_tag LOCUS_27750 gene cysC 2203 1613 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256588.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence349 2293 1493 gene locus_tag LOCUS_27760 2293 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence350 1796 762 gene locus_tag LOCUS_27770 1796 762 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence351 1670 876 gene locus_tag LOCUS_27780 1670 876 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_27780 2174 1767 gene locus_tag LOCUS_27790 2174 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2482 2171 gene locus_tag LOCUS_27800 2482 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence352 672 256 gene locus_tag LOCUS_27810 672 256 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257827.1 protein_id gnl|my_center|LOCUS_27810 1119 688 gene locus_tag LOCUS_27820 1119 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2281 1169 gene locus_tag LOCUS_27830 2281 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence353 603 1601 gene locus_tag LOCUS_27840 603 1601 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825317.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence354 <1 888 gene locus_tag LOCUS_27850 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256080.1:NAD(P)/FAD-dependent oxidoreductase 920 2032 gene locus_tag LOCUS_27860 920 2032 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence355 325 122 gene locus_tag LOCUS_27870 325 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 861 547 gene locus_tag LOCUS_27880 861 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 1426 848 gene locus_tag LOCUS_27890 1426 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence356 1912 428 gene locus_tag LOCUS_27900 1912 428 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902151.1 protein_id gnl|my_center|LOCUS_27900 2470 2156 gene locus_tag LOCUS_27910 2470 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence357 261 1478 gene locus_tag LOCUS_27920 gene trpB 261 1478 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_27920 1475 2260 gene locus_tag LOCUS_27930 gene trpA 1475 2260 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256579.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence358 1064 1708 gene locus_tag LOCUS_27940 1064 1708 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944374.1 protein_id gnl|my_center|LOCUS_27940 <2463 1681 gene locus_tag LOCUS_27950 <2463 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257118.1:SulP family inorganic anion transporter >Feature sequence359 79 1422 gene locus_tag LOCUS_27960 gene mgtE 79 1422 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_27960 >Feature sequence360 53 679 gene locus_tag LOCUS_27970 53 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 <2409 1049 gene locus_tag LOCUS_27980 <2409 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258322.1:O-antigen ligase family protein >Feature sequence361 93 416 gene locus_tag LOCUS_27990 93 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 2268 790 gene locus_tag LOCUS_28000 2268 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence362 180 362 gene locus_tag LOCUS_28010 180 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 1639 419 gene locus_tag LOCUS_28020 1639 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 2222 1611 gene locus_tag LOCUS_28030 2222 1611 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942328.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence363 <1 790 gene locus_tag LOCUS_28040 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062284418.1:(2Fe-2S)-binding protein 787 1911 gene locus_tag LOCUS_28050 787 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence364 147 527 gene locus_tag LOCUS_28060 147 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28060 527 1009 gene locus_tag LOCUS_28070 527 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 1006 1485 gene locus_tag LOCUS_28080 1006 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 1482 1862 gene locus_tag LOCUS_28090 1482 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence365 168 668 gene locus_tag LOCUS_28100 168 668 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111658546.1 protein_id gnl|my_center|LOCUS_28100 680 1723 gene locus_tag LOCUS_28110 gene holB 680 1723 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_28110 2061 1768 gene locus_tag LOCUS_28120 2061 1768 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066790080.1 protein_id gnl|my_center|LOCUS_28120 >Feature sequence366 144 1049 gene locus_tag LOCUS_28130 gene iolB 144 1049 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196071.1 protein_id gnl|my_center|LOCUS_28130 1046 2062 gene locus_tag LOCUS_28140 1046 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence367 325 1215 gene locus_tag LOCUS_28150 325 1215 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_28150 2169 1303 gene locus_tag LOCUS_28160 2169 1303 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_28160 >Feature sequence368 2198 195 gene locus_tag LOCUS_28170 2198 195 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976970.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence369 410 1924 gene locus_tag LOCUS_28180 410 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence370 2 349 gene locus_tag LOCUS_28190 2 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 472 1374 gene locus_tag LOCUS_28200 472 1374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence371 297 1649 gene locus_tag LOCUS_28210 297 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 2228 2031 gene locus_tag LOCUS_28220 2228 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence372 >Feature sequence373 68 871 gene locus_tag LOCUS_28230 gene trpC 68 871 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660663.1 protein_id gnl|my_center|LOCUS_28230 912 1160 gene locus_tag LOCUS_28240 912 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 1177 1857 gene locus_tag LOCUS_28250 1177 1857 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence374 2160 640 gene locus_tag LOCUS_28260 2160 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence375 1097 228 gene locus_tag LOCUS_28270 1097 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence376 1 636 gene locus_tag LOCUS_28280 1 636 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255938.1 protein_id gnl|my_center|LOCUS_28280 1281 640 gene locus_tag LOCUS_28290 gene pdxH 1281 640 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056186.1 protein_id gnl|my_center|LOCUS_28290 <2142 1361 gene locus_tag LOCUS_28300 <2142 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028181.1:endo alpha-1,4 polygalactosaminidase >Feature sequence377 882 1991 gene locus_tag LOCUS_28310 882 1991 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence378 1913 903 gene locus_tag LOCUS_28320 1913 903 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967034.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence379 1 1944 gene locus_tag LOCUS_28330 1 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence380 94 1644 gene locus_tag LOCUS_28340 94 1644 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence381 >Feature sequence382 2 391 gene locus_tag LOCUS_28350 2 391 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_28350 1842 472 gene locus_tag LOCUS_28360 1842 472 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_28360