>Feature sequence001 1417 197 gene locus_tag LOCUS_00010 1417 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2075 1479 gene locus_tag LOCUS_00020 gene phoU 2075 1479 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_00020 2248 3309 gene locus_tag LOCUS_00030 2248 3309 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979533.1 protein_id gnl|my_center|LOCUS_00030 3320 4135 gene locus_tag LOCUS_00040 3320 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4527 4132 gene locus_tag LOCUS_00050 4527 4132 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762564.1 protein_id gnl|my_center|LOCUS_00050 5694 4543 gene locus_tag LOCUS_00060 5694 4543 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 protein_id gnl|my_center|LOCUS_00060 6748 5699 gene locus_tag LOCUS_00070 6748 5699 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249136.1 protein_id gnl|my_center|LOCUS_00070 6861 7310 gene locus_tag LOCUS_00080 6861 7310 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868810.1 protein_id gnl|my_center|LOCUS_00080 7413 8522 gene locus_tag LOCUS_00090 gene cdvC 7413 8522 CDS product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_00090 9259 8519 gene locus_tag LOCUS_00100 9259 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9465 11267 gene locus_tag LOCUS_00110 gene glmS 9465 11267 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867349.1 protein_id gnl|my_center|LOCUS_00110 12700 11264 gene locus_tag LOCUS_00120 12700 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13704 12697 gene locus_tag LOCUS_00130 13704 12697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13770 14213 gene locus_tag LOCUS_00140 13770 14213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14696 14205 gene locus_tag LOCUS_00150 14696 14205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15160 14693 gene locus_tag LOCUS_00160 15160 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15627 15166 gene locus_tag LOCUS_00170 15627 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17648 15750 gene locus_tag LOCUS_00180 gene gatE 17648 15750 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146615.1 protein_id gnl|my_center|LOCUS_00180 19000 17645 gene locus_tag LOCUS_00190 gene gatD 19000 17645 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_00190 19080 20279 gene locus_tag LOCUS_00200 19080 20279 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_00200 20952 20269 gene locus_tag LOCUS_00210 20952 20269 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037909261.1 protein_id gnl|my_center|LOCUS_00210 21058 21933 gene locus_tag LOCUS_00220 21058 21933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21930 22931 gene locus_tag LOCUS_00230 21930 22931 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870598.1 protein_id gnl|my_center|LOCUS_00230 24516 22918 gene locus_tag LOCUS_00240 24516 22918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25834 24464 gene locus_tag LOCUS_00250 25834 24464 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251229.1 protein_id gnl|my_center|LOCUS_00250 >Feature sequence002 39 881 gene locus_tag LOCUS_00260 39 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 931 2046 gene locus_tag LOCUS_00270 931 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 2107 3348 gene locus_tag LOCUS_00280 gene thrC 2107 3348 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_00280 3341 4690 gene locus_tag LOCUS_00290 3341 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 4730 7354 gene locus_tag LOCUS_00300 gene copA 4730 7354 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_00300 7351 7806 gene locus_tag LOCUS_00310 7351 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 7842 8744 gene locus_tag LOCUS_00320 7842 8744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980531.1 protein_id gnl|my_center|LOCUS_00320 8734 9486 gene locus_tag LOCUS_00330 8734 9486 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249186.1 protein_id gnl|my_center|LOCUS_00330 9574 10443 gene locus_tag LOCUS_00340 9574 10443 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083270.1 protein_id gnl|my_center|LOCUS_00340 10502 10774 gene locus_tag LOCUS_00350 10502 10774 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_00350 10878 14039 gene locus_tag LOCUS_00360 gene ileS 10878 14039 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876987.1 protein_id gnl|my_center|LOCUS_00360 14047 14979 gene locus_tag LOCUS_00370 14047 14979 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868652.1 protein_id gnl|my_center|LOCUS_00370 14976 15719 gene locus_tag LOCUS_00380 14976 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 15743 16006 gene locus_tag LOCUS_00390 15743 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 16074 17303 gene locus_tag LOCUS_00400 16074 17303 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762445.1 protein_id gnl|my_center|LOCUS_00400 18079 17300 gene locus_tag LOCUS_00410 gene nucS 18079 17300 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250849.1 protein_id gnl|my_center|LOCUS_00410 18272 18976 gene locus_tag LOCUS_00420 18272 18976 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978652.1 protein_id gnl|my_center|LOCUS_00420 19059 20597 gene locus_tag LOCUS_00430 19059 20597 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083271.1 protein_id gnl|my_center|LOCUS_00430 20648 21562 gene locus_tag LOCUS_00440 20648 21562 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083273.1 protein_id gnl|my_center|LOCUS_00440 21573 22460 gene locus_tag LOCUS_00450 21573 22460 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015918758.1 protein_id gnl|my_center|LOCUS_00450 22522 23613 gene locus_tag LOCUS_00460 22522 23613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867312.1 protein_id gnl|my_center|LOCUS_00460 23711 23638 gene locus_tag LOCUS_t00010 23711 23638 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 23876 24616 gene locus_tag LOCUS_00470 23876 24616 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762640.1 protein_id gnl|my_center|LOCUS_00470 >Feature sequence003 1882 974 gene locus_tag LOCUS_00480 1882 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 2640 1879 gene locus_tag LOCUS_00490 2640 1879 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978941.1 protein_id gnl|my_center|LOCUS_00490 2955 2665 gene locus_tag LOCUS_00500 2955 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 3171 2968 gene locus_tag LOCUS_00510 3171 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 3495 3229 gene locus_tag LOCUS_00520 3495 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 3713 3492 gene locus_tag LOCUS_00530 3713 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 3834 4565 gene locus_tag LOCUS_00540 gene psmA 3834 4565 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870095.1 protein_id gnl|my_center|LOCUS_00540 4666 5361 gene locus_tag LOCUS_00550 4666 5361 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762590.1 protein_id gnl|my_center|LOCUS_00550 5358 6026 gene locus_tag LOCUS_00560 gene rrp4 5358 6026 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250586.1 protein_id gnl|my_center|LOCUS_00560 6026 6748 gene locus_tag LOCUS_00570 gene rrp41 6026 6748 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846320.1 protein_id gnl|my_center|LOCUS_00570 6752 7588 gene locus_tag LOCUS_00580 gene rrp42 6752 7588 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867735.1 protein_id gnl|my_center|LOCUS_00580 7635 7865 gene locus_tag LOCUS_00590 7635 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 7792 8115 gene locus_tag LOCUS_00600 7792 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 8743 8093 gene locus_tag LOCUS_00610 8743 8093 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 protein_id gnl|my_center|LOCUS_00610 8834 9442 gene locus_tag LOCUS_00620 8834 9442 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763732.1 protein_id gnl|my_center|LOCUS_00620 10048 9497 gene locus_tag LOCUS_00630 10048 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 13550 10083 gene locus_tag LOCUS_00640 13550 10083 CDS product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877671.1 protein_id gnl|my_center|LOCUS_00640 14722 13547 gene locus_tag LOCUS_00650 gene nrfD 14722 13547 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_00650 15272 14736 gene locus_tag LOCUS_00660 15272 14736 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877669.1 protein_id gnl|my_center|LOCUS_00660 16104 15619 gene locus_tag LOCUS_00670 16104 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 17035 16211 gene locus_tag LOCUS_00680 17035 16211 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527105.1 protein_id gnl|my_center|LOCUS_00680 17892 17032 gene locus_tag LOCUS_00690 17892 17032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878632.1 protein_id gnl|my_center|LOCUS_00690 19222 17867 gene locus_tag LOCUS_00700 19222 17867 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550379.1 protein_id gnl|my_center|LOCUS_00700 19784 19215 gene locus_tag LOCUS_00710 19784 19215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_00710 20290 19787 gene locus_tag LOCUS_00720 20290 19787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 22352 20295 gene locus_tag LOCUS_00730 gene nosZ 22352 20295 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_00730 23469 22435 gene locus_tag LOCUS_00740 23469 22435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 protein_id gnl|my_center|LOCUS_00740 <24926 23503 gene locus_tag LOCUS_00750 <24926 23503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167827733.1:citramalate synthase >Feature sequence004 1330 497 gene locus_tag LOCUS_00760 1330 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00760 2177 1311 gene locus_tag LOCUS_00770 2177 1311 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_00770 2977 2162 gene locus_tag LOCUS_00780 2977 2162 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991426.1 protein_id gnl|my_center|LOCUS_00780 3873 3019 gene locus_tag LOCUS_00790 3873 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 4159 3875 gene locus_tag LOCUS_00800 4159 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 4793 4239 gene locus_tag LOCUS_00810 4793 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 4924 5460 gene locus_tag LOCUS_00820 4924 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 5462 6955 gene locus_tag LOCUS_00830 5462 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 6972 7457 gene locus_tag LOCUS_00840 6972 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 8543 7452 gene locus_tag LOCUS_00850 gene hisC 8543 7452 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496679.1 protein_id gnl|my_center|LOCUS_00850 8872 8540 gene locus_tag LOCUS_00860 gene hisI 8872 8540 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879442.1 protein_id gnl|my_center|LOCUS_00860 9633 8869 gene locus_tag LOCUS_00870 gene hisF 9633 8869 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_00870 10354 9635 gene locus_tag LOCUS_00880 gene hisA 10354 9635 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228483.1 protein_id gnl|my_center|LOCUS_00880 10960 10361 gene locus_tag LOCUS_00890 gene hisH 10960 10361 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244267.1 protein_id gnl|my_center|LOCUS_00890 11535 10963 gene locus_tag LOCUS_00900 gene hisB 11535 10963 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061060.1 protein_id gnl|my_center|LOCUS_00900 12484 11522 gene locus_tag LOCUS_00910 gene hisG 12484 11522 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846572.1 protein_id gnl|my_center|LOCUS_00910 12668 13552 gene locus_tag LOCUS_00920 12668 13552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 14425 13544 gene locus_tag LOCUS_00930 14425 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 15786 14470 gene locus_tag LOCUS_00940 15786 14470 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030374.1 protein_id gnl|my_center|LOCUS_00940 15668 16066 gene locus_tag LOCUS_00950 15668 16066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 16052 16126 gene locus_tag LOCUS_t00020 16052 16126 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17231 16131 gene locus_tag LOCUS_00960 17231 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 18415 17228 gene locus_tag LOCUS_00970 18415 17228 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_00970 18618 19193 gene locus_tag LOCUS_00980 18618 19193 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986538.1 protein_id gnl|my_center|LOCUS_00980 19883 19170 gene locus_tag LOCUS_00990 19883 19170 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053836.1 protein_id gnl|my_center|LOCUS_00990 20885 20142 gene locus_tag LOCUS_01000 20885 20142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 21065 21631 gene locus_tag LOCUS_01010 21065 21631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 >Feature sequence005 236 36 gene locus_tag LOCUS_01020 236 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 312 860 gene locus_tag LOCUS_01030 312 860 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762118.1 protein_id gnl|my_center|LOCUS_01030 1750 854 gene locus_tag LOCUS_01040 1750 854 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_01040 2632 1796 gene locus_tag LOCUS_01050 gene cyoE 2632 1796 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846973.1 protein_id gnl|my_center|LOCUS_01050 3563 2880 gene locus_tag LOCUS_01060 gene pyrH 3563 2880 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249260.1 protein_id gnl|my_center|LOCUS_01060 4837 3605 gene locus_tag LOCUS_01070 gene tuf 4837 3605 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978219.1 protein_id gnl|my_center|LOCUS_01070 5057 5650 gene locus_tag LOCUS_01080 5057 5650 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_01080 6432 5647 gene locus_tag LOCUS_01090 6432 5647 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762787.1 protein_id gnl|my_center|LOCUS_01090 6907 6479 gene locus_tag LOCUS_01100 6907 6479 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978222.1 protein_id gnl|my_center|LOCUS_01100 7010 7396 gene locus_tag LOCUS_01110 7010 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 7369 7800 gene locus_tag LOCUS_01120 7369 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8747 7818 gene locus_tag LOCUS_01130 gene pyrB 8747 7818 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_01130 8850 9956 gene locus_tag LOCUS_01140 8850 9956 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968140.1 protein_id gnl|my_center|LOCUS_01140 11035 9971 gene locus_tag LOCUS_01150 11035 9971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443464.1 protein_id gnl|my_center|LOCUS_01150 11820 11029 gene locus_tag LOCUS_01160 11820 11029 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966038.1 protein_id gnl|my_center|LOCUS_01160 12710 11805 gene locus_tag LOCUS_01170 12710 11805 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810039.1 protein_id gnl|my_center|LOCUS_01170 12784 14019 gene locus_tag LOCUS_01180 12784 14019 CDS product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719312.1 protein_id gnl|my_center|LOCUS_01180 14027 14932 gene locus_tag LOCUS_01190 14027 14932 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337276.1 protein_id gnl|my_center|LOCUS_01190 14934 15710 gene locus_tag LOCUS_01200 14934 15710 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337275.1 protein_id gnl|my_center|LOCUS_01200 15719 16783 gene locus_tag LOCUS_01210 15719 16783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311608.1 protein_id gnl|my_center|LOCUS_01210 16815 18161 gene locus_tag LOCUS_01220 16815 18161 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_01220 18626 18144 gene locus_tag LOCUS_01230 18626 18144 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_01230 19483 18623 gene locus_tag LOCUS_01240 19483 18623 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532039.1 protein_id gnl|my_center|LOCUS_01240 >Feature sequence006 <1 795 gene locus_tag LOCUS_01250 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867808.1:NAD(P)-dependent glycerol-1-phosphate dehydrogenase 1656 784 gene locus_tag LOCUS_01260 1656 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 2444 1653 gene locus_tag LOCUS_01270 2444 1653 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013805.1 protein_id gnl|my_center|LOCUS_01270 3251 2538 gene locus_tag LOCUS_01280 3251 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 4100 3255 gene locus_tag LOCUS_01290 4100 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 4416 4174 gene locus_tag LOCUS_01300 gene albA 4416 4174 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061063.1 protein_id gnl|my_center|LOCUS_01300 4847 4533 gene locus_tag LOCUS_01310 4847 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 5370 4960 gene locus_tag LOCUS_01320 5370 4960 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978185.1 protein_id gnl|my_center|LOCUS_01320 5443 6312 gene locus_tag LOCUS_01330 5443 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 6319 8928 gene locus_tag LOCUS_01340 6319 8928 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762664.1 protein_id gnl|my_center|LOCUS_01340 9007 10053 gene locus_tag LOCUS_01350 9007 10053 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762663.1 protein_id gnl|my_center|LOCUS_01350 10053 11495 gene locus_tag LOCUS_01360 10053 11495 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240320.1 protein_id gnl|my_center|LOCUS_01360 11497 12459 gene locus_tag LOCUS_01370 11497 12459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250752.1 protein_id gnl|my_center|LOCUS_01370 12456 13421 gene locus_tag LOCUS_01380 12456 13421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762316.1 protein_id gnl|my_center|LOCUS_01380 14110 13418 gene locus_tag LOCUS_01390 14110 13418 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848553.1 protein_id gnl|my_center|LOCUS_01390 14202 15416 gene locus_tag LOCUS_01400 14202 15416 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090011.1 protein_id gnl|my_center|LOCUS_01400 16086 15421 gene locus_tag LOCUS_01410 16086 15421 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250368.1 protein_id gnl|my_center|LOCUS_01410 16692 16123 gene locus_tag LOCUS_01420 16692 16123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 17183 16695 gene locus_tag LOCUS_01430 17183 16695 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869872.1 protein_id gnl|my_center|LOCUS_01430 17657 17187 gene locus_tag LOCUS_01440 17657 17187 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869871.1 protein_id gnl|my_center|LOCUS_01440 17843 17673 gene locus_tag LOCUS_01450 17843 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 18942 18133 gene locus_tag LOCUS_01460 18942 18133 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525321.1 protein_id gnl|my_center|LOCUS_01460 19454 18939 gene locus_tag LOCUS_01470 19454 18939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence007 285 452 gene locus_tag LOCUS_01480 285 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 969 445 gene locus_tag LOCUS_01490 969 445 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_01490 1002 1442 gene locus_tag LOCUS_01500 gene moaC 1002 1442 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978449.1 protein_id gnl|my_center|LOCUS_01500 1435 1968 gene locus_tag LOCUS_01510 1435 1968 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762932.1 protein_id gnl|my_center|LOCUS_01510 2408 1965 gene locus_tag LOCUS_01520 2408 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 2969 2478 gene locus_tag LOCUS_01530 2969 2478 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_01530 3070 3999 gene locus_tag LOCUS_01540 3070 3999 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_01540 4028 5155 gene locus_tag LOCUS_01550 4028 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 5199 6446 gene locus_tag LOCUS_01560 5199 6446 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_01560 6453 6719 gene locus_tag LOCUS_01570 6453 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 9525 6712 gene locus_tag LOCUS_01580 9525 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 9893 9522 gene locus_tag LOCUS_01590 9893 9522 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978750.1 protein_id gnl|my_center|LOCUS_01590 10798 10010 gene locus_tag LOCUS_01600 10798 10010 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_01600 10853 12094 gene locus_tag LOCUS_01610 10853 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978805.1 protein_id gnl|my_center|LOCUS_01610 12124 12528 gene locus_tag LOCUS_01620 12124 12528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 13496 12525 gene locus_tag LOCUS_01630 13496 12525 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761771.1 protein_id gnl|my_center|LOCUS_01630 14130 13603 gene locus_tag LOCUS_01640 14130 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761769.1 protein_id gnl|my_center|LOCUS_01640 14426 14127 gene locus_tag LOCUS_01650 14426 14127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 15418 14486 gene locus_tag LOCUS_01660 15418 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248979.1 protein_id gnl|my_center|LOCUS_01660 16392 15415 gene locus_tag LOCUS_01670 16392 15415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050003361.1 protein_id gnl|my_center|LOCUS_01670 16517 16939 gene locus_tag LOCUS_01680 16517 16939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 18096 16936 gene locus_tag LOCUS_01690 18096 16936 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846613.1 protein_id gnl|my_center|LOCUS_01690 <19225 18128 gene locus_tag LOCUS_01700 <19225 18128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259178.1:leucyl aminopeptidase >Feature sequence008 120 281 gene locus_tag LOCUS_01710 120 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 913 278 gene locus_tag LOCUS_01720 913 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 1144 962 gene locus_tag LOCUS_01730 1144 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 1294 2712 gene locus_tag LOCUS_01740 gene merA 1294 2712 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031938.1 protein_id gnl|my_center|LOCUS_01740 2752 3135 gene locus_tag LOCUS_01750 2752 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 3148 3429 gene locus_tag LOCUS_01760 3148 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 3839 3426 gene locus_tag LOCUS_01770 gene nikR 3839 3426 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870053.1 protein_id gnl|my_center|LOCUS_01770 3933 5816 gene locus_tag LOCUS_01780 3933 5816 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989665.1 protein_id gnl|my_center|LOCUS_01780 5842 6183 gene locus_tag LOCUS_01790 5842 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 7955 6180 gene locus_tag LOCUS_01800 7955 6180 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970160.1 protein_id gnl|my_center|LOCUS_01800 8476 7952 gene locus_tag LOCUS_01810 8476 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 8910 8515 gene locus_tag LOCUS_01820 8910 8515 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762119.1 protein_id gnl|my_center|LOCUS_01820 9082 9993 gene locus_tag LOCUS_01830 9082 9993 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227955.1 protein_id gnl|my_center|LOCUS_01830 10132 11178 gene locus_tag LOCUS_01840 gene rtcA 10132 11178 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_01840 11182 11733 gene locus_tag LOCUS_01850 11182 11733 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879804.1 protein_id gnl|my_center|LOCUS_01850 12914 11730 gene locus_tag LOCUS_01860 12914 11730 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795164.1 protein_id gnl|my_center|LOCUS_01860 13036 13398 gene locus_tag LOCUS_01870 gene pth2 13036 13398 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_01870 13409 14776 gene locus_tag LOCUS_01880 gene truD 13409 14776 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762266.1 protein_id gnl|my_center|LOCUS_01880 14814 15467 gene locus_tag LOCUS_01890 14814 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 15525 16184 gene locus_tag LOCUS_01900 15525 16184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 16187 16675 gene locus_tag LOCUS_01910 16187 16675 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846746.1 protein_id gnl|my_center|LOCUS_01910 16680 17900 gene locus_tag LOCUS_01920 16680 17900 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762086.1 protein_id gnl|my_center|LOCUS_01920 18312 17902 gene locus_tag LOCUS_01930 18312 17902 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence009 2689 539 gene locus_tag LOCUS_01940 2689 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 2832 3983 gene locus_tag LOCUS_01950 2832 3983 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_01950 4040 4651 gene locus_tag LOCUS_01960 4040 4651 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978560.1 protein_id gnl|my_center|LOCUS_01960 4658 5866 gene locus_tag LOCUS_01970 4658 5866 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 protein_id gnl|my_center|LOCUS_01970 5909 6754 gene locus_tag LOCUS_01980 5909 6754 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881157.1 protein_id gnl|my_center|LOCUS_01980 6751 7329 gene locus_tag LOCUS_01990 6751 7329 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 protein_id gnl|my_center|LOCUS_01990 7399 8328 gene locus_tag LOCUS_02000 7399 8328 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762591.1 protein_id gnl|my_center|LOCUS_02000 8816 8325 gene locus_tag LOCUS_02010 8816 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 10272 8800 gene locus_tag LOCUS_02020 10272 8800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 10825 10307 gene locus_tag LOCUS_02030 10825 10307 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146480.1 protein_id gnl|my_center|LOCUS_02030 10914 12164 gene locus_tag LOCUS_02040 10914 12164 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762742.1 protein_id gnl|my_center|LOCUS_02040 12167 14110 gene locus_tag LOCUS_02050 12167 14110 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762741.1 protein_id gnl|my_center|LOCUS_02050 15173 14112 gene locus_tag LOCUS_02060 15173 14112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_02060 16842 15184 gene locus_tag LOCUS_02070 16842 15184 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626058.1 protein_id gnl|my_center|LOCUS_02070 17950 16859 gene locus_tag LOCUS_02080 17950 16859 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence010 765 349 gene locus_tag LOCUS_02090 765 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 926 762 gene locus_tag LOCUS_02100 926 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 1143 907 gene locus_tag LOCUS_02110 1143 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 1936 1136 gene locus_tag LOCUS_02120 1936 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2118 4499 gene locus_tag LOCUS_02130 2118 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 4528 5367 gene locus_tag LOCUS_02140 gene udp 4528 5367 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_02140 5394 6347 gene locus_tag LOCUS_02150 5394 6347 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385089.1 protein_id gnl|my_center|LOCUS_02150 6344 7030 gene locus_tag LOCUS_02160 gene deoC 6344 7030 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060904.1 protein_id gnl|my_center|LOCUS_02160 7027 7968 gene locus_tag LOCUS_02170 7027 7968 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210028.1 protein_id gnl|my_center|LOCUS_02170 8006 9550 gene locus_tag LOCUS_02180 8006 9550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 protein_id gnl|my_center|LOCUS_02180 9604 11127 gene locus_tag LOCUS_02190 9604 11127 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762231.1 protein_id gnl|my_center|LOCUS_02190 11183 12232 gene locus_tag LOCUS_02200 11183 12232 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249610.1 protein_id gnl|my_center|LOCUS_02200 12236 13231 gene locus_tag LOCUS_02210 12236 13231 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249611.1 protein_id gnl|my_center|LOCUS_02210 13330 14358 gene locus_tag LOCUS_02220 13330 14358 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140018.1 protein_id gnl|my_center|LOCUS_02220 14342 15229 gene locus_tag LOCUS_02230 gene pstC 14342 15229 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405018.1 protein_id gnl|my_center|LOCUS_02230 15226 16068 gene locus_tag LOCUS_02240 gene pstA 15226 16068 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_02240 >Feature sequence011 1361 330 gene locus_tag LOCUS_02250 1361 330 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024146.1 protein_id gnl|my_center|LOCUS_02250 1416 2294 gene locus_tag LOCUS_02260 1416 2294 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_02260 3016 2399 gene locus_tag LOCUS_02270 3016 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 3114 3590 gene locus_tag LOCUS_02280 3114 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 5374 3587 gene locus_tag LOCUS_02290 5374 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 6138 5371 gene locus_tag LOCUS_02300 6138 5371 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_02300 6199 6693 gene locus_tag LOCUS_02310 6199 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 7085 6738 gene locus_tag LOCUS_02320 7085 6738 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249177.1 protein_id gnl|my_center|LOCUS_02320 7452 7066 gene locus_tag LOCUS_02330 7452 7066 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879111.1 protein_id gnl|my_center|LOCUS_02330 7565 7822 gene locus_tag LOCUS_02340 7565 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 7862 9112 gene locus_tag LOCUS_02350 7862 9112 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763075.1 protein_id gnl|my_center|LOCUS_02350 9139 10980 gene locus_tag LOCUS_02360 9139 10980 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240328.1 protein_id gnl|my_center|LOCUS_02360 12147 10984 gene locus_tag LOCUS_02370 12147 10984 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762837.1 protein_id gnl|my_center|LOCUS_02370 12355 12140 gene locus_tag LOCUS_02380 12355 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 12509 12898 gene locus_tag LOCUS_02390 12509 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 13241 12855 gene locus_tag LOCUS_02400 13241 12855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 14821 13244 gene locus_tag LOCUS_02410 14821 13244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 15336 14938 gene locus_tag LOCUS_02420 15336 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 <16396 15419 gene locus_tag LOCUS_02430 <16396 15419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917973.1:lysine--tRNA ligase >Feature sequence012 865 2019 gene locus_tag LOCUS_02440 865 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 2030 3001 gene locus_tag LOCUS_02450 2030 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 3004 3594 gene locus_tag LOCUS_02460 3004 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3669 3596 gene locus_tag LOCUS_t00030 3669 3596 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4382 3693 gene locus_tag LOCUS_02470 4382 3693 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249827.1 protein_id gnl|my_center|LOCUS_02470 4444 4755 gene locus_tag LOCUS_02480 4444 4755 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870476.1 protein_id gnl|my_center|LOCUS_02480 4781 5221 gene locus_tag LOCUS_02490 4781 5221 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 protein_id gnl|my_center|LOCUS_02490 5847 5233 gene locus_tag LOCUS_02500 5847 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 6011 6334 gene locus_tag LOCUS_02510 6011 6334 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014597.1 protein_id gnl|my_center|LOCUS_02510 6341 6493 gene locus_tag LOCUS_02520 6341 6493 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868637.1 protein_id gnl|my_center|LOCUS_02520 6490 6807 gene locus_tag LOCUS_02530 6490 6807 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762212.1 protein_id gnl|my_center|LOCUS_02530 7720 6779 gene locus_tag LOCUS_02540 7720 6779 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146465.1 protein_id gnl|my_center|LOCUS_02540 8190 7765 gene locus_tag LOCUS_02550 8190 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 8292 8447 gene locus_tag LOCUS_02560 8292 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 8880 8954 gene locus_tag LOCUS_t00040 8880 8954 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9005 9496 gene locus_tag LOCUS_02570 gene dps 9005 9496 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065551.1 protein_id gnl|my_center|LOCUS_02570 10514 9504 gene locus_tag LOCUS_02580 10514 9504 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_02580 10594 10669 gene locus_tag LOCUS_t00050 10594 10669 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10793 11806 gene locus_tag LOCUS_02590 10793 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 12319 11876 gene locus_tag LOCUS_02600 12319 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 12694 12620 gene locus_tag LOCUS_t00060 12694 12620 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13679 12723 gene locus_tag LOCUS_02610 13679 12723 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868156.1 protein_id gnl|my_center|LOCUS_02610 13861 13673 gene locus_tag LOCUS_02620 13861 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 14865 13909 gene locus_tag LOCUS_02630 14865 13909 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 protein_id gnl|my_center|LOCUS_02630 14974 15921 gene locus_tag LOCUS_02640 14974 15921 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978410.1 protein_id gnl|my_center|LOCUS_02640 >Feature sequence013 209 649 gene locus_tag LOCUS_02650 209 649 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868556.1 protein_id gnl|my_center|LOCUS_02650 1738 662 gene locus_tag LOCUS_02660 1738 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2109 3665 gene locus_tag LOCUS_02670 2109 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 3670 5418 gene locus_tag LOCUS_02680 3670 5418 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973978.1 protein_id gnl|my_center|LOCUS_02680 5474 6532 gene locus_tag LOCUS_02690 5474 6532 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_02690 6628 8040 gene locus_tag LOCUS_02700 6628 8040 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_02700 9496 8042 gene locus_tag LOCUS_02710 gene xylB 9496 8042 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270490.1 protein_id gnl|my_center|LOCUS_02710 9603 10334 gene locus_tag LOCUS_02720 9603 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 10452 10312 gene locus_tag LOCUS_02730 10452 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 10740 12386 gene locus_tag LOCUS_02740 gene thsB 10740 12386 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_02740 12373 12639 gene locus_tag LOCUS_02750 12373 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 12639 12890 gene locus_tag LOCUS_02760 12639 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 12922 14007 gene locus_tag LOCUS_02770 12922 14007 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_02770 14331 14002 gene locus_tag LOCUS_02780 14331 14002 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250445.1 protein_id gnl|my_center|LOCUS_02780 14408 15202 gene locus_tag LOCUS_02790 14408 15202 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583576.1 protein_id gnl|my_center|LOCUS_02790 15667 15209 gene locus_tag LOCUS_02800 15667 15209 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978465.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence014 725 249 gene locus_tag LOCUS_02810 725 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 2170 803 gene locus_tag LOCUS_02820 2170 803 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 protein_id gnl|my_center|LOCUS_02820 2230 2934 gene locus_tag LOCUS_02830 2230 2934 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_02830 2984 3292 gene locus_tag LOCUS_02840 gene yciH 2984 3292 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496503.1 protein_id gnl|my_center|LOCUS_02840 4188 3289 gene locus_tag LOCUS_02850 4188 3289 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_02850 4501 4268 gene locus_tag LOCUS_02860 4501 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 4403 5833 gene locus_tag LOCUS_02870 gene cysS 4403 5833 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_02870 5866 6570 gene locus_tag LOCUS_02880 5866 6570 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 protein_id gnl|my_center|LOCUS_02880 6595 6912 gene locus_tag LOCUS_02890 6595 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 7406 6909 gene locus_tag LOCUS_02900 gene rimI 7406 6909 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762816.1 protein_id gnl|my_center|LOCUS_02900 7511 8608 gene locus_tag LOCUS_02910 7511 8608 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250198.1 protein_id gnl|my_center|LOCUS_02910 9605 8583 gene locus_tag LOCUS_02920 9605 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 9624 10667 gene locus_tag LOCUS_02930 gene mer 9624 10667 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_02930 10692 11963 gene locus_tag LOCUS_02940 10692 11963 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762402.1 protein_id gnl|my_center|LOCUS_02940 11960 12253 gene locus_tag LOCUS_02950 11960 12253 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762401.1 protein_id gnl|my_center|LOCUS_02950 12305 13909 gene locus_tag LOCUS_02960 12305 13909 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496733.1 protein_id gnl|my_center|LOCUS_02960 13860 14984 gene locus_tag LOCUS_02970 13860 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence015 1577 1248 gene locus_tag LOCUS_02980 1577 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 1459 2598 gene locus_tag LOCUS_02990 1459 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 2642 3259 gene locus_tag LOCUS_03000 2642 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 3730 3269 gene locus_tag LOCUS_03010 3730 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3746 4414 gene locus_tag LOCUS_03020 3746 4414 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_03020 4417 5352 gene locus_tag LOCUS_03030 4417 5352 CDS product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 protein_id gnl|my_center|LOCUS_03030 5357 5809 gene locus_tag LOCUS_03040 5357 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 8076 5806 gene locus_tag LOCUS_03050 8076 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 8397 8984 gene locus_tag LOCUS_03060 8397 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 10269 8962 gene locus_tag LOCUS_03070 10269 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 10395 12872 gene locus_tag LOCUS_03080 10395 12872 CDS product DNA-directed DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762568.1 protein_id gnl|my_center|LOCUS_03080 12920 13942 gene locus_tag LOCUS_03090 12920 13942 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_03090 13954 14619 gene locus_tag LOCUS_03100 13954 14619 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence016 1213 2160 gene locus_tag LOCUS_03110 1213 2160 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_03110 2172 2693 gene locus_tag LOCUS_03120 2172 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 2701 3258 gene locus_tag LOCUS_03130 2701 3258 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_03130 3260 3871 gene locus_tag LOCUS_03140 3260 3871 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081900.1 protein_id gnl|my_center|LOCUS_03140 3914 4819 gene locus_tag LOCUS_03150 gene menA 3914 4819 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_03150 4827 5816 gene locus_tag LOCUS_03160 4827 5816 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_03160 6643 5813 gene locus_tag LOCUS_03170 6643 5813 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020379.1 protein_id gnl|my_center|LOCUS_03170 6784 7449 gene locus_tag LOCUS_03180 gene coxB 6784 7449 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881439.1 protein_id gnl|my_center|LOCUS_03180 7451 9781 gene locus_tag LOCUS_03190 7451 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 9794 10075 gene locus_tag LOCUS_03200 9794 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 10082 10582 gene locus_tag LOCUS_03210 10082 10582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 10582 11031 gene locus_tag LOCUS_03220 10582 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 11133 11059 gene locus_tag LOCUS_t00070 11133 11059 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12413 11139 gene locus_tag LOCUS_03230 12413 11139 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545257.1 protein_id gnl|my_center|LOCUS_03230 12999 12427 gene locus_tag LOCUS_03240 12999 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 13122 14051 gene locus_tag LOCUS_03250 13122 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 14697 14038 gene locus_tag LOCUS_03260 14697 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 >Feature sequence017 1557 946 gene locus_tag LOCUS_03270 1557 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 2550 1588 gene locus_tag LOCUS_03280 2550 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 2695 3333 gene locus_tag LOCUS_03290 gene cdvB1/B2 2695 3333 CDS product cell division protein CdvB1/B2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_03290 3722 3330 gene locus_tag LOCUS_03300 3722 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 4842 3766 gene locus_tag LOCUS_03310 4842 3766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250726.1 protein_id gnl|my_center|LOCUS_03310 5926 4835 gene locus_tag LOCUS_03320 5926 4835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867147.1 protein_id gnl|my_center|LOCUS_03320 6751 5933 gene locus_tag LOCUS_03330 6751 5933 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086350.1 protein_id gnl|my_center|LOCUS_03330 7625 6756 gene locus_tag LOCUS_03340 7625 6756 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972367.1 protein_id gnl|my_center|LOCUS_03340 9358 7628 gene locus_tag LOCUS_03350 9358 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 10441 9476 gene locus_tag LOCUS_03360 10441 9476 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 protein_id gnl|my_center|LOCUS_03360 10572 11633 gene locus_tag LOCUS_03370 gene eltD 10572 11633 CDS product erythritol/L-threitol dehyrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728938.1 protein_id gnl|my_center|LOCUS_03370 11652 13205 gene locus_tag LOCUS_03380 gene xylB 11652 13205 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_03380 13239 14306 gene locus_tag LOCUS_03390 13239 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence018 <1 857 gene locus_tag LOCUS_03400 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869163.1:DUF2877 domain-containing protein 877 1632 gene locus_tag LOCUS_03410 877 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1697 2251 gene locus_tag LOCUS_03420 1697 2251 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949068.1 protein_id gnl|my_center|LOCUS_03420 2260 2661 gene locus_tag LOCUS_03430 2260 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 4376 2658 gene locus_tag LOCUS_03440 4376 2658 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_03440 4457 4843 gene locus_tag LOCUS_03450 gene rpl7ae 4457 4843 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979469.1 protein_id gnl|my_center|LOCUS_03450 5046 4840 gene locus_tag LOCUS_03460 5046 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5158 6867 gene locus_tag LOCUS_03470 5158 6867 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762147.1 protein_id gnl|my_center|LOCUS_03470 6868 7518 gene locus_tag LOCUS_03480 6868 7518 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_03480 7729 7505 gene locus_tag LOCUS_03490 7729 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 9186 7729 gene locus_tag LOCUS_03500 9186 7729 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_03500 12359 9216 gene locus_tag LOCUS_03510 12359 9216 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977932.1 protein_id gnl|my_center|LOCUS_03510 12422 13177 gene locus_tag LOCUS_03520 12422 13177 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_03520 13850 13155 gene locus_tag LOCUS_03530 13850 13155 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762388.1 protein_id gnl|my_center|LOCUS_03530 <14461 13853 gene locus_tag LOCUS_03540 <14461 13853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197030926.1:CDC48 family AAA ATPase >Feature sequence019 <1 1309 gene locus_tag LOCUS_03550 <1 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867738.1:DNA-directed RNA polymerase subunit B 1314 5117 gene locus_tag LOCUS_03560 1314 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 5158 5499 gene locus_tag LOCUS_03570 5158 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 5559 5993 gene locus_tag LOCUS_03580 5559 5993 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 protein_id gnl|my_center|LOCUS_03580 6047 8488 gene locus_tag LOCUS_03590 gene ppsA 6047 8488 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763610.1 protein_id gnl|my_center|LOCUS_03590 8495 8926 gene locus_tag LOCUS_03600 8495 8926 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878243.1 protein_id gnl|my_center|LOCUS_03600 9739 8891 gene locus_tag LOCUS_03610 9739 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 10220 9750 gene locus_tag LOCUS_03620 10220 9750 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393456.1 protein_id gnl|my_center|LOCUS_03620 11128 10223 gene locus_tag LOCUS_03630 11128 10223 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532039.1 protein_id gnl|my_center|LOCUS_03630 13511 11121 gene locus_tag LOCUS_03640 13511 11121 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_03640 <14437 13563 gene locus_tag LOCUS_03650 <14437 13563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980494.1:thiamine pyrophosphate-requiring protein >Feature sequence020 390 1862 gene locus_tag LOCUS_03660 390 1862 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_03660 1942 2118 gene locus_tag LOCUS_03670 1942 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 2217 2807 gene locus_tag LOCUS_03680 2217 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 3953 2904 gene locus_tag LOCUS_03690 gene fbp 3953 2904 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762924.1 protein_id gnl|my_center|LOCUS_03690 4457 8470 gene locus_tag LOCUS_03700 4457 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 8720 9631 gene locus_tag LOCUS_03710 gene htpX 8720 9631 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980430.1 protein_id gnl|my_center|LOCUS_03710 11615 9636 gene locus_tag LOCUS_03720 11615 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 12856 11612 gene locus_tag LOCUS_03730 12856 11612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 <14049 12889 gene locus_tag LOCUS_03740 <14049 12889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060857.1:proline--tRNA ligase >Feature sequence021 970 581 gene locus_tag LOCUS_03750 970 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 1073 1963 gene locus_tag LOCUS_03760 1073 1963 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762098.1 protein_id gnl|my_center|LOCUS_03760 1970 2179 gene locus_tag LOCUS_03770 1970 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 2216 4087 gene locus_tag LOCUS_03780 2216 4087 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878055.1 protein_id gnl|my_center|LOCUS_03780 4121 5002 gene locus_tag LOCUS_03790 4121 5002 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867380.1 protein_id gnl|my_center|LOCUS_03790 6039 4999 gene locus_tag LOCUS_03800 6039 4999 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_03800 6614 6081 gene locus_tag LOCUS_03810 6614 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 7387 6614 gene locus_tag LOCUS_03820 7387 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 7956 7384 gene locus_tag LOCUS_03830 7956 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 8081 8677 gene locus_tag LOCUS_03840 8081 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 8756 9406 gene locus_tag LOCUS_03850 8756 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 9413 11866 gene locus_tag LOCUS_03860 gene ctaD 9413 11866 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227851.1 protein_id gnl|my_center|LOCUS_03860 11877 12173 gene locus_tag LOCUS_03870 11877 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 12180 12638 gene locus_tag LOCUS_03880 12180 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 12729 12652 gene locus_tag LOCUS_t00080 12729 12652 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13498 12836 gene locus_tag LOCUS_03890 13498 12836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence022 1567 554 gene locus_tag LOCUS_03900 1567 554 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 protein_id gnl|my_center|LOCUS_03900 1473 1658 gene locus_tag LOCUS_03910 1473 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 1809 2177 gene locus_tag LOCUS_03920 1809 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 2553 2179 gene locus_tag LOCUS_03930 2553 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2606 3541 gene locus_tag LOCUS_03940 gene rbsK 2606 3541 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_03940 4248 3547 gene locus_tag LOCUS_03950 4248 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 4732 4283 gene locus_tag LOCUS_03960 4732 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 4797 5312 gene locus_tag LOCUS_03970 4797 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763023.1 protein_id gnl|my_center|LOCUS_03970 6403 5315 gene locus_tag LOCUS_03980 6403 5315 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095662.1 protein_id gnl|my_center|LOCUS_03980 7349 6411 gene locus_tag LOCUS_03990 7349 6411 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496774.1 protein_id gnl|my_center|LOCUS_03990 7463 8890 gene locus_tag LOCUS_04000 7463 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 8979 9725 gene locus_tag LOCUS_04010 8979 9725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762347.1 protein_id gnl|my_center|LOCUS_04010 9728 10441 gene locus_tag LOCUS_04020 9728 10441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546217.1 protein_id gnl|my_center|LOCUS_04020 10491 10664 gene locus_tag LOCUS_04030 10491 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 10687 11454 gene locus_tag LOCUS_04040 gene cofE 10687 11454 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_04040 11438 12103 gene locus_tag LOCUS_04050 11438 12103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 12779 12357 gene locus_tag LOCUS_04060 12779 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 13041 12769 gene locus_tag LOCUS_04070 13041 12769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 >Feature sequence023 789 337 gene locus_tag LOCUS_04080 789 337 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761799.1 protein_id gnl|my_center|LOCUS_04080 915 1397 gene locus_tag LOCUS_04090 915 1397 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172509.1 protein_id gnl|my_center|LOCUS_04090 1434 2303 gene locus_tag LOCUS_04100 1434 2303 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763484.1 protein_id gnl|my_center|LOCUS_04100 2343 2819 gene locus_tag LOCUS_04110 2343 2819 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_04110 2854 3453 gene locus_tag LOCUS_04120 2854 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 3872 3450 gene locus_tag LOCUS_04130 3872 3450 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_04130 4771 3869 gene locus_tag LOCUS_04140 gene ilvE 4771 3869 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870521.1 protein_id gnl|my_center|LOCUS_04140 4746 5159 gene locus_tag LOCUS_04150 4746 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 5198 6007 gene locus_tag LOCUS_04160 5198 6007 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249752.1 protein_id gnl|my_center|LOCUS_04160 6023 6589 gene locus_tag LOCUS_04170 6023 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 6679 8244 gene locus_tag LOCUS_04180 6679 8244 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979316.1 protein_id gnl|my_center|LOCUS_04180 8339 9547 gene locus_tag LOCUS_04190 8339 9547 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057897531.1 protein_id gnl|my_center|LOCUS_04190 9595 10158 gene locus_tag LOCUS_04200 9595 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 11216 10155 gene locus_tag LOCUS_04210 11216 10155 CDS product N-acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978128.1 protein_id gnl|my_center|LOCUS_04210 12386 11223 gene locus_tag LOCUS_04220 12386 11223 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978129.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence024 <1 839 gene locus_tag LOCUS_04230 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000954148.1:MBL fold metallo-hydrolase 935 2059 gene locus_tag LOCUS_04240 935 2059 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064757.1 protein_id gnl|my_center|LOCUS_04240 2085 2873 gene locus_tag LOCUS_04250 2085 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 2885 4042 gene locus_tag LOCUS_04260 2885 4042 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 protein_id gnl|my_center|LOCUS_04260 4048 4482 gene locus_tag LOCUS_04270 4048 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 4489 5679 gene locus_tag LOCUS_04280 4489 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 6650 5676 gene locus_tag LOCUS_04290 6650 5676 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_04290 7438 6650 gene locus_tag LOCUS_04300 7438 6650 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_04300 7939 8421 gene locus_tag LOCUS_04310 7939 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 8424 9335 gene locus_tag LOCUS_04320 8424 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 9372 10649 gene locus_tag LOCUS_04330 9372 10649 CDS product actin/actin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762638.1 protein_id gnl|my_center|LOCUS_04330 10634 11488 gene locus_tag LOCUS_04340 10634 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 11485 12216 gene locus_tag LOCUS_04350 11485 12216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 12232 12558 gene locus_tag LOCUS_04360 12232 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence025 1385 828 gene locus_tag LOCUS_04370 1385 828 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965783.1 protein_id gnl|my_center|LOCUS_04370 1442 2335 gene locus_tag LOCUS_04380 1442 2335 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876382.1 protein_id gnl|my_center|LOCUS_04380 2332 2964 gene locus_tag LOCUS_04390 2332 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 3481 2897 gene locus_tag LOCUS_04400 3481 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 6184 3485 gene locus_tag LOCUS_04410 6184 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 6253 6672 gene locus_tag LOCUS_04420 6253 6672 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_04420 7240 6659 gene locus_tag LOCUS_04430 7240 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762862.1 protein_id gnl|my_center|LOCUS_04430 9017 7242 gene locus_tag LOCUS_04440 9017 7242 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762861.1 protein_id gnl|my_center|LOCUS_04440 9993 9070 gene locus_tag LOCUS_04450 9993 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868135.1 protein_id gnl|my_center|LOCUS_04450 10049 10930 gene locus_tag LOCUS_04460 gene mptA 10049 10930 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496622.1 protein_id gnl|my_center|LOCUS_04460 10914 11681 gene locus_tag LOCUS_04470 10914 11681 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868117.1 protein_id gnl|my_center|LOCUS_04470 11714 12502 gene locus_tag LOCUS_04480 11714 12502 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250846.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence026 1045 683 gene locus_tag LOCUS_04490 1045 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 1531 1085 gene locus_tag LOCUS_04500 1531 1085 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_04500 1709 1524 gene locus_tag LOCUS_04510 1709 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 1642 2238 gene locus_tag LOCUS_04520 1642 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 2198 3475 gene locus_tag LOCUS_04530 2198 3475 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986509.1 protein_id gnl|my_center|LOCUS_04530 3441 4136 gene locus_tag LOCUS_04540 3441 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 4171 5346 gene locus_tag LOCUS_04550 4171 5346 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879038.1 protein_id gnl|my_center|LOCUS_04550 6476 5394 gene locus_tag LOCUS_04560 6476 5394 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880717.1 protein_id gnl|my_center|LOCUS_04560 8073 6499 gene locus_tag LOCUS_04570 8073 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 8819 8121 gene locus_tag LOCUS_04580 gene upp 8819 8121 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867910.1 protein_id gnl|my_center|LOCUS_04580 8990 8896 gene locus_tag LOCUS_t00090 8990 8896 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9106 9435 gene locus_tag LOCUS_04590 9106 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 9440 10498 gene locus_tag LOCUS_04600 9440 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 10495 10707 gene locus_tag LOCUS_04610 10495 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 10788 11309 gene locus_tag LOCUS_04620 10788 11309 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846160.1 protein_id gnl|my_center|LOCUS_04620 >Feature sequence027 823 443 gene locus_tag LOCUS_04630 823 443 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_04630 2268 826 gene locus_tag LOCUS_04640 2268 826 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249650.1 protein_id gnl|my_center|LOCUS_04640 3666 2335 gene locus_tag LOCUS_04650 3666 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 4552 3653 gene locus_tag LOCUS_04660 4552 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 4686 5414 gene locus_tag LOCUS_04670 4686 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 6199 5411 gene locus_tag LOCUS_04680 6199 5411 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761882.1 protein_id gnl|my_center|LOCUS_04680 6302 7324 gene locus_tag LOCUS_04690 6302 7324 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_04690 7321 8730 gene locus_tag LOCUS_04700 7321 8730 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_04700 8772 9926 gene locus_tag LOCUS_04710 8772 9926 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877631.1 protein_id gnl|my_center|LOCUS_04710 11008 9923 gene locus_tag LOCUS_04720 gene amrS 11008 9923 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979564.1 protein_id gnl|my_center|LOCUS_04720 11058 11483 gene locus_tag LOCUS_04730 11058 11483 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence028 197 994 gene locus_tag LOCUS_04740 gene prpB 197 994 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763428.1 protein_id gnl|my_center|LOCUS_04740 985 2136 gene locus_tag LOCUS_04750 gene mmgD 985 2136 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041090.1 protein_id gnl|my_center|LOCUS_04750 2188 3069 gene locus_tag LOCUS_04760 2188 3069 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714563.1 protein_id gnl|my_center|LOCUS_04760 4522 3056 gene locus_tag LOCUS_04770 4522 3056 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582610.1 protein_id gnl|my_center|LOCUS_04770 5528 4515 gene locus_tag LOCUS_04780 5528 4515 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582609.1 protein_id gnl|my_center|LOCUS_04780 6622 5564 gene locus_tag LOCUS_04790 6622 5564 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878692.1 protein_id gnl|my_center|LOCUS_04790 6731 7711 gene locus_tag LOCUS_04800 gene iolN 6731 7711 CDS product 3-dehydro-scyllo-inosose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083262.1 protein_id gnl|my_center|LOCUS_04800 7742 8554 gene locus_tag LOCUS_04810 gene iolO 7742 8554 CDS product 5-keto-L-gluconate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083268.1 protein_id gnl|my_center|LOCUS_04810 8592 9596 gene locus_tag LOCUS_04820 gene iolX 8592 9596 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_04820 10786 9593 gene locus_tag LOCUS_04830 gene iolM 10786 9593 CDS product scyllo-inosose 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083260.1 protein_id gnl|my_center|LOCUS_04830 10943 11161 gene locus_tag LOCUS_04840 10943 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence029 1596 1021 gene locus_tag LOCUS_04850 gene thpR 1596 1021 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762325.1 protein_id gnl|my_center|LOCUS_04850 2257 1628 gene locus_tag LOCUS_04860 2257 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2623 2324 gene locus_tag LOCUS_04870 2623 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 3567 2620 gene locus_tag LOCUS_04880 3567 2620 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582674.1 protein_id gnl|my_center|LOCUS_04880 4757 3564 gene locus_tag LOCUS_04890 4757 3564 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240382.1 protein_id gnl|my_center|LOCUS_04890 5060 4764 gene locus_tag LOCUS_04900 5060 4764 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582672.1 protein_id gnl|my_center|LOCUS_04900 5610 5053 gene locus_tag LOCUS_04910 5610 5053 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_04910 5692 6579 gene locus_tag LOCUS_04920 gene lipA 5692 6579 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174105.1 protein_id gnl|my_center|LOCUS_04920 6614 8008 gene locus_tag LOCUS_04930 gene lpdA 6614 8008 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_04930 7978 8652 gene locus_tag LOCUS_04940 gene lipB 7978 8652 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950674.1 protein_id gnl|my_center|LOCUS_04940 10397 8607 gene locus_tag LOCUS_04950 gene ade 10397 8607 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence030 244 948 gene locus_tag LOCUS_04960 244 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 1282 905 gene locus_tag LOCUS_04970 1282 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 1695 1291 gene locus_tag LOCUS_04980 1695 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 3137 1752 gene locus_tag LOCUS_04990 3137 1752 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141291.1 protein_id gnl|my_center|LOCUS_04990 3897 3130 gene locus_tag LOCUS_05000 3897 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 4209 5585 gene locus_tag LOCUS_05010 4209 5585 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530067.1 protein_id gnl|my_center|LOCUS_05010 6234 5575 gene locus_tag LOCUS_05020 6234 5575 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250893.1 protein_id gnl|my_center|LOCUS_05020 9071 6231 gene locus_tag LOCUS_05030 gene leuS 9071 6231 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061305.1 protein_id gnl|my_center|LOCUS_05030 9753 9166 gene locus_tag LOCUS_05040 9753 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 9665 9910 gene locus_tag LOCUS_05050 9665 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 10018 10824 gene locus_tag LOCUS_05060 10018 10824 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024199.1 protein_id gnl|my_center|LOCUS_05060 11194 10802 gene locus_tag LOCUS_05070 11194 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 >Feature sequence031 862 143 gene locus_tag LOCUS_05080 862 143 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_05080 1236 862 gene locus_tag LOCUS_05090 gene rplX 1236 862 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_05090 1841 1362 gene locus_tag LOCUS_05100 1841 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 2182 2027 gene locus_tag LOCUS_05110 2182 2027 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846365.1 protein_id gnl|my_center|LOCUS_05110 2877 2296 gene locus_tag LOCUS_05120 2877 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3692 2874 gene locus_tag LOCUS_05130 3692 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3970 5238 gene locus_tag LOCUS_05140 3970 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5241 6440 gene locus_tag LOCUS_05150 5241 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 6475 6912 gene locus_tag LOCUS_05160 6475 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 6928 8607 gene locus_tag LOCUS_05170 6928 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 9159 8611 gene locus_tag LOCUS_05180 9159 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 9251 10024 gene locus_tag LOCUS_05190 9251 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 10005 10706 gene locus_tag LOCUS_05200 gene sfsA 10005 10706 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence032 1456 170 gene locus_tag LOCUS_05210 1456 170 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869166.1 protein_id gnl|my_center|LOCUS_05210 1520 3142 gene locus_tag LOCUS_05220 gene fdrA 1520 3142 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111851.1 protein_id gnl|my_center|LOCUS_05220 3172 3342 gene locus_tag LOCUS_05230 3172 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 3818 3348 gene locus_tag LOCUS_05240 3818 3348 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869169.1 protein_id gnl|my_center|LOCUS_05240 4687 3815 gene locus_tag LOCUS_05250 4687 3815 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869168.1 protein_id gnl|my_center|LOCUS_05250 7077 4684 gene locus_tag LOCUS_05260 7077 4684 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948052.1 protein_id gnl|my_center|LOCUS_05260 7592 7152 gene locus_tag LOCUS_05270 7592 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 7697 8512 gene locus_tag LOCUS_05280 7697 8512 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_05280 8638 9918 gene locus_tag LOCUS_05290 8638 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 9930 10973 gene locus_tag LOCUS_05300 9930 10973 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence033 1287 3293 gene locus_tag LOCUS_05310 1287 3293 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_05310 4515 3298 gene locus_tag LOCUS_05320 4515 3298 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082184.1 protein_id gnl|my_center|LOCUS_05320 5893 4550 gene locus_tag LOCUS_05330 5893 4550 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496374.1 protein_id gnl|my_center|LOCUS_05330 7236 5917 gene locus_tag LOCUS_05340 7236 5917 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867603.1 protein_id gnl|my_center|LOCUS_05340 7322 8233 gene locus_tag LOCUS_05350 7322 8233 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_05350 8247 8319 gene locus_tag LOCUS_t00100 8247 8319 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8395 9864 gene locus_tag LOCUS_05360 gene argH 8395 9864 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_05360 <10844 9839 gene locus_tag LOCUS_05370 <10844 9839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021620.1:threonine synthase >Feature sequence034 1561 293 gene locus_tag LOCUS_05380 1561 293 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_05380 2626 1580 gene locus_tag LOCUS_05390 gene cysK 2626 1580 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582454.1 protein_id gnl|my_center|LOCUS_05390 2778 3362 gene locus_tag LOCUS_05400 2778 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 3359 4978 gene locus_tag LOCUS_05410 gene ctaD 3359 4978 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142160.1 protein_id gnl|my_center|LOCUS_05410 6036 4984 gene locus_tag LOCUS_05420 6036 4984 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869178.1 protein_id gnl|my_center|LOCUS_05420 7397 6099 gene locus_tag LOCUS_05430 7397 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 7281 7499 gene locus_tag LOCUS_05440 7281 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 8776 7577 gene locus_tag LOCUS_05450 8776 7577 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_05450 9100 8816 gene locus_tag LOCUS_05460 9100 8816 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 protein_id gnl|my_center|LOCUS_05460 9271 10119 gene locus_tag LOCUS_05470 gene lysX 9271 10119 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979555.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence035 147 674 gene locus_tag LOCUS_05480 147 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 712 1005 gene locus_tag LOCUS_05490 712 1005 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978432.1 protein_id gnl|my_center|LOCUS_05490 1008 1358 gene locus_tag LOCUS_05500 1008 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 1389 1973 gene locus_tag LOCUS_05510 1389 1973 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249851.1 protein_id gnl|my_center|LOCUS_05510 1970 2719 gene locus_tag LOCUS_05520 gene rsmA 1970 2719 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867501.1 protein_id gnl|my_center|LOCUS_05520 2723 3106 gene locus_tag LOCUS_05530 2723 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274390.1 protein_id gnl|my_center|LOCUS_05530 3116 3961 gene locus_tag LOCUS_05540 3116 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 3999 4514 gene locus_tag LOCUS_05550 gene rplJ 3999 4514 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_05550 4598 4927 gene locus_tag LOCUS_05560 4598 4927 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546858.1 protein_id gnl|my_center|LOCUS_05560 4957 6150 gene locus_tag LOCUS_05570 4957 6150 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870473.1 protein_id gnl|my_center|LOCUS_05570 6214 6906 gene locus_tag LOCUS_05580 6214 6906 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_05580 7476 6910 gene locus_tag LOCUS_05590 7476 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 7769 7479 gene locus_tag LOCUS_05600 7769 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 8095 7871 gene locus_tag LOCUS_05610 8095 7871 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762842.1 protein_id gnl|my_center|LOCUS_05610 8229 8426 gene locus_tag LOCUS_05620 8229 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 9155 8427 gene locus_tag LOCUS_05630 gene sdhB 9155 8427 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878185.1 protein_id gnl|my_center|LOCUS_05630 9525 9160 gene locus_tag LOCUS_05640 9525 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 9883 9518 gene locus_tag LOCUS_05650 9883 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 <10790 10011 gene locus_tag LOCUS_05660 <10790 10011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878184.1:succinate dehydrogenase/fumarate reductase flavoprotein subunit >Feature sequence036 2680 3771 gene locus_tag LOCUS_05670 2680 3771 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868088.1 protein_id gnl|my_center|LOCUS_05670 5568 3877 gene locus_tag LOCUS_05680 gene pheT 5568 3877 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249876.1 protein_id gnl|my_center|LOCUS_05680 5658 6065 gene locus_tag LOCUS_05690 gene trxA 5658 6065 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_05690 6137 7072 gene locus_tag LOCUS_05700 6137 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 7166 8677 gene locus_tag LOCUS_05710 7166 8677 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546850.1 protein_id gnl|my_center|LOCUS_05710 8712 9503 gene locus_tag LOCUS_05720 8712 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 9988 9500 gene locus_tag LOCUS_05730 9988 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 <10595 9985 gene locus_tag LOCUS_05740 <10595 9985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066094.1:glycosyltransferase >Feature sequence037 1140 898 gene locus_tag LOCUS_05750 1140 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 1024 1707 gene locus_tag LOCUS_05760 1024 1707 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_05760 2421 1693 gene locus_tag LOCUS_05770 2421 1693 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496728.1 protein_id gnl|my_center|LOCUS_05770 2702 4138 gene locus_tag LOCUS_05780 2702 4138 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_05780 4261 5079 gene locus_tag LOCUS_05790 4261 5079 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_05790 5076 6017 gene locus_tag LOCUS_05800 5076 6017 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_05800 6014 6727 gene locus_tag LOCUS_05810 6014 6727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_05810 6724 7428 gene locus_tag LOCUS_05820 6724 7428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228129.1 protein_id gnl|my_center|LOCUS_05820 8414 7425 gene locus_tag LOCUS_05830 8414 7425 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 protein_id gnl|my_center|LOCUS_05830 9724 8453 gene locus_tag LOCUS_05840 9724 8453 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763469.1 protein_id gnl|my_center|LOCUS_05840 9831 10199 gene locus_tag LOCUS_05850 9831 10199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence038 1537 224 gene locus_tag LOCUS_05860 1537 224 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763417.1 protein_id gnl|my_center|LOCUS_05860 1686 2960 gene locus_tag LOCUS_05870 1686 2960 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_05870 3787 2957 gene locus_tag LOCUS_05880 3787 2957 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230679.1 protein_id gnl|my_center|LOCUS_05880 4613 3777 gene locus_tag LOCUS_05890 4613 3777 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008272.1 protein_id gnl|my_center|LOCUS_05890 5819 4626 gene locus_tag LOCUS_05900 5819 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5939 7006 gene locus_tag LOCUS_05910 5939 7006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249113.1 protein_id gnl|my_center|LOCUS_05910 7012 7593 gene locus_tag LOCUS_05920 7012 7593 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762930.1 protein_id gnl|my_center|LOCUS_05920 8617 7568 gene locus_tag LOCUS_05930 8617 7568 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868819.1 protein_id gnl|my_center|LOCUS_05930 8949 8746 gene locus_tag LOCUS_05940 8949 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 8878 9687 gene locus_tag LOCUS_05950 8878 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 9757 10218 gene locus_tag LOCUS_05960 gene ribL 9757 10218 CDS product FAD synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870692.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence039 6 305 gene locus_tag LOCUS_05970 6 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 380 583 gene locus_tag LOCUS_05980 380 583 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250050.1 protein_id gnl|my_center|LOCUS_05980 600 1385 gene locus_tag LOCUS_05990 600 1385 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867969.1 protein_id gnl|my_center|LOCUS_05990 1396 1581 gene locus_tag LOCUS_06000 1396 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 1630 2385 gene locus_tag LOCUS_06010 1630 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4469 2382 gene locus_tag LOCUS_06020 4469 2382 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762186.1 protein_id gnl|my_center|LOCUS_06020 5248 4505 gene locus_tag LOCUS_06030 5248 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 5539 5288 gene locus_tag LOCUS_06040 5539 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 7824 5536 gene locus_tag LOCUS_06050 7824 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 7894 8853 gene locus_tag LOCUS_06060 7894 8853 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438698.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence040 2173 965 gene locus_tag LOCUS_06070 2173 965 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878430.1 protein_id gnl|my_center|LOCUS_06070 2652 2170 gene locus_tag LOCUS_06080 2652 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 3254 2679 gene locus_tag LOCUS_06090 3254 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4347 3388 gene locus_tag LOCUS_06100 4347 3388 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250501.1 protein_id gnl|my_center|LOCUS_06100 4565 5857 gene locus_tag LOCUS_06110 gene wecB 4565 5857 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_06110 5857 7137 gene locus_tag LOCUS_06120 5857 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 7221 7147 gene locus_tag LOCUS_t00110 7221 7147 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7300 7758 gene locus_tag LOCUS_06130 7300 7758 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868242.1 protein_id gnl|my_center|LOCUS_06130 9008 7755 gene locus_tag LOCUS_06140 9008 7755 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762312.1 protein_id gnl|my_center|LOCUS_06140 9129 9299 gene locus_tag LOCUS_06150 9129 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 10139 9315 gene locus_tag LOCUS_06160 10139 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence041 1998 814 gene locus_tag LOCUS_06170 1998 814 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_06170 2533 1991 gene locus_tag LOCUS_06180 2533 1991 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_06180 3138 2530 gene locus_tag LOCUS_06190 gene rnhB 3138 2530 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878125.1 protein_id gnl|my_center|LOCUS_06190 4553 3186 gene locus_tag LOCUS_06200 4553 3186 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965679.1 protein_id gnl|my_center|LOCUS_06200 4869 5825 gene locus_tag LOCUS_06210 4869 5825 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584104.1 protein_id gnl|my_center|LOCUS_06210 5822 6949 gene locus_tag LOCUS_06220 5822 6949 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250397.1 protein_id gnl|my_center|LOCUS_06220 7379 6951 gene locus_tag LOCUS_06230 7379 6951 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250457.1 protein_id gnl|my_center|LOCUS_06230 7490 7819 gene locus_tag LOCUS_06240 7490 7819 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240464.1 protein_id gnl|my_center|LOCUS_06240 7839 8075 gene locus_tag LOCUS_06250 7839 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 8091 8996 gene locus_tag LOCUS_06260 gene tatC 8091 8996 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199900.1 protein_id gnl|my_center|LOCUS_06260 9290 8997 gene locus_tag LOCUS_06270 9290 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 9957 9280 gene locus_tag LOCUS_06280 9957 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence042 1775 549 gene locus_tag LOCUS_06290 gene hisD 1775 549 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060775.1 protein_id gnl|my_center|LOCUS_06290 5440 1823 gene locus_tag LOCUS_06300 gene rgy 5440 1823 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868381.1 protein_id gnl|my_center|LOCUS_06300 5521 5712 gene locus_tag LOCUS_06310 5521 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06310 7046 5748 gene locus_tag LOCUS_06320 7046 5748 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_06320 7437 7231 gene locus_tag LOCUS_06330 7437 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06330 7609 7328 gene locus_tag LOCUS_06340 7609 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 7683 7758 gene locus_tag LOCUS_t00120 7683 7758 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8624 7956 gene locus_tag LOCUS_06350 8624 7956 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_06350 8875 8633 gene locus_tag LOCUS_06360 8875 8633 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057662.1 protein_id gnl|my_center|LOCUS_06360 <10087 9082 gene locus_tag LOCUS_06370 <10087 9082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868196.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD >Feature sequence043 3570 619 gene locus_tag LOCUS_06380 3570 619 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868563.1 protein_id gnl|my_center|LOCUS_06380 4038 3951 gene locus_tag LOCUS_t00130 4038 3951 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4451 4527 gene locus_tag LOCUS_t00140 4451 4527 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4566 4754 gene locus_tag LOCUS_06390 4566 4754 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672132.1 protein_id gnl|my_center|LOCUS_06390 4826 5350 gene locus_tag LOCUS_06400 4826 5350 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_06400 6139 5342 gene locus_tag LOCUS_06410 gene cyoE 6139 5342 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762065.1 protein_id gnl|my_center|LOCUS_06410 6326 7459 gene locus_tag LOCUS_06420 gene sucC 6326 7459 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762775.1 protein_id gnl|my_center|LOCUS_06420 7465 8343 gene locus_tag LOCUS_06430 gene sucD 7465 8343 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762776.1 protein_id gnl|my_center|LOCUS_06430 8356 9162 gene locus_tag LOCUS_06440 8356 9162 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007467.1 protein_id gnl|my_center|LOCUS_06440 9172 9690 gene locus_tag LOCUS_06450 9172 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence044 375 833 gene locus_tag LOCUS_06460 375 833 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_06460 836 2548 gene locus_tag LOCUS_06470 836 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2576 2926 gene locus_tag LOCUS_06480 2576 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2923 3498 gene locus_tag LOCUS_06490 2923 3498 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933512.1 protein_id gnl|my_center|LOCUS_06490 3538 5868 gene locus_tag LOCUS_06500 3538 5868 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_06500 6454 5951 gene locus_tag LOCUS_06510 6454 5951 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389385.1 protein_id gnl|my_center|LOCUS_06510 6983 6474 gene locus_tag LOCUS_06520 6983 6474 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_06520 7064 7747 gene locus_tag LOCUS_06530 7064 7747 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978977.1 protein_id gnl|my_center|LOCUS_06530 7872 8939 gene locus_tag LOCUS_06540 7872 8939 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880716.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence045 262 654 gene locus_tag LOCUS_06550 262 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 1316 651 gene locus_tag LOCUS_06560 gene radB 1316 651 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251181.1 protein_id gnl|my_center|LOCUS_06560 1376 2350 gene locus_tag LOCUS_06570 1376 2350 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878138.1 protein_id gnl|my_center|LOCUS_06570 3581 2328 gene locus_tag LOCUS_06580 gene gdhA 3581 2328 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_06580 3818 4348 gene locus_tag LOCUS_06590 3818 4348 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978531.1 protein_id gnl|my_center|LOCUS_06590 4388 5695 gene locus_tag LOCUS_06600 4388 5695 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251014.1 protein_id gnl|my_center|LOCUS_06600 5692 6234 gene locus_tag LOCUS_06610 5692 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 6246 7418 gene locus_tag LOCUS_06620 gene thiI 6246 7418 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878380.1 protein_id gnl|my_center|LOCUS_06620 7464 8084 gene locus_tag LOCUS_06630 gene npdG 7464 8084 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_06630 8690 8085 gene locus_tag LOCUS_06640 8690 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 8770 9657 gene locus_tag LOCUS_06650 8770 9657 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250367.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence046 15 238 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaatctcaaagagagaattgaaag 1731 250 gene locus_tag LOCUS_06660 1731 250 CDS product TM1812 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761906.1 protein_id gnl|my_center|LOCUS_06660 2369 1788 gene locus_tag LOCUS_06670 2369 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 2647 2372 gene locus_tag LOCUS_06680 2647 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 3665 2655 gene locus_tag LOCUS_06690 gene cas1 3665 2655 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_06690 4603 3662 gene locus_tag LOCUS_06700 gene cas4a 4603 3662 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977960.1 protein_id gnl|my_center|LOCUS_06700 5479 4664 gene locus_tag LOCUS_06710 5479 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 5596 5670 gene locus_tag LOCUS_t00150 5596 5670 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5711 6592 gene locus_tag LOCUS_06720 5711 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 6596 7645 gene locus_tag LOCUS_06730 6596 7645 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879715.1 protein_id gnl|my_center|LOCUS_06730 7678 8214 gene locus_tag LOCUS_06740 7678 8214 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_06740 9177 8200 gene locus_tag LOCUS_06750 gene thiL 9177 8200 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence047 <1 536 gene locus_tag LOCUS_06760 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496450.1:geranylgeranylglycerol-phosphate geranylgeranyltransferase 1352 528 gene locus_tag LOCUS_06770 1352 528 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 protein_id gnl|my_center|LOCUS_06770 1464 2618 gene locus_tag LOCUS_06780 1464 2618 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_06780 2662 2749 gene locus_tag LOCUS_t00160 2662 2749 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3446 2778 gene locus_tag LOCUS_06790 3446 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4339 3443 gene locus_tag LOCUS_06800 4339 3443 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_06800 4323 4577 gene locus_tag LOCUS_06810 4323 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 4563 4639 gene locus_tag LOCUS_t00170 4563 4639 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5827 4658 gene locus_tag LOCUS_06820 5827 4658 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250137.1 protein_id gnl|my_center|LOCUS_06820 6166 6840 gene locus_tag LOCUS_06830 6166 6840 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978236.1 protein_id gnl|my_center|LOCUS_06830 7166 6837 gene locus_tag LOCUS_06840 7166 6837 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980344.1 protein_id gnl|my_center|LOCUS_06840 7486 7211 gene locus_tag LOCUS_06850 7486 7211 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250118.1 protein_id gnl|my_center|LOCUS_06850 8070 7492 gene locus_tag LOCUS_06860 8070 7492 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 protein_id gnl|my_center|LOCUS_06860 9084 8074 gene locus_tag LOCUS_06870 gene dph2 9084 8074 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence048 237 1250 gene locus_tag LOCUS_06880 237 1250 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_06880 1247 1945 gene locus_tag LOCUS_06890 1247 1945 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_06890 2829 1942 gene locus_tag LOCUS_06900 2829 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3760 2942 gene locus_tag LOCUS_06910 3760 2942 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525321.1 protein_id gnl|my_center|LOCUS_06910 4688 3762 gene locus_tag LOCUS_06920 4688 3762 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082985.1 protein_id gnl|my_center|LOCUS_06920 6060 4648 gene locus_tag LOCUS_06930 6060 4648 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136619324.1 protein_id gnl|my_center|LOCUS_06930 7000 6140 gene locus_tag LOCUS_06940 7000 6140 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496764.1 protein_id gnl|my_center|LOCUS_06940 7091 7765 gene locus_tag LOCUS_06950 7091 7765 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763646.1 protein_id gnl|my_center|LOCUS_06950 7813 8610 gene locus_tag LOCUS_06960 7813 8610 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 protein_id gnl|my_center|LOCUS_06960 8710 9105 gene locus_tag LOCUS_06970 8710 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 >Feature sequence049 315 1259 gene locus_tag LOCUS_06980 315 1259 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763057.1 protein_id gnl|my_center|LOCUS_06980 1269 1787 gene locus_tag LOCUS_06990 1269 1787 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871125.1 protein_id gnl|my_center|LOCUS_06990 1993 1784 gene locus_tag LOCUS_07000 1993 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2111 2434 gene locus_tag LOCUS_07010 2111 2434 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249517.1 protein_id gnl|my_center|LOCUS_07010 2987 2424 gene locus_tag LOCUS_07020 2987 2424 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978815.1 protein_id gnl|my_center|LOCUS_07020 3082 3759 gene locus_tag LOCUS_07030 gene hypB 3082 3759 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_07030 3765 4133 gene locus_tag LOCUS_07040 gene hypA 3765 4133 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060898.1 protein_id gnl|my_center|LOCUS_07040 4176 4409 gene locus_tag LOCUS_07050 4176 4409 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_07050 4402 5523 gene locus_tag LOCUS_07060 gene hypD 4402 5523 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 protein_id gnl|my_center|LOCUS_07060 5516 6586 gene locus_tag LOCUS_07070 gene hypE 5516 6586 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870181.1 protein_id gnl|my_center|LOCUS_07070 6580 8952 gene locus_tag LOCUS_07080 gene hypF 6580 8952 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761966.1 protein_id gnl|my_center|LOCUS_07080 9308 8871 gene locus_tag LOCUS_07090 9308 8871 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895382.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence050 173 89 gene locus_tag LOCUS_t00180 173 89 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 542 210 gene locus_tag LOCUS_07100 542 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 738 1472 gene locus_tag LOCUS_07110 738 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 1498 2316 gene locus_tag LOCUS_07120 gene pheA 1498 2316 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_07120 2313 2903 gene locus_tag LOCUS_07130 2313 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2993 4255 gene locus_tag LOCUS_07140 gene prf1 2993 4255 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870340.1 protein_id gnl|my_center|LOCUS_07140 4271 5164 gene locus_tag LOCUS_07150 4271 5164 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879344.1 protein_id gnl|my_center|LOCUS_07150 5196 6107 gene locus_tag LOCUS_07160 gene mdh 5196 6107 CDS product NAD-dependent malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762366.1 protein_id gnl|my_center|LOCUS_07160 6734 6108 gene locus_tag LOCUS_07170 gene leuD 6734 6108 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083326.1 protein_id gnl|my_center|LOCUS_07170 8176 6737 gene locus_tag LOCUS_07180 gene leuC 8176 6737 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 protein_id gnl|my_center|LOCUS_07180 <9085 8267 gene locus_tag LOCUS_07190 <9085 8267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020910.1:phosphate uptake regulator PhoU >Feature sequence051 1292 405 gene locus_tag LOCUS_07200 1292 405 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257265.1 protein_id gnl|my_center|LOCUS_07200 1648 1337 gene locus_tag LOCUS_07210 gene rpsJ 1648 1337 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_07210 1726 2313 gene locus_tag LOCUS_07220 1726 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2310 2819 gene locus_tag LOCUS_07230 2310 2819 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763381.1 protein_id gnl|my_center|LOCUS_07230 2890 4200 gene locus_tag LOCUS_07240 2890 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4279 5412 gene locus_tag LOCUS_07250 4279 5412 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_07250 5417 5890 gene locus_tag LOCUS_07260 5417 5890 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_07260 5868 6719 gene locus_tag LOCUS_07270 5868 6719 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_07270 6723 7493 gene locus_tag LOCUS_07280 6723 7493 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_07280 7483 8772 gene locus_tag LOCUS_07290 7483 8772 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence052 <1 1429 gene locus_tag LOCUS_07300 <1 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846566.1:ATP synthase subunit A 1426 1740 gene locus_tag LOCUS_07310 1426 1740 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240352.1 protein_id gnl|my_center|LOCUS_07310 2235 1732 gene locus_tag LOCUS_07320 2235 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2314 3711 gene locus_tag LOCUS_07330 2314 3711 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_07330 4464 3844 gene locus_tag LOCUS_07340 4464 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 5067 4531 gene locus_tag LOCUS_07350 5067 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 5207 5878 gene locus_tag LOCUS_07360 5207 5878 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979483.1 protein_id gnl|my_center|LOCUS_07360 5856 5993 gene locus_tag LOCUS_07370 5856 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 6273 6587 gene locus_tag LOCUS_07380 6273 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 7408 6584 gene locus_tag LOCUS_07390 7408 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 7659 8147 gene locus_tag LOCUS_07400 7659 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence053 685 50 gene locus_tag LOCUS_07410 685 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 884 1144 gene locus_tag LOCUS_07420 884 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1125 1604 gene locus_tag LOCUS_07430 1125 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1644 2825 gene locus_tag LOCUS_07440 1644 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2855 3106 gene locus_tag LOCUS_07450 2855 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 3160 3528 gene locus_tag LOCUS_07460 3160 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4357 3518 gene locus_tag LOCUS_07470 4357 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4458 5216 gene locus_tag LOCUS_07480 4458 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 5250 6725 gene locus_tag LOCUS_07490 5250 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6769 7434 gene locus_tag LOCUS_07500 6769 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 7454 7996 gene locus_tag LOCUS_07510 gene endA 7454 7996 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence054 20 739 gene locus_tag LOCUS_07520 20 739 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_07520 736 1515 gene locus_tag LOCUS_07530 736 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 1564 2868 gene locus_tag LOCUS_07540 gene aspS 1564 2868 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_07540 3866 2865 gene locus_tag LOCUS_07550 gene nuoH 3866 2865 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573426.1 protein_id gnl|my_center|LOCUS_07550 4242 3868 gene locus_tag LOCUS_07560 4242 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 4622 4302 gene locus_tag LOCUS_07570 4622 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 5497 4649 gene locus_tag LOCUS_07580 5497 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 6017 5541 gene locus_tag LOCUS_07590 6017 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 6152 7129 gene locus_tag LOCUS_07600 6152 7129 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_07600 <8328 7220 gene locus_tag LOCUS_07610 <8328 7220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240218.1:ABC transporter permease >Feature sequence055 <1 1035 gene locus_tag LOCUS_07620 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930192.1:phospholipid carrier-dependent glycosyltransferase 1231 1016 gene locus_tag LOCUS_07630 1231 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 1315 1734 gene locus_tag LOCUS_07640 1315 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1778 2053 gene locus_tag LOCUS_07650 1778 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2083 3009 gene locus_tag LOCUS_07660 2083 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3736 2993 gene locus_tag LOCUS_07670 3736 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3870 4340 gene locus_tag LOCUS_07680 3870 4340 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_07680 4378 5283 gene locus_tag LOCUS_07690 4378 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 5270 5746 gene locus_tag LOCUS_07700 5270 5746 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969634.1 protein_id gnl|my_center|LOCUS_07700 6531 5749 gene locus_tag LOCUS_07710 6531 5749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529864.1 protein_id gnl|my_center|LOCUS_07710 7298 6528 gene locus_tag LOCUS_07720 7298 6528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_07720 <8227 7336 gene locus_tag LOCUS_07730 <8227 7336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392739.1:molybdopterin-dependent oxidoreductase >Feature sequence056 728 561 gene locus_tag LOCUS_07740 728 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 827 1543 gene locus_tag LOCUS_07750 827 1543 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256951.1 protein_id gnl|my_center|LOCUS_07750 1621 2172 gene locus_tag LOCUS_07760 1621 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2286 2212 gene locus_tag LOCUS_t00190 2286 2212 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2487 3446 gene locus_tag LOCUS_07770 2487 3446 CDS product TIGR04084 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878081.1 protein_id gnl|my_center|LOCUS_07770 3461 5953 gene locus_tag LOCUS_07780 3461 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 5991 6068 gene locus_tag LOCUS_t00200 5991 6068 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 6122 7726 gene locus_tag LOCUS_07790 6122 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 7760 7837 gene locus_tag LOCUS_t00210 7760 7837 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence057 458 2737 gene locus_tag LOCUS_07800 gene pucD 458 2737 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243174.1 protein_id gnl|my_center|LOCUS_07800 2769 3794 gene locus_tag LOCUS_07810 gene argF 2769 3794 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_07810 4726 3791 gene locus_tag LOCUS_07820 gene arcC 4726 3791 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_07820 4827 5558 gene locus_tag LOCUS_07830 4827 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 5555 5983 gene locus_tag LOCUS_07840 5555 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6213 6944 gene locus_tag LOCUS_07850 6213 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 6946 7617 gene locus_tag LOCUS_07860 6946 7617 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence058 1668 112 gene locus_tag LOCUS_07870 1668 112 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_07870 1754 2881 gene locus_tag LOCUS_07880 1754 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2878 3735 gene locus_tag LOCUS_07890 2878 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3765 5231 gene locus_tag LOCUS_07900 3765 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 5262 6167 gene locus_tag LOCUS_07910 5262 6167 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_07910 6244 6405 gene locus_tag LOCUS_07920 6244 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6463 6729 gene locus_tag LOCUS_07930 6463 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 6811 7053 gene locus_tag LOCUS_07940 6811 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07940 7583 7185 gene locus_tag LOCUS_07950 7583 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence059 1083 2558 gene locus_tag LOCUS_07960 1083 2558 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486252.1 protein_id gnl|my_center|LOCUS_07960 2639 3730 gene locus_tag LOCUS_07970 gene ugpC 2639 3730 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_07970 3802 4644 gene locus_tag LOCUS_07980 3802 4644 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805139.1 protein_id gnl|my_center|LOCUS_07980 4641 5447 gene locus_tag LOCUS_07990 4641 5447 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976934.1 protein_id gnl|my_center|LOCUS_07990 5513 6118 gene locus_tag LOCUS_08000 gene psmB 5513 6118 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 protein_id gnl|my_center|LOCUS_08000 6176 6961 gene locus_tag LOCUS_08010 6176 6961 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169713.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence060 260 1174 gene locus_tag LOCUS_08020 260 1174 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113476.1 protein_id gnl|my_center|LOCUS_08020 1307 1696 gene locus_tag LOCUS_08030 gene bcp 1307 1696 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_08030 2888 1686 gene locus_tag LOCUS_08040 2888 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 5743 2900 gene locus_tag LOCUS_08050 5743 2900 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762372.1 protein_id gnl|my_center|LOCUS_08050 5867 6124 gene locus_tag LOCUS_08060 5867 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 6176 6421 gene locus_tag LOCUS_08070 6176 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence061 844 2643 gene locus_tag LOCUS_08080 844 2643 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020291.1 protein_id gnl|my_center|LOCUS_08080 2678 4189 gene locus_tag LOCUS_08090 2678 4189 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980566.1 protein_id gnl|my_center|LOCUS_08090 5035 4190 gene locus_tag LOCUS_08100 gene lysX 5035 4190 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249233.1 protein_id gnl|my_center|LOCUS_08100 6086 5226 gene locus_tag LOCUS_08110 6086 5226 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980565.1 protein_id gnl|my_center|LOCUS_08110 6736 6248 gene locus_tag LOCUS_08120 6736 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762310.1 protein_id gnl|my_center|LOCUS_08120 6960 6784 gene locus_tag LOCUS_08130 gene lysW/argW 6960 6784 CDS product alpha-aminoadipate/glutamate carrier protein LysW/ArgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence062 1715 354 gene locus_tag LOCUS_08140 gene trpE 1715 354 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_08140 1964 2698 gene locus_tag LOCUS_08150 1964 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 3680 2709 gene locus_tag LOCUS_08160 3680 2709 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529592.1 protein_id gnl|my_center|LOCUS_08160 3740 4360 gene locus_tag LOCUS_08170 3740 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 4361 5206 gene locus_tag LOCUS_08180 4361 5206 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065199.1 protein_id gnl|my_center|LOCUS_08180 5211 6074 gene locus_tag LOCUS_08190 5211 6074 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_08190 6071 6907 gene locus_tag LOCUS_08200 6071 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08200 >Feature sequence063 473 216 gene locus_tag LOCUS_08210 473 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 581 979 gene locus_tag LOCUS_08220 gene lysM 581 979 CDS product HTH-type transcriptional regulator LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978132.1 protein_id gnl|my_center|LOCUS_08220 1017 1565 gene locus_tag LOCUS_08230 1017 1565 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978887.1 protein_id gnl|my_center|LOCUS_08230 1683 2684 gene locus_tag LOCUS_08240 1683 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 3807 2671 gene locus_tag LOCUS_08250 3807 2671 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259674.1 protein_id gnl|my_center|LOCUS_08250 3885 5795 gene locus_tag LOCUS_08260 3885 5795 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 protein_id gnl|my_center|LOCUS_08260 5792 6730 gene locus_tag LOCUS_08270 5792 6730 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980518.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence064 612 1115 gene locus_tag LOCUS_08280 612 1115 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061113.1 protein_id gnl|my_center|LOCUS_08280 1750 1109 gene locus_tag LOCUS_08290 1750 1109 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763709.1 protein_id gnl|my_center|LOCUS_08290 2531 1740 gene locus_tag LOCUS_08300 2531 1740 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762021.1 protein_id gnl|my_center|LOCUS_08300 4981 2528 gene locus_tag LOCUS_08310 4981 2528 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879871.1 protein_id gnl|my_center|LOCUS_08310 5148 5074 gene locus_tag LOCUS_t00220 5148 5074 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6327 5170 gene locus_tag LOCUS_08320 6327 5170 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873272.1 protein_id gnl|my_center|LOCUS_08320 6680 6411 gene locus_tag LOCUS_08330 6680 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence065 367 732 gene locus_tag LOCUS_08340 367 732 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978412.1 protein_id gnl|my_center|LOCUS_08340 729 1730 gene locus_tag LOCUS_08350 729 1730 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249596.1 protein_id gnl|my_center|LOCUS_08350 1731 2573 gene locus_tag LOCUS_08360 1731 2573 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_08360 2588 3385 gene locus_tag LOCUS_08370 2588 3385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249697.1 protein_id gnl|my_center|LOCUS_08370 3382 4155 gene locus_tag LOCUS_08380 3382 4155 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249696.1 protein_id gnl|my_center|LOCUS_08380 4221 5015 gene locus_tag LOCUS_08390 4221 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5043 5738 gene locus_tag LOCUS_08400 5043 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5763 6368 gene locus_tag LOCUS_08410 gene hxlB 5763 6368 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763308.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence066 817 314 gene locus_tag LOCUS_08420 817 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 865 2406 gene locus_tag LOCUS_08430 gene guaA 865 2406 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762354.1 protein_id gnl|my_center|LOCUS_08430 2482 2410 gene locus_tag LOCUS_t00230 2482 2410 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3065 3343 gene locus_tag LOCUS_08440 3065 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3552 3340 gene locus_tag LOCUS_08450 3552 3340 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146889.1 protein_id gnl|my_center|LOCUS_08450 4091 3558 gene locus_tag LOCUS_08460 gene cysC 4091 3558 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763240.1 protein_id gnl|my_center|LOCUS_08460 4179 5303 gene locus_tag LOCUS_08470 gene sat 4179 5303 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_08470 5339 5929 gene locus_tag LOCUS_08480 5339 5929 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_08480 <6631 5926 gene locus_tag LOCUS_08490 <6631 5926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763241.1:alkaline phosphatase family protein >Feature sequence067 <1 502 gene locus_tag LOCUS_08500 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943780.1:CoA pyrophosphatase 732 2048 gene locus_tag LOCUS_08510 732 2048 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064652.1 protein_id gnl|my_center|LOCUS_08510 2107 3324 gene locus_tag LOCUS_08520 2107 3324 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_08520 3794 3321 gene locus_tag LOCUS_08530 3794 3321 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978019.1 protein_id gnl|my_center|LOCUS_08530 3881 4312 gene locus_tag LOCUS_08540 3881 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 5750 4305 gene locus_tag LOCUS_08550 5750 4305 CDS product NuoM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142531.1 protein_id gnl|my_center|LOCUS_08550 <6557 5751 gene locus_tag LOCUS_08560 <6557 5751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258759.1:NADH-quinone oxidoreductase subunit L >Feature sequence068 1231 377 gene locus_tag LOCUS_08570 1231 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1337 2359 gene locus_tag LOCUS_08580 1337 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 3355 2315 gene locus_tag LOCUS_08590 3355 2315 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_08590 5508 3484 gene locus_tag LOCUS_08600 5508 3484 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763450.1 protein_id gnl|my_center|LOCUS_08600 6151 5555 gene locus_tag LOCUS_08610 6151 5555 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762237.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence069 543 1127 gene locus_tag LOCUS_08620 543 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2469 1114 gene locus_tag LOCUS_08630 gene fumC 2469 1114 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057374.1 protein_id gnl|my_center|LOCUS_08630 2583 4667 gene locus_tag LOCUS_08640 2583 4667 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_08640 4744 5583 gene locus_tag LOCUS_08650 4744 5583 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_08650 5593 6021 gene locus_tag LOCUS_08660 5593 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 <6532 6000 gene locus_tag LOCUS_08670 <6532 6000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256687.1:energy coupling factor transporter S component ThiW >Feature sequence070 1322 1774 gene locus_tag LOCUS_08680 1322 1774 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762714.1 protein_id gnl|my_center|LOCUS_08680 1771 3192 gene locus_tag LOCUS_08690 gene secY 1771 3192 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250469.1 protein_id gnl|my_center|LOCUS_08690 3193 3702 gene locus_tag LOCUS_08700 3193 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3662 3934 gene locus_tag LOCUS_08710 3662 3934 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870160.1 protein_id gnl|my_center|LOCUS_08710 4490 3903 gene locus_tag LOCUS_08720 4490 3903 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868267.1 protein_id gnl|my_center|LOCUS_08720 4588 4881 gene locus_tag LOCUS_08730 4588 4881 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762873.1 protein_id gnl|my_center|LOCUS_08730 4887 5912 gene locus_tag LOCUS_08740 4887 5912 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867646.1 protein_id gnl|my_center|LOCUS_08740 5939 6023 gene locus_tag LOCUS_t00240 5939 6023 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6097 6417 gene locus_tag LOCUS_08750 6097 6417 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979189.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence071 3 1775 gene locus_tag LOCUS_08760 3 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3413 1737 gene locus_tag LOCUS_08770 gene ilvD 3413 1737 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762493.1 protein_id gnl|my_center|LOCUS_08770 3505 4641 gene locus_tag LOCUS_08780 3505 4641 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349486.1 protein_id gnl|my_center|LOCUS_08780 5732 4638 gene locus_tag LOCUS_08790 5732 4638 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846958.1 protein_id gnl|my_center|LOCUS_08790 5764 6006 gene locus_tag LOCUS_08800 5764 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence072 638 1279 gene locus_tag LOCUS_08810 638 1279 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629591.1 protein_id gnl|my_center|LOCUS_08810 2016 1276 gene locus_tag LOCUS_08820 2016 1276 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978306.1 protein_id gnl|my_center|LOCUS_08820 2183 2812 gene locus_tag LOCUS_08830 gene psmB 2183 2812 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 protein_id gnl|my_center|LOCUS_08830 2815 4743 gene locus_tag LOCUS_08840 2815 4743 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978304.1 protein_id gnl|my_center|LOCUS_08840 5054 4740 gene locus_tag LOCUS_08850 5054 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 5182 5427 gene locus_tag LOCUS_08860 5182 5427 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_08860 5799 5440 gene locus_tag LOCUS_08870 5799 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 5907 6083 gene locus_tag LOCUS_08880 5907 6083 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978307.1 protein_id gnl|my_center|LOCUS_08880 6152 6224 gene locus_tag LOCUS_t00250 6152 6224 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence073 2779 1436 gene locus_tag LOCUS_08890 2779 1436 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762726.1 protein_id gnl|my_center|LOCUS_08890 3706 2783 gene locus_tag LOCUS_08900 3706 2783 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762992.1 protein_id gnl|my_center|LOCUS_08900 3801 4256 gene locus_tag LOCUS_08910 3801 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 4286 4936 gene locus_tag LOCUS_08920 4286 4936 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762102.1 protein_id gnl|my_center|LOCUS_08920 4975 5649 gene locus_tag LOCUS_08930 4975 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 5681 6304 gene locus_tag LOCUS_08940 5681 6304 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979569.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence074 69 1799 gene locus_tag LOCUS_08950 69 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1881 2150 gene locus_tag LOCUS_08960 1881 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2184 3521 gene locus_tag LOCUS_08970 2184 3521 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763469.1 protein_id gnl|my_center|LOCUS_08970 3774 3496 gene locus_tag LOCUS_08980 3774 3496 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 protein_id gnl|my_center|LOCUS_08980 3923 4789 gene locus_tag LOCUS_08990 3923 4789 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_08990 6039 4786 gene locus_tag LOCUS_09000 6039 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence075 559 128 gene locus_tag LOCUS_09010 559 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1287 556 gene locus_tag LOCUS_09020 1287 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1661 1392 gene locus_tag LOCUS_09030 1661 1392 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979253.1 protein_id gnl|my_center|LOCUS_09030 3084 1654 gene locus_tag LOCUS_09040 3084 1654 CDS product SelD-related putative sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846378.1 protein_id gnl|my_center|LOCUS_09040 3341 3087 gene locus_tag LOCUS_09050 3341 3087 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080581.1 protein_id gnl|my_center|LOCUS_09050 4303 3335 gene locus_tag LOCUS_09060 4303 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 5355 4651 gene locus_tag LOCUS_09070 gene rpiA 5355 4651 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878443.1 protein_id gnl|my_center|LOCUS_09070 5581 5339 gene locus_tag LOCUS_09080 5581 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 <6149 5606 gene locus_tag LOCUS_09090 <6149 5606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763581.1:LysE family translocator >Feature sequence076 2147 570 gene locus_tag LOCUS_09100 2147 570 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525323.1 protein_id gnl|my_center|LOCUS_09100 2260 3939 gene locus_tag LOCUS_09110 2260 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 4319 3942 gene locus_tag LOCUS_09120 4319 3942 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875816.1 protein_id gnl|my_center|LOCUS_09120 4816 4316 gene locus_tag LOCUS_09130 4816 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878211.1 protein_id gnl|my_center|LOCUS_09130 <6084 4806 gene locus_tag LOCUS_09140 <6084 4806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868200.1:GTPase HflX >Feature sequence077 2020 3234 gene locus_tag LOCUS_09150 2020 3234 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_09150 3231 4286 gene locus_tag LOCUS_09160 gene asd 3231 4286 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_09160 4292 5086 gene locus_tag LOCUS_09170 4292 5086 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869899.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence078 187 357 gene locus_tag LOCUS_09180 187 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 5260 392 gene locus_tag LOCUS_09190 5260 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence079 1811 981 gene locus_tag LOCUS_09200 gene amrB 1811 981 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_09200 1890 2972 gene locus_tag LOCUS_09210 gene fni 1890 2972 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064552.1 protein_id gnl|my_center|LOCUS_09210 2979 3431 gene locus_tag LOCUS_09220 2979 3431 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_09220 5026 3428 gene locus_tag LOCUS_09230 5026 3428 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_09230 <5595 5016 gene locus_tag LOCUS_09240 <5595 5016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730150.1:methylmalonyl Co-A mutase-associated GTPase MeaB >Feature sequence080 1388 1684 gene locus_tag LOCUS_09250 1388 1684 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867737.1 protein_id gnl|my_center|LOCUS_09250 2965 1685 gene locus_tag LOCUS_09260 gene rbcL 2965 1685 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146906.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence081 1862 1029 gene locus_tag LOCUS_09270 1862 1029 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_09270 1977 2474 gene locus_tag LOCUS_09280 1977 2474 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249196.1 protein_id gnl|my_center|LOCUS_09280 3237 2527 gene locus_tag LOCUS_09290 3237 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 5483 3351 gene locus_tag LOCUS_09300 5483 3351 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868004.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence082 148 657 gene locus_tag LOCUS_09310 148 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 677 1051 gene locus_tag LOCUS_09320 677 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1196 1576 gene locus_tag LOCUS_09330 1196 1576 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877438.1 protein_id gnl|my_center|LOCUS_09330 1971 1573 gene locus_tag LOCUS_09340 1971 1573 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980139.1 protein_id gnl|my_center|LOCUS_09340 2434 1964 gene locus_tag LOCUS_09350 gene rplM 2434 1964 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_09350 2525 3574 gene locus_tag LOCUS_09360 2525 3574 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_09360 3651 4217 gene locus_tag LOCUS_09370 3651 4217 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705937.1 protein_id gnl|my_center|LOCUS_09370 4582 4220 gene locus_tag LOCUS_09380 4582 4220 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_09380 5225 4572 gene locus_tag LOCUS_09390 5225 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence083 <1 774 gene locus_tag LOCUS_09400 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762324.1:CCA tRNA nucleotidyltransferase 771 1505 gene locus_tag LOCUS_09410 771 1505 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251001.1 protein_id gnl|my_center|LOCUS_09410 1548 2234 gene locus_tag LOCUS_09420 1548 2234 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763153.1 protein_id gnl|my_center|LOCUS_09420 2326 3318 gene locus_tag LOCUS_09430 2326 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 3320 4783 gene locus_tag LOCUS_09440 3320 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence084 1459 659 gene locus_tag LOCUS_09450 1459 659 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875872.1 protein_id gnl|my_center|LOCUS_09450 1471 2127 gene locus_tag LOCUS_09460 1471 2127 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762300.1 protein_id gnl|my_center|LOCUS_09460 2160 2552 gene locus_tag LOCUS_09470 2160 2552 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_09470 2594 2914 gene locus_tag LOCUS_09480 gene moaD 2594 2914 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_09480 2911 3990 gene locus_tag LOCUS_09490 gene pepQ 2911 3990 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146836.1 protein_id gnl|my_center|LOCUS_09490 4775 3987 gene locus_tag LOCUS_09500 gene uppS 4775 3987 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867696.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence085 323 249 gene locus_tag LOCUS_t00260 323 249 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 408 1694 gene locus_tag LOCUS_09510 408 1694 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980487.1 protein_id gnl|my_center|LOCUS_09510 1734 2951 gene locus_tag LOCUS_09520 1734 2951 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528955.1 protein_id gnl|my_center|LOCUS_09520 2998 4527 gene locus_tag LOCUS_09530 2998 4527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence086 1277 270 gene locus_tag LOCUS_09540 gene gpsA 1277 270 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878372.1 protein_id gnl|my_center|LOCUS_09540 1393 2199 gene locus_tag LOCUS_09550 1393 2199 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_09550 2318 3007 gene locus_tag LOCUS_09560 2318 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3010 3906 gene locus_tag LOCUS_09570 3010 3906 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545868.1 protein_id gnl|my_center|LOCUS_09570 5144 3903 gene locus_tag LOCUS_09580 5144 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence087 348 797 gene locus_tag LOCUS_09590 gene rimI 348 797 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240337.1 protein_id gnl|my_center|LOCUS_09590 1751 786 gene locus_tag LOCUS_09600 1751 786 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257728.1 protein_id gnl|my_center|LOCUS_09600 1808 2431 gene locus_tag LOCUS_09610 1808 2431 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_09610 3428 2403 gene locus_tag LOCUS_09620 3428 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3492 4868 gene locus_tag LOCUS_09630 3492 4868 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763429.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence088 197 1033 gene locus_tag LOCUS_09640 197 1033 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240426.1 protein_id gnl|my_center|LOCUS_09640 1539 1030 gene locus_tag LOCUS_09650 1539 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 2261 1608 gene locus_tag LOCUS_09660 2261 1608 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878926.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence089 1799 849 gene locus_tag LOCUS_09670 1799 849 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_09670 1928 1803 gene locus_tag LOCUS_09680 1928 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2389 1925 gene locus_tag LOCUS_09690 2389 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3180 2386 gene locus_tag LOCUS_09700 3180 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 3876 3223 gene locus_tag LOCUS_09710 3876 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3960 5141 gene locus_tag LOCUS_09720 3960 5141 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence090 138 308 gene locus_tag LOCUS_09730 138 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1198 305 gene locus_tag LOCUS_09740 1198 305 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909057.1 protein_id gnl|my_center|LOCUS_09740 1710 1195 gene locus_tag LOCUS_09750 1710 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1786 2358 gene locus_tag LOCUS_09760 1786 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2384 3769 gene locus_tag LOCUS_09770 gene pyk 2384 3769 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 protein_id gnl|my_center|LOCUS_09770 4228 3764 gene locus_tag LOCUS_09780 4228 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence091 1902 316 gene locus_tag LOCUS_09790 1902 316 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147188.1 protein_id gnl|my_center|LOCUS_09790 2038 2415 gene locus_tag LOCUS_09800 2038 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2456 3709 gene locus_tag LOCUS_09810 2456 3709 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061273.1 protein_id gnl|my_center|LOCUS_09810 3860 4666 gene locus_tag LOCUS_09820 3860 4666 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762400.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence092 2261 1581 gene locus_tag LOCUS_09830 2261 1581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_09830 2359 2880 gene locus_tag LOCUS_09840 2359 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2916 3371 gene locus_tag LOCUS_09850 2916 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4014 3298 gene locus_tag LOCUS_09860 4014 3298 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846925.1 protein_id gnl|my_center|LOCUS_09860 4070 5170 gene locus_tag LOCUS_09870 4070 5170 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049926525.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence093 98 718 gene locus_tag LOCUS_09880 98 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1093 731 gene locus_tag LOCUS_09890 1093 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1549 1151 gene locus_tag LOCUS_09900 1549 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2020 1598 gene locus_tag LOCUS_09910 2020 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2353 2117 gene locus_tag LOCUS_09920 2353 2117 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978435.1 protein_id gnl|my_center|LOCUS_09920 2632 3726 gene locus_tag LOCUS_09930 gene ugpC 2632 3726 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583259.1 protein_id gnl|my_center|LOCUS_09930 3767 4912 gene locus_tag LOCUS_09940 3767 4912 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867359.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence094 2 904 gene locus_tag LOCUS_09950 2 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1286 894 gene locus_tag LOCUS_09960 1286 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1460 1606 gene locus_tag LOCUS_09970 1460 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1599 2678 gene locus_tag LOCUS_09980 gene ftsZ 1599 2678 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_09980 4246 2675 gene locus_tag LOCUS_09990 4246 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence095 1276 809 gene locus_tag LOCUS_10000 1276 809 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_10000 1338 2171 gene locus_tag LOCUS_10010 1338 2171 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_10010 2769 2149 gene locus_tag LOCUS_10020 2769 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 4148 2757 gene locus_tag LOCUS_10030 4148 2757 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986686.1 protein_id gnl|my_center|LOCUS_10030 <5115 4145 gene locus_tag LOCUS_10040 <5115 4145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392739.1:molybdopterin-dependent oxidoreductase >Feature sequence096 <1 606 gene locus_tag LOCUS_10050 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393449.1:ABC transporter permease 596 1579 gene locus_tag LOCUS_10060 596 1579 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_10060 2955 1576 gene locus_tag LOCUS_10070 gene hydA 2955 1576 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979132.1 protein_id gnl|my_center|LOCUS_10070 3043 4056 gene locus_tag LOCUS_10080 gene mer 3043 4056 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence097 909 535 gene locus_tag LOCUS_10090 909 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2147 906 gene locus_tag LOCUS_10100 2147 906 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867591.1 protein_id gnl|my_center|LOCUS_10100 2615 2190 gene locus_tag LOCUS_10110 gene ndk 2615 2190 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846241.1 protein_id gnl|my_center|LOCUS_10110 2834 2643 gene locus_tag LOCUS_10120 2834 2643 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 protein_id gnl|my_center|LOCUS_10120 3077 2850 gene locus_tag LOCUS_10130 3077 2850 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867791.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence098 2076 1135 gene locus_tag LOCUS_10140 2076 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3655 2060 gene locus_tag LOCUS_10150 3655 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence099 1051 497 gene locus_tag LOCUS_10160 1051 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1161 1754 gene locus_tag LOCUS_10170 1161 1754 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256689.1 protein_id gnl|my_center|LOCUS_10170 1847 2314 gene locus_tag LOCUS_10180 1847 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2327 2719 gene locus_tag LOCUS_10190 2327 2719 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879687.1 protein_id gnl|my_center|LOCUS_10190 3395 2694 gene locus_tag LOCUS_10200 gene tpiA 3395 2694 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_10200 4338 3436 gene locus_tag LOCUS_10210 gene mtnA 4338 3436 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061163.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence100 2297 912 gene locus_tag LOCUS_10220 2297 912 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393791.1 protein_id gnl|my_center|LOCUS_10220 2421 2780 gene locus_tag LOCUS_10230 2421 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2810 3217 gene locus_tag LOCUS_10240 gene gcvH 2810 3217 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846941.1 protein_id gnl|my_center|LOCUS_10240 3218 3565 gene locus_tag LOCUS_10250 3218 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4154 3546 gene locus_tag LOCUS_10260 4154 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 <4692 4135 gene locus_tag LOCUS_10270 <4692 4135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227962.1:TIGR00269 family protein >Feature sequence101 2092 659 gene locus_tag LOCUS_10280 gene sufB 2092 659 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763471.1 protein_id gnl|my_center|LOCUS_10280 2850 2089 gene locus_tag LOCUS_10290 gene sufC 2850 2089 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763470.1 protein_id gnl|my_center|LOCUS_10290 3179 2934 gene locus_tag LOCUS_10300 3179 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 4095 3253 gene locus_tag LOCUS_10310 4095 3253 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632430.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence102 2559 2362 gene locus_tag LOCUS_10320 2559 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence103 180 794 gene locus_tag LOCUS_10330 180 794 CDS product DUF1122 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881283.1 protein_id gnl|my_center|LOCUS_10330 1243 797 gene locus_tag LOCUS_10340 1243 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2405 1248 gene locus_tag LOCUS_10350 2405 1248 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_10350 3363 2578 gene locus_tag LOCUS_10360 3363 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3905 3411 gene locus_tag LOCUS_10370 3905 3411 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583265.1 protein_id gnl|my_center|LOCUS_10370 <4537 3941 gene locus_tag LOCUS_10380 <4537 3941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496935.1:polyprenyl synthetase family protein >Feature sequence104 196 789 gene locus_tag LOCUS_10390 196 789 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879602.1 protein_id gnl|my_center|LOCUS_10390 859 1251 gene locus_tag LOCUS_10400 859 1251 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979516.1 protein_id gnl|my_center|LOCUS_10400 1748 1248 gene locus_tag LOCUS_10410 1748 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1867 3132 gene locus_tag LOCUS_10420 1867 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10420 3126 4157 gene locus_tag LOCUS_10430 3126 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10430 >Feature sequence105 1129 359 gene locus_tag LOCUS_10440 1129 359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868133.1 protein_id gnl|my_center|LOCUS_10440 1398 1180 gene locus_tag LOCUS_10450 1398 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 3275 1524 gene locus_tag LOCUS_10460 3275 1524 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879805.1 protein_id gnl|my_center|LOCUS_10460 4155 3346 gene locus_tag LOCUS_10470 4155 3346 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066628.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence106 829 173 gene locus_tag LOCUS_10480 829 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 945 1787 gene locus_tag LOCUS_10490 945 1787 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979458.1 protein_id gnl|my_center|LOCUS_10490 1788 2351 gene locus_tag LOCUS_10500 1788 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 4091 2505 gene locus_tag LOCUS_10510 4091 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence107 105 782 gene locus_tag LOCUS_10520 105 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 786 1193 gene locus_tag LOCUS_10530 786 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1851 1168 gene locus_tag LOCUS_10540 1851 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1952 2449 gene locus_tag LOCUS_10550 1952 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2650 2486 gene locus_tag LOCUS_10560 2650 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 2751 3737 gene locus_tag LOCUS_10570 2751 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064475.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence108 244 930 gene locus_tag LOCUS_10580 244 930 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010351.1 protein_id gnl|my_center|LOCUS_10580 1157 927 gene locus_tag LOCUS_10590 1157 927 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228240.1 protein_id gnl|my_center|LOCUS_10590 1260 3965 gene locus_tag LOCUS_10600 gene acnA 1260 3965 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence109 114 539 gene locus_tag LOCUS_10610 114 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 532 927 gene locus_tag LOCUS_10620 532 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1012 928 gene locus_tag LOCUS_t00270 1012 928 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1058 1381 gene locus_tag LOCUS_10630 1058 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1392 1994 gene locus_tag LOCUS_10640 1392 1994 CDS product TIGR00267 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870150.1 protein_id gnl|my_center|LOCUS_10640 3012 1975 gene locus_tag LOCUS_10650 gene mtnA 3012 1975 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_10650 <4042 3142 gene locus_tag LOCUS_10660 <4042 3142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876508.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence110 123 197 gene locus_tag LOCUS_t00280 123 197 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 264 644 gene locus_tag LOCUS_10670 gene speD 264 644 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081137.1 protein_id gnl|my_center|LOCUS_10670 637 1557 gene locus_tag LOCUS_10680 gene speE 637 1557 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546275.1 protein_id gnl|my_center|LOCUS_10680 1598 1915 gene locus_tag LOCUS_10690 1598 1915 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240464.1 protein_id gnl|my_center|LOCUS_10690 1884 3512 gene locus_tag LOCUS_10700 1884 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence111 158 1201 gene locus_tag LOCUS_10710 gene moaA 158 1201 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251175.1 protein_id gnl|my_center|LOCUS_10710 1218 3017 gene locus_tag LOCUS_10720 gene infB 1218 3017 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978230.1 protein_id gnl|my_center|LOCUS_10720 3063 3500 gene locus_tag LOCUS_10730 3063 3500 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250901.1 protein_id gnl|my_center|LOCUS_10730 3487 3789 gene locus_tag LOCUS_10740 3487 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 3782 3946 gene locus_tag LOCUS_10750 3782 3946 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013748365.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence112 <1 953 gene locus_tag LOCUS_10760 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393455.1:putative aminohydrolase SsnA 999 1865 gene locus_tag LOCUS_10770 999 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1872 2336 gene locus_tag LOCUS_10780 1872 2336 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434079.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence113 <1 1296 gene locus_tag LOCUS_10790 <1 1296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_148183415.1:type II/IV secretion system ATPase subunit 1305 1886 gene locus_tag LOCUS_10800 1305 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2388 1912 gene locus_tag LOCUS_10810 2388 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2525 2893 gene locus_tag LOCUS_10820 2525 2893 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870858.1 protein_id gnl|my_center|LOCUS_10820 2969 3562 gene locus_tag LOCUS_10830 2969 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence114 610 1647 gene locus_tag LOCUS_10840 610 1647 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_10840 3629 1644 gene locus_tag LOCUS_10850 3629 1644 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763679.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence115 110 883 gene locus_tag LOCUS_10860 110 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10860 871 1650 gene locus_tag LOCUS_10870 gene trpA 871 1650 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 protein_id gnl|my_center|LOCUS_10870 1713 2138 gene locus_tag LOCUS_10880 1713 2138 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930690.1 protein_id gnl|my_center|LOCUS_10880 2778 2146 gene locus_tag LOCUS_10890 2778 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3416 2775 gene locus_tag LOCUS_10900 3416 2775 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064817.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence116 1885 404 gene locus_tag LOCUS_10910 1885 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2589 1882 gene locus_tag LOCUS_10920 2589 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence117 244 35 gene locus_tag LOCUS_10930 244 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 794 492 gene locus_tag LOCUS_10940 794 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 996 811 gene locus_tag LOCUS_10950 996 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1198 1374 gene locus_tag LOCUS_10960 1198 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1789 1568 gene locus_tag LOCUS_10970 1789 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1991 2485 gene locus_tag LOCUS_10980 1991 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2511 2723 gene locus_tag LOCUS_10990 2511 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3561 2878 gene locus_tag LOCUS_11000 3561 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence118 836 378 gene locus_tag LOCUS_11010 836 378 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250161.1 protein_id gnl|my_center|LOCUS_11010 1644 883 gene locus_tag LOCUS_11020 1644 883 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_11020 2018 1641 gene locus_tag LOCUS_11030 2018 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 <3603 2072 gene locus_tag LOCUS_11040 <3603 2072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877664.1:heavy metal translocating P-type ATPase >Feature sequence119 711 1094 gene locus_tag LOCUS_11050 gene mce 711 1094 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_11050 1133 2647 gene locus_tag LOCUS_11060 1133 2647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_11060 <3582 2649 gene locus_tag LOCUS_11070 <3582 2649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393448.1:ABC transporter permease >Feature sequence120 1337 615 gene locus_tag LOCUS_11080 1337 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 <3570 1391 gene locus_tag LOCUS_11090 <3570 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762664.1:ABC transporter substrate-binding protein >Feature sequence121 890 420 gene locus_tag LOCUS_11100 890 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1411 923 gene locus_tag LOCUS_11110 1411 923 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867981.1 protein_id gnl|my_center|LOCUS_11110 2559 1459 gene locus_tag LOCUS_11120 2559 1459 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228989.1 protein_id gnl|my_center|LOCUS_11120 2634 3161 gene locus_tag LOCUS_11130 gene dcd 2634 3161 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776509.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence122 180 1640 gene locus_tag LOCUS_11140 gene xylB 180 1640 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_11140 1790 2059 gene locus_tag LOCUS_11150 1790 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2062 2451 gene locus_tag LOCUS_11160 2062 2451 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763385.1 protein_id gnl|my_center|LOCUS_11160 <3234 2453 gene locus_tag LOCUS_11170 <3234 2453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022970.1:ribonuclease Z >Feature sequence123 697 1377 gene locus_tag LOCUS_11180 697 1377 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249896.1 protein_id gnl|my_center|LOCUS_11180 1427 2203 gene locus_tag LOCUS_11190 1427 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2245 2616 gene locus_tag LOCUS_11200 2245 2616 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240467.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence124 1196 1606 gene locus_tag LOCUS_11210 1196 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2304 1603 gene locus_tag LOCUS_11220 2304 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2630 2352 gene locus_tag LOCUS_11230 2630 2352 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence125 447 1466 gene locus_tag LOCUS_11240 447 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 <3117 1582 gene locus_tag LOCUS_11250 <3117 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146849.1:PINc/VapC family ATPase >Feature sequence126 382 1407 gene locus_tag LOCUS_11260 gene leuB 382 1407 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978405.1 protein_id gnl|my_center|LOCUS_11260 1432 1980 gene locus_tag LOCUS_11270 1432 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2530 1967 gene locus_tag LOCUS_11280 2530 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762933.1 protein_id gnl|my_center|LOCUS_11280 2964 2551 gene locus_tag LOCUS_11290 2964 2551 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582738.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence127 280 636 gene locus_tag LOCUS_11300 280 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11300 636 893 gene locus_tag LOCUS_11310 636 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 894 1880 gene locus_tag LOCUS_11320 gene ilvC 894 1880 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146977.1 protein_id gnl|my_center|LOCUS_11320 2308 1892 gene locus_tag LOCUS_11330 gene lrpA 2308 1892 CDS product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251084.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence128 280 519 gene locus_tag LOCUS_11340 280 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 516 1523 gene locus_tag LOCUS_11350 gene gyaR 516 1523 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_11350 1525 2313 gene locus_tag LOCUS_11360 1525 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence129 >Feature sequence130 314 550 gene locus_tag LOCUS_11370 314 550 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846657.1 protein_id gnl|my_center|LOCUS_11370 557 958 gene locus_tag LOCUS_11380 557 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 995 1990 gene locus_tag LOCUS_11390 995 1990 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878608.1 protein_id gnl|my_center|LOCUS_11390 <3037 1985 gene locus_tag LOCUS_11400 <3037 1985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978163.1:FAD-binding oxidoreductase >Feature sequence131 81 290 gene locus_tag LOCUS_11410 81 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1698 532 gene locus_tag LOCUS_11420 1698 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 <2906 1695 gene locus_tag LOCUS_11430 <2906 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877115.1:amidohydrolase family protein >Feature sequence132 412 951 gene locus_tag LOCUS_11440 412 951 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762516.1 protein_id gnl|my_center|LOCUS_11440 948 1109 gene locus_tag LOCUS_11450 948 1109 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763587.1 protein_id gnl|my_center|LOCUS_11450 1205 1591 gene locus_tag LOCUS_11460 1205 1591 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_11460 1602 2156 gene locus_tag LOCUS_11470 1602 2156 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 protein_id gnl|my_center|LOCUS_11470 2153 2650 gene locus_tag LOCUS_11480 2153 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence133 614 949 gene locus_tag LOCUS_11490 614 949 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_11490 1450 1133 gene locus_tag LOCUS_11500 1450 1133 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_11500 1823 1443 gene locus_tag LOCUS_11510 1823 1443 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879111.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence134 <1 955 gene locus_tag LOCUS_11520 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878252.1:2-oxoacid:acceptor oxidoreductase subunit alpha 952 1818 gene locus_tag LOCUS_11530 952 1818 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878253.1 protein_id gnl|my_center|LOCUS_11530 1897 2118 gene locus_tag LOCUS_11540 1897 2118 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015098.1 protein_id gnl|my_center|LOCUS_11540 <2710 2133 gene locus_tag LOCUS_11550 <2710 2133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583028.1:glycosidase >Feature sequence135 1418 399 gene locus_tag LOCUS_11560 gene adhP 1418 399 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258663.1 protein_id gnl|my_center|LOCUS_11560 1556 2020 gene locus_tag LOCUS_11570 1556 2020 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768286.1 protein_id gnl|my_center|LOCUS_11570 2407 2021 gene locus_tag LOCUS_11580 2407 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence136 1181 696 gene locus_tag LOCUS_11590 1181 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1270 1494 gene locus_tag LOCUS_11600 1270 1494 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980138.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence137 2167 1442 gene locus_tag LOCUS_11610 2167 1442 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061059.1 protein_id gnl|my_center|LOCUS_11610 2327 2509 gene locus_tag LOCUS_11620 2327 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence138 1672 359 gene locus_tag LOCUS_11630 gene hisS 1672 359 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868795.1 protein_id gnl|my_center|LOCUS_11630 1786 1712 gene locus_tag LOCUS_t00290 1786 1712 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence139 1324 1058 gene locus_tag LOCUS_11640 1324 1058 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869959.1 protein_id gnl|my_center|LOCUS_11640 1515 1336 gene locus_tag LOCUS_11650 1515 1336 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867153.1 protein_id gnl|my_center|LOCUS_11650 <2447 1535 gene locus_tag LOCUS_11660 <2447 1535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023790.1:geranylgeranyl reductase family protein >Feature sequence140 <1 792 gene locus_tag LOCUS_11670 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763152.1:bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase 1346 801 gene locus_tag LOCUS_11680 1346 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 <2377 1471 gene locus_tag LOCUS_11690 <2377 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240273.1:PINc/VapC family ATPase >Feature sequence141 228 2060 gene locus_tag LOCUS_11700 228 2060 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence142 <1 1078 gene locus_tag LOCUS_11710 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000414744.1:long-chain-fatty-acid--CoA ligase 2004 1075 gene locus_tag LOCUS_11720 2004 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence143 1407 421 gene locus_tag LOCUS_11730 1407 421 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence144