>Feature sequence001 29 322 gene locus_tag LOCUS_00010 29 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1254 328 gene locus_tag LOCUS_00020 1254 328 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257037.1 protein_id gnl|my_center|LOCUS_00020 1360 2772 gene locus_tag LOCUS_00030 1360 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2808 4892 gene locus_tag LOCUS_00040 2808 4892 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_00040 4879 5193 gene locus_tag LOCUS_00050 4879 5193 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250247.1 protein_id gnl|my_center|LOCUS_00050 5985 5194 gene locus_tag LOCUS_00060 gene nadE 5985 5194 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878500.1 protein_id gnl|my_center|LOCUS_00060 6099 9371 gene locus_tag LOCUS_00070 gene polC 6099 9371 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_00070 9368 10135 gene locus_tag LOCUS_00080 9368 10135 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_00080 10636 10136 gene locus_tag LOCUS_00090 gene pyrE 10636 10136 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870621.1 protein_id gnl|my_center|LOCUS_00090 10709 10984 gene locus_tag LOCUS_00100 10709 10984 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545551.1 protein_id gnl|my_center|LOCUS_00100 10984 11718 gene locus_tag LOCUS_00110 10984 11718 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496890.1 protein_id gnl|my_center|LOCUS_00110 12260 11709 gene locus_tag LOCUS_00120 12260 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12568 12257 gene locus_tag LOCUS_00130 12568 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13155 12565 gene locus_tag LOCUS_00140 13155 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13236 14576 gene locus_tag LOCUS_00150 gene purB 13236 14576 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868368.1 protein_id gnl|my_center|LOCUS_00150 14573 15289 gene locus_tag LOCUS_00160 14573 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15440 17743 gene locus_tag LOCUS_00170 15440 17743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17779 19128 gene locus_tag LOCUS_00180 17779 19128 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867603.1 protein_id gnl|my_center|LOCUS_00180 19125 19694 gene locus_tag LOCUS_00190 gene trmY 19125 19694 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064324.1 protein_id gnl|my_center|LOCUS_00190 19691 20617 gene locus_tag LOCUS_00200 19691 20617 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251198.1 protein_id gnl|my_center|LOCUS_00200 22448 20604 gene locus_tag LOCUS_00210 22448 20604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24037 22445 gene locus_tag LOCUS_00220 24037 22445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24120 25871 gene locus_tag LOCUS_00230 24120 25871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27348 25855 gene locus_tag LOCUS_00240 gene arcS 27348 25855 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_00240 32116 27353 gene locus_tag LOCUS_00250 32116 27353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33207 32161 gene locus_tag LOCUS_00260 gene ftsZ 33207 32161 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_00260 33558 33208 gene locus_tag LOCUS_00270 33558 33208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 33664 34320 gene locus_tag LOCUS_00280 33664 34320 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868627.1 protein_id gnl|my_center|LOCUS_00280 35622 34303 gene locus_tag LOCUS_00290 35622 34303 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496722.1 protein_id gnl|my_center|LOCUS_00290 35708 35881 gene locus_tag LOCUS_00300 35708 35881 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867659.1 protein_id gnl|my_center|LOCUS_00300 37106 35874 gene locus_tag LOCUS_00310 37106 35874 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878039.1 protein_id gnl|my_center|LOCUS_00310 37707 37138 gene locus_tag LOCUS_00320 37707 37138 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250408.1 protein_id gnl|my_center|LOCUS_00320 38270 37698 gene locus_tag LOCUS_00330 38270 37698 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867340.1 protein_id gnl|my_center|LOCUS_00330 38622 38311 gene locus_tag LOCUS_00340 38622 38311 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024127.1 protein_id gnl|my_center|LOCUS_00340 38758 40821 gene locus_tag LOCUS_00350 38758 40821 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_00350 40858 42312 gene locus_tag LOCUS_00360 40858 42312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 42783 42295 gene locus_tag LOCUS_00370 42783 42295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 42881 43435 gene locus_tag LOCUS_00380 42881 43435 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250285.1 protein_id gnl|my_center|LOCUS_00380 43849 43367 gene locus_tag LOCUS_00390 43849 43367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45039 43846 gene locus_tag LOCUS_00400 gene folP 45039 43846 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948526.1 protein_id gnl|my_center|LOCUS_00400 46472 45081 gene locus_tag LOCUS_00410 46472 45081 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868191.1 protein_id gnl|my_center|LOCUS_00410 46961 46515 gene locus_tag LOCUS_00420 46961 46515 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147325.1 protein_id gnl|my_center|LOCUS_00420 48703 46964 gene locus_tag LOCUS_00430 gene infB 48703 46964 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_00430 49566 49021 gene locus_tag LOCUS_00440 49566 49021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 >Feature sequence002 307 513 gene locus_tag LOCUS_00450 307 513 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_00450 1063 485 gene locus_tag LOCUS_00460 1063 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868040.1 protein_id gnl|my_center|LOCUS_00460 1562 1113 gene locus_tag LOCUS_00470 1562 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 2813 1695 gene locus_tag LOCUS_00480 2813 1695 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249758.1 protein_id gnl|my_center|LOCUS_00480 3370 2936 gene locus_tag LOCUS_00490 3370 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 4445 3375 gene locus_tag LOCUS_00500 4445 3375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867864.1 protein_id gnl|my_center|LOCUS_00500 5529 4438 gene locus_tag LOCUS_00510 5529 4438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_00510 6451 5534 gene locus_tag LOCUS_00520 6451 5534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 protein_id gnl|my_center|LOCUS_00520 7431 6457 gene locus_tag LOCUS_00530 7431 6457 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810095.1 protein_id gnl|my_center|LOCUS_00530 9223 7523 gene locus_tag LOCUS_00540 9223 7523 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830550.1 protein_id gnl|my_center|LOCUS_00540 9482 9321 gene locus_tag LOCUS_00550 9482 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 9589 9825 gene locus_tag LOCUS_00560 gene rpl18a 9589 9825 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870099.1 protein_id gnl|my_center|LOCUS_00560 9818 10252 gene locus_tag LOCUS_00570 gene pfdA 9818 10252 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249956.1 protein_id gnl|my_center|LOCUS_00570 10236 11159 gene locus_tag LOCUS_00580 gene ftsY 10236 11159 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 protein_id gnl|my_center|LOCUS_00580 11161 12045 gene locus_tag LOCUS_00590 gene cysK 11161 12045 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436514.1 protein_id gnl|my_center|LOCUS_00590 13408 12029 gene locus_tag LOCUS_00600 13408 12029 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869712.1 protein_id gnl|my_center|LOCUS_00600 15157 13409 gene locus_tag LOCUS_00610 15157 13409 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_00610 15480 15163 gene locus_tag LOCUS_00620 15480 15163 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869714.1 protein_id gnl|my_center|LOCUS_00620 16565 15477 gene locus_tag LOCUS_00630 16565 15477 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869715.1 protein_id gnl|my_center|LOCUS_00630 17142 16558 gene locus_tag LOCUS_00640 17142 16558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 18963 17143 gene locus_tag LOCUS_00650 18963 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 21110 18963 gene locus_tag LOCUS_00660 21110 18963 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060932.1 protein_id gnl|my_center|LOCUS_00660 21418 21107 gene locus_tag LOCUS_00670 21418 21107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 21503 22270 gene locus_tag LOCUS_00680 21503 22270 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868110.1 protein_id gnl|my_center|LOCUS_00680 22267 22932 gene locus_tag LOCUS_00690 gene pxpB 22267 22932 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868109.1 protein_id gnl|my_center|LOCUS_00690 22929 23918 gene locus_tag LOCUS_00700 22929 23918 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146781.1 protein_id gnl|my_center|LOCUS_00700 24571 23915 gene locus_tag LOCUS_00710 24571 23915 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020542.1 protein_id gnl|my_center|LOCUS_00710 25403 24768 gene locus_tag LOCUS_00720 25403 24768 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868563.1 protein_id gnl|my_center|LOCUS_00720 25503 27221 gene locus_tag LOCUS_00730 25503 27221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867422.1 protein_id gnl|my_center|LOCUS_00730 27218 28954 gene locus_tag LOCUS_00740 27218 28954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867421.1 protein_id gnl|my_center|LOCUS_00740 29675 28962 gene locus_tag LOCUS_00750 29675 28962 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868772.1 protein_id gnl|my_center|LOCUS_00750 29794 30444 gene locus_tag LOCUS_00760 29794 30444 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250036.1 protein_id gnl|my_center|LOCUS_00760 30450 31400 gene locus_tag LOCUS_00770 gene trxB 30450 31400 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060886.1 protein_id gnl|my_center|LOCUS_00770 31473 31781 gene locus_tag LOCUS_00780 gene eif1A 31473 31781 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249753.1 protein_id gnl|my_center|LOCUS_00780 31778 32542 gene locus_tag LOCUS_00790 31778 32542 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 protein_id gnl|my_center|LOCUS_00790 32543 33091 gene locus_tag LOCUS_00800 32543 33091 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249751.1 protein_id gnl|my_center|LOCUS_00800 33096 34316 gene locus_tag LOCUS_00810 33096 34316 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250764.1 protein_id gnl|my_center|LOCUS_00810 34872 34300 gene locus_tag LOCUS_00820 34872 34300 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146478.1 protein_id gnl|my_center|LOCUS_00820 35210 34869 gene locus_tag LOCUS_00830 gene pth2 35210 34869 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_00830 35697 35212 gene locus_tag LOCUS_00840 35697 35212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 35799 37379 gene locus_tag LOCUS_00850 35799 37379 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867223.1 protein_id gnl|my_center|LOCUS_00850 37432 39087 gene locus_tag LOCUS_00860 gene thsB 37432 39087 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_00860 39815 39102 gene locus_tag LOCUS_00870 39815 39102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 39805 41022 gene locus_tag LOCUS_00880 gene hutI 39805 41022 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 protein_id gnl|my_center|LOCUS_00880 41009 41440 gene locus_tag LOCUS_00890 gene rimI 41009 41440 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208657.1 protein_id gnl|my_center|LOCUS_00890 42643 41447 gene locus_tag LOCUS_00900 42643 41447 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146541.1 protein_id gnl|my_center|LOCUS_00900 43691 42693 gene locus_tag LOCUS_00910 gene queA 43691 42693 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583955.1 protein_id gnl|my_center|LOCUS_00910 43764 44423 gene locus_tag LOCUS_00920 43764 44423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 44430 45437 gene locus_tag LOCUS_00930 44430 45437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 >Feature sequence003 <1 691 gene locus_tag LOCUS_00940 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162013106.1:tetratricopeptide repeat protein 856 692 gene locus_tag LOCUS_00950 856 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 1037 1345 gene locus_tag LOCUS_00960 1037 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 1511 2980 gene locus_tag LOCUS_00970 gene purH 1511 2980 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 protein_id gnl|my_center|LOCUS_00970 2990 4150 gene locus_tag LOCUS_00980 2990 4150 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147112.1 protein_id gnl|my_center|LOCUS_00980 4147 4509 gene locus_tag LOCUS_00990 4147 4509 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_00990 7533 4510 gene locus_tag LOCUS_01000 7533 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 7616 8908 gene locus_tag LOCUS_01010 gene asnS 7616 8908 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762130.1 protein_id gnl|my_center|LOCUS_01010 9996 8923 gene locus_tag LOCUS_01020 9996 8923 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_01020 11041 9989 gene locus_tag LOCUS_01030 11041 9989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_01030 13503 11047 gene locus_tag LOCUS_01040 13503 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 14955 13519 gene locus_tag LOCUS_01050 14955 13519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 15067 15234 gene locus_tag LOCUS_01060 15067 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 15234 15581 gene locus_tag LOCUS_01070 15234 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 16093 15578 gene locus_tag LOCUS_01080 16093 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 16325 16648 gene locus_tag LOCUS_01090 16325 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 17202 16645 gene locus_tag LOCUS_01100 gene hpt 17202 16645 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871179.1 protein_id gnl|my_center|LOCUS_01100 17864 17199 gene locus_tag LOCUS_01110 17864 17199 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867371.1 protein_id gnl|my_center|LOCUS_01110 17941 19017 gene locus_tag LOCUS_01120 17941 19017 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868753.1 protein_id gnl|my_center|LOCUS_01120 19474 19986 gene locus_tag LOCUS_01130 19474 19986 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_01130 19973 20446 gene locus_tag LOCUS_01140 19973 20446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 20476 21375 gene locus_tag LOCUS_01150 20476 21375 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_01150 21375 22127 gene locus_tag LOCUS_01160 21375 22127 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_01160 22124 22804 gene locus_tag LOCUS_01170 22124 22804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022197.1 protein_id gnl|my_center|LOCUS_01170 23041 22808 gene locus_tag LOCUS_01180 23041 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 23490 24146 gene locus_tag LOCUS_01190 23490 24146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 24724 24143 gene locus_tag LOCUS_01200 24724 24143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 24826 25224 gene locus_tag LOCUS_01210 24826 25224 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867887.1 protein_id gnl|my_center|LOCUS_01210 25229 26089 gene locus_tag LOCUS_01220 25229 26089 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867985.1 protein_id gnl|my_center|LOCUS_01220 26090 26968 gene locus_tag LOCUS_01230 26090 26968 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249652.1 protein_id gnl|my_center|LOCUS_01230 26961 27335 gene locus_tag LOCUS_01240 26961 27335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 28087 27332 gene locus_tag LOCUS_01250 gene xth 28087 27332 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_01250 28267 29160 gene locus_tag LOCUS_01260 28267 29160 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_01260 31523 29157 gene locus_tag LOCUS_01270 gene gyrA 31523 29157 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_01270 33468 31534 gene locus_tag LOCUS_01280 gene gyrB 33468 31534 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_01280 33609 33956 gene locus_tag LOCUS_01290 33609 33956 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 protein_id gnl|my_center|LOCUS_01290 33953 34795 gene locus_tag LOCUS_01300 33953 34795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 34785 35252 gene locus_tag LOCUS_01310 34785 35252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 35242 36159 gene locus_tag LOCUS_01320 35242 36159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948828.1 protein_id gnl|my_center|LOCUS_01320 36152 36961 gene locus_tag LOCUS_01330 36152 36961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 38735 36963 gene locus_tag LOCUS_01340 38735 36963 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978165.1 protein_id gnl|my_center|LOCUS_01340 38809 39321 gene locus_tag LOCUS_01350 38809 39321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 >Feature sequence004 1555 1124 gene locus_tag LOCUS_01360 1555 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2740 1625 gene locus_tag LOCUS_01370 gene fbp 2740 1625 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868421.1 protein_id gnl|my_center|LOCUS_01370 2834 3832 gene locus_tag LOCUS_01380 gene gap 2834 3832 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_01380 3878 4843 gene locus_tag LOCUS_01390 gene radA 3878 4843 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_01390 6207 4840 gene locus_tag LOCUS_01400 gene cysS 6207 4840 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_01400 7053 6238 gene locus_tag LOCUS_01410 7053 6238 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947384.1 protein_id gnl|my_center|LOCUS_01410 8994 7114 gene locus_tag LOCUS_01420 8994 7114 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249027.1 protein_id gnl|my_center|LOCUS_01420 10169 9045 gene locus_tag LOCUS_01430 10169 9045 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_01430 10274 11779 gene locus_tag LOCUS_01440 10274 11779 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250791.1 protein_id gnl|my_center|LOCUS_01440 11831 12658 gene locus_tag LOCUS_01450 11831 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 12667 13461 gene locus_tag LOCUS_01460 12667 13461 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_01460 13738 13469 gene locus_tag LOCUS_01470 13738 13469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 13907 14212 gene locus_tag LOCUS_01480 13907 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 14446 14213 gene locus_tag LOCUS_01490 14446 14213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 14581 15474 gene locus_tag LOCUS_01500 14581 15474 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993980.1 protein_id gnl|my_center|LOCUS_01500 15475 16095 gene locus_tag LOCUS_01510 15475 16095 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022418.1 protein_id gnl|my_center|LOCUS_01510 16095 16850 gene locus_tag LOCUS_01520 gene uppS 16095 16850 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867696.1 protein_id gnl|my_center|LOCUS_01520 16855 17508 gene locus_tag LOCUS_01530 16855 17508 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496578.1 protein_id gnl|my_center|LOCUS_01530 17489 18193 gene locus_tag LOCUS_01540 17489 18193 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902907.1 protein_id gnl|my_center|LOCUS_01540 18794 18135 gene locus_tag LOCUS_01550 18794 18135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 19491 18787 gene locus_tag LOCUS_01560 gene rph 19491 18787 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_01560 19568 19951 gene locus_tag LOCUS_01570 19568 19951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 20940 19957 gene locus_tag LOCUS_01580 20940 19957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080230.1 protein_id gnl|my_center|LOCUS_01580 21913 20942 gene locus_tag LOCUS_01590 21913 20942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879266.1 protein_id gnl|my_center|LOCUS_01590 22778 21918 gene locus_tag LOCUS_01600 22778 21918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879265.1 protein_id gnl|my_center|LOCUS_01600 23811 22789 gene locus_tag LOCUS_01610 23811 22789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064459.1 protein_id gnl|my_center|LOCUS_01610 25447 23867 gene locus_tag LOCUS_01620 25447 23867 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762356.1 protein_id gnl|my_center|LOCUS_01620 25629 26042 gene locus_tag LOCUS_01630 25629 26042 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_01630 26072 28255 gene locus_tag LOCUS_01640 26072 28255 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_01640 28979 28284 gene locus_tag LOCUS_01650 28979 28284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 30254 29100 gene locus_tag LOCUS_01660 gene tdt 30254 29100 CDS product tellurite-resistance/dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870267.1 protein_id gnl|my_center|LOCUS_01660 31985 30615 gene locus_tag LOCUS_01670 31985 30615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 32456 32025 gene locus_tag LOCUS_01680 gene lrpA 32456 32025 CDS product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251084.1 protein_id gnl|my_center|LOCUS_01680 34586 32502 gene locus_tag LOCUS_01690 34586 32502 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868004.1 protein_id gnl|my_center|LOCUS_01690 <35221 34622 gene locus_tag LOCUS_01700 <35221 34622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146523.1:DEAD/DEAH box helicase >Feature sequence005 553 182 gene locus_tag LOCUS_01710 553 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 1307 624 gene locus_tag LOCUS_01720 1307 624 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021328.1 protein_id gnl|my_center|LOCUS_01720 1437 4973 gene locus_tag LOCUS_01730 1437 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 4980 5501 gene locus_tag LOCUS_01740 4980 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 5581 6666 gene locus_tag LOCUS_01750 5581 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 6663 7181 gene locus_tag LOCUS_01760 6663 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 8173 7202 gene locus_tag LOCUS_01770 8173 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 8245 8733 gene locus_tag LOCUS_01780 8245 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 9311 8730 gene locus_tag LOCUS_01790 9311 8730 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_01790 11197 9308 gene locus_tag LOCUS_01800 gene iorA 11197 9308 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_01800 12099 11194 gene locus_tag LOCUS_01810 12099 11194 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_01810 13286 12099 gene locus_tag LOCUS_01820 13286 12099 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 protein_id gnl|my_center|LOCUS_01820 13609 13283 gene locus_tag LOCUS_01830 13609 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 14171 13611 gene locus_tag LOCUS_01840 14171 13611 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_01840 15226 14204 gene locus_tag LOCUS_01850 15226 14204 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 protein_id gnl|my_center|LOCUS_01850 15762 15223 gene locus_tag LOCUS_01860 15762 15223 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_01860 16141 15752 gene locus_tag LOCUS_01870 16141 15752 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_01870 16233 17021 gene locus_tag LOCUS_01880 16233 17021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 17374 17024 gene locus_tag LOCUS_01890 17374 17024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 18184 17408 gene locus_tag LOCUS_01900 18184 17408 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496701.1 protein_id gnl|my_center|LOCUS_01900 18254 19501 gene locus_tag LOCUS_01910 18254 19501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868492.1 protein_id gnl|my_center|LOCUS_01910 20105 19512 gene locus_tag LOCUS_01920 20105 19512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249088.1 protein_id gnl|my_center|LOCUS_01920 20224 21432 gene locus_tag LOCUS_01930 20224 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 21434 22108 gene locus_tag LOCUS_01940 gene mobB 21434 22108 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870841.1 protein_id gnl|my_center|LOCUS_01940 22697 22095 gene locus_tag LOCUS_01950 22697 22095 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_01950 22825 23511 gene locus_tag LOCUS_01960 22825 23511 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868290.1 protein_id gnl|my_center|LOCUS_01960 23542 24699 gene locus_tag LOCUS_01970 23542 24699 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_01970 24699 26459 gene locus_tag LOCUS_01980 gene glmS 24699 26459 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880146.1 protein_id gnl|my_center|LOCUS_01980 26949 26461 gene locus_tag LOCUS_01990 26949 26461 CDS product DUF2250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249672.1 protein_id gnl|my_center|LOCUS_01990 26952 28256 gene locus_tag LOCUS_02000 gene glmM 26952 28256 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065583.1 protein_id gnl|my_center|LOCUS_02000 29254 28238 gene locus_tag LOCUS_02010 29254 28238 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 protein_id gnl|my_center|LOCUS_02010 29374 30537 gene locus_tag LOCUS_02020 29374 30537 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868819.1 protein_id gnl|my_center|LOCUS_02020 31391 30534 gene locus_tag LOCUS_02030 31391 30534 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_02030 31564 32844 gene locus_tag LOCUS_02040 31564 32844 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_02040 33010 32855 gene locus_tag LOCUS_02050 33010 32855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 33843 33007 gene locus_tag LOCUS_02060 33843 33007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 >Feature sequence006 1224 556 gene locus_tag LOCUS_02070 1224 556 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 protein_id gnl|my_center|LOCUS_02070 1311 1979 gene locus_tag LOCUS_02080 1311 1979 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083177.1 protein_id gnl|my_center|LOCUS_02080 2015 4231 gene locus_tag LOCUS_02090 2015 4231 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_02090 4241 4483 gene locus_tag LOCUS_02100 4241 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 5704 4484 gene locus_tag LOCUS_02110 gene prf1 5704 4484 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878715.1 protein_id gnl|my_center|LOCUS_02110 5798 6217 gene locus_tag LOCUS_02120 5798 6217 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_02120 6580 6505 gene locus_tag LOCUS_t00010 6580 6505 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6639 7370 gene locus_tag LOCUS_02130 6639 7370 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868696.1 protein_id gnl|my_center|LOCUS_02130 8181 7360 gene locus_tag LOCUS_02140 8181 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 8750 8187 gene locus_tag LOCUS_02150 8750 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 8836 9738 gene locus_tag LOCUS_02160 8836 9738 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762992.1 protein_id gnl|my_center|LOCUS_02160 9763 11025 gene locus_tag LOCUS_02170 gene rbcL 9763 11025 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870747.1 protein_id gnl|my_center|LOCUS_02170 12572 11028 gene locus_tag LOCUS_02180 12572 11028 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496733.1 protein_id gnl|my_center|LOCUS_02180 12644 13354 gene locus_tag LOCUS_02190 12644 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 13769 13344 gene locus_tag LOCUS_02200 13769 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 14056 13769 gene locus_tag LOCUS_02210 14056 13769 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065070.1 protein_id gnl|my_center|LOCUS_02210 15606 14062 gene locus_tag LOCUS_02220 15606 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 18294 15607 gene locus_tag LOCUS_02230 18294 15607 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879381.1 protein_id gnl|my_center|LOCUS_02230 21896 18291 gene locus_tag LOCUS_02240 21896 18291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 22160 21906 gene locus_tag LOCUS_02250 22160 21906 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250035.1 protein_id gnl|my_center|LOCUS_02250 22257 22182 gene locus_tag LOCUS_t00020 22257 22182 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 23054 22389 gene locus_tag LOCUS_02260 23054 22389 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868261.1 protein_id gnl|my_center|LOCUS_02260 23413 23051 gene locus_tag LOCUS_02270 23413 23051 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583683.1 protein_id gnl|my_center|LOCUS_02270 23960 23433 gene locus_tag LOCUS_02280 23960 23433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02280 24552 24773 gene locus_tag LOCUS_02290 24552 24773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 25071 24778 gene locus_tag LOCUS_02300 25071 24778 CDS product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066065.1 protein_id gnl|my_center|LOCUS_02300 25519 25073 gene locus_tag LOCUS_02310 25519 25073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 25576 26085 gene locus_tag LOCUS_02320 gene scpB 25576 26085 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879077.1 protein_id gnl|my_center|LOCUS_02320 26078 27406 gene locus_tag LOCUS_02330 gene purD 26078 27406 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868755.1 protein_id gnl|my_center|LOCUS_02330 28632 27403 gene locus_tag LOCUS_02340 28632 27403 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877199.1 protein_id gnl|my_center|LOCUS_02340 28956 28663 gene locus_tag LOCUS_02350 28956 28663 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018862.1 protein_id gnl|my_center|LOCUS_02350 29008 31281 gene locus_tag LOCUS_02360 29008 31281 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 protein_id gnl|my_center|LOCUS_02360 31308 31394 gene locus_tag LOCUS_t00030 31308 31394 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence007 2413 1454 gene locus_tag LOCUS_02370 2413 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 2514 3164 gene locus_tag LOCUS_02380 2514 3164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978899.1 protein_id gnl|my_center|LOCUS_02380 3154 3873 gene locus_tag LOCUS_02390 3154 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3931 5082 gene locus_tag LOCUS_02400 3931 5082 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_02400 5991 5143 gene locus_tag LOCUS_02410 5991 5143 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064919.1 protein_id gnl|my_center|LOCUS_02410 7271 5994 gene locus_tag LOCUS_02420 7271 5994 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020639.1 protein_id gnl|my_center|LOCUS_02420 7886 7281 gene locus_tag LOCUS_02430 7886 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249088.1 protein_id gnl|my_center|LOCUS_02430 7958 8443 gene locus_tag LOCUS_02440 7958 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 8875 8432 gene locus_tag LOCUS_02450 8875 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 9420 8872 gene locus_tag LOCUS_02460 9420 8872 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878792.1 protein_id gnl|my_center|LOCUS_02460 9631 10884 gene locus_tag LOCUS_02470 9631 10884 CDS product TIGR00529 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867137.1 protein_id gnl|my_center|LOCUS_02470 11103 11029 gene locus_tag LOCUS_t00040 11103 11029 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11968 11111 gene locus_tag LOCUS_02480 11968 11111 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869643.1 protein_id gnl|my_center|LOCUS_02480 12491 11952 gene locus_tag LOCUS_02490 12491 11952 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 protein_id gnl|my_center|LOCUS_02490 13159 12488 gene locus_tag LOCUS_02500 13159 12488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 13710 13156 gene locus_tag LOCUS_02510 13710 13156 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496506.1 protein_id gnl|my_center|LOCUS_02510 15506 13707 gene locus_tag LOCUS_02520 gene secY 15506 13707 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_02520 15924 15499 gene locus_tag LOCUS_02530 15924 15499 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 protein_id gnl|my_center|LOCUS_02530 16401 15925 gene locus_tag LOCUS_02540 16401 15925 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 protein_id gnl|my_center|LOCUS_02540 17032 16379 gene locus_tag LOCUS_02550 gene rpsE 17032 16379 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879398.1 protein_id gnl|my_center|LOCUS_02550 17532 17035 gene locus_tag LOCUS_02560 17532 17035 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319359.1 protein_id gnl|my_center|LOCUS_02560 17987 17535 gene locus_tag LOCUS_02570 17987 17535 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496504.1 protein_id gnl|my_center|LOCUS_02570 18402 17989 gene locus_tag LOCUS_02580 18402 17989 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869973.1 protein_id gnl|my_center|LOCUS_02580 18944 18408 gene locus_tag LOCUS_02590 18944 18408 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 protein_id gnl|my_center|LOCUS_02590 19344 18955 gene locus_tag LOCUS_02600 19344 18955 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869971.1 protein_id gnl|my_center|LOCUS_02600 19517 19356 gene locus_tag LOCUS_02610 19517 19356 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 protein_id gnl|my_center|LOCUS_02610 20053 19517 gene locus_tag LOCUS_02620 20053 19517 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013673.1 protein_id gnl|my_center|LOCUS_02620 20760 20050 gene locus_tag LOCUS_02630 20760 20050 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_02630 21223 20753 gene locus_tag LOCUS_02640 21223 20753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 21632 21234 gene locus_tag LOCUS_02650 21632 21234 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869966.1 protein_id gnl|my_center|LOCUS_02650 21967 21638 gene locus_tag LOCUS_02660 21967 21638 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011696863.1 protein_id gnl|my_center|LOCUS_02660 22245 21964 gene locus_tag LOCUS_02670 22245 21964 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869964.1 protein_id gnl|my_center|LOCUS_02670 22436 22242 gene locus_tag LOCUS_02680 gene rpmC 22436 22242 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869962.1 protein_id gnl|my_center|LOCUS_02680 23079 22366 gene locus_tag LOCUS_02690 23079 22366 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869961.1 protein_id gnl|my_center|LOCUS_02690 23537 23082 gene locus_tag LOCUS_02700 23537 23082 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978397.1 protein_id gnl|my_center|LOCUS_02700 24002 23547 gene locus_tag LOCUS_02710 gene rpsS 24002 23547 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879414.1 protein_id gnl|my_center|LOCUS_02710 24712 24008 gene locus_tag LOCUS_02720 24712 24008 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_02720 24986 24723 gene locus_tag LOCUS_02730 24986 24723 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_02730 25747 24983 gene locus_tag LOCUS_02740 gene rpl4p 25747 24983 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 protein_id gnl|my_center|LOCUS_02740 26773 25751 gene locus_tag LOCUS_02750 gene rpl3p 26773 25751 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_02750 27816 26929 gene locus_tag LOCUS_02760 27816 26929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 29780 28164 gene locus_tag LOCUS_02770 gene hutU 29780 28164 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 protein_id gnl|my_center|LOCUS_02770 29871 30092 gene locus_tag LOCUS_02780 29871 30092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence008 106 1164 gene locus_tag LOCUS_02790 106 1164 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099211502.1 protein_id gnl|my_center|LOCUS_02790 1248 1808 gene locus_tag LOCUS_02800 1248 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2790 1798 gene locus_tag LOCUS_02810 2790 1798 CDS product TIGR04084 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878081.1 protein_id gnl|my_center|LOCUS_02810 2990 3988 gene locus_tag LOCUS_02820 2990 3988 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_02820 4833 4012 gene locus_tag LOCUS_02830 4833 4012 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_02830 5220 4834 gene locus_tag LOCUS_02840 5220 4834 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879772.1 protein_id gnl|my_center|LOCUS_02840 5786 5223 gene locus_tag LOCUS_02850 5786 5223 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869685.1 protein_id gnl|my_center|LOCUS_02850 6237 5791 gene locus_tag LOCUS_02860 6237 5791 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879774.1 protein_id gnl|my_center|LOCUS_02860 6469 7656 gene locus_tag LOCUS_02870 gene dnaG 6469 7656 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_02870 7653 9143 gene locus_tag LOCUS_02880 7653 9143 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876525.1 protein_id gnl|my_center|LOCUS_02880 9130 9507 gene locus_tag LOCUS_02890 9130 9507 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526762.1 protein_id gnl|my_center|LOCUS_02890 9537 10682 gene locus_tag LOCUS_02900 9537 10682 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080938.1 protein_id gnl|my_center|LOCUS_02900 10930 10858 gene locus_tag LOCUS_t00050 10930 10858 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11026 11253 gene locus_tag LOCUS_02910 11026 11253 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023130.1 protein_id gnl|my_center|LOCUS_02910 11377 12816 gene locus_tag LOCUS_02920 gene purF 11377 12816 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_02920 12854 13102 gene locus_tag LOCUS_02930 12854 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 13099 14493 gene locus_tag LOCUS_02940 13099 14493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 14787 14494 gene locus_tag LOCUS_02950 14787 14494 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496905.1 protein_id gnl|my_center|LOCUS_02950 16312 14822 gene locus_tag LOCUS_02960 16312 14822 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_02960 17517 16333 gene locus_tag LOCUS_02970 gene pan 17517 16333 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_02970 17609 17890 gene locus_tag LOCUS_02980 17609 17890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 18740 17883 gene locus_tag LOCUS_02990 18740 17883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 22266 18730 gene locus_tag LOCUS_03000 gene smc 22266 18730 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_03000 22465 23367 gene locus_tag LOCUS_03010 22465 23367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 23364 23873 gene locus_tag LOCUS_03020 23364 23873 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876823.1 protein_id gnl|my_center|LOCUS_03020 25148 23883 gene locus_tag LOCUS_03030 25148 23883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 26820 25195 gene locus_tag LOCUS_03040 26820 25195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 >Feature sequence009 1606 785 gene locus_tag LOCUS_03050 1606 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 2673 1606 gene locus_tag LOCUS_03060 2673 1606 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_03060 3112 2666 gene locus_tag LOCUS_03070 3112 2666 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_03070 5655 3109 gene locus_tag LOCUS_03080 5655 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 8973 5656 gene locus_tag LOCUS_03090 8973 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 9854 8964 gene locus_tag LOCUS_03100 9854 8964 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_03100 10265 9864 gene locus_tag LOCUS_03110 10265 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 10511 11335 gene locus_tag LOCUS_03120 10511 11335 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867336.1 protein_id gnl|my_center|LOCUS_03120 11332 11748 gene locus_tag LOCUS_03130 11332 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 11754 12674 gene locus_tag LOCUS_03140 11754 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 12725 12808 gene locus_tag LOCUS_t00060 12725 12808 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12887 12960 gene locus_tag LOCUS_t00070 12887 12960 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13096 13653 gene locus_tag LOCUS_03150 13096 13653 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_03150 13694 13810 gene locus_tag LOCUS_r00010 13694 13810 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 15380 13845 gene locus_tag LOCUS_03160 gene citF 15380 13845 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_03160 16229 15381 gene locus_tag LOCUS_03170 16229 15381 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870112.1 protein_id gnl|my_center|LOCUS_03170 16468 16226 gene locus_tag LOCUS_03180 gene citD 16468 16226 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700703.1 protein_id gnl|my_center|LOCUS_03180 16541 17707 gene locus_tag LOCUS_03190 16541 17707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 19158 17704 gene locus_tag LOCUS_03200 19158 17704 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_03200 19829 19203 gene locus_tag LOCUS_03210 19829 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 20928 19816 gene locus_tag LOCUS_03220 gene ftsZ 20928 19816 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_03220 21760 20996 gene locus_tag LOCUS_03230 21760 20996 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_03230 21871 22206 gene locus_tag LOCUS_03240 21871 22206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 22708 22196 gene locus_tag LOCUS_03250 22708 22196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867695.1 protein_id gnl|my_center|LOCUS_03250 22725 23024 gene locus_tag LOCUS_03260 22725 23024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 24301 23021 gene locus_tag LOCUS_03270 24301 23021 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496570.1 protein_id gnl|my_center|LOCUS_03270 24439 25536 gene locus_tag LOCUS_03280 24439 25536 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 protein_id gnl|my_center|LOCUS_03280 25723 25538 gene locus_tag LOCUS_03290 25723 25538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 26194 25724 gene locus_tag LOCUS_03300 26194 25724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 >Feature sequence010 1302 1688 gene locus_tag LOCUS_03310 1302 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 1764 3383 gene locus_tag LOCUS_03320 gene thsB 1764 3383 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878948.1 protein_id gnl|my_center|LOCUS_03320 4691 3384 gene locus_tag LOCUS_03330 4691 3384 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249495.1 protein_id gnl|my_center|LOCUS_03330 4764 6608 gene locus_tag LOCUS_03340 4764 6608 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868264.1 protein_id gnl|my_center|LOCUS_03340 6605 7366 gene locus_tag LOCUS_03350 6605 7366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868133.1 protein_id gnl|my_center|LOCUS_03350 7375 8850 gene locus_tag LOCUS_03360 7375 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868132.1 protein_id gnl|my_center|LOCUS_03360 8931 9530 gene locus_tag LOCUS_03370 8931 9530 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_03370 9565 10617 gene locus_tag LOCUS_03380 9565 10617 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496935.1 protein_id gnl|my_center|LOCUS_03380 10654 10917 gene locus_tag LOCUS_03390 10654 10917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 10874 11239 gene locus_tag LOCUS_03400 10874 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 11245 12090 gene locus_tag LOCUS_03410 11245 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 12121 13035 gene locus_tag LOCUS_03420 gene pyrB 12121 13035 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_03420 13035 13499 gene locus_tag LOCUS_03430 gene pyrI 13035 13499 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_03430 14155 13496 gene locus_tag LOCUS_03440 14155 13496 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_03440 14504 14148 gene locus_tag LOCUS_03450 14504 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 15121 14504 gene locus_tag LOCUS_03460 15121 14504 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_03460 16602 15169 gene locus_tag LOCUS_03470 16602 15169 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878238.1 protein_id gnl|my_center|LOCUS_03470 16751 18262 gene locus_tag LOCUS_03480 16751 18262 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062419932.1 protein_id gnl|my_center|LOCUS_03480 20045 18363 gene locus_tag LOCUS_03490 20045 18363 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023883.1 protein_id gnl|my_center|LOCUS_03490 20158 20337 gene locus_tag LOCUS_03500 20158 20337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249069.1 protein_id gnl|my_center|LOCUS_03500 20334 21923 gene locus_tag LOCUS_03510 20334 21923 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249070.1 protein_id gnl|my_center|LOCUS_03510 22394 21912 gene locus_tag LOCUS_03520 22394 21912 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598730.1 protein_id gnl|my_center|LOCUS_03520 22483 22944 gene locus_tag LOCUS_03530 22483 22944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 22976 24055 gene locus_tag LOCUS_03540 gene thiI 22976 24055 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496669.1 protein_id gnl|my_center|LOCUS_03540 24480 24052 gene locus_tag LOCUS_03550 24480 24052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902326.1 protein_id gnl|my_center|LOCUS_03550 <25131 24461 gene locus_tag LOCUS_03560 <25131 24461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878356.1:NOL1/NOP2/sun family putative RNA methylase >Feature sequence011 <1 1066 gene locus_tag LOCUS_03570 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021657.1:dihydrolipoyl dehydrogenase 1192 1599 gene locus_tag LOCUS_03580 gene speD 1192 1599 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880113.1 protein_id gnl|my_center|LOCUS_03580 1601 2575 gene locus_tag LOCUS_03590 1601 2575 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064426.1 protein_id gnl|my_center|LOCUS_03590 2572 3117 gene locus_tag LOCUS_03600 2572 3117 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_03600 3220 4575 gene locus_tag LOCUS_03610 3220 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4656 4823 gene locus_tag LOCUS_03620 4656 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 5062 4820 gene locus_tag LOCUS_03630 5062 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5575 5120 gene locus_tag LOCUS_03640 5575 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6728 5643 gene locus_tag LOCUS_03650 6728 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 7177 6734 gene locus_tag LOCUS_03660 7177 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 7243 7413 gene locus_tag LOCUS_03670 7243 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 7476 8789 gene locus_tag LOCUS_03680 7476 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 9045 9716 gene locus_tag LOCUS_03690 gene tpiA 9045 9716 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064694.1 protein_id gnl|my_center|LOCUS_03690 9718 10401 gene locus_tag LOCUS_03700 9718 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 11563 10379 gene locus_tag LOCUS_03710 gene cca 11563 10379 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_03710 12033 11695 gene locus_tag LOCUS_03720 12033 11695 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867761.1 protein_id gnl|my_center|LOCUS_03720 12175 14046 gene locus_tag LOCUS_03730 12175 14046 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584045.1 protein_id gnl|my_center|LOCUS_03730 14058 14741 gene locus_tag LOCUS_03740 14058 14741 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_03740 14815 16305 gene locus_tag LOCUS_03750 14815 16305 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_03750 17378 16302 gene locus_tag LOCUS_03760 17378 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 17459 17824 gene locus_tag LOCUS_03770 17459 17824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 17863 18645 gene locus_tag LOCUS_03780 17863 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 18642 19307 gene locus_tag LOCUS_03790 18642 19307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 20037 19309 gene locus_tag LOCUS_03800 20037 19309 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_03800 20941 20105 gene locus_tag LOCUS_03810 20941 20105 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_03810 21584 20985 gene locus_tag LOCUS_03820 21584 20985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 21708 22535 gene locus_tag LOCUS_03830 21708 22535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 22567 23178 gene locus_tag LOCUS_03840 22567 23178 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014586.1 protein_id gnl|my_center|LOCUS_03840 <24628 23179 gene locus_tag LOCUS_03850 <24628 23179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867326.1:DUF2139 domain-containing protein >Feature sequence012 2411 495 gene locus_tag LOCUS_03860 2411 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 2712 3281 gene locus_tag LOCUS_03870 2712 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3278 4336 gene locus_tag LOCUS_03880 3278 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 4659 4574 gene locus_tag LOCUS_t00080 4659 4574 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6784 5396 gene locus_tag LOCUS_03890 6784 5396 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088854992.1 protein_id gnl|my_center|LOCUS_03890 7098 7388 gene locus_tag LOCUS_03900 7098 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 7385 7735 gene locus_tag LOCUS_03910 7385 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 8082 7894 gene locus_tag LOCUS_03920 8082 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03920 8233 11166 gene locus_tag LOCUS_03930 8233 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 12393 11494 gene locus_tag LOCUS_03940 12393 11494 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015858271.1 protein_id gnl|my_center|LOCUS_03940 12943 12458 gene locus_tag LOCUS_03950 12943 12458 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249292.1 protein_id gnl|my_center|LOCUS_03950 13002 14258 gene locus_tag LOCUS_03960 13002 14258 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870108.1 protein_id gnl|my_center|LOCUS_03960 14259 14750 gene locus_tag LOCUS_03970 14259 14750 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870109.1 protein_id gnl|my_center|LOCUS_03970 16201 14747 gene locus_tag LOCUS_03980 16201 14747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 16279 16686 gene locus_tag LOCUS_03990 16279 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 16683 17435 gene locus_tag LOCUS_04000 16683 17435 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249754.1 protein_id gnl|my_center|LOCUS_04000 17422 18219 gene locus_tag LOCUS_04010 17422 18219 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584030.1 protein_id gnl|my_center|LOCUS_04010 18283 18915 gene locus_tag LOCUS_04020 gene psmB 18283 18915 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_04020 18920 20863 gene locus_tag LOCUS_04030 18920 20863 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_04030 21791 20856 gene locus_tag LOCUS_04040 gene trm5b 21791 20856 CDS product tRNA (guanine(37)-N1)-methyltransferase Trm5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_04040 <24269 21794 gene locus_tag LOCUS_04050 <24269 21794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_156029477.1:HAMP domain-containing sensor histidine kinase >Feature sequence013 <1 1809 gene locus_tag LOCUS_04060 <1 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228691.1:phospholipase D-like domain-containing protein 2574 1759 gene locus_tag LOCUS_04070 gene speE 2574 1759 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869811.1 protein_id gnl|my_center|LOCUS_04070 2781 2632 gene locus_tag LOCUS_04080 2781 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 2744 8893 gene locus_tag LOCUS_04090 2744 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 8890 9663 gene locus_tag LOCUS_04100 8890 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 9994 9665 gene locus_tag LOCUS_04110 9994 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 10682 9978 gene locus_tag LOCUS_04120 10682 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 10775 12313 gene locus_tag LOCUS_04130 10775 12313 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878819.1 protein_id gnl|my_center|LOCUS_04130 12550 12269 gene locus_tag LOCUS_04140 12550 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 13286 12573 gene locus_tag LOCUS_04150 13286 12573 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878652.1 protein_id gnl|my_center|LOCUS_04150 14115 13303 gene locus_tag LOCUS_04160 14115 13303 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726751.1 protein_id gnl|my_center|LOCUS_04160 14750 14145 gene locus_tag LOCUS_04170 14750 14145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 16141 14747 gene locus_tag LOCUS_04180 16141 14747 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_04180 18332 16197 gene locus_tag LOCUS_04190 18332 16197 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_04190 18486 18635 gene locus_tag LOCUS_04200 18486 18635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 18789 18613 gene locus_tag LOCUS_04210 18789 18613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 18897 19964 gene locus_tag LOCUS_04220 18897 19964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 20001 20444 gene locus_tag LOCUS_04230 20001 20444 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080627.1 protein_id gnl|my_center|LOCUS_04230 20434 21630 gene locus_tag LOCUS_04240 20434 21630 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867258.1 protein_id gnl|my_center|LOCUS_04240 21614 22657 gene locus_tag LOCUS_04250 21614 22657 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978530.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence014 211 1248 gene locus_tag LOCUS_04260 211 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2376 1234 gene locus_tag LOCUS_04270 2376 1234 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868440.1 protein_id gnl|my_center|LOCUS_04270 2453 3034 gene locus_tag LOCUS_04280 2453 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3085 3537 gene locus_tag LOCUS_04290 3085 3537 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879561.1 protein_id gnl|my_center|LOCUS_04290 3544 3879 gene locus_tag LOCUS_04300 3544 3879 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064758.1 protein_id gnl|my_center|LOCUS_04300 3882 4037 gene locus_tag LOCUS_04310 3882 4037 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877221.1 protein_id gnl|my_center|LOCUS_04310 4049 4312 gene locus_tag LOCUS_04320 4049 4312 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877220.1 protein_id gnl|my_center|LOCUS_04320 4309 4965 gene locus_tag LOCUS_04330 4309 4965 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879557.1 protein_id gnl|my_center|LOCUS_04330 5590 4955 gene locus_tag LOCUS_04340 5590 4955 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_04340 5680 6177 gene locus_tag LOCUS_04350 5680 6177 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870442.1 protein_id gnl|my_center|LOCUS_04350 6174 6443 gene locus_tag LOCUS_04360 6174 6443 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878323.1 protein_id gnl|my_center|LOCUS_04360 7002 6421 gene locus_tag LOCUS_04370 7002 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877860.1 protein_id gnl|my_center|LOCUS_04370 7691 6999 gene locus_tag LOCUS_04380 7691 6999 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877861.1 protein_id gnl|my_center|LOCUS_04380 7787 8506 gene locus_tag LOCUS_04390 7787 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 8632 8829 gene locus_tag LOCUS_04400 8632 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 8894 8967 gene locus_tag LOCUS_t00090 8894 8967 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8970 9626 gene locus_tag LOCUS_04410 8970 9626 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877296.1 protein_id gnl|my_center|LOCUS_04410 10527 9601 gene locus_tag LOCUS_04420 10527 9601 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250927.1 protein_id gnl|my_center|LOCUS_04420 11151 10561 gene locus_tag LOCUS_04430 11151 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 12296 11367 gene locus_tag LOCUS_04440 gene arcC 12296 11367 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_04440 12439 12774 gene locus_tag LOCUS_04450 12439 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 13712 12777 gene locus_tag LOCUS_04460 13712 12777 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_04460 14725 13709 gene locus_tag LOCUS_04470 14725 13709 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_04470 14796 15503 gene locus_tag LOCUS_04480 14796 15503 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877451.1 protein_id gnl|my_center|LOCUS_04480 15536 16681 gene locus_tag LOCUS_04490 15536 16681 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990823.1 protein_id gnl|my_center|LOCUS_04490 16886 17011 gene locus_tag LOCUS_04500 16886 17011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 17185 17550 gene locus_tag LOCUS_04510 17185 17550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 17552 18028 gene locus_tag LOCUS_04520 17552 18028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 18097 18804 gene locus_tag LOCUS_04530 18097 18804 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250861.1 protein_id gnl|my_center|LOCUS_04530 18808 19470 gene locus_tag LOCUS_04540 18808 19470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 19632 19447 gene locus_tag LOCUS_04550 19632 19447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 19982 19629 gene locus_tag LOCUS_04560 19982 19629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250991.1 protein_id gnl|my_center|LOCUS_04560 21629 19992 gene locus_tag LOCUS_04570 21629 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 21731 22681 gene locus_tag LOCUS_04580 gene gyaR 21731 22681 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_04580 >Feature sequence015 <1 1544 gene locus_tag LOCUS_04590 <1 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000149407.1:formate--tetrahydrofolate ligase 1587 2600 gene locus_tag LOCUS_04600 1587 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2606 3142 gene locus_tag LOCUS_04610 gene hxlB 2606 3142 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061311.1 protein_id gnl|my_center|LOCUS_04610 3133 3513 gene locus_tag LOCUS_04620 3133 3513 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250286.1 protein_id gnl|my_center|LOCUS_04620 4606 3506 gene locus_tag LOCUS_04630 4606 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 4782 5657 gene locus_tag LOCUS_04640 gene flaB5 4782 5657 CDS product flagellin B5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248997.1 protein_id gnl|my_center|LOCUS_04640 5667 6011 gene locus_tag LOCUS_04650 5667 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 7082 6000 gene locus_tag LOCUS_04660 7082 6000 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249854.1 protein_id gnl|my_center|LOCUS_04660 7866 7252 gene locus_tag LOCUS_04670 7866 7252 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_04670 8147 7875 gene locus_tag LOCUS_04680 8147 7875 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_04680 8460 8158 gene locus_tag LOCUS_04690 8460 8158 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256760.1 protein_id gnl|my_center|LOCUS_04690 9235 8513 gene locus_tag LOCUS_04700 9235 8513 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436928.1 protein_id gnl|my_center|LOCUS_04700 9424 10215 gene locus_tag LOCUS_04710 9424 10215 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249187.1 protein_id gnl|my_center|LOCUS_04710 10286 10567 gene locus_tag LOCUS_04720 10286 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 10564 11169 gene locus_tag LOCUS_04730 10564 11169 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868858.1 protein_id gnl|my_center|LOCUS_04730 11196 11372 gene locus_tag LOCUS_04740 11196 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 11417 11635 gene locus_tag LOCUS_04750 11417 11635 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_04750 11638 13419 gene locus_tag LOCUS_04760 11638 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 13429 15021 gene locus_tag LOCUS_04770 13429 15021 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023612.1 protein_id gnl|my_center|LOCUS_04770 15014 15559 gene locus_tag LOCUS_04780 15014 15559 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868811.1 protein_id gnl|my_center|LOCUS_04780 16389 15676 gene locus_tag LOCUS_04790 gene queC 16389 15676 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_04790 16868 16386 gene locus_tag LOCUS_04800 16868 16386 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870785.1 protein_id gnl|my_center|LOCUS_04800 17487 16900 gene locus_tag LOCUS_04810 17487 16900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 17567 18421 gene locus_tag LOCUS_04820 gene xerA 17567 18421 CDS product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867504.1 protein_id gnl|my_center|LOCUS_04820 19511 18384 gene locus_tag LOCUS_04830 19511 18384 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871044.1 protein_id gnl|my_center|LOCUS_04830 19584 21365 gene locus_tag LOCUS_04840 gene rqcH 19584 21365 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867817.1 protein_id gnl|my_center|LOCUS_04840 21478 21939 gene locus_tag LOCUS_04850 21478 21939 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197463606.1 protein_id gnl|my_center|LOCUS_04850 22077 22598 gene locus_tag LOCUS_04860 22077 22598 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251030.1 protein_id gnl|my_center|LOCUS_04860 22595 22852 gene locus_tag LOCUS_04870 22595 22852 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251031.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence016 938 1489 gene locus_tag LOCUS_04880 gene pgiA 938 1489 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147196.1 protein_id gnl|my_center|LOCUS_04880 1553 2659 gene locus_tag LOCUS_04890 gene ftsZ 1553 2659 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_04890 2671 3519 gene locus_tag LOCUS_04900 2671 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 3956 3510 gene locus_tag LOCUS_04910 3956 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 4860 3961 gene locus_tag LOCUS_04920 4860 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 4976 6103 gene locus_tag LOCUS_04930 4976 6103 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879620.1 protein_id gnl|my_center|LOCUS_04930 6100 6405 gene locus_tag LOCUS_04940 6100 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 6410 6922 gene locus_tag LOCUS_04950 6410 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 8123 6927 gene locus_tag LOCUS_04960 8123 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 8229 8065 gene locus_tag LOCUS_04970 8229 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 8498 9190 gene locus_tag LOCUS_04980 8498 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 9249 10790 gene locus_tag LOCUS_04990 9249 10790 CDS product 7,8-dihydro-6-hydroxymethylpterin dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870124.1 protein_id gnl|my_center|LOCUS_04990 10787 10975 gene locus_tag LOCUS_05000 10787 10975 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 protein_id gnl|my_center|LOCUS_05000 10972 12159 gene locus_tag LOCUS_05010 10972 12159 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_05010 13301 12168 gene locus_tag LOCUS_05020 13301 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 14630 13308 gene locus_tag LOCUS_05030 14630 13308 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209475626.1 protein_id gnl|my_center|LOCUS_05030 15958 14627 gene locus_tag LOCUS_05040 15958 14627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 16761 15955 gene locus_tag LOCUS_05050 16761 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 19955 16713 gene locus_tag LOCUS_05060 19955 16713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 20858 19989 gene locus_tag LOCUS_05070 20858 19989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 21328 20855 gene locus_tag LOCUS_05080 21328 20855 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_05080 <22908 21367 gene locus_tag LOCUS_05090 <22908 21367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249711.1:tRNA guanosine(15) transglycosylase TgtA >Feature sequence017 710 3286 gene locus_tag LOCUS_05100 gene valS 710 3286 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_05100 3990 3283 gene locus_tag LOCUS_05110 3990 3283 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146572.1 protein_id gnl|my_center|LOCUS_05110 4604 3996 gene locus_tag LOCUS_05120 4604 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 4689 5450 gene locus_tag LOCUS_05130 4689 5450 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868725.1 protein_id gnl|my_center|LOCUS_05130 6099 5440 gene locus_tag LOCUS_05140 6099 5440 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868512.1 protein_id gnl|my_center|LOCUS_05140 6186 7340 gene locus_tag LOCUS_05150 6186 7340 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_05150 7309 7971 gene locus_tag LOCUS_05160 7309 7971 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868117.1 protein_id gnl|my_center|LOCUS_05160 7984 8400 gene locus_tag LOCUS_05170 7984 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 8394 8654 gene locus_tag LOCUS_05180 8394 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 9174 8602 gene locus_tag LOCUS_05190 9174 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 9775 9131 gene locus_tag LOCUS_05200 gene pyrH 9775 9131 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496770.1 protein_id gnl|my_center|LOCUS_05200 9895 11268 gene locus_tag LOCUS_05210 9895 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 11265 11624 gene locus_tag LOCUS_05220 11265 11624 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023007.1 protein_id gnl|my_center|LOCUS_05220 12189 13208 gene locus_tag LOCUS_05230 12189 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 14954 13212 gene locus_tag LOCUS_05240 14954 13212 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250266.1 protein_id gnl|my_center|LOCUS_05240 15260 14955 gene locus_tag LOCUS_05250 15260 14955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877792.1 protein_id gnl|my_center|LOCUS_05250 15737 16198 gene locus_tag LOCUS_05260 15737 16198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 16927 16199 gene locus_tag LOCUS_05270 16927 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 17328 16948 gene locus_tag LOCUS_05280 17328 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 17878 17558 gene locus_tag LOCUS_05290 17878 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 18397 17888 gene locus_tag LOCUS_05300 gene cobO 18397 17888 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867207.1 protein_id gnl|my_center|LOCUS_05300 18485 19297 gene locus_tag LOCUS_05310 18485 19297 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250014.1 protein_id gnl|my_center|LOCUS_05310 19470 20279 gene locus_tag LOCUS_05320 gene moaA 19470 20279 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867236.1 protein_id gnl|my_center|LOCUS_05320 20315 20389 gene locus_tag LOCUS_t00100 20315 20389 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 20561 20800 gene locus_tag LOCUS_05330 20561 20800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence018 <1 510 gene locus_tag LOCUS_05340 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979518.1:radical SAM protein 1172 507 gene locus_tag LOCUS_05350 1172 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 1252 2919 gene locus_tag LOCUS_05360 1252 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 2951 3652 gene locus_tag LOCUS_05370 gene alaXM 2951 3652 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846184.1 protein_id gnl|my_center|LOCUS_05370 3688 4338 gene locus_tag LOCUS_05380 3688 4338 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868878.1 protein_id gnl|my_center|LOCUS_05380 4319 4480 gene locus_tag LOCUS_05390 4319 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 5099 4470 gene locus_tag LOCUS_05400 gene pyrF 5099 4470 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251226.1 protein_id gnl|my_center|LOCUS_05400 5146 5835 gene locus_tag LOCUS_05410 5146 5835 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868024.1 protein_id gnl|my_center|LOCUS_05410 5884 6339 gene locus_tag LOCUS_05420 5884 6339 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146602.1 protein_id gnl|my_center|LOCUS_05420 6332 7708 gene locus_tag LOCUS_05430 6332 7708 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082217.1 protein_id gnl|my_center|LOCUS_05430 7766 8293 gene locus_tag LOCUS_05440 7766 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 8353 9279 gene locus_tag LOCUS_05450 8353 9279 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250772.1 protein_id gnl|my_center|LOCUS_05450 10162 9257 gene locus_tag LOCUS_05460 10162 9257 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978561.1 protein_id gnl|my_center|LOCUS_05460 10878 10195 gene locus_tag LOCUS_05470 10878 10195 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073546.1 protein_id gnl|my_center|LOCUS_05470 12141 10885 gene locus_tag LOCUS_05480 12141 10885 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_05480 12484 12155 gene locus_tag LOCUS_05490 12484 12155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 13479 12481 gene locus_tag LOCUS_05500 13479 12481 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296895.1 protein_id gnl|my_center|LOCUS_05500 14271 13516 gene locus_tag LOCUS_05510 14271 13516 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_05510 14434 14252 gene locus_tag LOCUS_05520 14434 14252 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867970.1 protein_id gnl|my_center|LOCUS_05520 15201 14437 gene locus_tag LOCUS_05530 15201 14437 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061020.1 protein_id gnl|my_center|LOCUS_05530 15380 15198 gene locus_tag LOCUS_05540 15380 15198 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878831.1 protein_id gnl|my_center|LOCUS_05540 15664 15380 gene locus_tag LOCUS_05550 15664 15380 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868833.1 protein_id gnl|my_center|LOCUS_05550 16663 15704 gene locus_tag LOCUS_05560 16663 15704 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867984.1 protein_id gnl|my_center|LOCUS_05560 16735 17709 gene locus_tag LOCUS_05570 gene purM 16735 17709 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879189.1 protein_id gnl|my_center|LOCUS_05570 18464 17703 gene locus_tag LOCUS_05580 18464 17703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence019 <1 943 gene locus_tag LOCUS_05590 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496898.1:ribose 1,5-bisphosphate isomerase 894 2414 gene locus_tag LOCUS_05600 894 2414 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870172.1 protein_id gnl|my_center|LOCUS_05600 3419 2415 gene locus_tag LOCUS_05610 3419 2415 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064506.1 protein_id gnl|my_center|LOCUS_05610 4307 3459 gene locus_tag LOCUS_05620 4307 3459 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_05620 6540 4297 gene locus_tag LOCUS_05630 6540 4297 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010916276.1 protein_id gnl|my_center|LOCUS_05630 7903 6578 gene locus_tag LOCUS_05640 gene sufB 7903 6578 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867885.1 protein_id gnl|my_center|LOCUS_05640 8642 7896 gene locus_tag LOCUS_05650 gene sufC 8642 7896 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249682.1 protein_id gnl|my_center|LOCUS_05650 8776 9819 gene locus_tag LOCUS_05660 8776 9819 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871070.1 protein_id gnl|my_center|LOCUS_05660 9820 10986 gene locus_tag LOCUS_05670 9820 10986 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_05670 10987 11391 gene locus_tag LOCUS_05680 10987 11391 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_05680 11445 11921 gene locus_tag LOCUS_05690 11445 11921 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249247.1 protein_id gnl|my_center|LOCUS_05690 11893 12879 gene locus_tag LOCUS_05700 11893 12879 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867805.1 protein_id gnl|my_center|LOCUS_05700 13350 12844 gene locus_tag LOCUS_05710 13350 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 14522 13347 gene locus_tag LOCUS_05720 14522 13347 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868401.1 protein_id gnl|my_center|LOCUS_05720 15457 14525 gene locus_tag LOCUS_05730 15457 14525 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_05730 16014 15454 gene locus_tag LOCUS_05740 16014 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 16813 15998 gene locus_tag LOCUS_05750 16813 15998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 16894 17379 gene locus_tag LOCUS_05760 16894 17379 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_05760 17372 18700 gene locus_tag LOCUS_05770 gene serS 17372 18700 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 protein_id gnl|my_center|LOCUS_05770 18737 20311 gene locus_tag LOCUS_05780 18737 20311 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_05780 20313 20507 gene locus_tag LOCUS_05790 20313 20507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence020 3779 2580 gene locus_tag LOCUS_05800 3779 2580 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879739.1 protein_id gnl|my_center|LOCUS_05800 4374 3763 gene locus_tag LOCUS_05810 4374 3763 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496635.1 protein_id gnl|my_center|LOCUS_05810 4990 4376 gene locus_tag LOCUS_05820 4990 4376 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_05820 5078 5497 gene locus_tag LOCUS_05830 5078 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 5494 6504 gene locus_tag LOCUS_05840 5494 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 6494 7423 gene locus_tag LOCUS_05850 6494 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 8753 7407 gene locus_tag LOCUS_05860 8753 7407 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 protein_id gnl|my_center|LOCUS_05860 9891 8890 gene locus_tag LOCUS_05870 gene amrS 9891 8890 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_05870 10765 9854 gene locus_tag LOCUS_05880 10765 9854 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249841.1 protein_id gnl|my_center|LOCUS_05880 10834 11298 gene locus_tag LOCUS_05890 10834 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 11280 11750 gene locus_tag LOCUS_05900 11280 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 12503 11745 gene locus_tag LOCUS_05910 12503 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 13057 12527 gene locus_tag LOCUS_05920 13057 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 14316 13054 gene locus_tag LOCUS_05930 14316 13054 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_05930 14415 18560 gene locus_tag LOCUS_05940 14415 18560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 18624 19823 gene locus_tag LOCUS_05950 18624 19823 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence021 1069 218 gene locus_tag LOCUS_05960 gene sdaAA 1069 218 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_05960 1722 1072 gene locus_tag LOCUS_05970 gene sdaAB 1722 1072 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963992.1 protein_id gnl|my_center|LOCUS_05970 1832 2329 gene locus_tag LOCUS_05980 1832 2329 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870107.1 protein_id gnl|my_center|LOCUS_05980 2322 3176 gene locus_tag LOCUS_05990 2322 3176 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 protein_id gnl|my_center|LOCUS_05990 3852 3118 gene locus_tag LOCUS_06000 3852 3118 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_06000 3936 4805 gene locus_tag LOCUS_06010 3936 4805 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053764.1 protein_id gnl|my_center|LOCUS_06010 5653 4802 gene locus_tag LOCUS_06020 5653 4802 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320027.1 protein_id gnl|my_center|LOCUS_06020 6721 5708 gene locus_tag LOCUS_06030 6721 5708 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_06030 6736 7554 gene locus_tag LOCUS_06040 6736 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870951.1 protein_id gnl|my_center|LOCUS_06040 8581 7541 gene locus_tag LOCUS_06050 8581 7541 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438474.1 protein_id gnl|my_center|LOCUS_06050 9392 8616 gene locus_tag LOCUS_06060 9392 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 10159 9431 gene locus_tag LOCUS_06070 10159 9431 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978333.1 protein_id gnl|my_center|LOCUS_06070 10230 10526 gene locus_tag LOCUS_06080 gene yciH 10230 10526 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_06080 10529 12730 gene locus_tag LOCUS_06090 10529 12730 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868389.1 protein_id gnl|my_center|LOCUS_06090 12684 13004 gene locus_tag LOCUS_06100 12684 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 13525 13076 gene locus_tag LOCUS_06110 13525 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 14152 13631 gene locus_tag LOCUS_06120 14152 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 14248 14793 gene locus_tag LOCUS_06130 14248 14793 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870158.1 protein_id gnl|my_center|LOCUS_06130 14798 15196 gene locus_tag LOCUS_06140 14798 15196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 15166 15474 gene locus_tag LOCUS_06150 15166 15474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 15471 16193 gene locus_tag LOCUS_06160 gene phbB 15471 16193 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250412.1 protein_id gnl|my_center|LOCUS_06160 16228 16848 gene locus_tag LOCUS_06170 16228 16848 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_06170 17480 16845 gene locus_tag LOCUS_06180 17480 16845 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877550.1 protein_id gnl|my_center|LOCUS_06180 17573 18001 gene locus_tag LOCUS_06190 17573 18001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 18095 18883 gene locus_tag LOCUS_06200 18095 18883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence022 879 562 gene locus_tag LOCUS_06210 879 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1097 1456 gene locus_tag LOCUS_06220 1097 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 2381 1428 gene locus_tag LOCUS_06230 2381 1428 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_06230 3042 2329 gene locus_tag LOCUS_06240 3042 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3684 3049 gene locus_tag LOCUS_06250 3684 3049 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867184.1 protein_id gnl|my_center|LOCUS_06250 3760 4830 gene locus_tag LOCUS_06260 gene trm14 3760 4830 CDS product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869937.1 protein_id gnl|my_center|LOCUS_06260 6166 4835 gene locus_tag LOCUS_06270 6166 4835 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_06270 6254 9928 gene locus_tag LOCUS_06280 6254 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 12989 9915 gene locus_tag LOCUS_06290 gene ileS 12989 9915 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_06290 13518 13012 gene locus_tag LOCUS_06300 13518 13012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 14183 13515 gene locus_tag LOCUS_06310 gene deoC 14183 13515 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_06310 14836 14201 gene locus_tag LOCUS_06320 14836 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 15375 14839 gene locus_tag LOCUS_06330 15375 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 15883 15362 gene locus_tag LOCUS_06340 15883 15362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 16397 15876 gene locus_tag LOCUS_06350 16397 15876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 16862 16461 gene locus_tag LOCUS_06360 16862 16461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 16986 17141 gene locus_tag LOCUS_06370 16986 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence023 414 280 gene locus_tag LOCUS_06380 414 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 541 2214 gene locus_tag LOCUS_06390 gene gltX 541 2214 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870894.1 protein_id gnl|my_center|LOCUS_06390 2460 2215 gene locus_tag LOCUS_06400 2460 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2576 3373 gene locus_tag LOCUS_06410 2576 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06410 3354 4013 gene locus_tag LOCUS_06420 3354 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06420 4006 4506 gene locus_tag LOCUS_06430 4006 4506 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867435.1 protein_id gnl|my_center|LOCUS_06430 4507 4788 gene locus_tag LOCUS_06440 4507 4788 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249076.1 protein_id gnl|my_center|LOCUS_06440 4778 5929 gene locus_tag LOCUS_06450 4778 5929 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249077.1 protein_id gnl|my_center|LOCUS_06450 5992 6822 gene locus_tag LOCUS_06460 5992 6822 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_06460 6824 8254 gene locus_tag LOCUS_06470 gene gltA 6824 8254 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868067.1 protein_id gnl|my_center|LOCUS_06470 8407 9426 gene locus_tag LOCUS_06480 gene hydB 8407 9426 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251022.1 protein_id gnl|my_center|LOCUS_06480 9423 10235 gene locus_tag LOCUS_06490 9423 10235 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_06490 10232 10978 gene locus_tag LOCUS_06500 10232 10978 CDS product NADH ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933551.1 protein_id gnl|my_center|LOCUS_06500 10960 12225 gene locus_tag LOCUS_06510 10960 12225 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_06510 12272 13048 gene locus_tag LOCUS_06520 12272 13048 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_06520 13045 13833 gene locus_tag LOCUS_06530 13045 13833 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023273.1 protein_id gnl|my_center|LOCUS_06530 13830 14201 gene locus_tag LOCUS_06540 13830 14201 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868701.1 protein_id gnl|my_center|LOCUS_06540 14198 14839 gene locus_tag LOCUS_06550 14198 14839 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868496.1 protein_id gnl|my_center|LOCUS_06550 15551 15889 gene locus_tag LOCUS_06560 15551 15889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 16748 16569 gene locus_tag LOCUS_06570 16748 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence024 246 860 gene locus_tag LOCUS_06580 246 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2444 1047 gene locus_tag LOCUS_06590 gene proS 2444 1047 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868093.1 protein_id gnl|my_center|LOCUS_06590 3054 2479 gene locus_tag LOCUS_06600 3054 2479 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870034.1 protein_id gnl|my_center|LOCUS_06600 4049 3036 gene locus_tag LOCUS_06610 gene fni 4049 3036 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870377.1 protein_id gnl|my_center|LOCUS_06610 4753 4046 gene locus_tag LOCUS_06620 4753 4046 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867666.1 protein_id gnl|my_center|LOCUS_06620 5771 4815 gene locus_tag LOCUS_06630 5771 4815 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966531.1 protein_id gnl|my_center|LOCUS_06630 6526 5825 gene locus_tag LOCUS_06640 6526 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6656 8026 gene locus_tag LOCUS_06650 6656 8026 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249457.1 protein_id gnl|my_center|LOCUS_06650 8023 9354 gene locus_tag LOCUS_06660 8023 9354 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249454.1 protein_id gnl|my_center|LOCUS_06660 9351 9962 gene locus_tag LOCUS_06670 9351 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 9993 11489 gene locus_tag LOCUS_06680 gene hutH 9993 11489 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017128.1 protein_id gnl|my_center|LOCUS_06680 12069 11473 gene locus_tag LOCUS_06690 12069 11473 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867812.1 protein_id gnl|my_center|LOCUS_06690 12222 13430 gene locus_tag LOCUS_06700 12222 13430 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869075.1 protein_id gnl|my_center|LOCUS_06700 13481 14227 gene locus_tag LOCUS_06710 13481 14227 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 protein_id gnl|my_center|LOCUS_06710 14227 14802 gene locus_tag LOCUS_06720 14227 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 14799 15539 gene locus_tag LOCUS_06730 14799 15539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 15546 16631 gene locus_tag LOCUS_06740 15546 16631 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence025 3 551 gene locus_tag LOCUS_06750 3 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 826 752 gene locus_tag LOCUS_t00110 826 752 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2540 1254 gene locus_tag LOCUS_06760 gene aspS 2540 1254 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496866.1 protein_id gnl|my_center|LOCUS_06760 3967 2576 gene locus_tag LOCUS_06770 gene kaiC 3967 2576 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056334.1 protein_id gnl|my_center|LOCUS_06770 4326 3964 gene locus_tag LOCUS_06780 4326 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4426 5004 gene locus_tag LOCUS_06790 gene pdxT 4426 5004 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878016.1 protein_id gnl|my_center|LOCUS_06790 5074 6189 gene locus_tag LOCUS_06800 gene gcvT 5074 6189 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732261.1 protein_id gnl|my_center|LOCUS_06800 6825 6220 gene locus_tag LOCUS_06810 6825 6220 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_06810 10715 6822 gene locus_tag LOCUS_06820 10715 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 10889 11101 gene locus_tag LOCUS_06830 10889 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 11085 12023 gene locus_tag LOCUS_06840 11085 12023 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_06840 12665 12024 gene locus_tag LOCUS_06850 12665 12024 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_06850 12750 12941 gene locus_tag LOCUS_06860 12750 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 13210 13899 gene locus_tag LOCUS_06870 13210 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence026 3 899 gene locus_tag LOCUS_06880 3 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 919 1521 gene locus_tag LOCUS_06890 919 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2033 1518 gene locus_tag LOCUS_06900 gene rplJ 2033 1518 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870047.1 protein_id gnl|my_center|LOCUS_06900 2063 2626 gene locus_tag LOCUS_06910 2063 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 2598 4172 gene locus_tag LOCUS_06920 2598 4172 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147188.1 protein_id gnl|my_center|LOCUS_06920 6058 4169 gene locus_tag LOCUS_06930 6058 4169 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867909.1 protein_id gnl|my_center|LOCUS_06930 6973 6134 gene locus_tag LOCUS_06940 6973 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 7176 7685 gene locus_tag LOCUS_06950 gene pfpI 7176 7685 CDS product deglycase PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867593.1 protein_id gnl|my_center|LOCUS_06950 7714 9015 gene locus_tag LOCUS_06960 gene glyA 7714 9015 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871121.1 protein_id gnl|my_center|LOCUS_06960 9563 9018 gene locus_tag LOCUS_06970 9563 9018 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_06970 10396 9560 gene locus_tag LOCUS_06980 10396 9560 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870041.1 protein_id gnl|my_center|LOCUS_06980 11511 10393 gene locus_tag LOCUS_06990 11511 10393 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_06990 11759 11508 gene locus_tag LOCUS_07000 11759 11508 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082295.1 protein_id gnl|my_center|LOCUS_07000 11872 13014 gene locus_tag LOCUS_07010 11872 13014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 13311 13237 gene locus_tag LOCUS_t00120 13311 13237 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14692 13352 gene locus_tag LOCUS_07020 14692 13352 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence027 <1 986 gene locus_tag LOCUS_07030 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867776.1:phosphomethylpyrimidine synthase ThiC 1013 1873 gene locus_tag LOCUS_07040 1013 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 1879 2859 gene locus_tag LOCUS_07050 gene rtcA 1879 2859 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_07050 3578 2850 gene locus_tag LOCUS_07060 3578 2850 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876917.1 protein_id gnl|my_center|LOCUS_07060 3656 5260 gene locus_tag LOCUS_07070 gene pyrG 3656 5260 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 protein_id gnl|my_center|LOCUS_07070 6378 5251 gene locus_tag LOCUS_07080 6378 5251 CDS product lipid galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557046.1 protein_id gnl|my_center|LOCUS_07080 6537 10856 gene locus_tag LOCUS_07090 6537 10856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 12479 10872 gene locus_tag LOCUS_07100 gene pheT 12479 10872 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_07100 12979 12512 gene locus_tag LOCUS_07110 12979 12512 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_07110 13435 13022 gene locus_tag LOCUS_07120 13435 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07120 13590 14339 gene locus_tag LOCUS_07130 13590 14339 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876232.1 protein_id gnl|my_center|LOCUS_07130 14336 15064 gene locus_tag LOCUS_07140 14336 15064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence028 958 437 gene locus_tag LOCUS_07150 958 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1471 995 gene locus_tag LOCUS_07160 1471 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1667 2314 gene locus_tag LOCUS_07170 1667 2314 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080380.1 protein_id gnl|my_center|LOCUS_07170 2319 3722 gene locus_tag LOCUS_07180 2319 3722 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250133.1 protein_id gnl|my_center|LOCUS_07180 5933 3903 gene locus_tag LOCUS_07190 5933 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 6248 5961 gene locus_tag LOCUS_07200 6248 5961 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249855.1 protein_id gnl|my_center|LOCUS_07200 6750 6241 gene locus_tag LOCUS_07210 6750 6241 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_07210 6906 7268 gene locus_tag LOCUS_07220 6906 7268 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064265.1 protein_id gnl|my_center|LOCUS_07220 7932 7240 gene locus_tag LOCUS_07230 gene rpiA 7932 7240 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364539.1 protein_id gnl|my_center|LOCUS_07230 8600 7923 gene locus_tag LOCUS_07240 8600 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 9466 8597 gene locus_tag LOCUS_07250 9466 8597 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250992.1 protein_id gnl|my_center|LOCUS_07250 9546 10694 gene locus_tag LOCUS_07260 9546 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 11452 10691 gene locus_tag LOCUS_07270 11452 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 11575 12393 gene locus_tag LOCUS_07280 11575 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 12399 13082 gene locus_tag LOCUS_07290 12399 13082 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877858.1 protein_id gnl|my_center|LOCUS_07290 13092 13433 gene locus_tag LOCUS_07300 13092 13433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 13430 13711 gene locus_tag LOCUS_07310 13430 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 14319 13708 gene locus_tag LOCUS_07320 14319 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 14431 14862 gene locus_tag LOCUS_07330 14431 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 >Feature sequence029 1243 401 gene locus_tag LOCUS_07340 1243 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1299 2528 gene locus_tag LOCUS_07350 gene pgk 1299 2528 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_07350 3266 2520 gene locus_tag LOCUS_07360 3266 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3864 3298 gene locus_tag LOCUS_07370 3864 3298 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867925.1 protein_id gnl|my_center|LOCUS_07370 4798 3869 gene locus_tag LOCUS_07380 4798 3869 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_07380 4913 6151 gene locus_tag LOCUS_07390 4913 6151 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004069588.1 protein_id gnl|my_center|LOCUS_07390 6287 6153 gene locus_tag LOCUS_07400 6287 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 6619 6263 gene locus_tag LOCUS_07410 6619 6263 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_07410 6703 7110 gene locus_tag LOCUS_07420 6703 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 8275 7136 gene locus_tag LOCUS_07430 8275 7136 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_07430 8724 8272 gene locus_tag LOCUS_07440 8724 8272 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_07440 9509 8721 gene locus_tag LOCUS_07450 gene udp 9509 8721 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_07450 9619 10023 gene locus_tag LOCUS_07460 9619 10023 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_07460 10166 10020 gene locus_tag LOCUS_07470 10166 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 10390 10728 gene locus_tag LOCUS_07480 10390 10728 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_07480 10721 11239 gene locus_tag LOCUS_07490 10721 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 12479 11241 gene locus_tag LOCUS_07500 12479 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 12574 12873 gene locus_tag LOCUS_07510 12574 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 12973 13749 gene locus_tag LOCUS_07520 gene dph5 12973 13749 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249061.1 protein_id gnl|my_center|LOCUS_07520 <14658 13746 gene locus_tag LOCUS_07530 <14658 13746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060889.1:NosD domain-containing protein >Feature sequence030 156 509 gene locus_tag LOCUS_07540 gene mnhG 156 509 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251032.1 protein_id gnl|my_center|LOCUS_07540 506 760 gene locus_tag LOCUS_07550 506 760 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251033.1 protein_id gnl|my_center|LOCUS_07550 757 1062 gene locus_tag LOCUS_07560 757 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251034.1 protein_id gnl|my_center|LOCUS_07560 1059 1526 gene locus_tag LOCUS_07570 1059 1526 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867848.1 protein_id gnl|my_center|LOCUS_07570 1516 1860 gene locus_tag LOCUS_07580 1516 1860 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146633.1 protein_id gnl|my_center|LOCUS_07580 1857 3434 gene locus_tag LOCUS_07590 1857 3434 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 protein_id gnl|my_center|LOCUS_07590 3431 3778 gene locus_tag LOCUS_07600 3431 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 3778 4218 gene locus_tag LOCUS_07610 3778 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 4215 4745 gene locus_tag LOCUS_07620 4215 4745 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867843.1 protein_id gnl|my_center|LOCUS_07620 4738 5982 gene locus_tag LOCUS_07630 4738 5982 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251041.1 protein_id gnl|my_center|LOCUS_07630 5963 6979 gene locus_tag LOCUS_07640 5963 6979 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053771.1 protein_id gnl|my_center|LOCUS_07640 6989 7435 gene locus_tag LOCUS_07650 6989 7435 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867840.1 protein_id gnl|my_center|LOCUS_07650 8155 7415 gene locus_tag LOCUS_07660 8155 7415 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250957.1 protein_id gnl|my_center|LOCUS_07660 8567 8160 gene locus_tag LOCUS_07670 gene hypA 8567 8160 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867705.1 protein_id gnl|my_center|LOCUS_07670 9592 8579 gene locus_tag LOCUS_07680 gene hypE 9592 8579 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868428.1 protein_id gnl|my_center|LOCUS_07680 11885 9585 gene locus_tag LOCUS_07690 gene hypF 11885 9585 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250947.1 protein_id gnl|my_center|LOCUS_07690 12965 11886 gene locus_tag LOCUS_07700 gene hypD 12965 11886 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868353.1 protein_id gnl|my_center|LOCUS_07700 13186 12962 gene locus_tag LOCUS_07710 13186 12962 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_07710 13618 13271 gene locus_tag LOCUS_07720 13618 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 13711 14112 gene locus_tag LOCUS_07730 13711 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence031 1191 649 gene locus_tag LOCUS_07740 1191 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1293 2507 gene locus_tag LOCUS_07750 1293 2507 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251014.1 protein_id gnl|my_center|LOCUS_07750 2564 2935 gene locus_tag LOCUS_07760 2564 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 4015 2936 gene locus_tag LOCUS_07770 4015 2936 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146565.1 protein_id gnl|my_center|LOCUS_07770 4724 3993 gene locus_tag LOCUS_07780 gene rsmA 4724 3993 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_07780 5791 4922 gene locus_tag LOCUS_07790 5791 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 5896 6063 gene locus_tag LOCUS_07800 5896 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 6672 6124 gene locus_tag LOCUS_07810 6672 6124 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_07810 6999 6685 gene locus_tag LOCUS_07820 6999 6685 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061025.1 protein_id gnl|my_center|LOCUS_07820 7220 6999 gene locus_tag LOCUS_07830 7220 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 7365 7231 gene locus_tag LOCUS_07840 7365 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 8578 7343 gene locus_tag LOCUS_07850 8578 7343 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867967.1 protein_id gnl|my_center|LOCUS_07850 9412 8594 gene locus_tag LOCUS_07860 9412 8594 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250507.1 protein_id gnl|my_center|LOCUS_07860 9549 9465 gene locus_tag LOCUS_t00130 9549 9465 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9625 9888 gene locus_tag LOCUS_07870 9625 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 10615 9878 gene locus_tag LOCUS_07880 10615 9878 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_07880 11403 10624 gene locus_tag LOCUS_07890 11403 10624 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020999.1 protein_id gnl|my_center|LOCUS_07890 12469 11486 gene locus_tag LOCUS_07900 12469 11486 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146822.1 protein_id gnl|my_center|LOCUS_07900 <13737 12583 gene locus_tag LOCUS_07910 <13737 12583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089079.1:hydrogenase 4 subunit B >Feature sequence032 578 1891 gene locus_tag LOCUS_07920 gene glnA 578 1891 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_07920 1916 3049 gene locus_tag LOCUS_07930 gene mfnA 1916 3049 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868331.1 protein_id gnl|my_center|LOCUS_07930 3930 3037 gene locus_tag LOCUS_07940 gene porB 3930 3037 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_07940 5123 3927 gene locus_tag LOCUS_07950 gene porA 5123 3927 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250933.1 protein_id gnl|my_center|LOCUS_07950 5442 5125 gene locus_tag LOCUS_07960 gene porD 5442 5125 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 protein_id gnl|my_center|LOCUS_07960 6036 5446 gene locus_tag LOCUS_07970 6036 5446 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_07970 6073 7287 gene locus_tag LOCUS_07980 6073 7287 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082184.1 protein_id gnl|my_center|LOCUS_07980 7324 8382 gene locus_tag LOCUS_07990 7324 8382 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_07990 8373 9395 gene locus_tag LOCUS_08000 8373 9395 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683404.1 protein_id gnl|my_center|LOCUS_08000 9443 11119 gene locus_tag LOCUS_08010 9443 11119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 11156 11869 gene locus_tag LOCUS_08020 11156 11869 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_08020 13472 11820 gene locus_tag LOCUS_08030 13472 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 13714 13469 gene locus_tag LOCUS_08040 13714 13469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence033 <1 4071 gene locus_tag LOCUS_08050 <1 4071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877562.1:C25 family cysteine peptidase 4127 4642 gene locus_tag LOCUS_08060 4127 4642 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868259.1 protein_id gnl|my_center|LOCUS_08060 4633 5235 gene locus_tag LOCUS_08070 4633 5235 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020322.1 protein_id gnl|my_center|LOCUS_08070 6334 5192 gene locus_tag LOCUS_08080 gene priL 6334 5192 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_08080 6547 7929 gene locus_tag LOCUS_08090 gene oadA 6547 7929 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_08090 7926 8618 gene locus_tag LOCUS_08100 7926 8618 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251184.1 protein_id gnl|my_center|LOCUS_08100 9925 8624 gene locus_tag LOCUS_08110 9925 8624 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249649.1 protein_id gnl|my_center|LOCUS_08110 11294 9930 gene locus_tag LOCUS_08120 11294 9930 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868372.1 protein_id gnl|my_center|LOCUS_08120 12447 11305 gene locus_tag LOCUS_08130 12447 11305 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980390.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence034 1475 228 gene locus_tag LOCUS_08140 1475 228 CDS product acyl-CoA--6-aminopenicillanic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332932.1 protein_id gnl|my_center|LOCUS_08140 1550 2350 gene locus_tag LOCUS_08150 1550 2350 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_08150 2385 3638 gene locus_tag LOCUS_08160 2385 3638 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209475689.1 protein_id gnl|my_center|LOCUS_08160 4966 3635 gene locus_tag LOCUS_08170 4966 3635 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250780.1 protein_id gnl|my_center|LOCUS_08170 6044 4959 gene locus_tag LOCUS_08180 6044 4959 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250781.1 protein_id gnl|my_center|LOCUS_08180 7087 6032 gene locus_tag LOCUS_08190 7087 6032 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254066.1 protein_id gnl|my_center|LOCUS_08190 8056 7118 gene locus_tag LOCUS_08200 8056 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 8198 8992 gene locus_tag LOCUS_08210 8198 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 8989 10779 gene locus_tag LOCUS_08220 8989 10779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 10913 11887 gene locus_tag LOCUS_08230 10913 11887 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 protein_id gnl|my_center|LOCUS_08230 11892 12317 gene locus_tag LOCUS_08240 11892 12317 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence035 1565 927 gene locus_tag LOCUS_08250 1565 927 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870406.1 protein_id gnl|my_center|LOCUS_08250 2699 1770 gene locus_tag LOCUS_08260 2699 1770 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_08260 3737 2736 gene locus_tag LOCUS_08270 3737 2736 CDS product lysyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867499.1 protein_id gnl|my_center|LOCUS_08270 3813 4256 gene locus_tag LOCUS_08280 3813 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4249 4512 gene locus_tag LOCUS_08290 4249 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 5018 4503 gene locus_tag LOCUS_08300 gene thpR 5018 4503 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871092.1 protein_id gnl|my_center|LOCUS_08300 5098 5478 gene locus_tag LOCUS_08310 gene gcvH 5098 5478 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_08310 5475 6062 gene locus_tag LOCUS_08320 5475 6062 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879543.1 protein_id gnl|my_center|LOCUS_08320 6661 6020 gene locus_tag LOCUS_08330 6661 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 7584 6658 gene locus_tag LOCUS_08340 7584 6658 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289434.1 protein_id gnl|my_center|LOCUS_08340 8570 7605 gene locus_tag LOCUS_08350 8570 7605 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928941.1 protein_id gnl|my_center|LOCUS_08350 11770 8690 gene locus_tag LOCUS_08360 11770 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 12667 11870 gene locus_tag LOCUS_08370 12667 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence036 1 1110 gene locus_tag LOCUS_08380 1 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1110 1772 gene locus_tag LOCUS_08390 1110 1772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_08390 1726 2157 gene locus_tag LOCUS_08400 1726 2157 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_08400 2178 3005 gene locus_tag LOCUS_08410 2178 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 3034 3681 gene locus_tag LOCUS_08420 gene rpe 3034 3681 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_08420 4615 3674 gene locus_tag LOCUS_08430 4615 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 4905 4612 gene locus_tag LOCUS_08440 4905 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 5879 4902 gene locus_tag LOCUS_08450 gene dph2 5879 4902 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_08450 6109 6381 gene locus_tag LOCUS_08460 6109 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 7303 6365 gene locus_tag LOCUS_08470 gene guaA 7303 6365 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867924.1 protein_id gnl|my_center|LOCUS_08470 7766 7290 gene locus_tag LOCUS_08480 gene purE 7766 7290 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_08480 8093 7797 gene locus_tag LOCUS_08490 8093 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 8340 8107 gene locus_tag LOCUS_08500 8340 8107 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_08500 9414 8395 gene locus_tag LOCUS_08510 gene fen 9414 8395 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877775.1 protein_id gnl|my_center|LOCUS_08510 10123 9440 gene locus_tag LOCUS_08520 gene radB 10123 9440 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 protein_id gnl|my_center|LOCUS_08520 11152 10634 gene locus_tag LOCUS_08530 11152 10634 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_08530 11637 11149 gene locus_tag LOCUS_08540 11637 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 12041 11634 gene locus_tag LOCUS_08550 12041 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence037 1772 567 gene locus_tag LOCUS_08560 1772 567 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023814.1 protein_id gnl|my_center|LOCUS_08560 1983 2654 gene locus_tag LOCUS_08570 gene ribB 1983 2654 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_08570 2642 3091 gene locus_tag LOCUS_08580 2642 3091 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_08580 3069 3554 gene locus_tag LOCUS_08590 gene ribC 3069 3554 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 protein_id gnl|my_center|LOCUS_08590 3567 3986 gene locus_tag LOCUS_08600 gene ribH 3567 3986 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879619.1 protein_id gnl|my_center|LOCUS_08600 4025 4306 gene locus_tag LOCUS_08610 4025 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 5391 4303 gene locus_tag LOCUS_08620 5391 4303 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_08620 7327 5381 gene locus_tag LOCUS_08630 gene top6B 7327 5381 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878155.1 protein_id gnl|my_center|LOCUS_08630 7728 7655 gene locus_tag LOCUS_t00140 7728 7655 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7806 8894 gene locus_tag LOCUS_08640 7806 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 9039 10169 gene locus_tag LOCUS_08650 9039 10169 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763075.1 protein_id gnl|my_center|LOCUS_08650 10156 10893 gene locus_tag LOCUS_08660 10156 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 11898 10894 gene locus_tag LOCUS_08670 11898 10894 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877133.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence038 2709 4265 gene locus_tag LOCUS_08680 2709 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4635 4189 gene locus_tag LOCUS_08690 4635 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 5726 4632 gene locus_tag LOCUS_08700 5726 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 7280 5810 gene locus_tag LOCUS_r00020 7280 5810 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 10045 7559 gene locus_tag LOCUS_08710 gene mutS 10045 7559 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_08710 10392 10319 gene locus_tag LOCUS_t00150 10392 10319 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10629 10408 gene locus_tag LOCUS_08720 10629 10408 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_08720 11036 10635 gene locus_tag LOCUS_08730 11036 10635 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_08730 11454 11038 gene locus_tag LOCUS_08740 gene rplM 11454 11038 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_08740 11812 11459 gene locus_tag LOCUS_08750 11812 11459 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867655.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence039 625 1983 gene locus_tag LOCUS_08760 625 1983 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903377.1 protein_id gnl|my_center|LOCUS_08760 2311 1964 gene locus_tag LOCUS_08770 2311 1964 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878881.1 protein_id gnl|my_center|LOCUS_08770 3077 2367 gene locus_tag LOCUS_08780 3077 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3124 3543 gene locus_tag LOCUS_08790 3124 3543 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755897.1 protein_id gnl|my_center|LOCUS_08790 4361 3540 gene locus_tag LOCUS_08800 4361 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4447 4532 gene locus_tag LOCUS_t00160 4447 4532 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4754 6235 gene locus_tag LOCUS_08810 4754 6235 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250344.1 protein_id gnl|my_center|LOCUS_08810 6232 7461 gene locus_tag LOCUS_08820 6232 7461 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209476615.1 protein_id gnl|my_center|LOCUS_08820 7461 7826 gene locus_tag LOCUS_08830 7461 7826 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867395.1 protein_id gnl|my_center|LOCUS_08830 7862 9718 gene locus_tag LOCUS_08840 7862 9718 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250999.1 protein_id gnl|my_center|LOCUS_08840 9751 9987 gene locus_tag LOCUS_08850 9751 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 9988 10404 gene locus_tag LOCUS_08860 9988 10404 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251148.1 protein_id gnl|my_center|LOCUS_08860 10943 10401 gene locus_tag LOCUS_08870 10943 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 11704 10943 gene locus_tag LOCUS_08880 gene truA 11704 10943 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 protein_id gnl|my_center|LOCUS_08880 11787 12254 gene locus_tag LOCUS_08890 11787 12254 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence040 729 58 gene locus_tag LOCUS_08900 729 58 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_08900 1167 1094 gene locus_tag LOCUS_t00170 1167 1094 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1317 2174 gene locus_tag LOCUS_08910 gene rnz 1317 2174 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 protein_id gnl|my_center|LOCUS_08910 3616 2309 gene locus_tag LOCUS_08920 3616 2309 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_08920 4032 3637 gene locus_tag LOCUS_08930 4032 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4738 4025 gene locus_tag LOCUS_08940 4738 4025 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_08940 5228 4743 gene locus_tag LOCUS_08950 5228 4743 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 protein_id gnl|my_center|LOCUS_08950 5309 6748 gene locus_tag LOCUS_08960 gene glpK 5309 6748 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146520.1 protein_id gnl|my_center|LOCUS_08960 6795 7340 gene locus_tag LOCUS_08970 6795 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 7407 9062 gene locus_tag LOCUS_08980 7407 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 9125 10288 gene locus_tag LOCUS_08990 9125 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 10275 11285 gene locus_tag LOCUS_09000 10275 11285 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868647.1 protein_id gnl|my_center|LOCUS_09000 <12166 11289 gene locus_tag LOCUS_09010 <12166 11289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867316.1:PLP-dependent aminotransferase family protein >Feature sequence041 2423 918 gene locus_tag LOCUS_09020 2423 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2501 2767 gene locus_tag LOCUS_09030 2501 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2777 3739 gene locus_tag LOCUS_09040 2777 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 5651 3714 gene locus_tag LOCUS_09050 5651 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 6050 5784 gene locus_tag LOCUS_09060 6050 5784 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 protein_id gnl|my_center|LOCUS_09060 6311 6898 gene locus_tag LOCUS_09070 6311 6898 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249780.1 protein_id gnl|my_center|LOCUS_09070 7349 7762 gene locus_tag LOCUS_09080 7349 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 7798 9666 gene locus_tag LOCUS_09090 7798 9666 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250356.1 protein_id gnl|my_center|LOCUS_09090 10207 9656 gene locus_tag LOCUS_09100 10207 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10908 10204 gene locus_tag LOCUS_09110 10908 10204 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250348.1 protein_id gnl|my_center|LOCUS_09110 11201 10908 gene locus_tag LOCUS_09120 11201 10908 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545162.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence042 215 1261 gene locus_tag LOCUS_09130 215 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1273 2400 gene locus_tag LOCUS_09140 1273 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2458 3387 gene locus_tag LOCUS_09150 2458 3387 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048190.1 protein_id gnl|my_center|LOCUS_09150 3342 3602 gene locus_tag LOCUS_09160 3342 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 4266 3568 gene locus_tag LOCUS_09170 4266 3568 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250338.1 protein_id gnl|my_center|LOCUS_09170 4411 4782 gene locus_tag LOCUS_09180 4411 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4794 4949 gene locus_tag LOCUS_09190 4794 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4979 5875 gene locus_tag LOCUS_09200 gene purC 4979 5875 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878767.1 protein_id gnl|my_center|LOCUS_09200 6532 5858 gene locus_tag LOCUS_09210 6532 5858 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250992.1 protein_id gnl|my_center|LOCUS_09210 7085 6522 gene locus_tag LOCUS_09220 7085 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 7426 7088 gene locus_tag LOCUS_09230 7426 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 8380 8039 gene locus_tag LOCUS_09240 8380 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 9700 8384 gene locus_tag LOCUS_09250 9700 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 10550 9705 gene locus_tag LOCUS_09260 10550 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 11104 10601 gene locus_tag LOCUS_09270 11104 10601 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762515.1 protein_id gnl|my_center|LOCUS_09270 11380 11129 gene locus_tag LOCUS_09280 11380 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence043 146 3589 gene locus_tag LOCUS_09290 146 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 4286 3576 gene locus_tag LOCUS_09300 4286 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4536 4288 gene locus_tag LOCUS_09310 4536 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4623 5624 gene locus_tag LOCUS_09320 gene mtnA 4623 5624 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166394793.1 protein_id gnl|my_center|LOCUS_09320 6745 5627 gene locus_tag LOCUS_09330 6745 5627 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868082.1 protein_id gnl|my_center|LOCUS_09330 6997 6746 gene locus_tag LOCUS_09340 6997 6746 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250016.1 protein_id gnl|my_center|LOCUS_09340 8836 7022 gene locus_tag LOCUS_09350 gene aor 8836 7022 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_09350 10058 8922 gene locus_tag LOCUS_09360 10058 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 <11406 10160 gene locus_tag LOCUS_09370 <11406 10160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065480.1:phosphoglucosamine mutase >Feature sequence044 2880 1237 gene locus_tag LOCUS_09380 gene pyk 2880 1237 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_09380 3143 2892 gene locus_tag LOCUS_09390 3143 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 3241 4080 gene locus_tag LOCUS_09400 3241 4080 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878298.1 protein_id gnl|my_center|LOCUS_09400 4082 4684 gene locus_tag LOCUS_09410 4082 4684 CDS product KaiC associated regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064643.1 protein_id gnl|my_center|LOCUS_09410 4709 7801 gene locus_tag LOCUS_09420 gene rgy 4709 7801 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878524.1 protein_id gnl|my_center|LOCUS_09420 7829 8251 gene locus_tag LOCUS_09430 7829 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 8532 8248 gene locus_tag LOCUS_09440 8532 8248 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_09440 9197 8583 gene locus_tag LOCUS_09450 9197 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 <11217 9200 gene locus_tag LOCUS_09460 <11217 9200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249133.1:IGHMBP2 family helicase >Feature sequence045 1285 200 gene locus_tag LOCUS_09470 gene pepQ 1285 200 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249918.1 protein_id gnl|my_center|LOCUS_09470 1881 1309 gene locus_tag LOCUS_09480 1881 1309 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249693.1 protein_id gnl|my_center|LOCUS_09480 2266 1907 gene locus_tag LOCUS_09490 2266 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3170 2259 gene locus_tag LOCUS_09500 3170 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3773 3180 gene locus_tag LOCUS_09510 gene tmk 3773 3180 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_09510 3825 5105 gene locus_tag LOCUS_09520 3825 5105 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878362.1 protein_id gnl|my_center|LOCUS_09520 5618 5106 gene locus_tag LOCUS_09530 5618 5106 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249777.1 protein_id gnl|my_center|LOCUS_09530 5709 6923 gene locus_tag LOCUS_09540 5709 6923 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053677.1 protein_id gnl|my_center|LOCUS_09540 6929 7159 gene locus_tag LOCUS_09550 6929 7159 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_09550 7178 7900 gene locus_tag LOCUS_09560 7178 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 7890 8693 gene locus_tag LOCUS_09570 7890 8693 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_09570 9817 8690 gene locus_tag LOCUS_09580 9817 8690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066039.1 protein_id gnl|my_center|LOCUS_09580 9861 9933 gene locus_tag LOCUS_t00180 9861 9933 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence046 123 860 gene locus_tag LOCUS_09590 gene sfsA 123 860 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081303.1 protein_id gnl|my_center|LOCUS_09590 876 1553 gene locus_tag LOCUS_09600 876 1553 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250422.1 protein_id gnl|my_center|LOCUS_09600 2000 1554 gene locus_tag LOCUS_09610 2000 1554 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980098.1 protein_id gnl|my_center|LOCUS_09610 2220 3812 gene locus_tag LOCUS_09620 2220 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3869 4963 gene locus_tag LOCUS_09630 gene ftsZ 3869 4963 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_09630 4969 5190 gene locus_tag LOCUS_09640 4969 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 5200 6033 gene locus_tag LOCUS_09650 5200 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 6035 6511 gene locus_tag LOCUS_09660 6035 6511 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869872.1 protein_id gnl|my_center|LOCUS_09660 6550 7191 gene locus_tag LOCUS_09670 6550 7191 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_09670 7197 8201 gene locus_tag LOCUS_09680 7197 8201 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 protein_id gnl|my_center|LOCUS_09680 8222 8539 gene locus_tag LOCUS_09690 8222 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 8551 8703 gene locus_tag LOCUS_09700 8551 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 9155 8700 gene locus_tag LOCUS_09710 9155 8700 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870950.1 protein_id gnl|my_center|LOCUS_09710 10905 9136 gene locus_tag LOCUS_09720 10905 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence047 2617 1958 gene locus_tag LOCUS_09730 2617 1958 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867891.1 protein_id gnl|my_center|LOCUS_09730 2898 2614 gene locus_tag LOCUS_09740 2898 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2979 3224 gene locus_tag LOCUS_09750 gene purS 2979 3224 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871117.1 protein_id gnl|my_center|LOCUS_09750 3221 5527 gene locus_tag LOCUS_09760 gene purL 3221 5527 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879433.1 protein_id gnl|my_center|LOCUS_09760 5532 6293 gene locus_tag LOCUS_09770 gene purQ 5532 6293 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_09770 6329 6979 gene locus_tag LOCUS_09780 6329 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 7281 6982 gene locus_tag LOCUS_09790 7281 6982 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081479.1 protein_id gnl|my_center|LOCUS_09790 7364 8125 gene locus_tag LOCUS_09800 7364 8125 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 protein_id gnl|my_center|LOCUS_09800 8149 8223 gene locus_tag LOCUS_t00190 8149 8223 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8707 8622 gene locus_tag LOCUS_t00200 8707 8622 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8815 9318 gene locus_tag LOCUS_09810 8815 9318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 10181 9324 gene locus_tag LOCUS_09820 10181 9324 CDS product 7,8-dihydropterin-6-methyl-4-(beta-D-ribofuranosyl)-aminobenzene-5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869799.1 protein_id gnl|my_center|LOCUS_09820 10297 10686 gene locus_tag LOCUS_09830 10297 10686 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence048 1291 2175 gene locus_tag LOCUS_09840 1291 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2466 3077 gene locus_tag LOCUS_09850 2466 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3070 4626 gene locus_tag LOCUS_09860 3070 4626 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392966.1 protein_id gnl|my_center|LOCUS_09860 4627 5337 gene locus_tag LOCUS_09870 4627 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6538 5306 gene locus_tag LOCUS_09880 gene truD 6538 5306 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_09880 6984 6538 gene locus_tag LOCUS_09890 gene ndk 6984 6538 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_09890 7201 6956 gene locus_tag LOCUS_09900 7201 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 7416 7207 gene locus_tag LOCUS_09910 7416 7207 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867791.1 protein_id gnl|my_center|LOCUS_09910 7793 7428 gene locus_tag LOCUS_09920 gene rpl7ae 7793 7428 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053601.1 protein_id gnl|my_center|LOCUS_09920 7970 8431 gene locus_tag LOCUS_09930 7970 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 8473 9012 gene locus_tag LOCUS_09940 8473 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 9009 9656 gene locus_tag LOCUS_09950 9009 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 9646 10515 gene locus_tag LOCUS_09960 9646 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence049 <1 1179 gene locus_tag LOCUS_09970 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250773.1:ATP-binding protein 1441 1202 gene locus_tag LOCUS_09980 1441 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2342 1434 gene locus_tag LOCUS_09990 2342 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2625 2458 gene locus_tag LOCUS_10000 2625 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2748 2626 gene locus_tag LOCUS_10010 2748 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2984 2745 gene locus_tag LOCUS_10020 2984 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3284 4711 gene locus_tag LOCUS_10030 3284 4711 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980691.1 protein_id gnl|my_center|LOCUS_10030 5347 4763 gene locus_tag LOCUS_10040 5347 4763 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_10040 6199 5348 gene locus_tag LOCUS_10050 6199 5348 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250915.1 protein_id gnl|my_center|LOCUS_10050 6900 6262 gene locus_tag LOCUS_10060 6900 6262 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_10060 9905 6897 gene locus_tag LOCUS_10070 9905 6897 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876573.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence050 324 578 gene locus_tag LOCUS_10080 324 578 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878607.1 protein_id gnl|my_center|LOCUS_10080 1516 830 gene locus_tag LOCUS_10090 1516 830 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_10090 1532 1747 gene locus_tag LOCUS_10100 1532 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1750 2577 gene locus_tag LOCUS_10110 1750 2577 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024147.1 protein_id gnl|my_center|LOCUS_10110 2600 3073 gene locus_tag LOCUS_10120 2600 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3108 3419 gene locus_tag LOCUS_10130 3108 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 3953 3585 gene locus_tag LOCUS_10140 3953 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 4288 5736 gene locus_tag LOCUS_10150 4288 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5738 6583 gene locus_tag LOCUS_10160 5738 6583 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_10160 6629 7891 gene locus_tag LOCUS_10170 6629 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 7973 8590 gene locus_tag LOCUS_10180 7973 8590 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066030.1 protein_id gnl|my_center|LOCUS_10180 8833 9699 gene locus_tag LOCUS_10190 8833 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence051 136 221 gene locus_tag LOCUS_t00210 136 221 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 223 861 gene locus_tag LOCUS_10200 223 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1025 1978 gene locus_tag LOCUS_10210 1025 1978 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_10210 3290 1971 gene locus_tag LOCUS_10220 gene glmM 3290 1971 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250059.1 protein_id gnl|my_center|LOCUS_10220 3339 4799 gene locus_tag LOCUS_10230 3339 4799 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869988.1 protein_id gnl|my_center|LOCUS_10230 5018 5749 gene locus_tag LOCUS_10240 gene psmA 5018 5749 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_10240 5752 6450 gene locus_tag LOCUS_10250 5752 6450 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 protein_id gnl|my_center|LOCUS_10250 6456 7148 gene locus_tag LOCUS_10260 gene rrp4 6456 7148 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_10260 7132 7869 gene locus_tag LOCUS_10270 gene rrp41 7132 7869 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_10270 7862 8674 gene locus_tag LOCUS_10280 gene rrp42 7862 8674 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_10280 8658 8912 gene locus_tag LOCUS_10290 8658 8912 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249566.1 protein_id gnl|my_center|LOCUS_10290 9473 9024 gene locus_tag LOCUS_10300 9473 9024 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249080.1 protein_id gnl|my_center|LOCUS_10300 9877 9464 gene locus_tag LOCUS_10310 9877 9464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence052 1302 679 gene locus_tag LOCUS_10320 1302 679 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_10320 1381 1788 gene locus_tag LOCUS_10330 gene nikR 1381 1788 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_10330 1874 2572 gene locus_tag LOCUS_10340 gene cbiM 1874 2572 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871093.1 protein_id gnl|my_center|LOCUS_10340 2556 2879 gene locus_tag LOCUS_10350 2556 2879 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871094.1 protein_id gnl|my_center|LOCUS_10350 2854 3660 gene locus_tag LOCUS_10360 2854 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3633 4337 gene locus_tag LOCUS_10370 3633 4337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871096.1 protein_id gnl|my_center|LOCUS_10370 5449 4334 gene locus_tag LOCUS_10380 5449 4334 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868007.1 protein_id gnl|my_center|LOCUS_10380 5823 5446 gene locus_tag LOCUS_10390 5823 5446 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250575.1 protein_id gnl|my_center|LOCUS_10390 6566 5820 gene locus_tag LOCUS_10400 6566 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 8101 6575 gene locus_tag LOCUS_10410 8101 6575 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250573.1 protein_id gnl|my_center|LOCUS_10410 9862 8183 gene locus_tag LOCUS_10420 9862 8183 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence053 <1 1451 gene locus_tag LOCUS_10430 <1 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053693.1:TAXI family TRAP transporter solute-binding subunit 1458 1910 gene locus_tag LOCUS_10440 1458 1910 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477679.1 protein_id gnl|my_center|LOCUS_10440 1925 4303 gene locus_tag LOCUS_10450 1925 4303 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249888.1 protein_id gnl|my_center|LOCUS_10450 4359 7178 gene locus_tag LOCUS_10460 gene leuS 4359 7178 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867994.1 protein_id gnl|my_center|LOCUS_10460 8145 7210 gene locus_tag LOCUS_10470 8145 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 8467 8778 gene locus_tag LOCUS_10480 8467 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 8771 9055 gene locus_tag LOCUS_10490 8771 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 9168 9371 gene locus_tag LOCUS_10500 9168 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence054 437 511 gene locus_tag LOCUS_t00220 437 511 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 559 641 gene locus_tag LOCUS_t00230 559 641 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1339 641 gene locus_tag LOCUS_10510 1339 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2272 1406 gene locus_tag LOCUS_10520 2272 1406 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879191.1 protein_id gnl|my_center|LOCUS_10520 2669 2184 gene locus_tag LOCUS_10530 2669 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 3409 2666 gene locus_tag LOCUS_10540 3409 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3504 4115 gene locus_tag LOCUS_10550 3504 4115 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250877.1 protein_id gnl|my_center|LOCUS_10550 4187 6046 gene locus_tag LOCUS_10560 4187 6046 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 protein_id gnl|my_center|LOCUS_10560 9823 6158 gene locus_tag LOCUS_10570 9823 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence055 998 1597 gene locus_tag LOCUS_10580 998 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2442 1591 gene locus_tag LOCUS_10590 2442 1591 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250352.1 protein_id gnl|my_center|LOCUS_10590 3748 2444 gene locus_tag LOCUS_10600 3748 2444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250351.1 protein_id gnl|my_center|LOCUS_10600 3855 4343 gene locus_tag LOCUS_10610 3855 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4381 5547 gene locus_tag LOCUS_10620 gene coaBC 4381 5547 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496663.1 protein_id gnl|my_center|LOCUS_10620 5544 6365 gene locus_tag LOCUS_10630 5544 6365 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_10630 6410 7810 gene locus_tag LOCUS_10640 6410 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 8771 7791 gene locus_tag LOCUS_10650 8771 7791 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_10650 9760 8810 gene locus_tag LOCUS_10660 9760 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence056 552 247 gene locus_tag LOCUS_10670 552 247 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_10670 1142 591 gene locus_tag LOCUS_10680 1142 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2881 1157 gene locus_tag LOCUS_10690 2881 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 3021 3605 gene locus_tag LOCUS_10700 3021 3605 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876509.1 protein_id gnl|my_center|LOCUS_10700 3812 3600 gene locus_tag LOCUS_10710 3812 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4235 3813 gene locus_tag LOCUS_10720 4235 3813 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496550.1 protein_id gnl|my_center|LOCUS_10720 4421 5503 gene locus_tag LOCUS_10730 4421 5503 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948782.1 protein_id gnl|my_center|LOCUS_10730 5504 6418 gene locus_tag LOCUS_10740 5504 6418 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_10740 6428 7696 gene locus_tag LOCUS_10750 6428 7696 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_10750 8918 7698 gene locus_tag LOCUS_10760 gene glnA 8918 7698 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877179.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence057 995 15 gene locus_tag LOCUS_10770 995 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270489.1 protein_id gnl|my_center|LOCUS_10770 1103 1834 gene locus_tag LOCUS_10780 1103 1834 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_10780 1838 2725 gene locus_tag LOCUS_10790 gene nadA 1838 2725 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146454.1 protein_id gnl|my_center|LOCUS_10790 2727 3536 gene locus_tag LOCUS_10800 gene nadC 2727 3536 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867134.1 protein_id gnl|my_center|LOCUS_10800 4378 3533 gene locus_tag LOCUS_10810 4378 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4848 4444 gene locus_tag LOCUS_10820 4848 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 5221 7959 gene locus_tag LOCUS_10830 gene ppdK 5221 7959 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_10830 7986 8492 gene locus_tag LOCUS_10840 7986 8492 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_10840 8847 8485 gene locus_tag LOCUS_10850 8847 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence058 <1 668 gene locus_tag LOCUS_10860 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249904.1:PINc/VapC family ATPase 1164 655 gene locus_tag LOCUS_10870 gene cyaB 1164 655 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879480.1 protein_id gnl|my_center|LOCUS_10870 1339 1136 gene locus_tag LOCUS_10880 1339 1136 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877990.1 protein_id gnl|my_center|LOCUS_10880 1877 1356 gene locus_tag LOCUS_10890 gene ppa 1877 1356 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881004.1 protein_id gnl|my_center|LOCUS_10890 2426 1893 gene locus_tag LOCUS_10900 2426 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2579 2728 gene locus_tag LOCUS_10910 2579 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2706 3104 gene locus_tag LOCUS_10920 2706 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3211 3558 gene locus_tag LOCUS_10930 3211 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 3512 3910 gene locus_tag LOCUS_10940 3512 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3932 5173 gene locus_tag LOCUS_10950 3932 5173 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903232.1 protein_id gnl|my_center|LOCUS_10950 5211 5552 gene locus_tag LOCUS_10960 5211 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 6393 5668 gene locus_tag LOCUS_10970 6393 5668 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250205.1 protein_id gnl|my_center|LOCUS_10970 6507 7628 gene locus_tag LOCUS_10980 gene thrC 6507 7628 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251155.1 protein_id gnl|my_center|LOCUS_10980 7625 8809 gene locus_tag LOCUS_10990 gene glyA 7625 8809 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871121.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence059 363 1538 gene locus_tag LOCUS_11000 363 1538 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868844.1 protein_id gnl|my_center|LOCUS_11000 1768 2496 gene locus_tag LOCUS_11010 gene thiD 1768 2496 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436492.1 protein_id gnl|my_center|LOCUS_11010 2493 3236 gene locus_tag LOCUS_11020 2493 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3681 4118 gene locus_tag LOCUS_11030 3681 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4583 4101 gene locus_tag LOCUS_11040 4583 4101 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_11040 4969 4583 gene locus_tag LOCUS_11050 4969 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 5437 4994 gene locus_tag LOCUS_11060 5437 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 5516 7354 gene locus_tag LOCUS_11070 5516 7354 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250121.1 protein_id gnl|my_center|LOCUS_11070 7745 7347 gene locus_tag LOCUS_11080 7745 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 8291 7767 gene locus_tag LOCUS_11090 8291 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980010.1 protein_id gnl|my_center|LOCUS_11090 <8877 8302 gene locus_tag LOCUS_11100 <8877 8302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240510.1:ATP-binding protein >Feature sequence060 198 383 gene locus_tag LOCUS_11110 198 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 355 918 gene locus_tag LOCUS_11120 355 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 915 1496 gene locus_tag LOCUS_11130 915 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2146 1661 gene locus_tag LOCUS_11140 2146 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 2702 2136 gene locus_tag LOCUS_11150 2702 2136 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493254.1 protein_id gnl|my_center|LOCUS_11150 3181 2699 gene locus_tag LOCUS_11160 3181 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 3520 3182 gene locus_tag LOCUS_11170 3520 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3957 4337 gene locus_tag LOCUS_11180 3957 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 4339 6150 gene locus_tag LOCUS_11190 gene aor 4339 6150 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_11190 6147 7871 gene locus_tag LOCUS_11200 6147 7871 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146547.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence061 1917 805 gene locus_tag LOCUS_11210 1917 805 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 protein_id gnl|my_center|LOCUS_11210 1976 2848 gene locus_tag LOCUS_11220 gene mptA 1976 2848 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876820.1 protein_id gnl|my_center|LOCUS_11220 2845 3519 gene locus_tag LOCUS_11230 gene mtnP 2845 3519 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_11230 3571 7587 gene locus_tag LOCUS_11240 3571 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence062 424 1218 gene locus_tag LOCUS_11250 424 1218 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878600.1 protein_id gnl|my_center|LOCUS_11250 1318 2712 gene locus_tag LOCUS_11260 1318 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3428 2709 gene locus_tag LOCUS_11270 3428 2709 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942367.1 protein_id gnl|my_center|LOCUS_11270 3561 3406 gene locus_tag LOCUS_11280 3561 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 3958 3623 gene locus_tag LOCUS_11290 3958 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 4344 4526 gene locus_tag LOCUS_11300 4344 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4576 5496 gene locus_tag LOCUS_11310 gene argF 4576 5496 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_11310 7176 5497 gene locus_tag LOCUS_11320 gene mutL 7176 5497 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_11320 7364 8218 gene locus_tag LOCUS_11330 7364 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence063 417 13 gene locus_tag LOCUS_11340 417 13 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250967.1 protein_id gnl|my_center|LOCUS_11340 1831 452 gene locus_tag LOCUS_11350 1831 452 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_11350 3327 1837 gene locus_tag LOCUS_11360 3327 1837 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_11360 3693 3328 gene locus_tag LOCUS_11370 3693 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3913 4386 gene locus_tag LOCUS_11380 3913 4386 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496545.1 protein_id gnl|my_center|LOCUS_11380 4389 5405 gene locus_tag LOCUS_11390 4389 5405 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080192.1 protein_id gnl|my_center|LOCUS_11390 5851 5408 gene locus_tag LOCUS_11400 gene hycI 5851 5408 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870136.1 protein_id gnl|my_center|LOCUS_11400 7082 5853 gene locus_tag LOCUS_11410 7082 5853 CDS product aconitase/3-isopropylmalate dehydratase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870106.1 protein_id gnl|my_center|LOCUS_11410 7158 7544 gene locus_tag LOCUS_11420 7158 7544 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083110.1 protein_id gnl|my_center|LOCUS_11420 7541 8308 gene locus_tag LOCUS_11430 7541 8308 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980238.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence064 832 233 gene locus_tag LOCUS_11440 832 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2152 845 gene locus_tag LOCUS_11450 2152 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2228 2410 gene locus_tag LOCUS_11460 2228 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2449 4101 gene locus_tag LOCUS_11470 gene argS 2449 4101 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869735.1 protein_id gnl|my_center|LOCUS_11470 7121 4104 gene locus_tag LOCUS_11480 7121 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence065 27 986 gene locus_tag LOCUS_11490 27 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 983 1168 gene locus_tag LOCUS_11500 983 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1181 2071 gene locus_tag LOCUS_11510 1181 2071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763692.1 protein_id gnl|my_center|LOCUS_11510 2058 2771 gene locus_tag LOCUS_11520 2058 2771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249186.1 protein_id gnl|my_center|LOCUS_11520 2898 3839 gene locus_tag LOCUS_11530 2898 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3854 4879 gene locus_tag LOCUS_11540 3854 4879 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053650.1 protein_id gnl|my_center|LOCUS_11540 4939 5445 gene locus_tag LOCUS_11550 4939 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6554 5442 gene locus_tag LOCUS_11560 6554 5442 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_11560 7912 6602 gene locus_tag LOCUS_11570 7912 6602 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082444.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence066 1353 376 gene locus_tag LOCUS_11580 gene wtpB 1353 376 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877607.1 protein_id gnl|my_center|LOCUS_11580 2339 1350 gene locus_tag LOCUS_11590 gene wtpA 2339 1350 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870699.1 protein_id gnl|my_center|LOCUS_11590 2417 2851 gene locus_tag LOCUS_11600 2417 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3136 3209 gene locus_tag LOCUS_t00240 3136 3209 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3989 3162 gene locus_tag LOCUS_11610 3989 3162 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868422.1 protein_id gnl|my_center|LOCUS_11610 4062 5957 gene locus_tag LOCUS_11620 gene lonB 4062 5957 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_11620 5954 6376 gene locus_tag LOCUS_11630 5954 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 7505 6411 gene locus_tag LOCUS_11640 gene tgt 7505 6411 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229725.1 protein_id gnl|my_center|LOCUS_11640 7635 8243 gene locus_tag LOCUS_11650 7635 8243 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250761.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence067 539 114 gene locus_tag LOCUS_11660 539 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1107 544 gene locus_tag LOCUS_11670 1107 544 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020321.1 protein_id gnl|my_center|LOCUS_11670 1305 2408 gene locus_tag LOCUS_11680 1305 2408 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009956127.1 protein_id gnl|my_center|LOCUS_11680 2857 2552 gene locus_tag LOCUS_11690 2857 2552 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250777.1 protein_id gnl|my_center|LOCUS_11690 3473 2862 gene locus_tag LOCUS_11700 3473 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250776.1 protein_id gnl|my_center|LOCUS_11700 4649 3543 gene locus_tag LOCUS_11710 gene dnaJ 4649 3543 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582445.1 protein_id gnl|my_center|LOCUS_11710 5078 4656 gene locus_tag LOCUS_11720 5078 4656 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_11720 6965 5121 gene locus_tag LOCUS_11730 gene dnaK 6965 5121 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_11730 7413 6958 gene locus_tag LOCUS_11740 7413 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence068 2782 1475 gene locus_tag LOCUS_11750 2782 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 4192 2870 gene locus_tag LOCUS_11760 4192 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 6395 4206 gene locus_tag LOCUS_11770 6395 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6962 6663 gene locus_tag LOCUS_11780 6962 6663 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 protein_id gnl|my_center|LOCUS_11780 7177 6959 gene locus_tag LOCUS_11790 7177 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 7428 7264 gene locus_tag LOCUS_11800 7428 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 7564 7857 gene locus_tag LOCUS_11810 7564 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence069 711 1145 gene locus_tag LOCUS_11820 711 1145 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249180.1 protein_id gnl|my_center|LOCUS_11820 1161 1544 gene locus_tag LOCUS_11830 1161 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1555 1785 gene locus_tag LOCUS_11840 1555 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2686 1754 gene locus_tag LOCUS_11850 2686 1754 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164490413.1 protein_id gnl|my_center|LOCUS_11850 3501 2683 gene locus_tag LOCUS_11860 3501 2683 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082313.1 protein_id gnl|my_center|LOCUS_11860 4271 3528 gene locus_tag LOCUS_11870 4271 3528 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250348.1 protein_id gnl|my_center|LOCUS_11870 4355 5482 gene locus_tag LOCUS_11880 4355 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 5992 5483 gene locus_tag LOCUS_11890 5992 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 6072 6590 gene locus_tag LOCUS_11900 6072 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 7585 6581 gene locus_tag LOCUS_11910 7585 6581 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868678.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence070 757 1431 gene locus_tag LOCUS_11920 757 1431 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404012.1 protein_id gnl|my_center|LOCUS_11920 1473 2333 gene locus_tag LOCUS_11930 1473 2333 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_11930 2326 3999 gene locus_tag LOCUS_11940 gene glyS 2326 3999 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869726.1 protein_id gnl|my_center|LOCUS_11940 4032 4772 gene locus_tag LOCUS_11950 4032 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 5714 4767 gene locus_tag LOCUS_11960 5714 4767 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680329.1 protein_id gnl|my_center|LOCUS_11960 6946 5768 gene locus_tag LOCUS_11970 6946 5768 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680038.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence071 <1 790 gene locus_tag LOCUS_11980 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014128488.1:isocitrate/isopropylmalate family dehydrogenase 1085 1759 gene locus_tag LOCUS_11990 1085 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1798 2469 gene locus_tag LOCUS_12000 1798 2469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_12000 2466 2984 gene locus_tag LOCUS_12010 2466 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2989 4137 gene locus_tag LOCUS_12020 2989 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4134 5294 gene locus_tag LOCUS_12030 4134 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5951 5334 gene locus_tag LOCUS_12040 5951 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6508 6002 gene locus_tag LOCUS_12050 6508 6002 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879257.1 protein_id gnl|my_center|LOCUS_12050 <7188 6519 gene locus_tag LOCUS_12060 <7188 6519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083007.1:3-isopropylmalate dehydratase large subunit >Feature sequence072 2778 988 gene locus_tag LOCUS_12070 gene gatE 2778 988 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_12070 4007 2772 gene locus_tag LOCUS_12080 gene gatD 4007 2772 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_12080 6710 4038 gene locus_tag LOCUS_12090 6710 4038 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878645.1 protein_id gnl|my_center|LOCUS_12090 6916 6746 gene locus_tag LOCUS_12100 6916 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence073 1450 719 gene locus_tag LOCUS_12110 gene cas6 1450 719 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023579.1 protein_id gnl|my_center|LOCUS_12110 2106 1621 gene locus_tag LOCUS_12120 2106 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 2668 4014 gene locus_tag LOCUS_12130 2668 4014 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868284.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence074 978 328 gene locus_tag LOCUS_12140 978 328 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_12140 3179 975 gene locus_tag LOCUS_12150 gene metG 3179 975 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868104.1 protein_id gnl|my_center|LOCUS_12150 3250 4203 gene locus_tag LOCUS_12160 3250 4203 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250141.1 protein_id gnl|my_center|LOCUS_12160 4474 4244 gene locus_tag LOCUS_12170 4474 4244 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_12170 4691 4461 gene locus_tag LOCUS_12180 4691 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 <6511 4890 gene locus_tag LOCUS_12190 <6511 4890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880376.1:chromosome segregation protein SMC >Feature sequence075 216 1013 gene locus_tag LOCUS_12200 216 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1324 1010 gene locus_tag LOCUS_12210 gene rpsJ 1324 1010 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_12210 2622 1348 gene locus_tag LOCUS_12220 gene tuf 2622 1348 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878437.1 protein_id gnl|my_center|LOCUS_12220 4880 2676 gene locus_tag LOCUS_12230 4880 2676 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 protein_id gnl|my_center|LOCUS_12230 5454 4891 gene locus_tag LOCUS_12240 gene rpsG 5454 4891 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879386.1 protein_id gnl|my_center|LOCUS_12240 5888 5460 gene locus_tag LOCUS_12250 5888 5460 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence076 <1 915 gene locus_tag LOCUS_12260 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812206.1:lactate utilization protein B 963 2264 gene locus_tag LOCUS_12270 963 2264 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867977.1 protein_id gnl|my_center|LOCUS_12270 2279 3385 gene locus_tag LOCUS_12280 gene sucC 2279 3385 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189251.1 protein_id gnl|my_center|LOCUS_12280 3382 4248 gene locus_tag LOCUS_12290 gene sucD 3382 4248 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774550.1 protein_id gnl|my_center|LOCUS_12290 4317 5894 gene locus_tag LOCUS_12300 4317 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence077 1653 310 gene locus_tag LOCUS_12310 1653 310 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876425.1 protein_id gnl|my_center|LOCUS_12310 2185 1646 gene locus_tag LOCUS_12320 gene cysC 2185 1646 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763240.1 protein_id gnl|my_center|LOCUS_12320 2745 2185 gene locus_tag LOCUS_12330 2745 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3659 2739 gene locus_tag LOCUS_12340 3659 2739 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868286.1 protein_id gnl|my_center|LOCUS_12340 4800 3664 gene locus_tag LOCUS_12350 gene sat 4800 3664 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_12350 5032 4811 gene locus_tag LOCUS_12360 5032 4811 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146889.1 protein_id gnl|my_center|LOCUS_12360 5132 6166 gene locus_tag LOCUS_12370 5132 6166 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence078 412 1395 gene locus_tag LOCUS_12380 412 1395 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485746.1 protein_id gnl|my_center|LOCUS_12380 1397 2896 gene locus_tag LOCUS_12390 1397 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2929 3582 gene locus_tag LOCUS_12400 2929 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3850 3924 gene locus_tag LOCUS_t00250 3850 3924 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4904 3996 gene locus_tag LOCUS_12410 4904 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 5206 5772 gene locus_tag LOCUS_12420 5206 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence079 <1 646 gene locus_tag LOCUS_12430 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250330.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB 1191 640 gene locus_tag LOCUS_12440 1191 640 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869594.1 protein_id gnl|my_center|LOCUS_12440 1280 2566 gene locus_tag LOCUS_12450 1280 2566 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868413.1 protein_id gnl|my_center|LOCUS_12450 2606 3376 gene locus_tag LOCUS_12460 2606 3376 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250526.1 protein_id gnl|my_center|LOCUS_12460 3424 4197 gene locus_tag LOCUS_12470 3424 4197 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_12470 4194 5711 gene locus_tag LOCUS_12480 4194 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence080 2299 539 gene locus_tag LOCUS_12490 2299 539 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_12490 2716 2309 gene locus_tag LOCUS_12500 2716 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2889 4085 gene locus_tag LOCUS_12510 2889 4085 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205044.1 protein_id gnl|my_center|LOCUS_12510 4383 4075 gene locus_tag LOCUS_12520 4383 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877792.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence081 1147 11 gene locus_tag LOCUS_12530 1147 11 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948513.1 protein_id gnl|my_center|LOCUS_12530 1205 1873 gene locus_tag LOCUS_12540 gene fabG 1205 1873 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_12540 2095 1874 gene locus_tag LOCUS_12550 2095 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 2188 2113 gene locus_tag LOCUS_t00260 2188 2113 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2267 2701 gene locus_tag LOCUS_12560 2267 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 2754 2960 gene locus_tag LOCUS_12570 2754 2960 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868845.1 protein_id gnl|my_center|LOCUS_12570 3000 3575 gene locus_tag LOCUS_12580 3000 3575 CDS product regulator of amino acid metabolism, contains ACT domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147148.1 protein_id gnl|my_center|LOCUS_12580 4514 3564 gene locus_tag LOCUS_12590 4514 3564 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020974.1 protein_id gnl|my_center|LOCUS_12590 5205 4519 gene locus_tag LOCUS_12600 5205 4519 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496372.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence082 1583 363 gene locus_tag LOCUS_12610 1583 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1776 2357 gene locus_tag LOCUS_12620 1776 2357 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370092.1 protein_id gnl|my_center|LOCUS_12620 2585 4645 gene locus_tag LOCUS_12630 2585 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 4896 4678 gene locus_tag LOCUS_12640 4896 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 5019 5588 gene locus_tag LOCUS_12650 5019 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 5746 5609 gene locus_tag LOCUS_12660 5746 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence083 2561 435 gene locus_tag LOCUS_12670 2561 435 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_12670 3744 2545 gene locus_tag LOCUS_12680 3744 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 4816 3749 gene locus_tag LOCUS_12690 gene wecB 4816 3749 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250181.1 protein_id gnl|my_center|LOCUS_12690 6042 4813 gene locus_tag LOCUS_12700 6042 4813 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867672.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence084 1037 129 gene locus_tag LOCUS_12710 1037 129 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619521.1 protein_id gnl|my_center|LOCUS_12710 1126 2472 gene locus_tag LOCUS_12720 1126 2472 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867485.1 protein_id gnl|my_center|LOCUS_12720 3875 2505 gene locus_tag LOCUS_12730 gene gdhA 3875 2505 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 protein_id gnl|my_center|LOCUS_12730 5199 4150 gene locus_tag LOCUS_12740 5199 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 6005 5322 gene locus_tag LOCUS_12750 6005 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence085 2 886 gene locus_tag LOCUS_12760 2 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 892 2091 gene locus_tag LOCUS_12770 892 2091 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_12770 2267 2584 gene locus_tag LOCUS_12780 2267 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2597 2836 gene locus_tag LOCUS_12790 2597 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 3805 2891 gene locus_tag LOCUS_12800 3805 2891 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_12800 4907 3918 gene locus_tag LOCUS_12810 4907 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence086 2370 1864 gene locus_tag LOCUS_12820 2370 1864 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249478.1 protein_id gnl|my_center|LOCUS_12820 2840 2367 gene locus_tag LOCUS_12830 gene bcp 2840 2367 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_12830 4021 2837 gene locus_tag LOCUS_12840 4021 2837 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_12840 4182 4024 gene locus_tag LOCUS_12850 4182 4024 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249479.1 protein_id gnl|my_center|LOCUS_12850 4696 4199 gene locus_tag LOCUS_12860 4696 4199 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249601.1 protein_id gnl|my_center|LOCUS_12860 5182 4697 gene locus_tag LOCUS_12870 5182 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence087 130 525 gene locus_tag LOCUS_12880 130 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 720 526 gene locus_tag LOCUS_12890 720 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 815 1204 gene locus_tag LOCUS_12900 815 1204 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878018.1 protein_id gnl|my_center|LOCUS_12900 1201 2427 gene locus_tag LOCUS_12910 gene eif2g 1201 2427 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 protein_id gnl|my_center|LOCUS_12910 3013 2429 gene locus_tag LOCUS_12920 3013 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022949.1 protein_id gnl|my_center|LOCUS_12920 3123 3677 gene locus_tag LOCUS_12930 gene mobA 3123 3677 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867983.1 protein_id gnl|my_center|LOCUS_12930 3698 4147 gene locus_tag LOCUS_12940 gene nuoE 3698 4147 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583281.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence088 447 1229 gene locus_tag LOCUS_12950 447 1229 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868837.1 protein_id gnl|my_center|LOCUS_12950 1569 1222 gene locus_tag LOCUS_12960 1569 1222 CDS product DUF3783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250025.1 protein_id gnl|my_center|LOCUS_12960 3423 1570 gene locus_tag LOCUS_12970 3423 1570 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249795.1 protein_id gnl|my_center|LOCUS_12970 3799 5178 gene locus_tag LOCUS_12980 3799 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence089 1216 503 gene locus_tag LOCUS_12990 1216 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1290 2165 gene locus_tag LOCUS_13000 1290 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2162 3019 gene locus_tag LOCUS_13010 gene gldA 2162 3019 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_13010 3016 3759 gene locus_tag LOCUS_13020 3016 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3756 4433 gene locus_tag LOCUS_13030 3756 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4571 4936 gene locus_tag LOCUS_13040 4571 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence090 <1 1246 gene locus_tag LOCUS_13050 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868797.1:hydrophobe/amphiphile efflux-3 (HAE3) family transporter 1328 1600 gene locus_tag LOCUS_13060 gene albA 1328 1600 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence091 1094 759 gene locus_tag LOCUS_13070 1094 759 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_13070 1819 1091 gene locus_tag LOCUS_13080 1819 1091 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867828.1 protein_id gnl|my_center|LOCUS_13080 2064 1816 gene locus_tag LOCUS_13090 2064 1816 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250174.1 protein_id gnl|my_center|LOCUS_13090 2413 2066 gene locus_tag LOCUS_13100 gene mnhG 2413 2066 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250175.1 protein_id gnl|my_center|LOCUS_13100 2676 2410 gene locus_tag LOCUS_13110 2676 2410 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250176.1 protein_id gnl|my_center|LOCUS_13110 3092 2673 gene locus_tag LOCUS_13120 3092 2673 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence092 775 95 gene locus_tag LOCUS_13130 775 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3221 813 gene locus_tag LOCUS_13140 3221 813 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876179.1 protein_id gnl|my_center|LOCUS_13140 4522 3218 gene locus_tag LOCUS_13150 4522 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence093 <1 1118 gene locus_tag LOCUS_13160 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250170.1:proton-conducting transporter membrane subunit 1115 2080 gene locus_tag LOCUS_13170 1115 2080 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867832.1 protein_id gnl|my_center|LOCUS_13170 2077 2619 gene locus_tag LOCUS_13180 2077 2619 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080086.1 protein_id gnl|my_center|LOCUS_13180 2616 3113 gene locus_tag LOCUS_13190 2616 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 3110 4237 gene locus_tag LOCUS_13200 3110 4237 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146623.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence094 869 357 gene locus_tag LOCUS_13210 869 357 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_13210 1236 901 gene locus_tag LOCUS_13220 1236 901 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250924.1 protein_id gnl|my_center|LOCUS_13220 2050 1298 gene locus_tag LOCUS_13230 2050 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 2271 2083 gene locus_tag LOCUS_13240 2271 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2376 3518 gene locus_tag LOCUS_13250 2376 3518 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867549.1 protein_id gnl|my_center|LOCUS_13250 3557 4378 gene locus_tag LOCUS_13260 3557 4378 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence095 <1 769 gene locus_tag LOCUS_13270 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048040655.1:serpin family protein 802 1236 gene locus_tag LOCUS_13280 gene moaC 802 1236 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249309.1 protein_id gnl|my_center|LOCUS_13280 1239 1739 gene locus_tag LOCUS_13290 1239 1739 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117124.1 protein_id gnl|my_center|LOCUS_13290 1736 2353 gene locus_tag LOCUS_13300 1736 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3774 2359 gene locus_tag LOCUS_13310 3774 2359 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657823.1 protein_id gnl|my_center|LOCUS_13310 4383 3832 gene locus_tag LOCUS_13320 4383 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence096 286 41 gene locus_tag LOCUS_13330 286 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 534 463 gene locus_tag LOCUS_t00270 534 463 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1778 561 gene locus_tag LOCUS_13340 gene guaD 1778 561 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_13340 1884 3041 gene locus_tag LOCUS_13350 1884 3041 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479989.1 protein_id gnl|my_center|LOCUS_13350 3046 4305 gene locus_tag LOCUS_13360 3046 4305 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083007.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence097 223 1350 gene locus_tag LOCUS_13370 223 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2536 1364 gene locus_tag LOCUS_13380 2536 1364 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_13380 2844 2665 gene locus_tag LOCUS_13390 2844 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 3210 2860 gene locus_tag LOCUS_13400 3210 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence098 866 1750 gene locus_tag LOCUS_13410 866 1750 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879523.1 protein_id gnl|my_center|LOCUS_13410 1747 2568 gene locus_tag LOCUS_13420 1747 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064248.1 protein_id gnl|my_center|LOCUS_13420 2754 3140 gene locus_tag LOCUS_13430 2754 3140 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_13430 3128 4078 gene locus_tag LOCUS_13440 gene meaB 3128 4078 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence099 <1 1227 gene locus_tag LOCUS_13450 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868281.1:nucleotide sugar dehydrogenase 1224 2177 gene locus_tag LOCUS_13460 1224 2177 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 protein_id gnl|my_center|LOCUS_13460 2227 2787 gene locus_tag LOCUS_13470 2227 2787 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 protein_id gnl|my_center|LOCUS_13470 2784 3860 gene locus_tag LOCUS_13480 2784 3860 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence100 122 1714 gene locus_tag LOCUS_13490 122 1714 CDS product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073522.1 protein_id gnl|my_center|LOCUS_13490 2093 1725 gene locus_tag LOCUS_13500 2093 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence101 2613 949 gene locus_tag LOCUS_13510 gene flaJ 2613 949 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496654.1 protein_id gnl|my_center|LOCUS_13510 <3725 2619 gene locus_tag LOCUS_13520 <3725 2619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868605.1:type II/IV secretion system ATPase subunit >Feature sequence102 1197 640 gene locus_tag LOCUS_13530 1197 640 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879236.1 protein_id gnl|my_center|LOCUS_13530 1268 1344 gene locus_tag LOCUS_t00280 1268 1344 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2641 1739 gene locus_tag LOCUS_13540 2641 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3071 3544 gene locus_tag LOCUS_13550 3071 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence103 138 1358 gene locus_tag LOCUS_13560 gene frhA 138 1358 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774535.1 protein_id gnl|my_center|LOCUS_13560 1355 2035 gene locus_tag LOCUS_13570 gene frhG 1355 2035 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496370.1 protein_id gnl|my_center|LOCUS_13570 2036 2830 gene locus_tag LOCUS_13580 gene frhB 2036 2830 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496371.1 protein_id gnl|my_center|LOCUS_13580 3211 2846 gene locus_tag LOCUS_13590 3211 2846 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250966.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence104 519 1760 gene locus_tag LOCUS_13600 519 1760 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022227.1 protein_id gnl|my_center|LOCUS_13600 1796 2323 gene locus_tag LOCUS_13610 1796 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2310 3104 gene locus_tag LOCUS_13620 2310 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3101 3475 gene locus_tag LOCUS_13630 3101 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence105 1426 785 gene locus_tag LOCUS_13640 1426 785 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_13640 1503 2102 gene locus_tag LOCUS_13650 1503 2102 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250650.1 protein_id gnl|my_center|LOCUS_13650 2099 2284 gene locus_tag LOCUS_13660 2099 2284 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868804.1 protein_id gnl|my_center|LOCUS_13660 2256 2765 gene locus_tag LOCUS_13670 2256 2765 CDS product GTP-dependent dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868805.1 protein_id gnl|my_center|LOCUS_13670 2768 3067 gene locus_tag LOCUS_13680 2768 3067 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 protein_id gnl|my_center|LOCUS_13680 3070 3222 gene locus_tag LOCUS_13690 3070 3222 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250646.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence106 2567 1491 gene locus_tag LOCUS_13700 2567 1491 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146519.1 protein_id gnl|my_center|LOCUS_13700 <3457 2573 gene locus_tag LOCUS_13710 <3457 2573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042680609.1:DUF438 domain-containing protein >Feature sequence107 <3334 143 gene locus_tag LOCUS_13720 <3334 143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158296897.1:PAS domain S-box protein >Feature sequence108 <1 1012 gene locus_tag LOCUS_13730 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249415.1:CRISPR-associated helicase/endonuclease Cas3 1097 1258 gene locus_tag LOCUS_13740 1097 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1261 1767 gene locus_tag LOCUS_13750 gene cas4 1261 1767 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023578.1 protein_id gnl|my_center|LOCUS_13750 1757 2728 gene locus_tag LOCUS_13760 gene cas1b 1757 2728 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065768.1 protein_id gnl|my_center|LOCUS_13760 2731 2994 gene locus_tag LOCUS_13770 gene cas2 2731 2994 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023576.1 protein_id gnl|my_center|LOCUS_13770 3145 3309 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttagaataagaccatattgggattgaaat >Feature sequence109 936 28 gene locus_tag LOCUS_13780 936 28 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846871.1 protein_id gnl|my_center|LOCUS_13780 1208 918 gene locus_tag LOCUS_13790 1208 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13790 1914 1177 gene locus_tag LOCUS_13800 1914 1177 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830993.1 protein_id gnl|my_center|LOCUS_13800 2282 1917 gene locus_tag LOCUS_13810 gene mntR 2282 1917 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003236923.1 protein_id gnl|my_center|LOCUS_13810 2371 3192 gene locus_tag LOCUS_13820 2371 3192 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015858271.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence110 447 620 gene locus_tag LOCUS_13830 447 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 809 1051 gene locus_tag LOCUS_13840 809 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1199 2128 gene locus_tag LOCUS_13850 1199 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2284 2457 gene locus_tag LOCUS_13860 2284 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2505 2855 gene locus_tag LOCUS_13870 2505 2855 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409273.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence111 36 248 gene locus_tag LOCUS_13880 36 248 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024015.1 protein_id gnl|my_center|LOCUS_13880 245 478 gene locus_tag LOCUS_13890 245 478 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048105191.1 protein_id gnl|my_center|LOCUS_13890 685 1812 gene locus_tag LOCUS_13900 685 1812 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868272.1 protein_id gnl|my_center|LOCUS_13900 1846 2475 gene locus_tag LOCUS_13910 1846 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2462 3151 gene locus_tag LOCUS_13920 2462 3151 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038679.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence112 1610 837 gene locus_tag LOCUS_13930 1610 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 3264 1621 gene locus_tag LOCUS_13940 3264 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence113 793 344 gene locus_tag LOCUS_13950 793 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13950 1017 850 gene locus_tag LOCUS_13960 1017 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1636 1007 gene locus_tag LOCUS_13970 1636 1007 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020851.1 protein_id gnl|my_center|LOCUS_13970 2859 1633 gene locus_tag LOCUS_13980 2859 1633 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020852.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence114 1277 678 gene locus_tag LOCUS_13990 gene rpsB 1277 678 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867661.1 protein_id gnl|my_center|LOCUS_13990 2485 1280 gene locus_tag LOCUS_14000 gene eno 2485 1280 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence115 875 147 gene locus_tag LOCUS_14010 875 147 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_14010 2188 926 gene locus_tag LOCUS_14020 2188 926 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878202.1 protein_id gnl|my_center|LOCUS_14020 2643 2188 gene locus_tag LOCUS_14030 2643 2188 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence116 134 433 gene locus_tag LOCUS_14040 134 433 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081479.1 protein_id gnl|my_center|LOCUS_14040 471 1046 gene locus_tag LOCUS_14050 gene udg 471 1046 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053779.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence117 1186 566 gene locus_tag LOCUS_14060 1186 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2983 1337 gene locus_tag LOCUS_14070 2983 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence118 795 2243 gene locus_tag LOCUS_14080 gene guaB 795 2243 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868777.1 protein_id gnl|my_center|LOCUS_14080 2275 2568 gene locus_tag LOCUS_14090 2275 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2603 2950 gene locus_tag LOCUS_14100 2603 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence119 1346 546 gene locus_tag LOCUS_14110 1346 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1590 1423 gene locus_tag LOCUS_14120 1590 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 2374 1691 gene locus_tag LOCUS_14130 2374 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence120 409 795 gene locus_tag LOCUS_14140 409 795 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249144.1 protein_id gnl|my_center|LOCUS_14140 798 1448 gene locus_tag LOCUS_14150 798 1448 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_14150 1445 1678 gene locus_tag LOCUS_14160 gene moaD 1445 1678 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_14160 <2766 1685 gene locus_tag LOCUS_14170 <2766 1685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990716.1:heavy metal translocating P-type ATPase >Feature sequence121 1784 387 gene locus_tag LOCUS_14180 1784 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1892 1977 gene locus_tag LOCUS_t00290 1892 1977 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2560 2051 gene locus_tag LOCUS_14190 2560 2051 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence122 >Feature sequence123 953 813 gene locus_tag LOCUS_14200 953 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1217 1011 gene locus_tag LOCUS_14210 1217 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1566 2444 gene locus_tag LOCUS_14220 1566 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence124 232 101 gene locus_tag LOCUS_14230 232 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 589 236 gene locus_tag LOCUS_14240 589 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1212 2348 gene locus_tag LOCUS_14250 1212 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence125 >Feature sequence126 926 297 gene locus_tag LOCUS_14260 gene thiE 926 297 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868208.1 protein_id gnl|my_center|LOCUS_14260 1006 2469 gene locus_tag LOCUS_14270 1006 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence127 2128 1493 gene locus_tag LOCUS_14280 2128 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2418 2128 gene locus_tag LOCUS_14290 2418 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence128 <1 921 gene locus_tag LOCUS_14300 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083774551.1:formate dehydrogenase subunit alpha 2114 918 gene locus_tag LOCUS_14310 2114 918 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence129 629 423 gene locus_tag LOCUS_14320 629 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1068 664 gene locus_tag LOCUS_14330 1068 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1792 1115 gene locus_tag LOCUS_14340 1792 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence130 >Feature sequence131 643 125 gene locus_tag LOCUS_14350 643 125 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582541.1 protein_id gnl|my_center|LOCUS_14350 1092 679 gene locus_tag LOCUS_14360 1092 679 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868380.1 protein_id gnl|my_center|LOCUS_14360 <2333 1134 gene locus_tag LOCUS_14370 <2333 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868838.1:DNA polymerase >Feature sequence132 764 2206 gene locus_tag LOCUS_14380 gene lysS 764 2206 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847014.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence133 272 526 gene locus_tag LOCUS_14390 272 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 717 1733 gene locus_tag LOCUS_14400 717 1733 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931000.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence134 1857 1216 gene locus_tag LOCUS_14410 gene cas5b 1857 1216 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249416.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence135 >Feature sequence136 2004 280 gene locus_tag LOCUS_14420 2004 280 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723837.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence137 304 726 gene locus_tag LOCUS_14430 304 726 CDS product flagellar protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320043.1 protein_id gnl|my_center|LOCUS_14430 730 1419 gene locus_tag LOCUS_14440 730 1419 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496652.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence138 986 1936 gene locus_tag LOCUS_14450 gene cas7b 986 1936 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence139 97 366 gene locus_tag LOCUS_14460 97 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 592 1113 gene locus_tag LOCUS_14470 592 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470