>Feature sequence01 2028 1522 gene locus_tag LOCUS_00010 2028 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2210 2025 gene locus_tag LOCUS_00020 2210 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2359 2231 gene locus_tag LOCUS_00030 2359 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2667 4301 gene locus_tag LOCUS_00040 2667 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5428 4400 gene locus_tag LOCUS_00050 gene asd 5428 4400 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_00050 8478 5577 gene locus_tag LOCUS_r00010 8478 5577 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 8693 8619 gene locus_tag LOCUS_t00010 8693 8619 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10225 8752 gene locus_tag LOCUS_r00020 10225 8752 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 11987 10695 gene locus_tag LOCUS_00060 11987 10695 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877734.1 protein_id gnl|my_center|LOCUS_00060 12108 12797 gene locus_tag LOCUS_00070 12108 12797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096431.1 protein_id gnl|my_center|LOCUS_00070 12803 13507 gene locus_tag LOCUS_00080 12803 13507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877732.1 protein_id gnl|my_center|LOCUS_00080 14219 13533 gene locus_tag LOCUS_00090 14219 13533 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877858.1 protein_id gnl|my_center|LOCUS_00090 15101 14304 gene locus_tag LOCUS_00100 15101 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064218.1 protein_id gnl|my_center|LOCUS_00100 15964 15149 gene locus_tag LOCUS_00110 gene nadE 15964 15149 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878500.1 protein_id gnl|my_center|LOCUS_00110 16891 15965 gene locus_tag LOCUS_00120 gene argF 16891 15965 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_00120 16993 17595 gene locus_tag LOCUS_00130 16993 17595 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879461.1 protein_id gnl|my_center|LOCUS_00130 17661 18461 gene locus_tag LOCUS_00140 17661 18461 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877622.1 protein_id gnl|my_center|LOCUS_00140 19162 19395 gene locus_tag LOCUS_00150 19162 19395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20015 19746 gene locus_tag LOCUS_00160 20015 19746 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879046.1 protein_id gnl|my_center|LOCUS_00160 20087 20734 gene locus_tag LOCUS_00170 20087 20734 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879047.1 protein_id gnl|my_center|LOCUS_00170 20744 21217 gene locus_tag LOCUS_00180 20744 21217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21753 21253 gene locus_tag LOCUS_00190 gene pyrI 21753 21253 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877621.1 protein_id gnl|my_center|LOCUS_00190 22677 21763 gene locus_tag LOCUS_00200 gene pyrB 22677 21763 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_00200 22809 23444 gene locus_tag LOCUS_00210 22809 23444 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878296.1 protein_id gnl|my_center|LOCUS_00210 23526 24050 gene locus_tag LOCUS_00220 gene rplJ 23526 24050 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_00220 24351 24058 gene locus_tag LOCUS_00230 24351 24058 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868047.1 protein_id gnl|my_center|LOCUS_00230 24996 24358 gene locus_tag LOCUS_00240 24996 24358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25211 25558 gene locus_tag LOCUS_00250 25211 25558 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_00250 26322 25633 gene locus_tag LOCUS_00260 26322 25633 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_00260 27275 26364 gene locus_tag LOCUS_00270 27275 26364 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_00270 27582 27250 gene locus_tag LOCUS_00280 27582 27250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28638 27655 gene locus_tag LOCUS_00290 28638 27655 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942059.1 protein_id gnl|my_center|LOCUS_00290 29099 28635 gene locus_tag LOCUS_00300 29099 28635 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020220.1 protein_id gnl|my_center|LOCUS_00300 30663 29293 gene locus_tag LOCUS_00310 30663 29293 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_00310 31019 30693 gene locus_tag LOCUS_00320 31019 30693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 32082 31606 gene locus_tag LOCUS_00330 32082 31606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 33438 32140 gene locus_tag LOCUS_00340 gene thiC 33438 32140 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879899.1 protein_id gnl|my_center|LOCUS_00340 34617 33562 gene locus_tag LOCUS_00350 34617 33562 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878993.1 protein_id gnl|my_center|LOCUS_00350 35630 34641 gene locus_tag LOCUS_00360 gene ala 35630 34641 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_00360 36308 35730 gene locus_tag LOCUS_00370 36308 35730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36451 36379 gene locus_tag LOCUS_t00020 36451 36379 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 37690 36557 gene locus_tag LOCUS_00380 37690 36557 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878914.1 protein_id gnl|my_center|LOCUS_00380 38183 37707 gene locus_tag LOCUS_00390 38183 37707 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_00390 39411 38233 gene locus_tag LOCUS_00400 39411 38233 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_00400 40066 40653 gene locus_tag LOCUS_00410 40066 40653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879514.1 protein_id gnl|my_center|LOCUS_00410 40653 41507 gene locus_tag LOCUS_00420 40653 41507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879515.1 protein_id gnl|my_center|LOCUS_00420 41948 41661 gene locus_tag LOCUS_00430 gene eif1A 41948 41661 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_00430 42922 41960 gene locus_tag LOCUS_00440 42922 41960 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_00440 43071 43850 gene locus_tag LOCUS_00450 gene artA 43071 43850 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879538.1 protein_id gnl|my_center|LOCUS_00450 43863 44468 gene locus_tag LOCUS_00460 43863 44468 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879537.1 protein_id gnl|my_center|LOCUS_00460 44444 45055 gene locus_tag LOCUS_00470 gene pssA 44444 45055 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879536.1 protein_id gnl|my_center|LOCUS_00470 45042 45416 gene locus_tag LOCUS_00480 45042 45416 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319505.1 protein_id gnl|my_center|LOCUS_00480 45441 45992 gene locus_tag LOCUS_00490 45441 45992 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879280.1 protein_id gnl|my_center|LOCUS_00490 46817 45993 gene locus_tag LOCUS_00500 46817 45993 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_00500 46882 47265 gene locus_tag LOCUS_00510 gene eif5A 46882 47265 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878148.1 protein_id gnl|my_center|LOCUS_00510 47288 48103 gene locus_tag LOCUS_00520 gene speB 47288 48103 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878149.1 protein_id gnl|my_center|LOCUS_00520 50214 48352 gene locus_tag LOCUS_00530 gene pheA 50214 48352 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683139.1 protein_id gnl|my_center|LOCUS_00530 50842 50219 gene locus_tag LOCUS_00540 gene aroD 50842 50219 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877739.1 protein_id gnl|my_center|LOCUS_00540 51926 50910 gene locus_tag LOCUS_00550 51926 50910 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877740.1 protein_id gnl|my_center|LOCUS_00550 52683 51892 gene locus_tag LOCUS_00560 52683 51892 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064192.1 protein_id gnl|my_center|LOCUS_00560 53309 52968 gene locus_tag LOCUS_00570 53309 52968 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870667.1 protein_id gnl|my_center|LOCUS_00570 53959 53306 gene locus_tag LOCUS_00580 53959 53306 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591675.1 protein_id gnl|my_center|LOCUS_00580 55512 53962 gene locus_tag LOCUS_00590 55512 53962 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071676851.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00590 55909 55517 gene locus_tag LOCUS_00600 55909 55517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00600 57873 56110 gene locus_tag LOCUS_00610 57873 56110 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871102.1 protein_id gnl|my_center|LOCUS_00610 58439 57870 gene locus_tag LOCUS_00620 58439 57870 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871101.1 protein_id gnl|my_center|LOCUS_00620 59638 59555 gene locus_tag LOCUS_t00030 59638 59555 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 59798 61702 gene locus_tag LOCUS_00630 59798 61702 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879914.1 protein_id gnl|my_center|LOCUS_00630 62749 61694 gene locus_tag LOCUS_00640 62749 61694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 62866 63393 gene locus_tag LOCUS_00650 62866 63393 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878494.1 protein_id gnl|my_center|LOCUS_00650 65575 63371 gene locus_tag LOCUS_00660 65575 63371 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878161.1 protein_id gnl|my_center|LOCUS_00660 66378 65632 gene locus_tag LOCUS_00670 66378 65632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 67121 66384 gene locus_tag LOCUS_00680 67121 66384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 68271 67189 gene locus_tag LOCUS_00690 68271 67189 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902067.1 protein_id gnl|my_center|LOCUS_00690 69413 68448 gene locus_tag LOCUS_00700 69413 68448 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879293.1 protein_id gnl|my_center|LOCUS_00700 69640 70635 gene locus_tag LOCUS_00710 gene pstS 69640 70635 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250815.1 protein_id gnl|my_center|LOCUS_00710 70707 71633 gene locus_tag LOCUS_00720 gene pstC 70707 71633 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250817.1 protein_id gnl|my_center|LOCUS_00720 71623 72474 gene locus_tag LOCUS_00730 gene pstA 71623 72474 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868165.1 protein_id gnl|my_center|LOCUS_00730 72471 73280 gene locus_tag LOCUS_00740 72471 73280 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250819.1 protein_id gnl|my_center|LOCUS_00740 73308 73916 gene locus_tag LOCUS_00750 gene phoU 73308 73916 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878857.1 protein_id gnl|my_center|LOCUS_00750 73955 74710 gene locus_tag LOCUS_00760 73955 74710 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250523.1 protein_id gnl|my_center|LOCUS_00760 74779 77826 gene locus_tag LOCUS_00770 74779 77826 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979014.1 protein_id gnl|my_center|LOCUS_00770 77974 78255 gene locus_tag LOCUS_00780 gene gatC 77974 78255 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879817.1 protein_id gnl|my_center|LOCUS_00780 78261 79664 gene locus_tag LOCUS_00790 gene gatA 78261 79664 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879818.1 protein_id gnl|my_center|LOCUS_00790 80959 79688 gene locus_tag LOCUS_00800 80959 79688 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_00800 81675 81067 gene locus_tag LOCUS_00810 81675 81067 CDS product KaiC associated regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064643.1 protein_id gnl|my_center|LOCUS_00810 82069 82257 gene locus_tag LOCUS_00820 82069 82257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00820 82557 82748 gene locus_tag LOCUS_00830 82557 82748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 83303 82971 gene locus_tag LOCUS_00840 83303 82971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 83836 83321 gene locus_tag LOCUS_00850 83836 83321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 84748 84674 gene locus_tag LOCUS_t00040 84748 84674 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 84837 84763 gene locus_tag LOCUS_t00050 84837 84763 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 85585 84917 gene locus_tag LOCUS_00860 85585 84917 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879543.1 protein_id gnl|my_center|LOCUS_00860 86027 85629 gene locus_tag LOCUS_00870 86027 85629 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879542.1 protein_id gnl|my_center|LOCUS_00870 87310 86105 gene locus_tag LOCUS_00880 87310 86105 CDS product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879541.1 protein_id gnl|my_center|LOCUS_00880 88288 87341 gene locus_tag LOCUS_00890 88288 87341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 88507 88833 gene locus_tag LOCUS_00900 88507 88833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879839.1 protein_id gnl|my_center|LOCUS_00900 >Feature sequence02 345 1448 gene locus_tag LOCUS_00910 345 1448 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_00910 1493 2449 gene locus_tag LOCUS_00920 1493 2449 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879283.1 protein_id gnl|my_center|LOCUS_00920 2574 3128 gene locus_tag LOCUS_00930 2574 3128 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877880.1 protein_id gnl|my_center|LOCUS_00930 3265 3582 gene locus_tag LOCUS_00940 gene trxA 3265 3582 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879633.1 protein_id gnl|my_center|LOCUS_00940 3579 3947 gene locus_tag LOCUS_00950 3579 3947 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012964688.1 protein_id gnl|my_center|LOCUS_00950 4265 4020 gene locus_tag LOCUS_00960 4265 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 4882 4562 gene locus_tag LOCUS_00970 gene rpl12p 4882 4562 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878989.1 protein_id gnl|my_center|LOCUS_00970 5995 4982 gene locus_tag LOCUS_00980 5995 4982 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878988.1 protein_id gnl|my_center|LOCUS_00980 6648 6007 gene locus_tag LOCUS_00990 6648 6007 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_00990 6795 7178 gene locus_tag LOCUS_01000 6795 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 7339 8574 gene locus_tag LOCUS_01010 7339 8574 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879139.1 protein_id gnl|my_center|LOCUS_01010 8611 9774 gene locus_tag LOCUS_01020 8611 9774 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064561.1 protein_id gnl|my_center|LOCUS_01020 10123 9866 gene locus_tag LOCUS_01030 10123 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 12010 10136 gene locus_tag LOCUS_01040 12010 10136 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878055.1 protein_id gnl|my_center|LOCUS_01040 12115 12891 gene locus_tag LOCUS_01050 gene tatC 12115 12891 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879009.1 protein_id gnl|my_center|LOCUS_01050 13769 12915 gene locus_tag LOCUS_01060 13769 12915 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879427.1 protein_id gnl|my_center|LOCUS_01060 14860 13892 gene locus_tag LOCUS_01070 14860 13892 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429777.1 protein_id gnl|my_center|LOCUS_01070 15533 14832 gene locus_tag LOCUS_01080 15533 14832 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318675.1 protein_id gnl|my_center|LOCUS_01080 16152 15577 gene locus_tag LOCUS_01090 16152 15577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 16522 16157 gene locus_tag LOCUS_01100 16522 16157 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881204.1 protein_id gnl|my_center|LOCUS_01100 17681 16500 gene locus_tag LOCUS_01110 17681 16500 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060852.1 protein_id gnl|my_center|LOCUS_01110 18439 17678 gene locus_tag LOCUS_01120 18439 17678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 18484 19044 gene locus_tag LOCUS_01130 18484 19044 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270468.1 protein_id gnl|my_center|LOCUS_01130 19103 20983 gene locus_tag LOCUS_01140 gene iorA 19103 20983 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878986.1 protein_id gnl|my_center|LOCUS_01140 22012 21158 gene locus_tag LOCUS_01150 22012 21158 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274369.1 protein_id gnl|my_center|LOCUS_01150 22740 22009 gene locus_tag LOCUS_01160 22740 22009 CDS product phosphoglycerol geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877910.1 protein_id gnl|my_center|LOCUS_01160 23427 22888 gene locus_tag LOCUS_01170 23427 22888 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879790.1 protein_id gnl|my_center|LOCUS_01170 23662 23859 gene locus_tag LOCUS_01180 23662 23859 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064240.1 protein_id gnl|my_center|LOCUS_01180 23865 25043 gene locus_tag LOCUS_01190 23865 25043 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_01190 25078 25899 gene locus_tag LOCUS_01200 25078 25899 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878595.1 protein_id gnl|my_center|LOCUS_01200 25912 26499 gene locus_tag LOCUS_01210 25912 26499 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064673.1 protein_id gnl|my_center|LOCUS_01210 26808 28244 gene locus_tag LOCUS_01220 26808 28244 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878747.1 protein_id gnl|my_center|LOCUS_01220 28378 28450 gene locus_tag LOCUS_t00060 28378 28450 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 29994 28864 gene locus_tag LOCUS_01230 gene ftsZ 29994 28864 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878074.1 protein_id gnl|my_center|LOCUS_01230 30182 30009 gene locus_tag LOCUS_01240 30182 30009 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878073.1 protein_id gnl|my_center|LOCUS_01240 32877 30793 gene locus_tag LOCUS_01250 32877 30793 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878834.1 protein_id gnl|my_center|LOCUS_01250 33093 33168 gene locus_tag LOCUS_t00070 33093 33168 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 34007 33495 gene locus_tag LOCUS_01260 34007 33495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 34411 34172 gene locus_tag LOCUS_01270 34411 34172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 36033 35119 gene locus_tag LOCUS_01280 gene mptA 36033 35119 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878675.1 protein_id gnl|my_center|LOCUS_01280 36151 37179 gene locus_tag LOCUS_01290 36151 37179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877363.1 protein_id gnl|my_center|LOCUS_01290 37226 38647 gene locus_tag LOCUS_01300 37226 38647 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878238.1 protein_id gnl|my_center|LOCUS_01300 39964 38819 gene locus_tag LOCUS_01310 39964 38819 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878922.1 protein_id gnl|my_center|LOCUS_01310 40620 40060 gene locus_tag LOCUS_01320 40620 40060 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968145.1 protein_id gnl|my_center|LOCUS_01320 40891 41640 gene locus_tag LOCUS_01330 40891 41640 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877588.1 protein_id gnl|my_center|LOCUS_01330 41658 41828 gene locus_tag LOCUS_01340 41658 41828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 42824 41859 gene locus_tag LOCUS_01350 42824 41859 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_01350 43410 42955 gene locus_tag LOCUS_01360 gene dsrJ 43410 42955 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393111.1 protein_id gnl|my_center|LOCUS_01360 45056 43422 gene locus_tag LOCUS_01370 gene hmeD 45056 43422 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878009.1 protein_id gnl|my_center|LOCUS_01370 46010 45060 gene locus_tag LOCUS_01380 gene dsrM 46010 45060 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878008.1 protein_id gnl|my_center|LOCUS_01380 47173 46007 gene locus_tag LOCUS_01390 gene hmeB 47173 46007 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_01390 48003 47188 gene locus_tag LOCUS_01400 gene hmeA 48003 47188 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_01400 49658 48240 gene locus_tag LOCUS_01410 gene cobQ 49658 48240 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878835.1 protein_id gnl|my_center|LOCUS_01410 50252 49668 gene locus_tag LOCUS_01420 50252 49668 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878485.1 protein_id gnl|my_center|LOCUS_01420 50401 50940 gene locus_tag LOCUS_01430 50401 50940 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878350.1 protein_id gnl|my_center|LOCUS_01430 51108 51986 gene locus_tag LOCUS_01440 51108 51986 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013684142.1 protein_id gnl|my_center|LOCUS_01440 51988 53139 gene locus_tag LOCUS_01450 51988 53139 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878352.1 protein_id gnl|my_center|LOCUS_01450 53561 53190 gene locus_tag LOCUS_01460 53561 53190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 54339 53761 gene locus_tag LOCUS_01470 54339 53761 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879050.1 protein_id gnl|my_center|LOCUS_01470 54395 54892 gene locus_tag LOCUS_01480 54395 54892 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878520.1 protein_id gnl|my_center|LOCUS_01480 55665 54907 gene locus_tag LOCUS_01490 55665 54907 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_01490 55907 56380 gene locus_tag LOCUS_01500 55907 56380 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496545.1 protein_id gnl|my_center|LOCUS_01500 58160 56382 gene locus_tag LOCUS_01510 58160 56382 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064494.1 protein_id gnl|my_center|LOCUS_01510 58505 58182 gene locus_tag LOCUS_01520 gene hisI 58505 58182 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879442.1 protein_id gnl|my_center|LOCUS_01520 58564 59268 gene locus_tag LOCUS_01530 58564 59268 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878025.1 protein_id gnl|my_center|LOCUS_01530 59787 59344 gene locus_tag LOCUS_01540 59787 59344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 59912 60565 gene locus_tag LOCUS_01550 59912 60565 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878728.1 protein_id gnl|my_center|LOCUS_01550 60571 60984 gene locus_tag LOCUS_01560 60571 60984 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878729.1 protein_id gnl|my_center|LOCUS_01560 60992 61279 gene locus_tag LOCUS_01570 60992 61279 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878730.1 protein_id gnl|my_center|LOCUS_01570 61350 61808 gene locus_tag LOCUS_01580 61350 61808 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878304.1 protein_id gnl|my_center|LOCUS_01580 62007 62081 gene locus_tag LOCUS_t00080 62007 62081 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 62166 63137 gene locus_tag LOCUS_01590 62166 63137 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879092.1 protein_id gnl|my_center|LOCUS_01590 64255 63143 gene locus_tag LOCUS_01600 64255 63143 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879390.1 protein_id gnl|my_center|LOCUS_01600 65368 64292 gene locus_tag LOCUS_01610 65368 64292 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_01610 65517 66506 gene locus_tag LOCUS_01620 65517 66506 CDS product NOL1/NOP2/sun family putative RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878356.1 protein_id gnl|my_center|LOCUS_01620 >Feature sequence03 1459 1148 gene locus_tag LOCUS_01630 1459 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 3184 2318 gene locus_tag LOCUS_01640 gene ilvE 3184 2318 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_01640 3342 4253 gene locus_tag LOCUS_01650 3342 4253 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_01650 5670 4369 gene locus_tag LOCUS_01660 5670 4369 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_01660 6943 5831 gene locus_tag LOCUS_01670 6943 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 7214 8173 gene locus_tag LOCUS_01680 7214 8173 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868292.1 protein_id gnl|my_center|LOCUS_01680 8331 9332 gene locus_tag LOCUS_01690 gene rfbB 8331 9332 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868293.1 protein_id gnl|my_center|LOCUS_01690 9354 10238 gene locus_tag LOCUS_01700 9354 10238 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_01700 10355 10852 gene locus_tag LOCUS_01710 10355 10852 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877830.1 protein_id gnl|my_center|LOCUS_01710 11069 10998 gene locus_tag LOCUS_t00090 11069 10998 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11196 12212 gene locus_tag LOCUS_01720 gene wtpA 11196 12212 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013684400.1 protein_id gnl|my_center|LOCUS_01720 12218 13030 gene locus_tag LOCUS_01730 gene wtpB 12218 13030 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877607.1 protein_id gnl|my_center|LOCUS_01730 13131 13460 gene locus_tag LOCUS_01740 13131 13460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 13742 13467 gene locus_tag LOCUS_01750 gene albA 13742 13467 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_01750 14457 13873 gene locus_tag LOCUS_01760 14457 13873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 15389 14469 gene locus_tag LOCUS_01770 15389 14469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 15439 15852 gene locus_tag LOCUS_01780 15439 15852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 16459 15815 gene locus_tag LOCUS_01790 16459 15815 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879472.1 protein_id gnl|my_center|LOCUS_01790 16838 16650 gene locus_tag LOCUS_01800 16838 16650 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877934.1 protein_id gnl|my_center|LOCUS_01800 17172 16933 gene locus_tag LOCUS_01810 17172 16933 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877932.1 protein_id gnl|my_center|LOCUS_01810 18324 17215 gene locus_tag LOCUS_01820 gene dsrB 18324 17215 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064231.1 protein_id gnl|my_center|LOCUS_01820 19621 18326 gene locus_tag LOCUS_01830 gene dsrA 19621 18326 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877930.1 protein_id gnl|my_center|LOCUS_01830 19838 20575 gene locus_tag LOCUS_01840 gene cobA 19838 20575 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877929.1 protein_id gnl|my_center|LOCUS_01840 21137 20619 gene locus_tag LOCUS_01850 21137 20619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 22108 21134 gene locus_tag LOCUS_01860 22108 21134 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878892.1 protein_id gnl|my_center|LOCUS_01860 22304 22633 gene locus_tag LOCUS_01870 22304 22633 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877726.1 protein_id gnl|my_center|LOCUS_01870 22650 23396 gene locus_tag LOCUS_01880 22650 23396 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877727.1 protein_id gnl|my_center|LOCUS_01880 24300 23479 gene locus_tag LOCUS_01890 24300 23479 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878399.1 protein_id gnl|my_center|LOCUS_01890 24916 24356 gene locus_tag LOCUS_01900 24916 24356 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878604.1 protein_id gnl|my_center|LOCUS_01900 25253 24891 gene locus_tag LOCUS_01910 25253 24891 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878605.1 protein_id gnl|my_center|LOCUS_01910 25864 25304 gene locus_tag LOCUS_01920 25864 25304 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878606.1 protein_id gnl|my_center|LOCUS_01920 27390 25963 gene locus_tag LOCUS_01930 27390 25963 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_01930 28284 27598 gene locus_tag LOCUS_01940 28284 27598 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878876.1 protein_id gnl|my_center|LOCUS_01940 29387 28281 gene locus_tag LOCUS_01950 29387 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 29741 29547 gene locus_tag LOCUS_01960 29741 29547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 30372 30445 gene locus_tag LOCUS_t00100 30372 30445 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 30549 31226 gene locus_tag LOCUS_01970 gene psmB 30549 31226 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 protein_id gnl|my_center|LOCUS_01970 31282 33186 gene locus_tag LOCUS_01980 31282 33186 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546184.1 protein_id gnl|my_center|LOCUS_01980 33226 33663 gene locus_tag LOCUS_01990 33226 33663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01990 33727 33801 gene locus_tag LOCUS_t00110 33727 33801 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 34591 34115 gene locus_tag LOCUS_02000 34591 34115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 34665 35144 gene locus_tag LOCUS_02010 gene hjc 34665 35144 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879457.1 protein_id gnl|my_center|LOCUS_02010 35638 35204 gene locus_tag LOCUS_02020 35638 35204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 36534 35728 gene locus_tag LOCUS_02030 36534 35728 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064505.1 protein_id gnl|my_center|LOCUS_02030 37354 36551 gene locus_tag LOCUS_02040 37354 36551 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879474.1 protein_id gnl|my_center|LOCUS_02040 38334 37369 gene locus_tag LOCUS_02050 38334 37369 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064506.1 protein_id gnl|my_center|LOCUS_02050 38400 39338 gene locus_tag LOCUS_02060 38400 39338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 39296 40192 gene locus_tag LOCUS_02070 39296 40192 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879191.1 protein_id gnl|my_center|LOCUS_02070 40301 40768 gene locus_tag LOCUS_02080 40301 40768 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_02080 41828 40746 gene locus_tag LOCUS_02090 41828 40746 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274451.1 protein_id gnl|my_center|LOCUS_02090 43105 41951 gene locus_tag LOCUS_02100 43105 41951 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250179.1 protein_id gnl|my_center|LOCUS_02100 43282 43863 gene locus_tag LOCUS_02110 43282 43863 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867585.1 protein_id gnl|my_center|LOCUS_02110 44021 44659 gene locus_tag LOCUS_02120 44021 44659 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867584.1 protein_id gnl|my_center|LOCUS_02120 44719 45879 gene locus_tag LOCUS_02130 gene trpB 44719 45879 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867583.1 protein_id gnl|my_center|LOCUS_02130 45892 46680 gene locus_tag LOCUS_02140 gene trpA 45892 46680 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867582.1 protein_id gnl|my_center|LOCUS_02140 46839 50078 gene locus_tag LOCUS_02150 gene rgy 46839 50078 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878524.1 protein_id gnl|my_center|LOCUS_02150 51932 50241 gene locus_tag LOCUS_02160 gene gltX 51932 50241 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868499.1 protein_id gnl|my_center|LOCUS_02160 52343 52726 gene locus_tag LOCUS_02170 52343 52726 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275600.1 protein_id gnl|my_center|LOCUS_02170 52737 52955 gene locus_tag LOCUS_02180 52737 52955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 52969 53619 gene locus_tag LOCUS_02190 gene trmY 52969 53619 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064324.1 protein_id gnl|my_center|LOCUS_02190 53807 54298 gene locus_tag LOCUS_02200 53807 54298 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879119.1 protein_id gnl|my_center|LOCUS_02200 54406 55560 gene locus_tag LOCUS_02210 54406 55560 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879120.1 protein_id gnl|my_center|LOCUS_02210 56971 55601 gene locus_tag LOCUS_02220 56971 55601 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096703.1 protein_id gnl|my_center|LOCUS_02220 57030 57953 gene locus_tag LOCUS_02230 gene nadA 57030 57953 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877429.1 protein_id gnl|my_center|LOCUS_02230 58050 58859 gene locus_tag LOCUS_02240 58050 58859 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_02240 58856 59716 gene locus_tag LOCUS_02250 gene nadC 58856 59716 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319001.1 protein_id gnl|my_center|LOCUS_02250 59765 62422 gene locus_tag LOCUS_02260 gene valS 59765 62422 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879713.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence04 84 563 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgccgttctccttatgagattc 1420 869 gene locus_tag LOCUS_02270 gene cas4 1420 869 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879370.1 protein_id gnl|my_center|LOCUS_02270 1673 1398 gene locus_tag LOCUS_02280 gene cas2 1673 1398 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846845.1 protein_id gnl|my_center|LOCUS_02280 1884 1675 gene locus_tag LOCUS_02290 1884 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 2381 1932 gene locus_tag LOCUS_02300 2381 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 3261 2365 gene locus_tag LOCUS_02310 gene cas4a 3261 2365 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980726.1 protein_id gnl|my_center|LOCUS_02310 3389 4036 gene locus_tag LOCUS_02320 3389 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4036 6462 gene locus_tag LOCUS_02330 4036 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 6470 6958 gene locus_tag LOCUS_02340 6470 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 6959 7762 gene locus_tag LOCUS_02350 gene csm3 6959 7762 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545354.1 protein_id gnl|my_center|LOCUS_02350 7759 8640 gene locus_tag LOCUS_02360 gene csm4 7759 8640 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021930.1 protein_id gnl|my_center|LOCUS_02360 8637 9698 gene locus_tag LOCUS_02370 gene csm5 8637 9698 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 protein_id gnl|my_center|LOCUS_02370 9682 10476 gene locus_tag LOCUS_02380 9682 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 10570 11076 gene locus_tag LOCUS_02390 10570 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 11070 11834 gene locus_tag LOCUS_02400 11070 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 13021 11888 gene locus_tag LOCUS_02410 13021 11888 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878523.1 protein_id gnl|my_center|LOCUS_02410 13071 13595 gene locus_tag LOCUS_02420 13071 13595 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878317.1 protein_id gnl|my_center|LOCUS_02420 13617 14669 gene locus_tag LOCUS_02430 13617 14669 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878318.1 protein_id gnl|my_center|LOCUS_02430 15485 14970 gene locus_tag LOCUS_02440 15485 14970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 16660 15776 gene locus_tag LOCUS_02450 gene thiL 16660 15776 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064276.1 protein_id gnl|my_center|LOCUS_02450 17321 16665 gene locus_tag LOCUS_02460 gene nep1 17321 16665 CDS product 16S rRNA (pseudouridine-N1-)-methyltransferase Nep1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878237.1 protein_id gnl|my_center|LOCUS_02460 17435 18232 gene locus_tag LOCUS_02470 gene surE 17435 18232 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 protein_id gnl|my_center|LOCUS_02470 18315 19130 gene locus_tag LOCUS_02480 18315 19130 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878034.1 protein_id gnl|my_center|LOCUS_02480 19184 19366 gene locus_tag LOCUS_02490 19184 19366 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878033.1 protein_id gnl|my_center|LOCUS_02490 19513 20292 gene locus_tag LOCUS_02500 19513 20292 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_02500 21469 20387 gene locus_tag LOCUS_02510 21469 20387 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320294.1 protein_id gnl|my_center|LOCUS_02510 22763 21540 gene locus_tag LOCUS_02520 22763 21540 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868147.1 protein_id gnl|my_center|LOCUS_02520 23246 22779 gene locus_tag LOCUS_02530 23246 22779 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064503.1 protein_id gnl|my_center|LOCUS_02530 23404 24687 gene locus_tag LOCUS_02540 gene pan 23404 24687 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_02540 25667 24768 gene locus_tag LOCUS_02550 gene trxB 25667 24768 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879051.1 protein_id gnl|my_center|LOCUS_02550 25798 26196 gene locus_tag LOCUS_02560 25798 26196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 26225 28087 gene locus_tag LOCUS_02570 26225 28087 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 protein_id gnl|my_center|LOCUS_02570 28068 28661 gene locus_tag LOCUS_02580 28068 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 28800 28648 gene locus_tag LOCUS_02590 28800 28648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 28918 29724 gene locus_tag LOCUS_02600 28918 29724 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879481.1 protein_id gnl|my_center|LOCUS_02600 31148 29748 gene locus_tag LOCUS_02610 31148 29748 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878157.1 protein_id gnl|my_center|LOCUS_02610 31263 32006 gene locus_tag LOCUS_02620 gene larB 31263 32006 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878770.1 protein_id gnl|my_center|LOCUS_02620 32922 32323 gene locus_tag LOCUS_02630 32922 32323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881155.1 protein_id gnl|my_center|LOCUS_02630 33048 33797 gene locus_tag LOCUS_02640 33048 33797 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879261.1 protein_id gnl|my_center|LOCUS_02640 33802 34308 gene locus_tag LOCUS_02650 33802 34308 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_02650 34624 35430 gene locus_tag LOCUS_02660 34624 35430 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868065.1 protein_id gnl|my_center|LOCUS_02660 35765 35682 gene locus_tag LOCUS_t00120 35765 35682 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 36632 35817 gene locus_tag LOCUS_02670 36632 35817 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064160.1 protein_id gnl|my_center|LOCUS_02670 36824 37966 gene locus_tag LOCUS_02680 gene pscS 36824 37966 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877542.1 protein_id gnl|my_center|LOCUS_02680 38073 38540 gene locus_tag LOCUS_02690 38073 38540 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879145.1 protein_id gnl|my_center|LOCUS_02690 38660 39844 gene locus_tag LOCUS_02700 38660 39844 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590401.1 protein_id gnl|my_center|LOCUS_02700 39853 40170 gene locus_tag LOCUS_02710 39853 40170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 40399 41271 gene locus_tag LOCUS_02720 40399 41271 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_02720 43222 41285 gene locus_tag LOCUS_02730 gene rqcH 43222 41285 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879530.1 protein_id gnl|my_center|LOCUS_02730 44532 43249 gene locus_tag LOCUS_02740 gene lysA 44532 43249 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878303.1 protein_id gnl|my_center|LOCUS_02740 45807 44608 gene locus_tag LOCUS_02750 45807 44608 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877916.1 protein_id gnl|my_center|LOCUS_02750 46999 45857 gene locus_tag LOCUS_02760 46999 45857 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878837.1 protein_id gnl|my_center|LOCUS_02760 48534 47017 gene locus_tag LOCUS_02770 48534 47017 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878838.1 protein_id gnl|my_center|LOCUS_02770 50073 48649 gene locus_tag LOCUS_02780 gene cysS 50073 48649 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877918.1 protein_id gnl|my_center|LOCUS_02780 52938 50137 gene locus_tag LOCUS_02790 52938 50137 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878645.1 protein_id gnl|my_center|LOCUS_02790 53158 55020 gene locus_tag LOCUS_02800 53158 55020 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878208.1 protein_id gnl|my_center|LOCUS_02800 55022 55831 gene locus_tag LOCUS_02810 55022 55831 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877926.1 protein_id gnl|my_center|LOCUS_02810 56493 56422 gene locus_tag LOCUS_t00130 56493 56422 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 56567 57544 gene locus_tag LOCUS_02820 56567 57544 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878353.1 protein_id gnl|my_center|LOCUS_02820 57619 58269 gene locus_tag LOCUS_02830 57619 58269 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_02830 58932 58366 gene locus_tag LOCUS_02840 58932 58366 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878945.1 protein_id gnl|my_center|LOCUS_02840 60363 59242 gene locus_tag LOCUS_02850 60363 59242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 >Feature sequence05 <1 811 gene locus_tag LOCUS_02860 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143274480.1:RsmB/NOP family class I SAM-dependent RNA methyltransferase 1579 857 gene locus_tag LOCUS_02870 1579 857 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 protein_id gnl|my_center|LOCUS_02870 1844 1581 gene locus_tag LOCUS_02880 1844 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 2172 1876 gene locus_tag LOCUS_02890 2172 1876 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878075.1 protein_id gnl|my_center|LOCUS_02890 2241 3080 gene locus_tag LOCUS_02900 2241 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 3281 5542 gene locus_tag LOCUS_02910 gene ppsA 3281 5542 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_02910 5700 7319 gene locus_tag LOCUS_02920 5700 7319 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877754.1 protein_id gnl|my_center|LOCUS_02920 8990 7365 gene locus_tag LOCUS_02930 8990 7365 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064497.1 protein_id gnl|my_center|LOCUS_02930 9054 9731 gene locus_tag LOCUS_02940 9054 9731 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879673.1 protein_id gnl|my_center|LOCUS_02940 9949 9713 gene locus_tag LOCUS_02950 9949 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 10439 9969 gene locus_tag LOCUS_02960 10439 9969 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878419.1 protein_id gnl|my_center|LOCUS_02960 10533 10606 gene locus_tag LOCUS_t00140 10533 10606 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 10727 10933 gene locus_tag LOCUS_02970 10727 10933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 10956 11240 gene locus_tag LOCUS_02980 10956 11240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 12361 11741 gene locus_tag LOCUS_02990 12361 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 13592 12354 gene locus_tag LOCUS_03000 13592 12354 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320500.1 protein_id gnl|my_center|LOCUS_03000 14244 13606 gene locus_tag LOCUS_03010 14244 13606 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878665.1 protein_id gnl|my_center|LOCUS_03010 14970 15230 gene locus_tag LOCUS_03020 14970 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 16046 15381 gene locus_tag LOCUS_03030 16046 15381 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879183.1 protein_id gnl|my_center|LOCUS_03030 16996 16043 gene locus_tag LOCUS_03040 16996 16043 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879181.1 protein_id gnl|my_center|LOCUS_03040 17901 16972 gene locus_tag LOCUS_03050 gene endA 17901 16972 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156029509.1 protein_id gnl|my_center|LOCUS_03050 19123 17975 gene locus_tag LOCUS_03060 19123 17975 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878941.1 protein_id gnl|my_center|LOCUS_03060 20484 19120 gene locus_tag LOCUS_03070 20484 19120 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064393.1 protein_id gnl|my_center|LOCUS_03070 21473 20490 gene locus_tag LOCUS_03080 gene mer 21473 20490 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_03080 21619 22050 gene locus_tag LOCUS_03090 21619 22050 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878992.1 protein_id gnl|my_center|LOCUS_03090 23010 22105 gene locus_tag LOCUS_03100 gene hisG 23010 22105 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682994.1 protein_id gnl|my_center|LOCUS_03100 24066 23239 gene locus_tag LOCUS_03110 24066 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 24247 24789 gene locus_tag LOCUS_03120 24247 24789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 24808 27402 gene locus_tag LOCUS_03130 24808 27402 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_03130 27961 28947 gene locus_tag LOCUS_03140 gene cofG 27961 28947 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878300.1 protein_id gnl|my_center|LOCUS_03140 28940 30052 gene locus_tag LOCUS_03150 gene cofH 28940 30052 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878301.1 protein_id gnl|my_center|LOCUS_03150 30279 30728 gene locus_tag LOCUS_03160 30279 30728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03160 30803 30922 gene locus_tag LOCUS_03170 30803 30922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 31684 30971 gene locus_tag LOCUS_03180 31684 30971 CDS product DUF432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879042.1 protein_id gnl|my_center|LOCUS_03180 31844 32356 gene locus_tag LOCUS_03190 31844 32356 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879312.1 protein_id gnl|my_center|LOCUS_03190 32876 32460 gene locus_tag LOCUS_03200 32876 32460 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879219.1 protein_id gnl|my_center|LOCUS_03200 32977 33621 gene locus_tag LOCUS_03210 32977 33621 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545081.1 protein_id gnl|my_center|LOCUS_03210 33817 34389 gene locus_tag LOCUS_03220 33817 34389 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878334.1 protein_id gnl|my_center|LOCUS_03220 34457 34792 gene locus_tag LOCUS_03230 34457 34792 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081116.1 protein_id gnl|my_center|LOCUS_03230 34862 36034 gene locus_tag LOCUS_03240 34862 36034 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_03240 36123 36386 gene locus_tag LOCUS_03250 36123 36386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879719.1 protein_id gnl|my_center|LOCUS_03250 36803 36465 gene locus_tag LOCUS_03260 36803 36465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 36983 37204 gene locus_tag LOCUS_03270 36983 37204 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053680.1 protein_id gnl|my_center|LOCUS_03270 37207 37911 gene locus_tag LOCUS_03280 37207 37911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03280 37890 39158 gene locus_tag LOCUS_03290 37890 39158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03290 39168 39569 gene locus_tag LOCUS_03300 39168 39569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 40672 39614 gene locus_tag LOCUS_03310 40672 39614 CDS product TIGR04084 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878081.1 protein_id gnl|my_center|LOCUS_03310 41490 40708 gene locus_tag LOCUS_03320 41490 40708 CDS product RNA-processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064527.1 protein_id gnl|my_center|LOCUS_03320 42443 41487 gene locus_tag LOCUS_03330 42443 41487 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879581.1 protein_id gnl|my_center|LOCUS_03330 43805 42639 gene locus_tag LOCUS_03340 43805 42639 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965679.1 protein_id gnl|my_center|LOCUS_03340 44112 45098 gene locus_tag LOCUS_03350 gene dph2 44112 45098 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879298.1 protein_id gnl|my_center|LOCUS_03350 45111 46322 gene locus_tag LOCUS_03360 45111 46322 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064350.1 protein_id gnl|my_center|LOCUS_03360 46354 47652 gene locus_tag LOCUS_03370 46354 47652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 47727 48563 gene locus_tag LOCUS_03380 gene hisF 47727 48563 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878322.1 protein_id gnl|my_center|LOCUS_03380 48630 48920 gene locus_tag LOCUS_03390 48630 48920 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878323.1 protein_id gnl|my_center|LOCUS_03390 48933 50123 gene locus_tag LOCUS_03400 48933 50123 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878324.1 protein_id gnl|my_center|LOCUS_03400 50571 50191 gene locus_tag LOCUS_03410 50571 50191 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208718.1 protein_id gnl|my_center|LOCUS_03410 50620 51516 gene locus_tag LOCUS_03420 50620 51516 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878248.1 protein_id gnl|my_center|LOCUS_03420 51565 52281 gene locus_tag LOCUS_03430 51565 52281 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878035.1 protein_id gnl|my_center|LOCUS_03430 53593 52382 gene locus_tag LOCUS_03440 53593 52382 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064652.1 protein_id gnl|my_center|LOCUS_03440 53895 54227 gene locus_tag LOCUS_03450 53895 54227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence06 199 441 gene locus_tag LOCUS_03460 199 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 695 979 gene locus_tag LOCUS_03470 695 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877792.1 protein_id gnl|my_center|LOCUS_03470 1689 994 gene locus_tag LOCUS_03480 1689 994 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878760.1 protein_id gnl|my_center|LOCUS_03480 2136 2600 gene locus_tag LOCUS_03490 2136 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 3857 2676 gene locus_tag LOCUS_03500 3857 2676 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879741.1 protein_id gnl|my_center|LOCUS_03500 4751 3999 gene locus_tag LOCUS_03510 gene dph5 4751 3999 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877888.1 protein_id gnl|my_center|LOCUS_03510 5593 4799 gene locus_tag LOCUS_03520 gene tatC 5593 4799 CDS product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023410.1 protein_id gnl|my_center|LOCUS_03520 5806 6351 gene locus_tag LOCUS_03530 5806 6351 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879195.1 protein_id gnl|my_center|LOCUS_03530 6388 6696 gene locus_tag LOCUS_03540 6388 6696 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879196.1 protein_id gnl|my_center|LOCUS_03540 6702 7877 gene locus_tag LOCUS_03550 6702 7877 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879197.1 protein_id gnl|my_center|LOCUS_03550 7874 8746 gene locus_tag LOCUS_03560 7874 8746 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879198.1 protein_id gnl|my_center|LOCUS_03560 10037 8814 gene locus_tag LOCUS_03570 10037 8814 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878039.1 protein_id gnl|my_center|LOCUS_03570 10307 11758 gene locus_tag LOCUS_03580 gene glnA 10307 11758 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318802.1 protein_id gnl|my_center|LOCUS_03580 12024 12488 gene locus_tag LOCUS_03590 12024 12488 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879318.1 protein_id gnl|my_center|LOCUS_03590 12485 12793 gene locus_tag LOCUS_03600 12485 12793 CDS product F420H(2):quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064470.1 protein_id gnl|my_center|LOCUS_03600 12790 14244 gene locus_tag LOCUS_03610 12790 14244 CDS product complex I subunit 5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879320.1 protein_id gnl|my_center|LOCUS_03610 14241 16148 gene locus_tag LOCUS_03620 14241 16148 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879321.1 protein_id gnl|my_center|LOCUS_03620 16148 17386 gene locus_tag LOCUS_03630 16148 17386 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064736.1 protein_id gnl|my_center|LOCUS_03630 17388 17762 gene locus_tag LOCUS_03640 17388 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 17768 18853 gene locus_tag LOCUS_03650 gene nuoB 17768 18853 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064471.1 protein_id gnl|my_center|LOCUS_03650 18880 20163 gene locus_tag LOCUS_03660 18880 20163 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064737.1 protein_id gnl|my_center|LOCUS_03660 20175 21329 gene locus_tag LOCUS_03670 gene nuoH 20175 21329 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591312.1 protein_id gnl|my_center|LOCUS_03670 21329 21865 gene locus_tag LOCUS_03680 21329 21865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 21987 22190 gene locus_tag LOCUS_03690 21987 22190 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318485.1 protein_id gnl|my_center|LOCUS_03690 22938 22276 gene locus_tag LOCUS_03700 22938 22276 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879579.1 protein_id gnl|my_center|LOCUS_03700 24255 22978 gene locus_tag LOCUS_03710 24255 22978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 24941 24252 gene locus_tag LOCUS_03720 24941 24252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 25220 25924 gene locus_tag LOCUS_03730 25220 25924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 26145 26342 gene locus_tag LOCUS_03740 26145 26342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 26982 26815 gene locus_tag LOCUS_03750 26982 26815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 27122 27475 gene locus_tag LOCUS_03760 27122 27475 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879692.1 protein_id gnl|my_center|LOCUS_03760 27472 28260 gene locus_tag LOCUS_03770 27472 28260 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879691.1 protein_id gnl|my_center|LOCUS_03770 28466 28394 gene locus_tag LOCUS_t00150 28466 28394 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 29062 28508 gene locus_tag LOCUS_03780 29062 28508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 30202 29123 gene locus_tag LOCUS_03790 30202 29123 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_03790 32000 30291 gene locus_tag LOCUS_03800 32000 30291 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023586.1 protein_id gnl|my_center|LOCUS_03800 33558 32065 gene locus_tag LOCUS_03810 33558 32065 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877731.1 protein_id gnl|my_center|LOCUS_03810 33606 34079 gene locus_tag LOCUS_03820 gene nob1 33606 34079 CDS product type II toxin-antitoxin system toxin endoribonuclease Nob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877892.1 protein_id gnl|my_center|LOCUS_03820 34066 34653 gene locus_tag LOCUS_03830 34066 34653 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877893.1 protein_id gnl|my_center|LOCUS_03830 34724 35653 gene locus_tag LOCUS_03840 gene aglJ 34724 35653 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877894.1 protein_id gnl|my_center|LOCUS_03840 35658 36701 gene locus_tag LOCUS_03850 35658 36701 CDS product CofH family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064223.1 protein_id gnl|my_center|LOCUS_03850 36865 37767 gene locus_tag LOCUS_03860 36865 37767 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879048.1 protein_id gnl|my_center|LOCUS_03860 37807 38217 gene locus_tag LOCUS_03870 37807 38217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 38269 38526 gene locus_tag LOCUS_03880 38269 38526 CDS product septation protein SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879274.1 protein_id gnl|my_center|LOCUS_03880 38817 39353 gene locus_tag LOCUS_03890 38817 39353 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878302.1 protein_id gnl|my_center|LOCUS_03890 39439 40452 gene locus_tag LOCUS_03900 39439 40452 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878344.1 protein_id gnl|my_center|LOCUS_03900 40653 42371 gene locus_tag LOCUS_03910 40653 42371 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879889.1 protein_id gnl|my_center|LOCUS_03910 42452 43042 gene locus_tag LOCUS_03920 42452 43042 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878134.1 protein_id gnl|my_center|LOCUS_03920 43170 43568 gene locus_tag LOCUS_03930 43170 43568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877573.1 protein_id gnl|my_center|LOCUS_03930 43620 44156 gene locus_tag LOCUS_03940 43620 44156 CDS product PUA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877572.1 protein_id gnl|my_center|LOCUS_03940 44186 45382 gene locus_tag LOCUS_03950 gene serB 44186 45382 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064533.1 protein_id gnl|my_center|LOCUS_03950 46705 45395 gene locus_tag LOCUS_03960 46705 45395 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879505.1 protein_id gnl|my_center|LOCUS_03960 47776 46982 gene locus_tag LOCUS_03970 47776 46982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065320.1 protein_id gnl|my_center|LOCUS_03970 48288 47770 gene locus_tag LOCUS_03980 48288 47770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03980 48808 48335 gene locus_tag LOCUS_03990 48808 48335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 49944 48808 gene locus_tag LOCUS_04000 49944 48808 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022139.1 protein_id gnl|my_center|LOCUS_04000 50682 49948 gene locus_tag LOCUS_04010 50682 49948 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022138.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence07 1552 878 gene locus_tag LOCUS_04020 1552 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 3061 1625 gene locus_tag LOCUS_04030 gene pyk 3061 1625 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868526.1 protein_id gnl|my_center|LOCUS_04030 3282 3695 gene locus_tag LOCUS_04040 3282 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064297.1 protein_id gnl|my_center|LOCUS_04040 3708 4679 gene locus_tag LOCUS_04050 3708 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 4761 4835 gene locus_tag LOCUS_t00160 4761 4835 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4845 5177 gene locus_tag LOCUS_04060 4845 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 5273 5890 gene locus_tag LOCUS_04070 5273 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318956.1 protein_id gnl|my_center|LOCUS_04070 5953 6423 gene locus_tag LOCUS_04080 5953 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 6839 6435 gene locus_tag LOCUS_04090 6839 6435 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393157.1 protein_id gnl|my_center|LOCUS_04090 7187 6909 gene locus_tag LOCUS_04100 7187 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 7756 7199 gene locus_tag LOCUS_04110 7756 7199 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878719.1 protein_id gnl|my_center|LOCUS_04110 8846 7758 gene locus_tag LOCUS_04120 8846 7758 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_04120 10305 8902 gene locus_tag LOCUS_04130 10305 8902 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878676.1 protein_id gnl|my_center|LOCUS_04130 10913 10410 gene locus_tag LOCUS_04140 10913 10410 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878749.1 protein_id gnl|my_center|LOCUS_04140 12178 11063 gene locus_tag LOCUS_04150 gene fbp 12178 11063 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878939.1 protein_id gnl|my_center|LOCUS_04150 12336 13082 gene locus_tag LOCUS_04160 12336 13082 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_04160 13268 14095 gene locus_tag LOCUS_04170 gene modA 13268 14095 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_04170 14271 16559 gene locus_tag LOCUS_04180 gene purL 14271 16559 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879433.1 protein_id gnl|my_center|LOCUS_04180 16641 17390 gene locus_tag LOCUS_04190 16641 17390 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_04190 17573 18760 gene locus_tag LOCUS_04200 17573 18760 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879532.1 protein_id gnl|my_center|LOCUS_04200 19175 19029 gene locus_tag LOCUS_04210 19175 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 19906 19187 gene locus_tag LOCUS_04220 19906 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 20961 20302 gene locus_tag LOCUS_04230 20961 20302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878503.1 protein_id gnl|my_center|LOCUS_04230 21047 21886 gene locus_tag LOCUS_04240 21047 21886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 21892 23085 gene locus_tag LOCUS_04250 gene priL 21892 23085 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877843.1 protein_id gnl|my_center|LOCUS_04250 23203 23343 gene locus_tag LOCUS_04260 23203 23343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 24769 23378 gene locus_tag LOCUS_04270 24769 23378 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877864.1 protein_id gnl|my_center|LOCUS_04270 26130 24778 gene locus_tag LOCUS_04280 26130 24778 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064221.1 protein_id gnl|my_center|LOCUS_04280 26246 26587 gene locus_tag LOCUS_04290 26246 26587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 26675 27157 gene locus_tag LOCUS_04300 26675 27157 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878644.1 protein_id gnl|my_center|LOCUS_04300 27973 27185 gene locus_tag LOCUS_04310 27973 27185 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877881.1 protein_id gnl|my_center|LOCUS_04310 28054 29703 gene locus_tag LOCUS_04320 28054 29703 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878120.1 protein_id gnl|my_center|LOCUS_04320 31182 29725 gene locus_tag LOCUS_04330 gene argH 31182 29725 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878383.1 protein_id gnl|my_center|LOCUS_04330 32228 31224 gene locus_tag LOCUS_04340 32228 31224 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761887.1 protein_id gnl|my_center|LOCUS_04340 32626 32240 gene locus_tag LOCUS_04350 32626 32240 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879641.1 protein_id gnl|my_center|LOCUS_04350 33962 32691 gene locus_tag LOCUS_04360 gene hisS 33962 32691 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879138.1 protein_id gnl|my_center|LOCUS_04360 34045 34872 gene locus_tag LOCUS_04370 34045 34872 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064238.1 protein_id gnl|my_center|LOCUS_04370 36374 34917 gene locus_tag LOCUS_04380 36374 34917 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879521.1 protein_id gnl|my_center|LOCUS_04380 36426 36701 gene locus_tag LOCUS_04390 36426 36701 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878163.1 protein_id gnl|my_center|LOCUS_04390 36844 37170 gene locus_tag LOCUS_04400 36844 37170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 37549 37097 gene locus_tag LOCUS_04410 37549 37097 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319580.1 protein_id gnl|my_center|LOCUS_04410 38130 39038 gene locus_tag LOCUS_04420 gene rnz 38130 39038 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878439.1 protein_id gnl|my_center|LOCUS_04420 39281 40423 gene locus_tag LOCUS_04430 39281 40423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 40425 41039 gene locus_tag LOCUS_04440 40425 41039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879076.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence08 217 2505 gene locus_tag LOCUS_04450 gene hdrA2 217 2505 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878733.1 protein_id gnl|my_center|LOCUS_04450 2560 3834 gene locus_tag LOCUS_04460 2560 3834 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879140.1 protein_id gnl|my_center|LOCUS_04460 3839 4978 gene locus_tag LOCUS_04470 gene coaBC 3839 4978 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274444.1 protein_id gnl|my_center|LOCUS_04470 5851 4985 gene locus_tag LOCUS_04480 gene dapA 5851 4985 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878410.1 protein_id gnl|my_center|LOCUS_04480 6041 5844 gene locus_tag LOCUS_04490 6041 5844 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878411.1 protein_id gnl|my_center|LOCUS_04490 6185 6514 gene locus_tag LOCUS_04500 6185 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6417 7412 gene locus_tag LOCUS_04510 6417 7412 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_04510 7679 7461 gene locus_tag LOCUS_04520 7679 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 7810 8028 gene locus_tag LOCUS_04530 7810 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 8074 8457 gene locus_tag LOCUS_04540 8074 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 8504 9250 gene locus_tag LOCUS_04550 8504 9250 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879697.1 protein_id gnl|my_center|LOCUS_04550 10549 9275 gene locus_tag LOCUS_04560 10549 9275 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878404.1 protein_id gnl|my_center|LOCUS_04560 11077 10598 gene locus_tag LOCUS_04570 11077 10598 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878403.1 protein_id gnl|my_center|LOCUS_04570 12040 11231 gene locus_tag LOCUS_04580 12040 11231 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064408.1 protein_id gnl|my_center|LOCUS_04580 12853 12053 gene locus_tag LOCUS_04590 gene purQ 12853 12053 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_04590 12942 14135 gene locus_tag LOCUS_04600 12942 14135 CDS product TIGR00529 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094870.1 protein_id gnl|my_center|LOCUS_04600 14444 14190 gene locus_tag LOCUS_04610 14444 14190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064198.1 protein_id gnl|my_center|LOCUS_04610 15763 14873 gene locus_tag LOCUS_04620 15763 14873 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879868.1 protein_id gnl|my_center|LOCUS_04620 16600 15797 gene locus_tag LOCUS_04630 16600 15797 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879867.1 protein_id gnl|my_center|LOCUS_04630 17005 16619 gene locus_tag LOCUS_04640 17005 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 18442 17162 gene locus_tag LOCUS_04650 18442 17162 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878693.1 protein_id gnl|my_center|LOCUS_04650 19677 18595 gene locus_tag LOCUS_04660 19677 18595 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009956127.1 protein_id gnl|my_center|LOCUS_04660 20311 19814 gene locus_tag LOCUS_04670 20311 19814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878415.1 protein_id gnl|my_center|LOCUS_04670 20666 20316 gene locus_tag LOCUS_04680 20666 20316 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870086.1 protein_id gnl|my_center|LOCUS_04680 21770 20703 gene locus_tag LOCUS_04690 21770 20703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 22446 21844 gene locus_tag LOCUS_04700 22446 21844 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064326.1 protein_id gnl|my_center|LOCUS_04700 22871 22587 gene locus_tag LOCUS_04710 22871 22587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 22943 23233 gene locus_tag LOCUS_04720 22943 23233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 23384 24331 gene locus_tag LOCUS_04730 23384 24331 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393677.1 protein_id gnl|my_center|LOCUS_04730 24328 24960 gene locus_tag LOCUS_04740 24328 24960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 24965 26308 gene locus_tag LOCUS_04750 24965 26308 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_04750 26305 27591 gene locus_tag LOCUS_04760 26305 27591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 27596 28237 gene locus_tag LOCUS_04770 27596 28237 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_04770 28243 30048 gene locus_tag LOCUS_04780 gene hyfB 28243 30048 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_04780 30180 30965 gene locus_tag LOCUS_04790 gene rio1 30180 30965 CDS product RIO-type serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879299.1 protein_id gnl|my_center|LOCUS_04790 31037 31579 gene locus_tag LOCUS_04800 31037 31579 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096095.1 protein_id gnl|my_center|LOCUS_04800 32508 31576 gene locus_tag LOCUS_04810 32508 31576 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879225.1 protein_id gnl|my_center|LOCUS_04810 32851 32693 gene locus_tag LOCUS_04820 32851 32693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 33080 34351 gene locus_tag LOCUS_04830 gene tuf 33080 34351 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878437.1 protein_id gnl|my_center|LOCUS_04830 34389 34709 gene locus_tag LOCUS_04840 gene rpsJ 34389 34709 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_04840 34866 35900 gene locus_tag LOCUS_04850 34866 35900 CDS product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064366.1 protein_id gnl|my_center|LOCUS_04850 36097 36270 gene locus_tag LOCUS_04860 36097 36270 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064461.1 protein_id gnl|my_center|LOCUS_04860 36407 36988 gene locus_tag LOCUS_04870 36407 36988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 38888 36969 gene locus_tag LOCUS_04880 gene lonB 38888 36969 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_04880 38963 39628 gene locus_tag LOCUS_04890 38963 39628 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868261.1 protein_id gnl|my_center|LOCUS_04890 39619 40185 gene locus_tag LOCUS_04900 39619 40185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 41508 40252 gene locus_tag LOCUS_04910 41508 40252 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879247.1 protein_id gnl|my_center|LOCUS_04910 42280 41618 gene locus_tag LOCUS_04920 42280 41618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence09 2703 319 gene locus_tag LOCUS_04930 2703 319 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878004.1 protein_id gnl|my_center|LOCUS_04930 2809 3468 gene locus_tag LOCUS_04940 2809 3468 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879388.1 protein_id gnl|my_center|LOCUS_04940 4281 3484 gene locus_tag LOCUS_04950 4281 3484 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879137.1 protein_id gnl|my_center|LOCUS_04950 4488 5066 gene locus_tag LOCUS_04960 gene hxlB 4488 5066 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879292.1 protein_id gnl|my_center|LOCUS_04960 5157 5663 gene locus_tag LOCUS_04970 5157 5663 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_04970 6179 5718 gene locus_tag LOCUS_04980 6179 5718 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_04980 6409 6176 gene locus_tag LOCUS_04990 6409 6176 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879883.1 protein_id gnl|my_center|LOCUS_04990 7057 6470 gene locus_tag LOCUS_05000 7057 6470 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_05000 7475 8383 gene locus_tag LOCUS_05010 7475 8383 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878274.1 protein_id gnl|my_center|LOCUS_05010 9692 8355 gene locus_tag LOCUS_05020 9692 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878275.1 protein_id gnl|my_center|LOCUS_05020 10048 9680 gene locus_tag LOCUS_05030 10048 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 10902 10021 gene locus_tag LOCUS_05040 10902 10021 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878278.1 protein_id gnl|my_center|LOCUS_05040 11075 12292 gene locus_tag LOCUS_05050 gene thrC 11075 12292 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878813.1 protein_id gnl|my_center|LOCUS_05050 12307 13413 gene locus_tag LOCUS_05060 gene aroC 12307 13413 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878173.1 protein_id gnl|my_center|LOCUS_05060 13776 14129 gene locus_tag LOCUS_05070 gene speD 13776 14129 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879107.1 protein_id gnl|my_center|LOCUS_05070 14174 15202 gene locus_tag LOCUS_05080 14174 15202 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064426.1 protein_id gnl|my_center|LOCUS_05080 15272 16045 gene locus_tag LOCUS_05090 15272 16045 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879758.1 protein_id gnl|my_center|LOCUS_05090 16511 16089 gene locus_tag LOCUS_05100 16511 16089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 16945 16565 gene locus_tag LOCUS_05110 16945 16565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 17427 17669 gene locus_tag LOCUS_05120 gene purS 17427 17669 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879434.1 protein_id gnl|my_center|LOCUS_05120 17785 19497 gene locus_tag LOCUS_05130 gene glyS 17785 19497 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096515.1 protein_id gnl|my_center|LOCUS_05130 19566 20777 gene locus_tag LOCUS_05140 19566 20777 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878802.1 protein_id gnl|my_center|LOCUS_05140 22320 20878 gene locus_tag LOCUS_05150 22320 20878 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064301.1 protein_id gnl|my_center|LOCUS_05150 22530 23240 gene locus_tag LOCUS_05160 22530 23240 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870611.1 protein_id gnl|my_center|LOCUS_05160 24567 23218 gene locus_tag LOCUS_05170 24567 23218 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879849.1 protein_id gnl|my_center|LOCUS_05170 24985 24578 gene locus_tag LOCUS_05180 24985 24578 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892241.1 protein_id gnl|my_center|LOCUS_05180 25087 25317 gene locus_tag LOCUS_05190 25087 25317 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878154.1 protein_id gnl|my_center|LOCUS_05190 25403 27238 gene locus_tag LOCUS_05200 gene top6B 25403 27238 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878155.1 protein_id gnl|my_center|LOCUS_05200 28086 28514 gene locus_tag LOCUS_05210 28086 28514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 28535 29164 gene locus_tag LOCUS_05220 28535 29164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 30691 29426 gene locus_tag LOCUS_05230 gene tiaS 30691 29426 CDS product tRNA(Ile2) 2-agmatinylcytidine synthetase TiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879748.1 protein_id gnl|my_center|LOCUS_05230 31855 30839 gene locus_tag LOCUS_05240 gene fen 31855 30839 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877775.1 protein_id gnl|my_center|LOCUS_05240 32097 33089 gene locus_tag LOCUS_05250 32097 33089 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877753.1 protein_id gnl|my_center|LOCUS_05250 33844 33131 gene locus_tag LOCUS_05260 gene hisA 33844 33131 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878486.1 protein_id gnl|my_center|LOCUS_05260 34876 33848 gene locus_tag LOCUS_05270 34876 33848 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877787.1 protein_id gnl|my_center|LOCUS_05270 35769 34972 gene locus_tag LOCUS_05280 35769 34972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 35927 36832 gene locus_tag LOCUS_05290 35927 36832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274381.1 protein_id gnl|my_center|LOCUS_05290 37474 36944 gene locus_tag LOCUS_05300 gene cyaB 37474 36944 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879480.1 protein_id gnl|my_center|LOCUS_05300 38630 37497 gene locus_tag LOCUS_05310 38630 37497 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_05310 38755 38828 gene locus_tag LOCUS_t00170 38755 38828 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 39074 39802 gene locus_tag LOCUS_05320 39074 39802 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877842.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence10 280 513 gene locus_tag LOCUS_05330 280 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05330 1515 2924 gene locus_tag LOCUS_05340 1515 2924 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878354.1 protein_id gnl|my_center|LOCUS_05340 3050 4534 gene locus_tag LOCUS_05350 3050 4534 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878496.1 protein_id gnl|my_center|LOCUS_05350 4521 6257 gene locus_tag LOCUS_05360 4521 6257 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878161.1 protein_id gnl|my_center|LOCUS_05360 6289 6789 gene locus_tag LOCUS_05370 6289 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 6840 7562 gene locus_tag LOCUS_05380 6840 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 7946 7545 gene locus_tag LOCUS_05390 7946 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 8085 8822 gene locus_tag LOCUS_05400 8085 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 8819 9334 gene locus_tag LOCUS_05410 8819 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 9706 9344 gene locus_tag LOCUS_05420 9706 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 10737 9856 gene locus_tag LOCUS_05430 10737 9856 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877908.1 protein_id gnl|my_center|LOCUS_05430 10887 11243 gene locus_tag LOCUS_05440 10887 11243 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878558.1 protein_id gnl|my_center|LOCUS_05440 11967 13382 gene locus_tag LOCUS_05450 gene rbcL 11967 13382 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870747.1 protein_id gnl|my_center|LOCUS_05450 13945 13388 gene locus_tag LOCUS_05460 13945 13388 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878254.1 protein_id gnl|my_center|LOCUS_05460 14240 13962 gene locus_tag LOCUS_05470 14240 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878255.1 protein_id gnl|my_center|LOCUS_05470 14291 14518 gene locus_tag LOCUS_05480 14291 14518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 15439 16020 gene locus_tag LOCUS_05490 15439 16020 CDS product DUF1102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879573.1 protein_id gnl|my_center|LOCUS_05490 16047 16589 gene locus_tag LOCUS_05500 16047 16589 CDS product DUF1102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879572.1 protein_id gnl|my_center|LOCUS_05500 16628 17635 gene locus_tag LOCUS_05510 16628 17635 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064526.1 protein_id gnl|my_center|LOCUS_05510 17632 17991 gene locus_tag LOCUS_05520 17632 17991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 18022 18969 gene locus_tag LOCUS_05530 18022 18969 CDS product DUF5305 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250652.1 protein_id gnl|my_center|LOCUS_05530 19139 20494 gene locus_tag LOCUS_05540 gene glmM 19139 20494 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877965.1 protein_id gnl|my_center|LOCUS_05540 20839 20979 gene locus_tag LOCUS_05550 20839 20979 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877570.1 protein_id gnl|my_center|LOCUS_05550 21141 22517 gene locus_tag LOCUS_05560 gene cobB 21141 22517 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320008.1 protein_id gnl|my_center|LOCUS_05560 22712 23653 gene locus_tag LOCUS_05570 22712 23653 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496774.1 protein_id gnl|my_center|LOCUS_05570 23657 24730 gene locus_tag LOCUS_05580 23657 24730 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870783.1 protein_id gnl|my_center|LOCUS_05580 25347 24823 gene locus_tag LOCUS_05590 25347 24823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 27118 25508 gene locus_tag LOCUS_05600 gene sepS 27118 25508 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877624.1 protein_id gnl|my_center|LOCUS_05600 27605 27147 gene locus_tag LOCUS_05610 gene tsaA 27605 27147 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099839871.1 protein_id gnl|my_center|LOCUS_05610 28247 28029 gene locus_tag LOCUS_05620 28247 28029 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879575.1 protein_id gnl|my_center|LOCUS_05620 29114 28389 gene locus_tag LOCUS_05630 gene cas6 29114 28389 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877586.1 protein_id gnl|my_center|LOCUS_05630 29435 29172 gene locus_tag LOCUS_05640 gene cas2 29435 29172 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064580.1 protein_id gnl|my_center|LOCUS_05640 30406 29438 gene locus_tag LOCUS_05650 gene cas1b 30406 29438 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879922.1 protein_id gnl|my_center|LOCUS_05650 30554 31738 gene locus_tag LOCUS_05660 30554 31738 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878920.1 protein_id gnl|my_center|LOCUS_05660 31929 32279 gene locus_tag LOCUS_05670 31929 32279 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879717.1 protein_id gnl|my_center|LOCUS_05670 32471 32875 gene locus_tag LOCUS_05680 32471 32875 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878018.1 protein_id gnl|my_center|LOCUS_05680 32902 33516 gene locus_tag LOCUS_05690 32902 33516 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878019.1 protein_id gnl|my_center|LOCUS_05690 35289 33646 gene locus_tag LOCUS_05700 gene ilvD 35289 33646 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878514.1 protein_id gnl|my_center|LOCUS_05700 35515 35712 gene locus_tag LOCUS_05710 35515 35712 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064196.1 protein_id gnl|my_center|LOCUS_05710 35723 37306 gene locus_tag LOCUS_05720 gene pyrG 35723 37306 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877763.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence11 240 605 gene locus_tag LOCUS_05730 gene rpl7ae 240 605 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878267.1 protein_id gnl|my_center|LOCUS_05730 624 836 gene locus_tag LOCUS_05740 624 836 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878268.1 protein_id gnl|my_center|LOCUS_05740 847 1026 gene locus_tag LOCUS_05750 847 1026 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878269.1 protein_id gnl|my_center|LOCUS_05750 1113 1562 gene locus_tag LOCUS_05760 gene ndk 1113 1562 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_05760 1610 3409 gene locus_tag LOCUS_05770 gene infB 1610 3409 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878271.1 protein_id gnl|my_center|LOCUS_05770 3435 4700 gene locus_tag LOCUS_05780 3435 4700 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251117.1 protein_id gnl|my_center|LOCUS_05780 4788 5639 gene locus_tag LOCUS_05790 4788 5639 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878499.1 protein_id gnl|my_center|LOCUS_05790 6409 5708 gene locus_tag LOCUS_05800 6409 5708 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877630.1 protein_id gnl|my_center|LOCUS_05800 6456 7220 gene locus_tag LOCUS_05810 6456 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 7217 7951 gene locus_tag LOCUS_05820 7217 7951 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_05820 8079 8387 gene locus_tag LOCUS_05830 gene yciH 8079 8387 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878414.1 protein_id gnl|my_center|LOCUS_05830 8462 10198 gene locus_tag LOCUS_05840 8462 10198 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_05840 10238 10579 gene locus_tag LOCUS_05850 10238 10579 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877793.1 protein_id gnl|my_center|LOCUS_05850 10576 11256 gene locus_tag LOCUS_05860 10576 11256 CDS product Dna2/Cas4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879670.1 protein_id gnl|my_center|LOCUS_05860 13967 11253 gene locus_tag LOCUS_05870 gene alaS 13967 11253 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879744.1 protein_id gnl|my_center|LOCUS_05870 14102 14878 gene locus_tag LOCUS_05880 gene dapB 14102 14878 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878409.1 protein_id gnl|my_center|LOCUS_05880 14904 15200 gene locus_tag LOCUS_05890 14904 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 15197 15613 gene locus_tag LOCUS_05900 15197 15613 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250362.1 protein_id gnl|my_center|LOCUS_05900 15670 17640 gene locus_tag LOCUS_05910 15670 17640 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761987.1 protein_id gnl|my_center|LOCUS_05910 18120 17659 gene locus_tag LOCUS_05920 gene ribC 18120 17659 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878913.1 protein_id gnl|my_center|LOCUS_05920 18179 18769 gene locus_tag LOCUS_05930 18179 18769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 19718 18798 gene locus_tag LOCUS_05940 gene cbiB 19718 18798 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878833.1 protein_id gnl|my_center|LOCUS_05940 19833 20846 gene locus_tag LOCUS_05950 gene radA 19833 20846 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_05950 21395 20847 gene locus_tag LOCUS_05960 gene tfe 21395 20847 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878260.1 protein_id gnl|my_center|LOCUS_05960 21618 23312 gene locus_tag LOCUS_05970 gene feoB 21618 23312 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012939559.1 protein_id gnl|my_center|LOCUS_05970 23368 23730 gene locus_tag LOCUS_05980 23368 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 23734 24951 gene locus_tag LOCUS_05990 23734 24951 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879900.1 protein_id gnl|my_center|LOCUS_05990 24956 25918 gene locus_tag LOCUS_06000 24956 25918 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438415.1 protein_id gnl|my_center|LOCUS_06000 26080 27093 gene locus_tag LOCUS_06010 26080 27093 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877749.1 protein_id gnl|my_center|LOCUS_06010 27259 27621 gene locus_tag LOCUS_06020 27259 27621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 29069 27642 gene locus_tag LOCUS_06030 29069 27642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 29284 29359 gene locus_tag LOCUS_t00180 29284 29359 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 31164 29488 gene locus_tag LOCUS_06040 31164 29488 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877721.1 protein_id gnl|my_center|LOCUS_06040 31438 32562 gene locus_tag LOCUS_06050 31438 32562 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870392.1 protein_id gnl|my_center|LOCUS_06050 32595 33605 gene locus_tag LOCUS_06060 32595 33605 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453864.1 protein_id gnl|my_center|LOCUS_06060 33636 34832 gene locus_tag LOCUS_06070 33636 34832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439823.1 protein_id gnl|my_center|LOCUS_06070 35178 34786 gene locus_tag LOCUS_06080 35178 34786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 36029 35208 gene locus_tag LOCUS_06090 36029 35208 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879040.1 protein_id gnl|my_center|LOCUS_06090 36265 36098 gene locus_tag LOCUS_06100 36265 36098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence12 1880 357 gene locus_tag LOCUS_06110 1880 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2321 2127 gene locus_tag LOCUS_06120 2321 2127 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878927.1 protein_id gnl|my_center|LOCUS_06120 2436 3722 gene locus_tag LOCUS_06130 2436 3722 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_06130 4310 3885 gene locus_tag LOCUS_06140 4310 3885 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_06140 5625 4324 gene locus_tag LOCUS_06150 5625 4324 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879167.1 protein_id gnl|my_center|LOCUS_06150 5789 6811 gene locus_tag LOCUS_06160 5789 6811 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928941.1 protein_id gnl|my_center|LOCUS_06160 6862 7305 gene locus_tag LOCUS_06170 6862 7305 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877590.1 protein_id gnl|my_center|LOCUS_06170 7316 9049 gene locus_tag LOCUS_06180 7316 9049 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877591.1 protein_id gnl|my_center|LOCUS_06180 9351 9085 gene locus_tag LOCUS_06190 9351 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 9730 9338 gene locus_tag LOCUS_06200 9730 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 10039 13245 gene locus_tag LOCUS_06210 10039 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 14182 13337 gene locus_tag LOCUS_06220 gene dapF 14182 13337 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_06220 14972 14322 gene locus_tag LOCUS_06230 gene pyrF 14972 14322 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064309.1 protein_id gnl|my_center|LOCUS_06230 15976 15077 gene locus_tag LOCUS_06240 gene rio2 15976 15077 CDS product RIO-type serine/threonine-protein kinase Rio2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879913.1 protein_id gnl|my_center|LOCUS_06240 17166 16006 gene locus_tag LOCUS_06250 gene ribA 17166 16006 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877991.1 protein_id gnl|my_center|LOCUS_06250 17499 18731 gene locus_tag LOCUS_06260 17499 18731 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877755.1 protein_id gnl|my_center|LOCUS_06260 19361 18804 gene locus_tag LOCUS_06270 19361 18804 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879810.1 protein_id gnl|my_center|LOCUS_06270 20080 19352 gene locus_tag LOCUS_06280 gene cobS 20080 19352 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064156.1 protein_id gnl|my_center|LOCUS_06280 21021 20158 gene locus_tag LOCUS_06290 21021 20158 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878297.1 protein_id gnl|my_center|LOCUS_06290 21458 22519 gene locus_tag LOCUS_06300 21458 22519 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878121.1 protein_id gnl|my_center|LOCUS_06300 22749 25988 gene locus_tag LOCUS_06310 gene carB 22749 25988 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_06310 26722 26060 gene locus_tag LOCUS_06320 gene tpiA 26722 26060 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064694.1 protein_id gnl|my_center|LOCUS_06320 27617 26772 gene locus_tag LOCUS_06330 27617 26772 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878402.1 protein_id gnl|my_center|LOCUS_06330 27773 28477 gene locus_tag LOCUS_06340 gene cas6 27773 28477 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877586.1 protein_id gnl|my_center|LOCUS_06340 30227 28710 gene locus_tag LOCUS_06350 30227 28710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251151.1 protein_id gnl|my_center|LOCUS_06350 31868 30321 gene locus_tag LOCUS_06360 31868 30321 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_06360 32238 31963 gene locus_tag LOCUS_06370 32238 31963 CDS product NMD3-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208643.1 protein_id gnl|my_center|LOCUS_06370 33412 32249 gene locus_tag LOCUS_06380 33412 32249 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878861.1 protein_id gnl|my_center|LOCUS_06380 33696 33439 gene locus_tag LOCUS_06390 33696 33439 CDS product DUF2095 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878860.1 protein_id gnl|my_center|LOCUS_06390 <34868 33701 gene locus_tag LOCUS_06400 <34868 33701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878859.1:acyltransferase >Feature sequence13 <1 663 gene locus_tag LOCUS_06410 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878358.1:malate dehydrogenase 781 1674 gene locus_tag LOCUS_06420 781 1674 CDS product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878281.1 protein_id gnl|my_center|LOCUS_06420 3114 1675 gene locus_tag LOCUS_06430 gene gatB 3114 1675 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064531.1 protein_id gnl|my_center|LOCUS_06430 4400 3174 gene locus_tag LOCUS_06440 4400 3174 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878209.1 protein_id gnl|my_center|LOCUS_06440 4441 4983 gene locus_tag LOCUS_06450 4441 4983 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064638.1 protein_id gnl|my_center|LOCUS_06450 4973 5440 gene locus_tag LOCUS_06460 4973 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878211.1 protein_id gnl|my_center|LOCUS_06460 5452 5898 gene locus_tag LOCUS_06470 5452 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 5938 6354 gene locus_tag LOCUS_06480 gene trxA 5938 6354 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_06480 6363 6435 gene locus_tag LOCUS_t00190 6363 6435 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7460 7915 gene locus_tag LOCUS_06490 7460 7915 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064346.1 protein_id gnl|my_center|LOCUS_06490 7957 8577 gene locus_tag LOCUS_06500 7957 8577 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878689.1 protein_id gnl|my_center|LOCUS_06500 9447 8659 gene locus_tag LOCUS_06510 9447 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 10865 9468 gene locus_tag LOCUS_06520 10865 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 10941 11576 gene locus_tag LOCUS_06530 10941 11576 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879638.1 protein_id gnl|my_center|LOCUS_06530 11593 12513 gene locus_tag LOCUS_06540 11593 12513 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545868.1 protein_id gnl|my_center|LOCUS_06540 12636 13307 gene locus_tag LOCUS_06550 gene cofC 12636 13307 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879553.1 protein_id gnl|my_center|LOCUS_06550 13312 13782 gene locus_tag LOCUS_06560 13312 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 14211 13828 gene locus_tag LOCUS_06570 14211 13828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 15029 14211 gene locus_tag LOCUS_06580 15029 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 15742 15041 gene locus_tag LOCUS_06590 15742 15041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 18083 15753 gene locus_tag LOCUS_06600 18083 15753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 18516 18106 gene locus_tag LOCUS_06610 18516 18106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 19052 18504 gene locus_tag LOCUS_06620 19052 18504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064284.1 protein_id gnl|my_center|LOCUS_06620 19980 19069 gene locus_tag LOCUS_06630 19980 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 20128 20985 gene locus_tag LOCUS_06640 20128 20985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 21730 20993 gene locus_tag LOCUS_06650 21730 20993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 22112 21735 gene locus_tag LOCUS_06660 22112 21735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 23976 22117 gene locus_tag LOCUS_06670 23976 22117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 24162 24911 gene locus_tag LOCUS_06680 24162 24911 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_06680 24923 25330 gene locus_tag LOCUS_06690 24923 25330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 26238 25336 gene locus_tag LOCUS_06700 26238 25336 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_06700 27112 26219 gene locus_tag LOCUS_06710 27112 26219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878934.1 protein_id gnl|my_center|LOCUS_06710 28769 27219 gene locus_tag LOCUS_06720 28769 27219 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879747.1 protein_id gnl|my_center|LOCUS_06720 30912 28813 gene locus_tag LOCUS_06730 30912 28813 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877725.1 protein_id gnl|my_center|LOCUS_06730 31473 30925 gene locus_tag LOCUS_06740 31473 30925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 31633 31941 gene locus_tag LOCUS_06750 31633 31941 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879020.1 protein_id gnl|my_center|LOCUS_06750 32441 32725 gene locus_tag LOCUS_06760 32441 32725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 33214 32732 gene locus_tag LOCUS_06770 33214 32732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence14 517 2604 gene locus_tag LOCUS_06780 gene nrdD 517 2604 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330373.1 protein_id gnl|my_center|LOCUS_06780 2787 2704 gene locus_tag LOCUS_t00200 2787 2704 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2918 3805 gene locus_tag LOCUS_06790 2918 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 6026 3900 gene locus_tag LOCUS_06800 6026 3900 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683854.1 protein_id gnl|my_center|LOCUS_06800 6464 6117 gene locus_tag LOCUS_06810 6464 6117 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214298.1 protein_id gnl|my_center|LOCUS_06810 6604 7443 gene locus_tag LOCUS_06820 6604 7443 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_06820 8303 7539 gene locus_tag LOCUS_06830 8303 7539 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879187.1 protein_id gnl|my_center|LOCUS_06830 9207 8506 gene locus_tag LOCUS_06840 9207 8506 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878152.1 protein_id gnl|my_center|LOCUS_06840 9631 9251 gene locus_tag LOCUS_06850 9631 9251 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064682.1 protein_id gnl|my_center|LOCUS_06850 11146 9641 gene locus_tag LOCUS_06860 11146 9641 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878682.1 protein_id gnl|my_center|LOCUS_06860 11425 11234 gene locus_tag LOCUS_06870 11425 11234 CDS product DUF5371 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064725.1 protein_id gnl|my_center|LOCUS_06870 12896 11535 gene locus_tag LOCUS_06880 gene purB 12896 11535 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879731.1 protein_id gnl|my_center|LOCUS_06880 13597 12932 gene locus_tag LOCUS_06890 13597 12932 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878991.1 protein_id gnl|my_center|LOCUS_06890 14117 13695 gene locus_tag LOCUS_06900 14117 13695 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319975.1 protein_id gnl|my_center|LOCUS_06900 14291 15148 gene locus_tag LOCUS_06910 14291 15148 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064299.1 protein_id gnl|my_center|LOCUS_06910 15688 15152 gene locus_tag LOCUS_06920 15688 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 16154 15675 gene locus_tag LOCUS_06930 16154 15675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 16873 16472 gene locus_tag LOCUS_06940 16873 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 17527 16928 gene locus_tag LOCUS_06950 17527 16928 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878379.1 protein_id gnl|my_center|LOCUS_06950 20656 17537 gene locus_tag LOCUS_06960 gene ileS 20656 17537 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878137.1 protein_id gnl|my_center|LOCUS_06960 22364 21132 gene locus_tag LOCUS_06970 gene ahcY 22364 21132 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879492.1 protein_id gnl|my_center|LOCUS_06970 22530 24113 gene locus_tag LOCUS_06980 gene serA 22530 24113 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878316.1 protein_id gnl|my_center|LOCUS_06980 24252 24815 gene locus_tag LOCUS_06990 24252 24815 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879804.1 protein_id gnl|my_center|LOCUS_06990 24812 25294 gene locus_tag LOCUS_07000 24812 25294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 25535 25257 gene locus_tag LOCUS_07010 25535 25257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 25888 25529 gene locus_tag LOCUS_07020 25888 25529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 26469 25984 gene locus_tag LOCUS_07030 gene cgi121 26469 25984 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878026.1 protein_id gnl|my_center|LOCUS_07030 27772 26474 gene locus_tag LOCUS_07040 27772 26474 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_07040 28602 27874 gene locus_tag LOCUS_07050 28602 27874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 30528 28684 gene locus_tag LOCUS_07060 30528 28684 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146750.1 protein_id gnl|my_center|LOCUS_07060 30882 30535 gene locus_tag LOCUS_07070 30882 30535 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868054.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence15 <1 677 gene locus_tag LOCUS_07080 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879727.1:thermosome subunit beta 768 1193 gene locus_tag LOCUS_07090 768 1193 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 protein_id gnl|my_center|LOCUS_07090 1233 1901 gene locus_tag LOCUS_07100 1233 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 2069 1926 gene locus_tag LOCUS_07110 2069 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2187 2360 gene locus_tag LOCUS_07120 2187 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2449 3276 gene locus_tag LOCUS_07130 2449 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 3248 3796 gene locus_tag LOCUS_07140 3248 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 3927 4385 gene locus_tag LOCUS_07150 3927 4385 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877952.1 protein_id gnl|my_center|LOCUS_07150 4513 5571 gene locus_tag LOCUS_07160 4513 5571 CDS product TPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095346.1 protein_id gnl|my_center|LOCUS_07160 5797 6468 gene locus_tag LOCUS_07170 5797 6468 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870406.1 protein_id gnl|my_center|LOCUS_07170 6545 7036 gene locus_tag LOCUS_07180 6545 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 7033 8121 gene locus_tag LOCUS_07190 7033 8121 CDS product FlaD/FlaE family flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870409.1 protein_id gnl|my_center|LOCUS_07190 8111 8551 gene locus_tag LOCUS_07200 8111 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 8619 9071 gene locus_tag LOCUS_07210 8619 9071 CDS product flagellar protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320043.1 protein_id gnl|my_center|LOCUS_07210 9086 9778 gene locus_tag LOCUS_07220 9086 9778 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496652.1 protein_id gnl|my_center|LOCUS_07220 9839 11488 gene locus_tag LOCUS_07230 9839 11488 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249003.1 protein_id gnl|my_center|LOCUS_07230 11498 13174 gene locus_tag LOCUS_07240 gene flaJ 11498 13174 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147051.1 protein_id gnl|my_center|LOCUS_07240 13272 13595 gene locus_tag LOCUS_07250 13272 13595 CDS product archaellum operon transcriptional activator EarA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248991.1 protein_id gnl|my_center|LOCUS_07250 13592 14488 gene locus_tag LOCUS_07260 13592 14488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 15325 14489 gene locus_tag LOCUS_07270 15325 14489 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878217.1 protein_id gnl|my_center|LOCUS_07270 15630 17585 gene locus_tag LOCUS_07280 gene acs 15630 17585 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056731.1 protein_id gnl|my_center|LOCUS_07280 18072 17626 gene locus_tag LOCUS_07290 18072 17626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 20283 18112 gene locus_tag LOCUS_07300 20283 18112 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_07300 20862 20347 gene locus_tag LOCUS_07310 gene cas4 20862 20347 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879923.1 protein_id gnl|my_center|LOCUS_07310 20946 22037 gene locus_tag LOCUS_07320 gene priS 20946 22037 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064280.1 protein_id gnl|my_center|LOCUS_07320 22027 22587 gene locus_tag LOCUS_07330 22027 22587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878829.1 protein_id gnl|my_center|LOCUS_07330 22606 22887 gene locus_tag LOCUS_07340 22606 22887 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878830.1 protein_id gnl|my_center|LOCUS_07340 22950 23135 gene locus_tag LOCUS_07350 22950 23135 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878831.1 protein_id gnl|my_center|LOCUS_07350 23147 24340 gene locus_tag LOCUS_07360 23147 24340 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877564.1 protein_id gnl|my_center|LOCUS_07360 26044 24368 gene locus_tag LOCUS_07370 26044 24368 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 protein_id gnl|my_center|LOCUS_07370 26144 26794 gene locus_tag LOCUS_07380 gene fdhD 26144 26794 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877879.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence16 1029 202 gene locus_tag LOCUS_07390 1029 202 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879142.1 protein_id gnl|my_center|LOCUS_07390 1363 1043 gene locus_tag LOCUS_07400 1363 1043 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879671.1 protein_id gnl|my_center|LOCUS_07400 1425 2429 gene locus_tag LOCUS_07410 gene ilvC 1425 2429 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879477.1 protein_id gnl|my_center|LOCUS_07410 2539 2946 gene locus_tag LOCUS_07420 2539 2946 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064560.1 protein_id gnl|my_center|LOCUS_07420 2965 3264 gene locus_tag LOCUS_07430 2965 3264 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064559.1 protein_id gnl|my_center|LOCUS_07430 3309 4037 gene locus_tag LOCUS_07440 3309 4037 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878652.1 protein_id gnl|my_center|LOCUS_07440 4188 4874 gene locus_tag LOCUS_07450 gene pyrH 4188 4874 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879534.1 protein_id gnl|my_center|LOCUS_07450 4871 6382 gene locus_tag LOCUS_07460 4871 6382 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878911.1 protein_id gnl|my_center|LOCUS_07460 6393 7376 gene locus_tag LOCUS_07470 6393 7376 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_07470 8380 7403 gene locus_tag LOCUS_07480 8380 7403 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296895.1 protein_id gnl|my_center|LOCUS_07480 8508 10175 gene locus_tag LOCUS_07490 gene argS 8508 10175 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878394.1 protein_id gnl|my_center|LOCUS_07490 10854 11159 gene locus_tag LOCUS_07500 10854 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07500 12110 11499 gene locus_tag LOCUS_07510 12110 11499 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052747804.1 protein_id gnl|my_center|LOCUS_07510 14115 12955 gene locus_tag LOCUS_07520 14115 12955 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878936.1 protein_id gnl|my_center|LOCUS_07520 14230 15105 gene locus_tag LOCUS_07530 14230 15105 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879200.1 protein_id gnl|my_center|LOCUS_07530 15264 15338 gene locus_tag LOCUS_t00210 15264 15338 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15405 16148 gene locus_tag LOCUS_07540 15405 16148 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682933.1 protein_id gnl|my_center|LOCUS_07540 16266 17729 gene locus_tag LOCUS_07550 gene proS 16266 17729 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064425.1 protein_id gnl|my_center|LOCUS_07550 17805 17879 gene locus_tag LOCUS_t00220 17805 17879 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 19149 18937 gene locus_tag LOCUS_07560 19149 18937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 19370 19696 gene locus_tag LOCUS_07570 19370 19696 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877623.1 protein_id gnl|my_center|LOCUS_07570 19786 19706 gene locus_tag LOCUS_t00230 19786 19706 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20685 19822 gene locus_tag LOCUS_07580 gene mpgP 20685 19822 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 protein_id gnl|my_center|LOCUS_07580 21898 20720 gene locus_tag LOCUS_07590 gene mpgS 21898 20720 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868345.1 protein_id gnl|my_center|LOCUS_07590 23279 22056 gene locus_tag LOCUS_07600 gene pgk 23279 22056 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064339.1 protein_id gnl|my_center|LOCUS_07600 23454 25019 gene locus_tag LOCUS_07610 23454 25019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 25686 26321 gene locus_tag LOCUS_07620 25686 26321 CDS product DUF996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250164.1 protein_id gnl|my_center|LOCUS_07620 26490 27086 gene locus_tag LOCUS_07630 26490 27086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878938.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence17 1798 878 gene locus_tag LOCUS_07640 1798 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1849 2586 gene locus_tag LOCUS_07650 1849 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2720 5143 gene locus_tag LOCUS_07660 2720 5143 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197030926.1 protein_id gnl|my_center|LOCUS_07660 5284 6690 gene locus_tag LOCUS_07670 gene purD 5284 6690 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878654.1 protein_id gnl|my_center|LOCUS_07670 6834 7403 gene locus_tag LOCUS_07680 6834 7403 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878293.1 protein_id gnl|my_center|LOCUS_07680 7435 8004 gene locus_tag LOCUS_07690 7435 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 8519 8073 gene locus_tag LOCUS_07700 8519 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878135.1 protein_id gnl|my_center|LOCUS_07700 8809 8549 gene locus_tag LOCUS_07710 8809 8549 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878136.1 protein_id gnl|my_center|LOCUS_07710 8859 9887 gene locus_tag LOCUS_07720 8859 9887 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064502.1 protein_id gnl|my_center|LOCUS_07720 10837 9917 gene locus_tag LOCUS_07730 gene cofD 10837 9917 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878417.1 protein_id gnl|my_center|LOCUS_07730 11819 10830 gene locus_tag LOCUS_07740 11819 10830 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879459.1 protein_id gnl|my_center|LOCUS_07740 11984 13294 gene locus_tag LOCUS_07750 11984 13294 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064354.1 protein_id gnl|my_center|LOCUS_07750 14374 13319 gene locus_tag LOCUS_07760 14374 13319 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020301.1 protein_id gnl|my_center|LOCUS_07760 14862 14395 gene locus_tag LOCUS_07770 14862 14395 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_07770 16427 14910 gene locus_tag LOCUS_07780 16427 14910 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879286.1 protein_id gnl|my_center|LOCUS_07780 16445 17032 gene locus_tag LOCUS_07790 16445 17032 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879287.1 protein_id gnl|my_center|LOCUS_07790 19040 17175 gene locus_tag LOCUS_07800 19040 17175 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319085.1 protein_id gnl|my_center|LOCUS_07800 19844 19098 gene locus_tag LOCUS_07810 gene rsmA 19844 19098 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879279.1 protein_id gnl|my_center|LOCUS_07810 20477 19854 gene locus_tag LOCUS_07820 20477 19854 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879028.1 protein_id gnl|my_center|LOCUS_07820 21200 20610 gene locus_tag LOCUS_07830 21200 20610 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879458.1 protein_id gnl|my_center|LOCUS_07830 21507 21259 gene locus_tag LOCUS_07840 21507 21259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 22781 21480 gene locus_tag LOCUS_07850 22781 21480 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878202.1 protein_id gnl|my_center|LOCUS_07850 22820 23647 gene locus_tag LOCUS_07860 gene cofE 22820 23647 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879745.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence18 1598 408 gene locus_tag LOCUS_07870 1598 408 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_07870 2278 1754 gene locus_tag LOCUS_07880 2278 1754 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064607.1 protein_id gnl|my_center|LOCUS_07880 2571 2380 gene locus_tag LOCUS_07890 2571 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2785 3222 gene locus_tag LOCUS_07900 gene ribH 2785 3222 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879619.1 protein_id gnl|my_center|LOCUS_07900 3331 4482 gene locus_tag LOCUS_07910 3331 4482 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879620.1 protein_id gnl|my_center|LOCUS_07910 5467 4604 gene locus_tag LOCUS_07920 5467 4604 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878298.1 protein_id gnl|my_center|LOCUS_07920 5797 7251 gene locus_tag LOCUS_07930 5797 7251 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978813.1 protein_id gnl|my_center|LOCUS_07930 7233 8366 gene locus_tag LOCUS_07940 7233 8366 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065771.1 protein_id gnl|my_center|LOCUS_07940 8495 9691 gene locus_tag LOCUS_07950 8495 9691 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_07950 9688 11412 gene locus_tag LOCUS_07960 9688 11412 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_07960 11554 13797 gene locus_tag LOCUS_07970 11554 13797 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879160.1 protein_id gnl|my_center|LOCUS_07970 13966 14172 gene locus_tag LOCUS_07980 13966 14172 CDS product archaeal histone A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867469.1 protein_id gnl|my_center|LOCUS_07980 14833 14285 gene locus_tag LOCUS_07990 gene yjjX 14833 14285 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318533.1 protein_id gnl|my_center|LOCUS_07990 15308 14826 gene locus_tag LOCUS_08000 15308 14826 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879695.1 protein_id gnl|my_center|LOCUS_08000 15707 15387 gene locus_tag LOCUS_08010 15707 15387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878778.1 protein_id gnl|my_center|LOCUS_08010 16476 15745 gene locus_tag LOCUS_08020 16476 15745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546217.1 protein_id gnl|my_center|LOCUS_08020 17365 16595 gene locus_tag LOCUS_08030 17365 16595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095657.1 protein_id gnl|my_center|LOCUS_08030 18782 17376 gene locus_tag LOCUS_08040 18782 17376 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878888.1 protein_id gnl|my_center|LOCUS_08040 19069 19476 gene locus_tag LOCUS_08050 19069 19476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 19532 19846 gene locus_tag LOCUS_08060 gene tatA 19532 19846 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879548.1 protein_id gnl|my_center|LOCUS_08060 20682 19852 gene locus_tag LOCUS_08070 20682 19852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 21571 20684 gene locus_tag LOCUS_08080 21571 20684 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877625.1 protein_id gnl|my_center|LOCUS_08080 21726 22664 gene locus_tag LOCUS_08090 21726 22664 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877935.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence19 1359 115 gene locus_tag LOCUS_08100 gene hisD 1359 115 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877723.1 protein_id gnl|my_center|LOCUS_08100 2027 1497 gene locus_tag LOCUS_08110 2027 1497 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879241.1 protein_id gnl|my_center|LOCUS_08110 2180 3577 gene locus_tag LOCUS_08120 2180 3577 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879242.1 protein_id gnl|my_center|LOCUS_08120 3593 3931 gene locus_tag LOCUS_08130 gene glnK2 3593 3931 CDS product P-II family nitrogen regulator GlnK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879243.1 protein_id gnl|my_center|LOCUS_08130 4845 4171 gene locus_tag LOCUS_08140 4845 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4928 5842 gene locus_tag LOCUS_08150 4928 5842 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868873.1 protein_id gnl|my_center|LOCUS_08150 6590 5988 gene locus_tag LOCUS_08160 6590 5988 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878601.1 protein_id gnl|my_center|LOCUS_08160 7508 6645 gene locus_tag LOCUS_08170 7508 6645 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878600.1 protein_id gnl|my_center|LOCUS_08170 7561 8238 gene locus_tag LOCUS_08180 7561 8238 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878012.1 protein_id gnl|my_center|LOCUS_08180 8294 9052 gene locus_tag LOCUS_08190 8294 9052 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879869.1 protein_id gnl|my_center|LOCUS_08190 9291 10334 gene locus_tag LOCUS_08200 9291 10334 CDS product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064366.1 protein_id gnl|my_center|LOCUS_08200 10731 10937 gene locus_tag LOCUS_08210 10731 10937 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146889.1 protein_id gnl|my_center|LOCUS_08210 11842 10967 gene locus_tag LOCUS_08220 11842 10967 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966201.1 protein_id gnl|my_center|LOCUS_08220 11906 12865 gene locus_tag LOCUS_08230 11906 12865 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_08230 13222 14355 gene locus_tag LOCUS_08240 13222 14355 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877767.1 protein_id gnl|my_center|LOCUS_08240 14533 14790 gene locus_tag LOCUS_08250 14533 14790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 14791 15711 gene locus_tag LOCUS_08260 gene modA 14791 15711 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249668.1 protein_id gnl|my_center|LOCUS_08260 15699 16478 gene locus_tag LOCUS_08270 15699 16478 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249669.1 protein_id gnl|my_center|LOCUS_08270 16475 17182 gene locus_tag LOCUS_08280 16475 17182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08280 17199 17645 gene locus_tag LOCUS_08290 17199 17645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 21043 17549 gene locus_tag LOCUS_08300 gene polC 21043 17549 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_08300 21281 21208 gene locus_tag LOCUS_t00240 21281 21208 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21389 22336 gene locus_tag LOCUS_08310 21389 22336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence20 1988 978 gene locus_tag LOCUS_08320 1988 978 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879296.1 protein_id gnl|my_center|LOCUS_08320 3008 2031 gene locus_tag LOCUS_08330 3008 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 3808 3020 gene locus_tag LOCUS_08340 3808 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4671 3946 gene locus_tag LOCUS_08350 gene queC 4671 3946 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_08350 6743 4698 gene locus_tag LOCUS_08360 gene metG 6743 4698 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878950.1 protein_id gnl|my_center|LOCUS_08360 7447 6881 gene locus_tag LOCUS_08370 7447 6881 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940055.1 protein_id gnl|my_center|LOCUS_08370 8843 7932 gene locus_tag LOCUS_08380 gene guaA 8843 7932 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877764.1 protein_id gnl|my_center|LOCUS_08380 9130 8894 gene locus_tag LOCUS_08390 9130 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 10185 9175 gene locus_tag LOCUS_08400 10185 9175 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683404.1 protein_id gnl|my_center|LOCUS_08400 11180 10215 gene locus_tag LOCUS_08410 11180 10215 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879606.1 protein_id gnl|my_center|LOCUS_08410 12241 11177 gene locus_tag LOCUS_08420 12241 11177 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879224.1 protein_id gnl|my_center|LOCUS_08420 12293 12802 gene locus_tag LOCUS_08430 12293 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 13655 12777 gene locus_tag LOCUS_08440 13655 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 13768 15261 gene locus_tag LOCUS_08450 gene tgtA 13768 15261 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878092.1 protein_id gnl|my_center|LOCUS_08450 15248 16873 gene locus_tag LOCUS_08460 gene arcS 15248 16873 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878091.1 protein_id gnl|my_center|LOCUS_08460 18044 16863 gene locus_tag LOCUS_08470 18044 16863 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879290.1 protein_id gnl|my_center|LOCUS_08470 18270 20894 gene locus_tag LOCUS_08480 18270 20894 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584105.1 protein_id gnl|my_center|LOCUS_08480 21017 20943 gene locus_tag LOCUS_t00250 21017 20943 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence21 296 1165 gene locus_tag LOCUS_08490 296 1165 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877735.1 protein_id gnl|my_center|LOCUS_08490 1167 2162 gene locus_tag LOCUS_08500 1167 2162 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274355.1 protein_id gnl|my_center|LOCUS_08500 2309 4105 gene locus_tag LOCUS_08510 2309 4105 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_08510 4880 4125 gene locus_tag LOCUS_08520 4880 4125 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_08520 5407 4877 gene locus_tag LOCUS_08530 5407 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 5518 6318 gene locus_tag LOCUS_08540 5518 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08540 6322 7644 gene locus_tag LOCUS_08550 6322 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 7663 10080 gene locus_tag LOCUS_08560 gene hdrA2 7663 10080 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022820.1 protein_id gnl|my_center|LOCUS_08560 10418 10176 gene locus_tag LOCUS_08570 10418 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 10718 11986 gene locus_tag LOCUS_08580 gene hemL 10718 11986 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878736.1 protein_id gnl|my_center|LOCUS_08580 11968 12870 gene locus_tag LOCUS_08590 gene hemC 11968 12870 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878737.1 protein_id gnl|my_center|LOCUS_08590 12897 13649 gene locus_tag LOCUS_08600 gene cobA 12897 13649 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878738.1 protein_id gnl|my_center|LOCUS_08600 15099 13681 gene locus_tag LOCUS_08610 gene acsC 15099 13681 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877883.1 protein_id gnl|my_center|LOCUS_08610 16437 15118 gene locus_tag LOCUS_08620 gene cdhD 16437 15118 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877884.1 protein_id gnl|my_center|LOCUS_08620 17281 16520 gene locus_tag LOCUS_08630 17281 16520 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877885.1 protein_id gnl|my_center|LOCUS_08630 18853 17285 gene locus_tag LOCUS_08640 gene cdhC 18853 17285 CDS product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877886.1 protein_id gnl|my_center|LOCUS_08640 21333 18916 gene locus_tag LOCUS_08650 gene cdhA 21333 18916 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878596.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence22 1245 874 gene locus_tag LOCUS_08660 1245 874 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064265.1 protein_id gnl|my_center|LOCUS_08660 2800 1406 gene locus_tag LOCUS_08670 2800 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3727 2912 gene locus_tag LOCUS_08680 gene truA 3727 2912 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064445.1 protein_id gnl|my_center|LOCUS_08680 4169 3756 gene locus_tag LOCUS_08690 4169 3756 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878679.1 protein_id gnl|my_center|LOCUS_08690 4553 4200 gene locus_tag LOCUS_08700 4553 4200 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064681.1 protein_id gnl|my_center|LOCUS_08700 5205 4570 gene locus_tag LOCUS_08710 5205 4570 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 protein_id gnl|my_center|LOCUS_08710 5451 5281 gene locus_tag LOCUS_08720 5451 5281 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064219.1 protein_id gnl|my_center|LOCUS_08720 6103 5597 gene locus_tag LOCUS_08730 6103 5597 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020553.1 protein_id gnl|my_center|LOCUS_08730 6570 6100 gene locus_tag LOCUS_08740 6570 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 7139 6567 gene locus_tag LOCUS_08750 7139 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 7500 7222 gene locus_tag LOCUS_08760 7500 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 8278 7511 gene locus_tag LOCUS_08770 8278 7511 CDS product DUF6345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064899.1 protein_id gnl|my_center|LOCUS_08770 9721 8435 gene locus_tag LOCUS_08780 9721 8435 CDS product TraB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877838.1 protein_id gnl|my_center|LOCUS_08780 9806 10072 gene locus_tag LOCUS_08790 9806 10072 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879029.1 protein_id gnl|my_center|LOCUS_08790 10608 10069 gene locus_tag LOCUS_08800 gene hpt 10608 10069 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 protein_id gnl|my_center|LOCUS_08800 12369 10648 gene locus_tag LOCUS_08810 gene ade 12369 10648 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876499.1 protein_id gnl|my_center|LOCUS_08810 12994 12443 gene locus_tag LOCUS_08820 12994 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 13185 13829 gene locus_tag LOCUS_08830 13185 13829 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_08830 14976 13945 gene locus_tag LOCUS_08840 14976 13945 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096596.1 protein_id gnl|my_center|LOCUS_08840 16966 14993 gene locus_tag LOCUS_08850 16966 14993 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878706.1 protein_id gnl|my_center|LOCUS_08850 18307 17057 gene locus_tag LOCUS_08860 18307 17057 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879688.1 protein_id gnl|my_center|LOCUS_08860 18564 18791 gene locus_tag LOCUS_08870 18564 18791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 18868 19014 gene locus_tag LOCUS_08880 18868 19014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 19637 20188 gene locus_tag LOCUS_08890 19637 20188 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_08890 20194 20460 gene locus_tag LOCUS_08900 20194 20460 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879596.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence23 171 737 gene locus_tag LOCUS_08910 171 737 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878659.1 protein_id gnl|my_center|LOCUS_08910 744 1757 gene locus_tag LOCUS_08920 744 1757 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319644.1 protein_id gnl|my_center|LOCUS_08920 1754 2053 gene locus_tag LOCUS_08930 1754 2053 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878661.1 protein_id gnl|my_center|LOCUS_08930 2044 3789 gene locus_tag LOCUS_08940 2044 3789 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878662.1 protein_id gnl|my_center|LOCUS_08940 3834 5249 gene locus_tag LOCUS_08950 3834 5249 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064680.1 protein_id gnl|my_center|LOCUS_08950 5304 5972 gene locus_tag LOCUS_08960 5304 5972 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878664.1 protein_id gnl|my_center|LOCUS_08960 6498 5983 gene locus_tag LOCUS_08970 6498 5983 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880961.1 protein_id gnl|my_center|LOCUS_08970 6527 7543 gene locus_tag LOCUS_08980 6527 7543 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878029.1 protein_id gnl|my_center|LOCUS_08980 7571 8737 gene locus_tag LOCUS_08990 7571 8737 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879686.1 protein_id gnl|my_center|LOCUS_08990 9527 8775 gene locus_tag LOCUS_09000 gene nadK 9527 8775 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879860.1 protein_id gnl|my_center|LOCUS_09000 10411 9629 gene locus_tag LOCUS_09010 gene suhB 10411 9629 CDS product bifunctional fructose-1,6-bisphosphatase/inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879859.1 protein_id gnl|my_center|LOCUS_09010 11266 10451 gene locus_tag LOCUS_09020 gene aroE 11266 10451 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879816.1 protein_id gnl|my_center|LOCUS_09020 11729 11361 gene locus_tag LOCUS_09030 11729 11361 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877870.1 protein_id gnl|my_center|LOCUS_09030 11987 11760 gene locus_tag LOCUS_09040 11987 11760 CDS product Like-Sm ribonucleoprotein core inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094490.1 protein_id gnl|my_center|LOCUS_09040 12018 12980 gene locus_tag LOCUS_09050 12018 12980 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877868.1 protein_id gnl|my_center|LOCUS_09050 13805 12981 gene locus_tag LOCUS_09060 13805 12981 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878207.1 protein_id gnl|my_center|LOCUS_09060 14178 13987 gene locus_tag LOCUS_09070 14178 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 14989 14831 gene locus_tag LOCUS_09080 14989 14831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 15946 15080 gene locus_tag LOCUS_09090 gene cyoE 15946 15080 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_09090 16387 16824 gene locus_tag LOCUS_09100 16387 16824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 17610 16891 gene locus_tag LOCUS_09110 17610 16891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 17989 17741 gene locus_tag LOCUS_09120 17989 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 18054 18326 gene locus_tag LOCUS_09130 18054 18326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 18683 18360 gene locus_tag LOCUS_09140 18683 18360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09140 19269 18730 gene locus_tag LOCUS_09150 19269 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 19619 19275 gene locus_tag LOCUS_09160 19619 19275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence24 1302 271 gene locus_tag LOCUS_09170 1302 271 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682815.1 protein_id gnl|my_center|LOCUS_09170 1483 1292 gene locus_tag LOCUS_09180 1483 1292 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064446.1 protein_id gnl|my_center|LOCUS_09180 2090 1533 gene locus_tag LOCUS_09190 2090 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3663 2155 gene locus_tag LOCUS_09200 3663 2155 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878819.1 protein_id gnl|my_center|LOCUS_09200 3760 4074 gene locus_tag LOCUS_09210 gene cutA 3760 4074 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879470.1 protein_id gnl|my_center|LOCUS_09210 4135 4833 gene locus_tag LOCUS_09220 4135 4833 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064504.1 protein_id gnl|my_center|LOCUS_09220 4878 6377 gene locus_tag LOCUS_09230 4878 6377 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878457.1 protein_id gnl|my_center|LOCUS_09230 6524 6757 gene locus_tag LOCUS_09240 6524 6757 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296894.1 protein_id gnl|my_center|LOCUS_09240 6877 8355 gene locus_tag LOCUS_09250 6877 8355 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879379.1 protein_id gnl|my_center|LOCUS_09250 8377 10185 gene locus_tag LOCUS_09260 gene rpoB 8377 10185 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879380.1 protein_id gnl|my_center|LOCUS_09260 10311 12953 gene locus_tag LOCUS_09270 10311 12953 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879381.1 protein_id gnl|my_center|LOCUS_09270 12946 14133 gene locus_tag LOCUS_09280 gene rpoA2 12946 14133 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879382.1 protein_id gnl|my_center|LOCUS_09280 14153 14473 gene locus_tag LOCUS_09290 14153 14473 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065070.1 protein_id gnl|my_center|LOCUS_09290 14539 14958 gene locus_tag LOCUS_09300 14539 14958 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879384.1 protein_id gnl|my_center|LOCUS_09300 14970 15398 gene locus_tag LOCUS_09310 14970 15398 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064744.1 protein_id gnl|my_center|LOCUS_09310 15412 16008 gene locus_tag LOCUS_09320 gene rpsG 15412 16008 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879386.1 protein_id gnl|my_center|LOCUS_09320 16051 18237 gene locus_tag LOCUS_09330 16051 18237 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879387.1 protein_id gnl|my_center|LOCUS_09330 18413 18234 gene locus_tag LOCUS_09340 18413 18234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 19716 18403 gene locus_tag LOCUS_09350 19716 18403 CDS product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064366.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence25 2256 181 gene locus_tag LOCUS_09360 2256 181 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683176.1 protein_id gnl|my_center|LOCUS_09360 2434 3045 gene locus_tag LOCUS_09370 gene tmk 2434 3045 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877575.1 protein_id gnl|my_center|LOCUS_09370 3721 3035 gene locus_tag LOCUS_09380 3721 3035 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683937.1 protein_id gnl|my_center|LOCUS_09380 4068 4295 gene locus_tag LOCUS_09390 4068 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 5220 4396 gene locus_tag LOCUS_09400 5220 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 5432 6286 gene locus_tag LOCUS_09410 5432 6286 CDS product ARMT1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582978.1 protein_id gnl|my_center|LOCUS_09410 6363 7373 gene locus_tag LOCUS_09420 gene amrS 6363 7373 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878827.1 protein_id gnl|my_center|LOCUS_09420 7616 8224 gene locus_tag LOCUS_09430 7616 8224 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_09430 8291 8662 gene locus_tag LOCUS_09440 gene queD 8291 8662 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389277.1 protein_id gnl|my_center|LOCUS_09440 8696 9544 gene locus_tag LOCUS_09450 8696 9544 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096160.1 protein_id gnl|my_center|LOCUS_09450 9724 12048 gene locus_tag LOCUS_09460 gene gyrA 9724 12048 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877972.1 protein_id gnl|my_center|LOCUS_09460 12042 12731 gene locus_tag LOCUS_09470 12042 12731 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878168.1 protein_id gnl|my_center|LOCUS_09470 12838 14145 gene locus_tag LOCUS_09480 12838 14145 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879190.1 protein_id gnl|my_center|LOCUS_09480 15310 14135 gene locus_tag LOCUS_09490 15310 14135 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879875.1 protein_id gnl|my_center|LOCUS_09490 16570 15545 gene locus_tag LOCUS_09500 16570 15545 CDS product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064366.1 protein_id gnl|my_center|LOCUS_09500 18302 16770 gene locus_tag LOCUS_09510 18302 16770 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064191.1 protein_id gnl|my_center|LOCUS_09510 18698 19297 gene locus_tag LOCUS_09520 18698 19297 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439009.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence26 758 33 gene locus_tag LOCUS_09530 758 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1626 745 gene locus_tag LOCUS_09540 1626 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1818 2792 gene locus_tag LOCUS_09550 1818 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 2939 2868 gene locus_tag LOCUS_t00260 2939 2868 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2993 4075 gene locus_tag LOCUS_09560 2993 4075 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870834.1 protein_id gnl|my_center|LOCUS_09560 7622 4167 gene locus_tag LOCUS_09570 gene cobN 7622 4167 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870959.1 protein_id gnl|my_center|LOCUS_09570 7675 8415 gene locus_tag LOCUS_09580 7675 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 9489 8524 gene locus_tag LOCUS_09590 9489 8524 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879529.1 protein_id gnl|my_center|LOCUS_09590 9566 10090 gene locus_tag LOCUS_09600 9566 10090 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879824.1 protein_id gnl|my_center|LOCUS_09600 10097 11161 gene locus_tag LOCUS_09610 10097 11161 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064460.1 protein_id gnl|my_center|LOCUS_09610 12349 11246 gene locus_tag LOCUS_09620 12349 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 14031 12436 gene locus_tag LOCUS_09630 14031 12436 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056105.1 protein_id gnl|my_center|LOCUS_09630 14111 14182 gene locus_tag LOCUS_t00270 14111 14182 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15138 14239 gene locus_tag LOCUS_09640 gene htpX 15138 14239 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_09640 15541 15278 gene locus_tag LOCUS_09650 15541 15278 CDS product RpoL/Rpb11 RNA polymerase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877718.1 protein_id gnl|my_center|LOCUS_09650 16175 15579 gene locus_tag LOCUS_09660 16175 15579 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877717.1 protein_id gnl|my_center|LOCUS_09660 16783 16178 gene locus_tag LOCUS_09670 16783 16178 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877716.1 protein_id gnl|my_center|LOCUS_09670 16843 18324 gene locus_tag LOCUS_09680 16843 18324 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878406.1 protein_id gnl|my_center|LOCUS_09680 <19440 18365 gene locus_tag LOCUS_09690 <19440 18365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060929.1:phosphoenolpyruvate carboxylase >Feature sequence27 724 443 gene locus_tag LOCUS_09700 724 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 859 1725 gene locus_tag LOCUS_09710 859 1725 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248984.1 protein_id gnl|my_center|LOCUS_09710 1757 2254 gene locus_tag LOCUS_09720 1757 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2306 5374 gene locus_tag LOCUS_09730 2306 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 6055 5483 gene locus_tag LOCUS_09740 6055 5483 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879239.1 protein_id gnl|my_center|LOCUS_09740 6253 6666 gene locus_tag LOCUS_09750 gene nikR 6253 6666 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878246.1 protein_id gnl|my_center|LOCUS_09750 7272 6769 gene locus_tag LOCUS_09760 7272 6769 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878133.1 protein_id gnl|my_center|LOCUS_09760 9613 7313 gene locus_tag LOCUS_09770 9613 7313 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868573.1 protein_id gnl|my_center|LOCUS_09770 10345 9701 gene locus_tag LOCUS_09780 gene rnhB 10345 9701 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878125.1 protein_id gnl|my_center|LOCUS_09780 11657 10347 gene locus_tag LOCUS_09790 gene srp54 11657 10347 CDS product signal recognition particle protein SRP54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878126.1 protein_id gnl|my_center|LOCUS_09790 12176 12691 gene locus_tag LOCUS_09800 12176 12691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 12706 16269 gene locus_tag LOCUS_09810 gene smc 12706 16269 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879055.1 protein_id gnl|my_center|LOCUS_09810 16312 17157 gene locus_tag LOCUS_09820 16312 17157 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879056.1 protein_id gnl|my_center|LOCUS_09820 17132 17749 gene locus_tag LOCUS_09830 gene scpB 17132 17749 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879077.1 protein_id gnl|my_center|LOCUS_09830 17759 18526 gene locus_tag LOCUS_09840 17759 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879584.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence28 663 64 gene locus_tag LOCUS_09850 663 64 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879199.1 protein_id gnl|my_center|LOCUS_09850 1273 668 gene locus_tag LOCUS_09860 1273 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879749.1 protein_id gnl|my_center|LOCUS_09860 2262 1357 gene locus_tag LOCUS_09870 gene twy1 2262 1357 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879750.1 protein_id gnl|my_center|LOCUS_09870 2512 2790 gene locus_tag LOCUS_09880 2512 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879585.1 protein_id gnl|my_center|LOCUS_09880 2853 3197 gene locus_tag LOCUS_09890 gene pth2 2853 3197 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879586.1 protein_id gnl|my_center|LOCUS_09890 4713 3220 gene locus_tag LOCUS_09900 4713 3220 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879180.1 protein_id gnl|my_center|LOCUS_09900 6882 5905 gene locus_tag LOCUS_09910 6882 5905 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096340.1 protein_id gnl|my_center|LOCUS_09910 7970 6909 gene locus_tag LOCUS_09920 gene fni 7970 6909 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064552.1 protein_id gnl|my_center|LOCUS_09920 8771 7983 gene locus_tag LOCUS_09930 8771 7983 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965876.1 protein_id gnl|my_center|LOCUS_09930 9660 8734 gene locus_tag LOCUS_09940 gene mvk 9660 8734 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879778.1 protein_id gnl|my_center|LOCUS_09940 10462 9677 gene locus_tag LOCUS_09950 10462 9677 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879799.1 protein_id gnl|my_center|LOCUS_09950 10733 10649 gene locus_tag LOCUS_t00280 10733 10649 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10810 11337 gene locus_tag LOCUS_09960 10810 11337 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878930.1 protein_id gnl|my_center|LOCUS_09960 11846 11625 gene locus_tag LOCUS_09970 11846 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 12035 13264 gene locus_tag LOCUS_09980 12035 13264 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064633.1 protein_id gnl|my_center|LOCUS_09980 13284 13670 gene locus_tag LOCUS_09990 gene vapC9 13284 13670 CDS product type II toxin-antitoxin system toxin ribonuclease VapC9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878095.1 protein_id gnl|my_center|LOCUS_09990 13926 13708 gene locus_tag LOCUS_10000 13926 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 14140 14212 gene locus_tag LOCUS_t00290 14140 14212 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14954 14280 gene locus_tag LOCUS_10010 14954 14280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 15868 15086 gene locus_tag LOCUS_10020 15868 15086 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878754.1 protein_id gnl|my_center|LOCUS_10020 16247 15903 gene locus_tag LOCUS_10030 16247 15903 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877543.1 protein_id gnl|my_center|LOCUS_10030 16675 16589 gene locus_tag LOCUS_t00300 16675 16589 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16816 17751 gene locus_tag LOCUS_10040 16816 17751 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584103.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence29 796 722 gene locus_tag LOCUS_t00310 796 722 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2228 843 gene locus_tag LOCUS_10050 gene serS 2228 843 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879527.1 protein_id gnl|my_center|LOCUS_10050 2693 2364 gene locus_tag LOCUS_10060 2693 2364 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064662.1 protein_id gnl|my_center|LOCUS_10060 3930 2707 gene locus_tag LOCUS_10070 3930 2707 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879245.1 protein_id gnl|my_center|LOCUS_10070 4243 5352 gene locus_tag LOCUS_10080 4243 5352 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878452.1 protein_id gnl|my_center|LOCUS_10080 5362 6888 gene locus_tag LOCUS_10090 5362 6888 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878453.1 protein_id gnl|my_center|LOCUS_10090 6918 7748 gene locus_tag LOCUS_10100 6918 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878454.1 protein_id gnl|my_center|LOCUS_10100 8542 7766 gene locus_tag LOCUS_10110 8542 7766 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320550.1 protein_id gnl|my_center|LOCUS_10110 9478 8594 gene locus_tag LOCUS_10120 gene argB 9478 8594 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878775.1 protein_id gnl|my_center|LOCUS_10120 9695 10222 gene locus_tag LOCUS_10130 gene porC 9695 10222 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869766.1 protein_id gnl|my_center|LOCUS_10130 10213 10470 gene locus_tag LOCUS_10140 10213 10470 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762253.1 protein_id gnl|my_center|LOCUS_10140 10484 11623 gene locus_tag LOCUS_10150 10484 11623 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096516.1 protein_id gnl|my_center|LOCUS_10150 11634 12500 gene locus_tag LOCUS_10160 11634 12500 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879544.1 protein_id gnl|my_center|LOCUS_10160 12753 14036 gene locus_tag LOCUS_10170 gene cmr1 12753 14036 CDS product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855653.1 protein_id gnl|my_center|LOCUS_10170 14033 15184 gene locus_tag LOCUS_10180 14033 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 15212 15958 gene locus_tag LOCUS_10190 15212 15958 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence30 651 352 gene locus_tag LOCUS_10200 651 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 2538 652 gene locus_tag LOCUS_10210 2538 652 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011018621.1 protein_id gnl|my_center|LOCUS_10210 3830 2535 gene locus_tag LOCUS_10220 3830 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 4212 3832 gene locus_tag LOCUS_10230 4212 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 4489 4214 gene locus_tag LOCUS_10240 4489 4214 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_10240 4913 4743 gene locus_tag LOCUS_10250 4913 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 5248 4919 gene locus_tag LOCUS_10260 5248 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 5590 5249 gene locus_tag LOCUS_10270 5590 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 5716 6069 gene locus_tag LOCUS_10280 5716 6069 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879705.1 protein_id gnl|my_center|LOCUS_10280 6728 8020 gene locus_tag LOCUS_10290 6728 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 8076 8663 gene locus_tag LOCUS_10300 8076 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 9729 8725 gene locus_tag LOCUS_10310 9729 8725 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061302.1 protein_id gnl|my_center|LOCUS_10310 11171 9882 gene locus_tag LOCUS_10320 11171 9882 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877734.1 protein_id gnl|my_center|LOCUS_10320 12430 11168 gene locus_tag LOCUS_10330 12430 11168 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878570.1 protein_id gnl|my_center|LOCUS_10330 13340 12720 gene locus_tag LOCUS_10340 gene rpsB 13340 12720 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878629.1 protein_id gnl|my_center|LOCUS_10340 13574 13431 gene locus_tag LOCUS_10350 13574 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 13788 13714 gene locus_tag LOCUS_t00320 13788 13714 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13974 13774 gene locus_tag LOCUS_10360 13974 13774 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878626.1 protein_id gnl|my_center|LOCUS_10360 14379 13981 gene locus_tag LOCUS_10370 14379 13981 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_10370 14877 14389 gene locus_tag LOCUS_10380 gene rplM 14877 14389 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_10380 15252 14896 gene locus_tag LOCUS_10390 15252 14896 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095548.1 protein_id gnl|my_center|LOCUS_10390 15368 15979 gene locus_tag LOCUS_10400 gene thiE 15368 15979 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868208.1 protein_id gnl|my_center|LOCUS_10400 16086 >16623 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcccactatggtctgattttatc >Feature sequence31 145 1383 gene locus_tag LOCUS_10410 145 1383 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877984.1 protein_id gnl|my_center|LOCUS_10410 1362 2204 gene locus_tag LOCUS_10420 1362 2204 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877985.1 protein_id gnl|my_center|LOCUS_10420 2291 3283 gene locus_tag LOCUS_10430 2291 3283 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064243.1 protein_id gnl|my_center|LOCUS_10430 3300 3935 gene locus_tag LOCUS_10440 3300 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878076.1 protein_id gnl|my_center|LOCUS_10440 3966 4127 gene locus_tag LOCUS_10450 3966 4127 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878077.1 protein_id gnl|my_center|LOCUS_10450 4140 4406 gene locus_tag LOCUS_10460 4140 4406 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878078.1 protein_id gnl|my_center|LOCUS_10460 4559 5176 gene locus_tag LOCUS_10470 4559 5176 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_10470 5242 5709 gene locus_tag LOCUS_10480 5242 5709 CDS product DUF2250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249672.1 protein_id gnl|my_center|LOCUS_10480 5822 6742 gene locus_tag LOCUS_10490 5822 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 7945 6773 gene locus_tag LOCUS_10500 7945 6773 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_10500 9994 7955 gene locus_tag LOCUS_10510 gene fdhF 9994 7955 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_10510 11069 10071 gene locus_tag LOCUS_10520 gene purM 11069 10071 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879189.1 protein_id gnl|my_center|LOCUS_10520 11709 11212 gene locus_tag LOCUS_10530 gene ilvN 11709 11212 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_10530 13390 11720 gene locus_tag LOCUS_10540 13390 11720 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879216.1 protein_id gnl|my_center|LOCUS_10540 14450 14175 gene locus_tag LOCUS_10550 14450 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence32 891 301 gene locus_tag LOCUS_10560 891 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1947 988 gene locus_tag LOCUS_10570 1947 988 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878259.1 protein_id gnl|my_center|LOCUS_10570 2724 2059 gene locus_tag LOCUS_10580 2724 2059 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879499.1 protein_id gnl|my_center|LOCUS_10580 3458 2736 gene locus_tag LOCUS_10590 3458 2736 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879740.1 protein_id gnl|my_center|LOCUS_10590 3586 4599 gene locus_tag LOCUS_10600 3586 4599 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064754.1 protein_id gnl|my_center|LOCUS_10600 5491 4670 gene locus_tag LOCUS_10610 5491 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 6116 5607 gene locus_tag LOCUS_10620 6116 5607 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879735.1 protein_id gnl|my_center|LOCUS_10620 6275 7054 gene locus_tag LOCUS_10630 6275 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 7196 8506 gene locus_tag LOCUS_10640 gene aroA 7196 8506 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878994.1 protein_id gnl|my_center|LOCUS_10640 8809 9585 gene locus_tag LOCUS_10650 8809 9585 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_10650 9788 11452 gene locus_tag LOCUS_10660 9788 11452 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_10660 11433 12185 gene locus_tag LOCUS_10670 11433 12185 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870684.1 protein_id gnl|my_center|LOCUS_10670 12335 13573 gene locus_tag LOCUS_10680 gene dnaG 12335 13573 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_10680 13704 14009 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcccactatggtctgattttatc >Feature sequence33 608 985 gene locus_tag LOCUS_10690 gene sepF 608 985 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878285.1 protein_id gnl|my_center|LOCUS_10690 1012 1590 gene locus_tag LOCUS_10700 1012 1590 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878286.1 protein_id gnl|my_center|LOCUS_10700 2181 1591 gene locus_tag LOCUS_10710 2181 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683780.1 protein_id gnl|my_center|LOCUS_10710 2362 2290 gene locus_tag LOCUS_t00330 2362 2290 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3169 2348 gene locus_tag LOCUS_10720 3169 2348 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878129.1 protein_id gnl|my_center|LOCUS_10720 3473 4288 gene locus_tag LOCUS_10730 3473 4288 CDS product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812774.1 protein_id gnl|my_center|LOCUS_10730 4470 4958 gene locus_tag LOCUS_10740 4470 4958 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879807.1 protein_id gnl|my_center|LOCUS_10740 4948 5610 gene locus_tag LOCUS_10750 4948 5610 CDS product RNase P subunit p30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879806.1 protein_id gnl|my_center|LOCUS_10750 5616 6029 gene locus_tag LOCUS_10760 5616 6029 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064245.1 protein_id gnl|my_center|LOCUS_10760 6220 6957 gene locus_tag LOCUS_10770 gene psmA 6220 6957 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_10770 6982 7689 gene locus_tag LOCUS_10780 6982 7689 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877998.1 protein_id gnl|my_center|LOCUS_10780 7686 8366 gene locus_tag LOCUS_10790 gene rrp4 7686 8366 CDS product exosome complex protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877999.1 protein_id gnl|my_center|LOCUS_10790 8353 9105 gene locus_tag LOCUS_10800 gene rrp41 8353 9105 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878000.1 protein_id gnl|my_center|LOCUS_10800 9159 9977 gene locus_tag LOCUS_10810 gene rrp42 9159 9977 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878001.1 protein_id gnl|my_center|LOCUS_10810 9955 10215 gene locus_tag LOCUS_10820 gene rpl37A 9955 10215 CDS product 50S ribosomal protein L37Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877571.1 protein_id gnl|my_center|LOCUS_10820 10832 10278 gene locus_tag LOCUS_10830 10832 10278 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878817.1 protein_id gnl|my_center|LOCUS_10830 11430 12677 gene locus_tag LOCUS_10840 gene cbpB 11430 12677 CDS product peptide-modifying radical SAM enzyme CbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879693.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence34 2245 152 gene locus_tag LOCUS_10850 2245 152 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878656.1 protein_id gnl|my_center|LOCUS_10850 2567 2238 gene locus_tag LOCUS_10860 gene ahaH 2567 2238 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591748.1 protein_id gnl|my_center|LOCUS_10860 3837 2767 gene locus_tag LOCUS_10870 3837 2767 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878780.1 protein_id gnl|my_center|LOCUS_10870 3870 4415 gene locus_tag LOCUS_10880 gene thpR 3870 4415 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 protein_id gnl|my_center|LOCUS_10880 4425 5795 gene locus_tag LOCUS_10890 gene cca 4425 5795 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879645.1 protein_id gnl|my_center|LOCUS_10890 5878 6537 gene locus_tag LOCUS_10900 gene npdG 5878 6537 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_10900 6680 6889 gene locus_tag LOCUS_10910 6680 6889 CDS product archaeal histone A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867469.1 protein_id gnl|my_center|LOCUS_10910 7240 8652 gene locus_tag LOCUS_10920 7240 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 8658 8912 gene locus_tag LOCUS_10930 8658 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 9608 9069 gene locus_tag LOCUS_10940 9608 9069 CDS product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878786.1 protein_id gnl|my_center|LOCUS_10940 9824 11185 gene locus_tag LOCUS_10950 9824 11185 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250060.1 protein_id gnl|my_center|LOCUS_10950 11306 11381 gene locus_tag LOCUS_t00340 11306 11381 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12376 11519 gene locus_tag LOCUS_10960 12376 11519 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064458.1 protein_id gnl|my_center|LOCUS_10960 12944 12576 gene locus_tag LOCUS_10970 12944 12576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence35 376 816 gene locus_tag LOCUS_10980 376 816 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878603.1 protein_id gnl|my_center|LOCUS_10980 842 1999 gene locus_tag LOCUS_10990 842 1999 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064188.1 protein_id gnl|my_center|LOCUS_10990 1996 2391 gene locus_tag LOCUS_11000 1996 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2533 2784 gene locus_tag LOCUS_11010 2533 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2911 3528 gene locus_tag LOCUS_11020 2911 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3635 4468 gene locus_tag LOCUS_11030 3635 4468 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878916.1 protein_id gnl|my_center|LOCUS_11030 5154 4495 gene locus_tag LOCUS_11040 5154 4495 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879188.1 protein_id gnl|my_center|LOCUS_11040 5429 5196 gene locus_tag LOCUS_11050 5429 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 5611 6657 gene locus_tag LOCUS_11060 5611 6657 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262757.1 protein_id gnl|my_center|LOCUS_11060 8134 6764 gene locus_tag LOCUS_11070 8134 6764 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004069588.1 protein_id gnl|my_center|LOCUS_11070 8166 9158 gene locus_tag LOCUS_11080 8166 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 9251 9715 gene locus_tag LOCUS_11090 9251 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 10325 9771 gene locus_tag LOCUS_11100 gene pyrE 10325 9771 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318736.1 protein_id gnl|my_center|LOCUS_11100 10913 10338 gene locus_tag LOCUS_11110 10913 10338 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879236.1 protein_id gnl|my_center|LOCUS_11110 11829 11005 gene locus_tag LOCUS_11120 11829 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 12505 11978 gene locus_tag LOCUS_11130 12505 11978 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence36 1255 1485 gene locus_tag LOCUS_11140 1255 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1498 1791 gene locus_tag LOCUS_11150 1498 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2128 1799 gene locus_tag LOCUS_11160 2128 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 3135 2170 gene locus_tag LOCUS_11170 gene mch 3135 2170 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879428.1 protein_id gnl|my_center|LOCUS_11170 3303 4952 gene locus_tag LOCUS_11180 3303 4952 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_11180 7340 5325 gene locus_tag LOCUS_11190 7340 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 7983 7471 gene locus_tag LOCUS_11200 7983 7471 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878592.1 protein_id gnl|my_center|LOCUS_11200 8212 8760 gene locus_tag LOCUS_11210 8212 8760 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320297.1 protein_id gnl|my_center|LOCUS_11210 9266 8796 gene locus_tag LOCUS_11220 9266 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 10163 9270 gene locus_tag LOCUS_11230 10163 9270 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877636.1 protein_id gnl|my_center|LOCUS_11230 10559 11236 gene locus_tag LOCUS_11240 10559 11236 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879429.1 protein_id gnl|my_center|LOCUS_11240 11265 12167 gene locus_tag LOCUS_11250 11265 12167 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878818.1 protein_id gnl|my_center|LOCUS_11250 12524 12171 gene locus_tag LOCUS_11260 12524 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879004.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence37 245 1228 gene locus_tag LOCUS_11270 245 1228 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878435.1 protein_id gnl|my_center|LOCUS_11270 1238 1942 gene locus_tag LOCUS_11280 1238 1942 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878436.1 protein_id gnl|my_center|LOCUS_11280 2113 2814 gene locus_tag LOCUS_11290 2113 2814 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879901.1 protein_id gnl|my_center|LOCUS_11290 2834 3871 gene locus_tag LOCUS_11300 2834 3871 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_11300 3885 5042 gene locus_tag LOCUS_11310 3885 5042 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_11310 5084 5470 gene locus_tag LOCUS_11320 5084 5470 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_11320 5890 5534 gene locus_tag LOCUS_11330 5890 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6345 5896 gene locus_tag LOCUS_11340 6345 5896 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877967.1 protein_id gnl|my_center|LOCUS_11340 7241 6447 gene locus_tag LOCUS_11350 7241 6447 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877968.1 protein_id gnl|my_center|LOCUS_11350 7581 8951 gene locus_tag LOCUS_11360 gene sat 7581 8951 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064439.1 protein_id gnl|my_center|LOCUS_11360 8965 9312 gene locus_tag LOCUS_11370 8965 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064720.1 protein_id gnl|my_center|LOCUS_11370 9447 9890 gene locus_tag LOCUS_11380 gene aprB 9447 9890 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_11380 9905 11788 gene locus_tag LOCUS_11390 gene aprA 9905 11788 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence38 522 319 gene locus_tag LOCUS_11400 522 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 829 2061 gene locus_tag LOCUS_11410 829 2061 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878649.1 protein_id gnl|my_center|LOCUS_11410 2061 2387 gene locus_tag LOCUS_11420 2061 2387 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879026.1 protein_id gnl|my_center|LOCUS_11420 2398 2751 gene locus_tag LOCUS_11430 2398 2751 CDS product RNA polymerase Rpb4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064405.1 protein_id gnl|my_center|LOCUS_11430 2781 3731 gene locus_tag LOCUS_11440 2781 3731 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870386.1 protein_id gnl|my_center|LOCUS_11440 3743 4945 gene locus_tag LOCUS_11450 3743 4945 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939181.1 protein_id gnl|my_center|LOCUS_11450 4968 5342 gene locus_tag LOCUS_11460 4968 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 6493 5339 gene locus_tag LOCUS_11470 6493 5339 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583802.1 protein_id gnl|my_center|LOCUS_11470 6609 7379 gene locus_tag LOCUS_11480 6609 7379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879850.1 protein_id gnl|my_center|LOCUS_11480 7401 8516 gene locus_tag LOCUS_11490 7401 8516 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096393.1 protein_id gnl|my_center|LOCUS_11490 8553 9806 gene locus_tag LOCUS_11500 8553 9806 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879234.1 protein_id gnl|my_center|LOCUS_11500 9811 10020 gene locus_tag LOCUS_11510 9811 10020 CDS product DUF1922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876808.1 protein_id gnl|my_center|LOCUS_11510 10039 10449 gene locus_tag LOCUS_11520 10039 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879819.1 protein_id gnl|my_center|LOCUS_11520 10468 10866 gene locus_tag LOCUS_11530 10468 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 10879 11913 gene locus_tag LOCUS_11540 10879 11913 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878752.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence39 893 246 gene locus_tag LOCUS_11550 893 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1455 2891 gene locus_tag LOCUS_11560 1455 2891 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879447.1 protein_id gnl|my_center|LOCUS_11560 2978 4624 gene locus_tag LOCUS_11570 gene pheT 2978 4624 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_11570 4835 5467 gene locus_tag LOCUS_11580 4835 5467 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877878.1 protein_id gnl|my_center|LOCUS_11580 5955 5479 gene locus_tag LOCUS_11590 5955 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 6111 7355 gene locus_tag LOCUS_11600 gene gatD 6111 7355 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319255.1 protein_id gnl|my_center|LOCUS_11600 7484 8113 gene locus_tag LOCUS_11610 7484 8113 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_11610 8193 8651 gene locus_tag LOCUS_11620 8193 8651 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604768.1 protein_id gnl|my_center|LOCUS_11620 9145 8699 gene locus_tag LOCUS_11630 9145 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 9950 9336 gene locus_tag LOCUS_11640 9950 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 10212 10763 gene locus_tag LOCUS_11650 10212 10763 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879609.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence40 876 658 gene locus_tag LOCUS_11660 876 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11660 1147 935 gene locus_tag LOCUS_11670 1147 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1352 1182 gene locus_tag LOCUS_11680 1352 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1968 1657 gene locus_tag LOCUS_11690 1968 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11690 2300 2013 gene locus_tag LOCUS_11700 2300 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11700 2886 2545 gene locus_tag LOCUS_11710 gene vnfG 2886 2545 CDS product V-containing nitrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021238.1 protein_id gnl|my_center|LOCUS_11710 4024 3092 gene locus_tag LOCUS_11720 4024 3092 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096256.1 protein_id gnl|my_center|LOCUS_11720 4824 4090 gene locus_tag LOCUS_11730 gene ribB 4824 4090 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879598.1 protein_id gnl|my_center|LOCUS_11730 5526 4870 gene locus_tag LOCUS_11740 5526 4870 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_11740 6975 5605 gene locus_tag LOCUS_11750 gene purF 6975 5605 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878374.1 protein_id gnl|my_center|LOCUS_11750 7237 7058 gene locus_tag LOCUS_11760 7237 7058 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878375.1 protein_id gnl|my_center|LOCUS_11760 7480 7253 gene locus_tag LOCUS_11770 7480 7253 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_11770 7559 8053 gene locus_tag LOCUS_11780 7559 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878902.1 protein_id gnl|my_center|LOCUS_11780 8065 8796 gene locus_tag LOCUS_11790 gene rpiA 8065 8796 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878443.1 protein_id gnl|my_center|LOCUS_11790 8966 10012 gene locus_tag LOCUS_11800 8966 10012 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877877.1 protein_id gnl|my_center|LOCUS_11800 10098 11039 gene locus_tag LOCUS_11810 10098 11039 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876717.1 protein_id gnl|my_center|LOCUS_11810 11029 11778 gene locus_tag LOCUS_11820 11029 11778 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022096.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence41 210 1502 gene locus_tag LOCUS_11830 210 1502 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878362.1 protein_id gnl|my_center|LOCUS_11830 2053 1517 gene locus_tag LOCUS_11840 2053 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2579 2160 gene locus_tag LOCUS_11850 2579 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3940 2573 gene locus_tag LOCUS_11860 3940 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 4710 3937 gene locus_tag LOCUS_11870 4710 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 5342 4707 gene locus_tag LOCUS_11880 5342 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 5506 5327 gene locus_tag LOCUS_11890 5506 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 6056 6928 gene locus_tag LOCUS_11900 6056 6928 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879330.1 protein_id gnl|my_center|LOCUS_11900 7078 7671 gene locus_tag LOCUS_11910 7078 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 7726 8556 gene locus_tag LOCUS_11920 gene speE 7726 8556 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879823.1 protein_id gnl|my_center|LOCUS_11920 10362 8647 gene locus_tag LOCUS_11930 gene gatE 10362 8647 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878937.1 protein_id gnl|my_center|LOCUS_11930 11273 10608 gene locus_tag LOCUS_11940 11273 10608 CDS product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878216.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence42 357 211 gene locus_tag LOCUS_11950 357 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 584 372 gene locus_tag LOCUS_11960 584 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1274 1032 gene locus_tag LOCUS_11970 1274 1032 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_11970 1492 1271 gene locus_tag LOCUS_11980 1492 1271 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227795.1 protein_id gnl|my_center|LOCUS_11980 2863 5151 gene locus_tag LOCUS_11990 gene hdrA2 2863 5151 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878733.1 protein_id gnl|my_center|LOCUS_11990 5402 5890 gene locus_tag LOCUS_12000 5402 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 6386 7027 gene locus_tag LOCUS_12010 6386 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 7092 7766 gene locus_tag LOCUS_12020 7092 7766 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878772.1 protein_id gnl|my_center|LOCUS_12020 7882 8457 gene locus_tag LOCUS_12030 7882 8457 CDS product ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879690.1 protein_id gnl|my_center|LOCUS_12030 8454 9446 gene locus_tag LOCUS_12040 8454 9446 CDS product NOL1/NOP2/sun family putative RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879531.1 protein_id gnl|my_center|LOCUS_12040 9523 10113 gene locus_tag LOCUS_12050 9523 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 10568 10110 gene locus_tag LOCUS_12060 10568 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence43 931 248 gene locus_tag LOCUS_12070 931 248 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 protein_id gnl|my_center|LOCUS_12070 1087 3675 gene locus_tag LOCUS_12080 1087 3675 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879887.1 protein_id gnl|my_center|LOCUS_12080 3669 4649 gene locus_tag LOCUS_12090 3669 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879888.1 protein_id gnl|my_center|LOCUS_12090 4662 5690 gene locus_tag LOCUS_12100 4662 5690 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064578.1 protein_id gnl|my_center|LOCUS_12100 5659 6834 gene locus_tag LOCUS_12110 5659 6834 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879911.1 protein_id gnl|my_center|LOCUS_12110 6847 7404 gene locus_tag LOCUS_12120 6847 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 7995 7414 gene locus_tag LOCUS_12130 7995 7414 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_12130 8099 8407 gene locus_tag LOCUS_12140 8099 8407 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878607.1 protein_id gnl|my_center|LOCUS_12140 8440 9141 gene locus_tag LOCUS_12150 8440 9141 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978509.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence44 2233 1082 gene locus_tag LOCUS_12160 2233 1082 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181452.1 protein_id gnl|my_center|LOCUS_12160 4121 2358 gene locus_tag LOCUS_12170 4121 2358 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877518.1 protein_id gnl|my_center|LOCUS_12170 4279 4782 gene locus_tag LOCUS_12180 4279 4782 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878235.1 protein_id gnl|my_center|LOCUS_12180 4895 5518 gene locus_tag LOCUS_12190 4895 5518 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878230.1 protein_id gnl|my_center|LOCUS_12190 5592 6335 gene locus_tag LOCUS_12200 5592 6335 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878229.1 protein_id gnl|my_center|LOCUS_12200 6404 7027 gene locus_tag LOCUS_12210 6404 7027 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274383.1 protein_id gnl|my_center|LOCUS_12210 7050 8459 gene locus_tag LOCUS_12220 gene cobJ 7050 8459 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878227.1 protein_id gnl|my_center|LOCUS_12220 8476 9144 gene locus_tag LOCUS_12230 8476 9144 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878225.1 protein_id gnl|my_center|LOCUS_12230 9177 9590 gene locus_tag LOCUS_12240 gene cbiX 9177 9590 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878224.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence45 59 1261 gene locus_tag LOCUS_12250 59 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1258 1791 gene locus_tag LOCUS_12260 1258 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 4608 1927 gene locus_tag LOCUS_12270 4608 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4795 5436 gene locus_tag LOCUS_12280 4795 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 7603 5504 gene locus_tag LOCUS_12290 7603 5504 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_12290 7864 8940 gene locus_tag LOCUS_12300 7864 8940 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879068.1 protein_id gnl|my_center|LOCUS_12300 8972 9613 gene locus_tag LOCUS_12310 8972 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence46 1567 47 gene locus_tag LOCUS_12320 1567 47 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878691.1 protein_id gnl|my_center|LOCUS_12320 2620 2132 gene locus_tag LOCUS_12330 2620 2132 CDS product DUF2299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270501.1 protein_id gnl|my_center|LOCUS_12330 2680 2892 gene locus_tag LOCUS_12340 2680 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 3672 2896 gene locus_tag LOCUS_12350 3672 2896 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878498.1 protein_id gnl|my_center|LOCUS_12350 3862 4134 gene locus_tag LOCUS_12360 3862 4134 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878241.1 protein_id gnl|my_center|LOCUS_12360 4564 4115 gene locus_tag LOCUS_12370 gene rimI 4564 4115 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208657.1 protein_id gnl|my_center|LOCUS_12370 4604 5014 gene locus_tag LOCUS_12380 4604 5014 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878243.1 protein_id gnl|my_center|LOCUS_12380 5075 5242 gene locus_tag LOCUS_12390 5075 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 6239 5301 gene locus_tag LOCUS_12400 6239 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 6641 7357 gene locus_tag LOCUS_12410 6641 7357 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878668.1 protein_id gnl|my_center|LOCUS_12410 7464 8108 gene locus_tag LOCUS_12420 gene udg 7464 8108 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879766.1 protein_id gnl|my_center|LOCUS_12420 8227 9420 gene locus_tag LOCUS_12430 8227 9420 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878159.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence47 <1 737 gene locus_tag LOCUS_12440 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250397.1:methionine synthase 785 1504 gene locus_tag LOCUS_12450 gene thyX 785 1504 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459086.1 protein_id gnl|my_center|LOCUS_12450 2157 1507 gene locus_tag LOCUS_12460 gene radB 2157 1507 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320585.1 protein_id gnl|my_center|LOCUS_12460 2847 2179 gene locus_tag LOCUS_12470 2847 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 3193 4476 gene locus_tag LOCUS_12480 3193 4476 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878497.1 protein_id gnl|my_center|LOCUS_12480 4503 6185 gene locus_tag LOCUS_12490 4503 6185 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868709.1 protein_id gnl|my_center|LOCUS_12490 6580 6182 gene locus_tag LOCUS_12500 6580 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 6653 7393 gene locus_tag LOCUS_12510 6653 7393 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877842.1 protein_id gnl|my_center|LOCUS_12510 8666 7467 gene locus_tag LOCUS_12520 8666 7467 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879739.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence48 629 339 gene locus_tag LOCUS_12530 629 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 806 1054 gene locus_tag LOCUS_12540 806 1054 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877866.1 protein_id gnl|my_center|LOCUS_12540 1051 1737 gene locus_tag LOCUS_12550 1051 1737 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877867.1 protein_id gnl|my_center|LOCUS_12550 2483 1824 gene locus_tag LOCUS_12560 2483 1824 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 protein_id gnl|my_center|LOCUS_12560 3001 2480 gene locus_tag LOCUS_12570 3001 2480 CDS product DUF531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877914.1 protein_id gnl|my_center|LOCUS_12570 3500 3081 gene locus_tag LOCUS_12580 3500 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4846 3572 gene locus_tag LOCUS_12590 4846 3572 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_12590 5614 4871 gene locus_tag LOCUS_12600 gene mtnP 5614 4871 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879284.1 protein_id gnl|my_center|LOCUS_12600 5660 5920 gene locus_tag LOCUS_12610 5660 5920 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879278.1 protein_id gnl|my_center|LOCUS_12610 7227 5935 gene locus_tag LOCUS_12620 gene eno 7227 5935 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105084.1 protein_id gnl|my_center|LOCUS_12620 7453 7372 gene locus_tag LOCUS_t00350 7453 7372 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7761 8729 gene locus_tag LOCUS_12630 7761 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence49 1249 206 gene locus_tag LOCUS_12640 1249 206 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064498.1 protein_id gnl|my_center|LOCUS_12640 1998 1372 gene locus_tag LOCUS_12650 1998 1372 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048174238.1 protein_id gnl|my_center|LOCUS_12650 3714 2134 gene locus_tag LOCUS_12660 3714 2134 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879805.1 protein_id gnl|my_center|LOCUS_12660 4458 3817 gene locus_tag LOCUS_12670 4458 3817 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879602.1 protein_id gnl|my_center|LOCUS_12670 5449 4493 gene locus_tag LOCUS_12680 5449 4493 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879603.1 protein_id gnl|my_center|LOCUS_12680 6765 5476 gene locus_tag LOCUS_12690 6765 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 7442 6888 gene locus_tag LOCUS_12700 7442 6888 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879683.1 protein_id gnl|my_center|LOCUS_12700 7500 8600 gene locus_tag LOCUS_12710 7500 8600 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877839.1 protein_id gnl|my_center|LOCUS_12710 9180 8824 gene locus_tag LOCUS_12720 9180 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence50 1384 647 gene locus_tag LOCUS_12730 1384 647 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250964.1 protein_id gnl|my_center|LOCUS_12730 1496 1855 gene locus_tag LOCUS_12740 1496 1855 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870086.1 protein_id gnl|my_center|LOCUS_12740 1861 2718 gene locus_tag LOCUS_12750 1861 2718 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081367.1 protein_id gnl|my_center|LOCUS_12750 3678 2719 gene locus_tag LOCUS_12760 3678 2719 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879855.1 protein_id gnl|my_center|LOCUS_12760 3740 5029 gene locus_tag LOCUS_12770 gene truD 3740 5029 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879173.1 protein_id gnl|my_center|LOCUS_12770 7231 6029 gene locus_tag LOCUS_12780 7231 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 7625 7254 gene locus_tag LOCUS_12790 7625 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 8447 7677 gene locus_tag LOCUS_12800 8447 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065938.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence51 215 1396 gene locus_tag LOCUS_12810 215 1396 CDS product acetylornithine/succinylornithine family transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877594.1 protein_id gnl|my_center|LOCUS_12810 1428 2915 gene locus_tag LOCUS_12820 gene lysS 1428 2915 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878711.1 protein_id gnl|my_center|LOCUS_12820 2984 4000 gene locus_tag LOCUS_12830 2984 4000 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064351.1 protein_id gnl|my_center|LOCUS_12830 4020 4322 gene locus_tag LOCUS_12840 4020 4322 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878713.1 protein_id gnl|my_center|LOCUS_12840 4435 5322 gene locus_tag LOCUS_12850 gene uppS 4435 5322 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878714.1 protein_id gnl|my_center|LOCUS_12850 6456 5398 gene locus_tag LOCUS_12860 6456 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 7233 6469 gene locus_tag LOCUS_12870 gene cbiQ 7233 6469 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877313.1 protein_id gnl|my_center|LOCUS_12870 7702 7349 gene locus_tag LOCUS_12880 7702 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 <8217 7695 gene locus_tag LOCUS_12890 <8217 7695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964674.1:energy-coupling factor ABC transporter permease >Feature sequence52 701 629 gene locus_tag LOCUS_t00360 701 629 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1681 755 gene locus_tag LOCUS_12900 1681 755 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879847.1 protein_id gnl|my_center|LOCUS_12900 1948 3036 gene locus_tag LOCUS_12910 1948 3036 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_12910 3193 3426 gene locus_tag LOCUS_12920 3193 3426 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_12920 3429 4085 gene locus_tag LOCUS_12930 3429 4085 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878900.1 protein_id gnl|my_center|LOCUS_12930 4543 4100 gene locus_tag LOCUS_12940 4543 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 5089 4604 gene locus_tag LOCUS_12950 5089 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5689 5099 gene locus_tag LOCUS_12960 5689 5099 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877924.1 protein_id gnl|my_center|LOCUS_12960 7122 5830 gene locus_tag LOCUS_12970 7122 5830 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878158.1 protein_id gnl|my_center|LOCUS_12970 7184 7771 gene locus_tag LOCUS_12980 gene hisH 7184 7771 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879754.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence53 520 634 gene locus_tag LOCUS_r00030 520 634 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1233 667 gene locus_tag LOCUS_12990 1233 667 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879307.1 protein_id gnl|my_center|LOCUS_12990 2021 1317 gene locus_tag LOCUS_13000 2021 1317 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879644.1 protein_id gnl|my_center|LOCUS_13000 3365 2034 gene locus_tag LOCUS_13010 3365 2034 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064356.1 protein_id gnl|my_center|LOCUS_13010 3609 3352 gene locus_tag LOCUS_13020 3609 3352 CDS product RNA repair domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012939633.1 protein_id gnl|my_center|LOCUS_13020 4217 3702 gene locus_tag LOCUS_13030 4217 3702 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877928.1 protein_id gnl|my_center|LOCUS_13030 5803 4307 gene locus_tag LOCUS_13040 5803 4307 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879747.1 protein_id gnl|my_center|LOCUS_13040 6075 6518 gene locus_tag LOCUS_13050 6075 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence54 21 388 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gataaaatcagaccatagtgggattgaaag 1283 498 gene locus_tag LOCUS_13060 1283 498 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879771.1 protein_id gnl|my_center|LOCUS_13060 1743 1333 gene locus_tag LOCUS_13070 1743 1333 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879772.1 protein_id gnl|my_center|LOCUS_13070 2390 1851 gene locus_tag LOCUS_13080 gene rpsD 2390 1851 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879773.1 protein_id gnl|my_center|LOCUS_13080 2920 2411 gene locus_tag LOCUS_13090 2920 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3626 2955 gene locus_tag LOCUS_13100 gene larE 3626 2955 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878066.1 protein_id gnl|my_center|LOCUS_13100 3684 3756 gene locus_tag LOCUS_t00370 3684 3756 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4660 3833 gene locus_tag LOCUS_13110 4660 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5414 6517 gene locus_tag LOCUS_13120 5414 6517 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878110.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence55 1651 974 gene locus_tag LOCUS_13130 1651 974 CDS product DUF6293 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879479.1 protein_id gnl|my_center|LOCUS_13130 2014 3150 gene locus_tag LOCUS_13140 2014 3150 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846352.1 protein_id gnl|my_center|LOCUS_13140 3202 4524 gene locus_tag LOCUS_13150 3202 4524 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978478.1 protein_id gnl|my_center|LOCUS_13150 4901 4530 gene locus_tag LOCUS_13160 4901 4530 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879421.1 protein_id gnl|my_center|LOCUS_13160 5832 4969 gene locus_tag LOCUS_13170 5832 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064248.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence56 645 563 gene locus_tag LOCUS_t00380 645 563 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2220 652 gene locus_tag LOCUS_13180 2220 652 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064281.1 protein_id gnl|my_center|LOCUS_13180 2964 2329 gene locus_tag LOCUS_13190 2964 2329 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_13190 5717 3063 gene locus_tag LOCUS_13200 5717 3063 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055983.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence57 188 487 gene locus_tag LOCUS_13210 188 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 705 2903 gene locus_tag LOCUS_13220 gene katG 705 2903 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966622.1 protein_id gnl|my_center|LOCUS_13220 3078 3716 gene locus_tag LOCUS_13230 3078 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4005 4418 gene locus_tag LOCUS_13240 4005 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064510.1 protein_id gnl|my_center|LOCUS_13240 4421 4894 gene locus_tag LOCUS_13250 4421 4894 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320322.1 protein_id gnl|my_center|LOCUS_13250 4905 5315 gene locus_tag LOCUS_13260 4905 5315 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence58 370 188 gene locus_tag LOCUS_13270 370 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 517 1509 gene locus_tag LOCUS_13280 517 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877545.1 protein_id gnl|my_center|LOCUS_13280 1496 2332 gene locus_tag LOCUS_13290 1496 2332 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868181.1 protein_id gnl|my_center|LOCUS_13290 2562 2723 gene locus_tag LOCUS_13300 2562 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 2798 3013 gene locus_tag LOCUS_13310 2798 3013 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878240.1 protein_id gnl|my_center|LOCUS_13310 3806 4000 gene locus_tag LOCUS_13320 3806 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 4000 4473 gene locus_tag LOCUS_13330 4000 4473 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879687.1 protein_id gnl|my_center|LOCUS_13330 4567 4493 gene locus_tag LOCUS_t00390 4567 4493 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence59 578 2893 gene locus_tag LOCUS_13340 578 2893 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146523.1 protein_id gnl|my_center|LOCUS_13340 3133 3339 gene locus_tag LOCUS_13350 3133 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 3326 3559 gene locus_tag LOCUS_13360 3326 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3516 3704 gene locus_tag LOCUS_13370 3516 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence60 1777 695 gene locus_tag LOCUS_13380 gene mqnC 1777 695 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877897.1 protein_id gnl|my_center|LOCUS_13380 2622 1858 gene locus_tag LOCUS_13390 2622 1858 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064224.1 protein_id gnl|my_center|LOCUS_13390 3114 2680 gene locus_tag LOCUS_13400 3114 2680 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878568.1 protein_id gnl|my_center|LOCUS_13400 3481 3092 gene locus_tag LOCUS_13410 3481 3092 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545102.1 protein_id gnl|my_center|LOCUS_13410 4882 3566 gene locus_tag LOCUS_13420 gene aspS 4882 3566 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence61 323 1330 gene locus_tag LOCUS_13430 gene pdxS 323 1330 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878015.1 protein_id gnl|my_center|LOCUS_13430 1397 2083 gene locus_tag LOCUS_13440 gene pdxT 1397 2083 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878016.1 protein_id gnl|my_center|LOCUS_13440 4371 2110 gene locus_tag LOCUS_13450 4371 2110 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879109.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence62 <1 665 gene locus_tag LOCUS_13460 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878948.1:thermosome subunit beta 895 1623 gene locus_tag LOCUS_13470 895 1623 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878746.1 protein_id gnl|my_center|LOCUS_13470 1634 2038 gene locus_tag LOCUS_13480 1634 2038 CDS product DUF473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878745.1 protein_id gnl|my_center|LOCUS_13480 3093 2035 gene locus_tag LOCUS_13490 3093 2035 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_13490 3214 3768 gene locus_tag LOCUS_13500 3214 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence63 1257 1006 gene locus_tag LOCUS_13510 1257 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1486 2130 gene locus_tag LOCUS_13520 1486 2130 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879809.1 protein_id gnl|my_center|LOCUS_13520 2431 3537 gene locus_tag LOCUS_13530 2431 3537 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879526.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence64 803 1543 gene locus_tag LOCUS_13540 803 1543 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320172.1 protein_id gnl|my_center|LOCUS_13540 2119 1502 gene locus_tag LOCUS_13550 2119 1502 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879281.1 protein_id gnl|my_center|LOCUS_13550 3053 2124 gene locus_tag LOCUS_13560 3053 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence65 1341 427 gene locus_tag LOCUS_13570 1341 427 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_13570 2117 1368 gene locus_tag LOCUS_13580 2117 1368 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214510.1 protein_id gnl|my_center|LOCUS_13580 3380 2190 gene locus_tag LOCUS_13590 3380 2190 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence66 230 90 gene locus_tag LOCUS_13600 230 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 740 2494 gene locus_tag LOCUS_13610 740 2494 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878782.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence67 21 290 gene locus_tag LOCUS_13620 21 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1410 1225 gene locus_tag LOCUS_13630 1410 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 <3241 1497 gene locus_tag LOCUS_13640 <3241 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878431.1:molybdopterin biosynthesis protein >Feature sequence68 237 1022 gene locus_tag LOCUS_13650 237 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2142 1120 gene locus_tag LOCUS_13660 gene rtcA 2142 1120 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence69 1061 609 gene locus_tag LOCUS_13670 gene pfdA 1061 609 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879555.1 protein_id gnl|my_center|LOCUS_13670 1296 1102 gene locus_tag LOCUS_13680 gene rpl18a 1296 1102 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879556.1 protein_id gnl|my_center|LOCUS_13680 2031 1402 gene locus_tag LOCUS_13690 2031 1402 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879557.1 protein_id gnl|my_center|LOCUS_13690 2346 2080 gene locus_tag LOCUS_13700 2346 2080 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879558.1 protein_id gnl|my_center|LOCUS_13700 2523 2371 gene locus_tag LOCUS_13710 2523 2371 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879559.1 protein_id gnl|my_center|LOCUS_13710 2869 2528 gene locus_tag LOCUS_13720 2869 2528 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064758.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence70 <1 603 gene locus_tag LOCUS_13730 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878496.1:type II/IV secretion system ATPase subunit 578 2539 gene locus_tag LOCUS_13740 578 2539 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence71 1111 638 gene locus_tag LOCUS_13750 1111 638 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878045.1 protein_id gnl|my_center|LOCUS_13750 1628 1155 gene locus_tag LOCUS_13760 1628 1155 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878044.1 protein_id gnl|my_center|LOCUS_13760 1919 1695 gene locus_tag LOCUS_13770 1919 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 <2556 1952 gene locus_tag LOCUS_13780 <2556 1952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064630.1:cell division protein FtsZ