>Feature sequence01 414 157 gene locus_tag LOCUS_00010 414 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 498 1982 gene locus_tag LOCUS_00020 498 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2836 1979 gene locus_tag LOCUS_00030 2836 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3457 2891 gene locus_tag LOCUS_00040 3457 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3548 4828 gene locus_tag LOCUS_00050 gene eno 3548 4828 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496902.1 protein_id gnl|my_center|LOCUS_00050 4902 5642 gene locus_tag LOCUS_00060 4902 5642 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250541.1 protein_id gnl|my_center|LOCUS_00060 5733 6260 gene locus_tag LOCUS_00070 5733 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870566.1 protein_id gnl|my_center|LOCUS_00070 6361 7539 gene locus_tag LOCUS_00080 gene mpgS 6361 7539 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868345.1 protein_id gnl|my_center|LOCUS_00080 7550 8470 gene locus_tag LOCUS_00090 7550 8470 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762659.1 protein_id gnl|my_center|LOCUS_00090 8509 10161 gene locus_tag LOCUS_00100 8509 10161 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762019.1 protein_id gnl|my_center|LOCUS_00100 10353 10276 gene locus_tag LOCUS_t00010 10353 10276 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10818 10339 gene locus_tag LOCUS_00110 10818 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10907 13195 gene locus_tag LOCUS_00120 10907 13195 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249526.1 protein_id gnl|my_center|LOCUS_00120 13208 14305 gene locus_tag LOCUS_00130 13208 14305 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_00130 14385 16457 gene locus_tag LOCUS_00140 14385 16457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17238 16447 gene locus_tag LOCUS_00150 17238 16447 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_00150 17330 18913 gene locus_tag LOCUS_00160 17330 18913 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978525.1 protein_id gnl|my_center|LOCUS_00160 23022 18931 gene locus_tag LOCUS_00170 23022 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23270 24043 gene locus_tag LOCUS_00180 23270 24043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24036 24590 gene locus_tag LOCUS_00190 24036 24590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24682 26706 gene locus_tag LOCUS_00200 24682 26706 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250266.1 protein_id gnl|my_center|LOCUS_00200 29585 26703 gene locus_tag LOCUS_00210 29585 26703 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978365.1 protein_id gnl|my_center|LOCUS_00210 30013 29804 gene locus_tag LOCUS_00220 30013 29804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 30300 31442 gene locus_tag LOCUS_00230 30300 31442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 31490 31852 gene locus_tag LOCUS_00240 31490 31852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 32221 31844 gene locus_tag LOCUS_00250 32221 31844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 32325 33077 gene locus_tag LOCUS_00260 32325 33077 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978361.1 protein_id gnl|my_center|LOCUS_00260 34216 33446 gene locus_tag LOCUS_00270 34216 33446 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762656.1 protein_id gnl|my_center|LOCUS_00270 34890 34201 gene locus_tag LOCUS_00280 34890 34201 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249269.1 protein_id gnl|my_center|LOCUS_00280 35394 34981 gene locus_tag LOCUS_00290 35394 34981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 35570 38734 gene locus_tag LOCUS_00300 gene ileS 35570 38734 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978404.1 protein_id gnl|my_center|LOCUS_00300 38749 39393 gene locus_tag LOCUS_00310 38749 39393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39452 40369 gene locus_tag LOCUS_00320 39452 40369 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_00320 40371 42098 gene locus_tag LOCUS_00330 40371 42098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 42178 42606 gene locus_tag LOCUS_00340 42178 42606 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763431.1 protein_id gnl|my_center|LOCUS_00340 42618 43088 gene locus_tag LOCUS_00350 42618 43088 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978397.1 protein_id gnl|my_center|LOCUS_00350 43094 43807 gene locus_tag LOCUS_00360 43094 43807 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978396.1 protein_id gnl|my_center|LOCUS_00360 43826 44026 gene locus_tag LOCUS_00370 gene rpmC 43826 44026 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763454.1 protein_id gnl|my_center|LOCUS_00370 44156 44440 gene locus_tag LOCUS_00380 44156 44440 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875653.1 protein_id gnl|my_center|LOCUS_00380 44458 44808 gene locus_tag LOCUS_00390 44458 44808 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_00390 44810 45232 gene locus_tag LOCUS_00400 44810 45232 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846308.1 protein_id gnl|my_center|LOCUS_00400 45245 45625 gene locus_tag LOCUS_00410 gene rplX 45245 45625 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_00410 45674 46435 gene locus_tag LOCUS_00420 45674 46435 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250480.1 protein_id gnl|my_center|LOCUS_00420 46432 46995 gene locus_tag LOCUS_00430 46432 46995 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250479.1 protein_id gnl|my_center|LOCUS_00430 47009 47173 gene locus_tag LOCUS_00440 47009 47173 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978389.1 protein_id gnl|my_center|LOCUS_00440 47184 47585 gene locus_tag LOCUS_00450 47184 47585 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978388.1 protein_id gnl|my_center|LOCUS_00450 47600 48151 gene locus_tag LOCUS_00460 47600 48151 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978387.1 protein_id gnl|my_center|LOCUS_00460 48148 48543 gene locus_tag LOCUS_00470 48148 48543 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978386.1 protein_id gnl|my_center|LOCUS_00470 48543 49001 gene locus_tag LOCUS_00480 48543 49001 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867445.1 protein_id gnl|my_center|LOCUS_00480 49014 49643 gene locus_tag LOCUS_00490 49014 49643 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978384.1 protein_id gnl|my_center|LOCUS_00490 49640 50278 gene locus_tag LOCUS_00500 49640 50278 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978383.1 protein_id gnl|my_center|LOCUS_00500 50294 50785 gene locus_tag LOCUS_00510 50294 50785 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 protein_id gnl|my_center|LOCUS_00510 50798 51250 gene locus_tag LOCUS_00520 50798 51250 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 protein_id gnl|my_center|LOCUS_00520 51467 51389 gene locus_tag LOCUS_t00020 51467 51389 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 51549 52538 gene locus_tag LOCUS_00530 51549 52538 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584103.1 protein_id gnl|my_center|LOCUS_00530 52540 53532 gene locus_tag LOCUS_00540 52540 53532 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_00540 53708 53529 gene locus_tag LOCUS_00550 53708 53529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 53796 54044 gene locus_tag LOCUS_00560 53796 54044 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846780.1 protein_id gnl|my_center|LOCUS_00560 54299 54036 gene locus_tag LOCUS_00570 54299 54036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 54489 56342 gene locus_tag LOCUS_00580 54489 56342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 57098 56364 gene locus_tag LOCUS_00590 57098 56364 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060841.1 protein_id gnl|my_center|LOCUS_00590 57363 57067 gene locus_tag LOCUS_00600 57363 57067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 57496 58740 gene locus_tag LOCUS_00610 gene ahcY 57496 58740 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 protein_id gnl|my_center|LOCUS_00610 58915 59325 gene locus_tag LOCUS_00620 58915 59325 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479566.1 protein_id gnl|my_center|LOCUS_00620 59388 59987 gene locus_tag LOCUS_00630 59388 59987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 60421 60035 gene locus_tag LOCUS_00640 gene speD 60421 60035 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650921.1 protein_id gnl|my_center|LOCUS_00640 60554 61369 gene locus_tag LOCUS_00650 60554 61369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 61356 61565 gene locus_tag LOCUS_00660 61356 61565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 62932 61583 gene locus_tag LOCUS_00670 62932 61583 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 protein_id gnl|my_center|LOCUS_00670 63740 62943 gene locus_tag LOCUS_00680 63740 62943 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_00680 63845 64297 gene locus_tag LOCUS_00690 gene hjc 63845 64297 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846967.1 protein_id gnl|my_center|LOCUS_00690 65850 64294 gene locus_tag LOCUS_00700 65850 64294 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979490.1 protein_id gnl|my_center|LOCUS_00700 65945 66793 gene locus_tag LOCUS_00710 65945 66793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 68013 66853 gene locus_tag LOCUS_00720 gene thiI 68013 66853 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980307.1 protein_id gnl|my_center|LOCUS_00720 68079 68528 gene locus_tag LOCUS_00730 68079 68528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 68547 69509 gene locus_tag LOCUS_00740 68547 69509 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762696.1 protein_id gnl|my_center|LOCUS_00740 69531 70562 gene locus_tag LOCUS_00750 69531 70562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 70850 70569 gene locus_tag LOCUS_00760 70850 70569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 70900 71808 gene locus_tag LOCUS_00770 70900 71808 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846368.1 protein_id gnl|my_center|LOCUS_00770 71805 72407 gene locus_tag LOCUS_00780 71805 72407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979538.1 protein_id gnl|my_center|LOCUS_00780 73455 72340 gene locus_tag LOCUS_00790 73455 72340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 73572 74948 gene locus_tag LOCUS_00800 gene cdr 73572 74948 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250250.1 protein_id gnl|my_center|LOCUS_00800 75358 74945 gene locus_tag LOCUS_00810 75358 74945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 75485 76777 gene locus_tag LOCUS_00820 75485 76777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 78164 76785 gene locus_tag LOCUS_00830 78164 76785 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763429.1 protein_id gnl|my_center|LOCUS_00830 78282 79445 gene locus_tag LOCUS_00840 78282 79445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 80220 79453 gene locus_tag LOCUS_00850 80220 79453 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_00850 80382 81272 gene locus_tag LOCUS_00860 gene cyoE 80382 81272 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_00860 81533 81327 gene locus_tag LOCUS_00870 81533 81327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 81812 81681 gene locus_tag LOCUS_00880 81812 81681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 83014 82010 gene locus_tag LOCUS_00890 gene moaA 83014 82010 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979427.1 protein_id gnl|my_center|LOCUS_00890 83201 83125 gene locus_tag LOCUS_t00030 83201 83125 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 83887 83312 gene locus_tag LOCUS_00900 83887 83312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 84686 85180 gene locus_tag LOCUS_00910 84686 85180 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978503.1 protein_id gnl|my_center|LOCUS_00910 85908 85186 gene locus_tag LOCUS_00920 85908 85186 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762388.1 protein_id gnl|my_center|LOCUS_00920 85976 86737 gene locus_tag LOCUS_00930 85976 86737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 88011 86734 gene locus_tag LOCUS_00940 88011 86734 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582434.1 protein_id gnl|my_center|LOCUS_00940 88423 88028 gene locus_tag LOCUS_00950 88423 88028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979242.1 protein_id gnl|my_center|LOCUS_00950 88522 89601 gene locus_tag LOCUS_00960 88522 89601 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763325.1 protein_id gnl|my_center|LOCUS_00960 90136 89588 gene locus_tag LOCUS_00970 90136 89588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 90533 90216 gene locus_tag LOCUS_00980 90533 90216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 90696 92996 gene locus_tag LOCUS_00990 90696 92996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 92962 93612 gene locus_tag LOCUS_01000 92962 93612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 93716 94153 gene locus_tag LOCUS_01010 93716 94153 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978480.1 protein_id gnl|my_center|LOCUS_01010 94273 95568 gene locus_tag LOCUS_01020 94273 95568 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762742.1 protein_id gnl|my_center|LOCUS_01020 95565 97301 gene locus_tag LOCUS_01030 95565 97301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 97603 97406 gene locus_tag LOCUS_01040 97603 97406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 98307 97753 gene locus_tag LOCUS_01050 98307 97753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 98816 99097 gene locus_tag LOCUS_01060 98816 99097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 99649 99059 gene locus_tag LOCUS_01070 99649 99059 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_01070 101590 99662 gene locus_tag LOCUS_01080 101590 99662 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978723.1 protein_id gnl|my_center|LOCUS_01080 101728 102048 gene locus_tag LOCUS_01090 101728 102048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 102225 102377 gene locus_tag LOCUS_01100 102225 102377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 102451 102527 gene locus_tag LOCUS_t00040 102451 102527 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 102953 102567 gene locus_tag LOCUS_01110 gene cdd 102953 102567 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240361.1 protein_id gnl|my_center|LOCUS_01110 103004 104176 gene locus_tag LOCUS_01120 103004 104176 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846352.1 protein_id gnl|my_center|LOCUS_01120 104179 105570 gene locus_tag LOCUS_01130 104179 105570 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978478.1 protein_id gnl|my_center|LOCUS_01130 106418 105567 gene locus_tag LOCUS_01140 106418 105567 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876199.1 protein_id gnl|my_center|LOCUS_01140 106497 107519 gene locus_tag LOCUS_01150 106497 107519 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146584.1 protein_id gnl|my_center|LOCUS_01150 107538 107807 gene locus_tag LOCUS_01160 107538 107807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 108746 107820 gene locus_tag LOCUS_01170 gene mdh 108746 107820 CDS product NAD-dependent malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762366.1 protein_id gnl|my_center|LOCUS_01170 109409 108828 gene locus_tag LOCUS_01180 109409 108828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 110644 109412 gene locus_tag LOCUS_01190 110644 109412 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978258.1 protein_id gnl|my_center|LOCUS_01190 110762 110838 gene locus_tag LOCUS_t00050 110762 110838 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 111167 110865 gene locus_tag LOCUS_01200 111167 110865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 112285 111293 gene locus_tag LOCUS_01210 112285 111293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 112499 112744 gene locus_tag LOCUS_01220 112499 112744 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_01220 112843 114228 gene locus_tag LOCUS_01230 gene tiaS 112843 114228 CDS product tRNA(Ile2) 2-agmatinylcytidine synthetase TiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249508.1 protein_id gnl|my_center|LOCUS_01230 114591 115148 gene locus_tag LOCUS_01240 gene porC 114591 115148 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892553.1 protein_id gnl|my_center|LOCUS_01240 115209 115490 gene locus_tag LOCUS_01250 115209 115490 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762253.1 protein_id gnl|my_center|LOCUS_01250 115497 116732 gene locus_tag LOCUS_01260 115497 116732 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846988.1 protein_id gnl|my_center|LOCUS_01260 116739 117680 gene locus_tag LOCUS_01270 gene porB 116739 117680 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762255.1 protein_id gnl|my_center|LOCUS_01270 117752 118468 gene locus_tag LOCUS_01280 gene rpiA 117752 118468 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 protein_id gnl|my_center|LOCUS_01280 118416 118847 gene locus_tag LOCUS_01290 118416 118847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 119788 118850 gene locus_tag LOCUS_01300 gene arcC 119788 118850 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_01300 121314 119893 gene locus_tag LOCUS_01310 121314 119893 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence02 418 1866 gene locus_tag LOCUS_01320 418 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3051 1894 gene locus_tag LOCUS_01330 3051 1894 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081432771.1 protein_id gnl|my_center|LOCUS_01330 5058 3100 gene locus_tag LOCUS_01340 5058 3100 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979277.1 protein_id gnl|my_center|LOCUS_01340 5363 5058 gene locus_tag LOCUS_01350 5363 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 5467 6483 gene locus_tag LOCUS_01360 gene gyaR 5467 6483 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_01360 7134 6727 gene locus_tag LOCUS_01370 gene speD 7134 6727 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979389.1 protein_id gnl|my_center|LOCUS_01370 7341 11477 gene locus_tag LOCUS_01380 7341 11477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 11562 12050 gene locus_tag LOCUS_01390 11562 12050 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 protein_id gnl|my_center|LOCUS_01390 12728 12114 gene locus_tag LOCUS_01400 12728 12114 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979589.1 protein_id gnl|my_center|LOCUS_01400 12874 13794 gene locus_tag LOCUS_01410 12874 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 13763 15025 gene locus_tag LOCUS_01420 13763 15025 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020842.1 protein_id gnl|my_center|LOCUS_01420 14946 15722 gene locus_tag LOCUS_01430 14946 15722 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064968.1 protein_id gnl|my_center|LOCUS_01430 16745 15945 gene locus_tag LOCUS_01440 16745 15945 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869745.1 protein_id gnl|my_center|LOCUS_01440 16857 17984 gene locus_tag LOCUS_01450 16857 17984 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146675.1 protein_id gnl|my_center|LOCUS_01450 18578 18372 gene locus_tag LOCUS_01460 18578 18372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 18622 19539 gene locus_tag LOCUS_01470 18622 19539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 19526 20485 gene locus_tag LOCUS_01480 19526 20485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 21140 20472 gene locus_tag LOCUS_01490 21140 20472 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978111.1 protein_id gnl|my_center|LOCUS_01490 22002 21157 gene locus_tag LOCUS_01500 22002 21157 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496450.1 protein_id gnl|my_center|LOCUS_01500 22077 23708 gene locus_tag LOCUS_01510 gene lysS 22077 23708 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251190.1 protein_id gnl|my_center|LOCUS_01510 23705 24235 gene locus_tag LOCUS_01520 23705 24235 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_01520 25440 24367 gene locus_tag LOCUS_01530 25440 24367 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978466.1 protein_id gnl|my_center|LOCUS_01530 25588 26307 gene locus_tag LOCUS_01540 25588 26307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 26354 27949 gene locus_tag LOCUS_01550 26354 27949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 28902 27946 gene locus_tag LOCUS_01560 gene gdS-2 28902 27946 CDS product hexaprenyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978463.1 protein_id gnl|my_center|LOCUS_01560 29006 30232 gene locus_tag LOCUS_01570 gene ilvA 29006 30232 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978248.1 protein_id gnl|my_center|LOCUS_01570 30546 30238 gene locus_tag LOCUS_01580 gene yciH 30546 30238 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978313.1 protein_id gnl|my_center|LOCUS_01580 30673 30849 gene locus_tag LOCUS_01590 30673 30849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 31767 30859 gene locus_tag LOCUS_01600 gene speB 31767 30859 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978315.1 protein_id gnl|my_center|LOCUS_01600 31851 33599 gene locus_tag LOCUS_01610 gene glyS 31851 33599 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978316.1 protein_id gnl|my_center|LOCUS_01610 33620 33991 gene locus_tag LOCUS_01620 33620 33991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 34069 34422 gene locus_tag LOCUS_01630 34069 34422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 34555 35262 gene locus_tag LOCUS_01640 34555 35262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 35361 35906 gene locus_tag LOCUS_01650 gene endA 35361 35906 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_01650 36002 36463 gene locus_tag LOCUS_01660 36002 36463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015385509.1 protein_id gnl|my_center|LOCUS_01660 37022 36444 gene locus_tag LOCUS_01670 37022 36444 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060752.1 protein_id gnl|my_center|LOCUS_01670 37549 36998 gene locus_tag LOCUS_01680 37549 36998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 37634 37831 gene locus_tag LOCUS_01690 37634 37831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 37885 38931 gene locus_tag LOCUS_01700 37885 38931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 39038 40219 gene locus_tag LOCUS_01710 39038 40219 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846356.1 protein_id gnl|my_center|LOCUS_01710 41260 40220 gene locus_tag LOCUS_01720 41260 40220 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846752.1 protein_id gnl|my_center|LOCUS_01720 42022 41393 gene locus_tag LOCUS_01730 42022 41393 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249858.1 protein_id gnl|my_center|LOCUS_01730 42117 42617 gene locus_tag LOCUS_01740 42117 42617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 42733 43470 gene locus_tag LOCUS_01750 42733 43470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 43467 44144 gene locus_tag LOCUS_01760 gene pyrH 43467 44144 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 protein_id gnl|my_center|LOCUS_01760 45033 44137 gene locus_tag LOCUS_01770 45033 44137 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879344.1 protein_id gnl|my_center|LOCUS_01770 45201 45277 gene locus_tag LOCUS_t00060 45201 45277 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 45874 45293 gene locus_tag LOCUS_01780 45874 45293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 46664 45912 gene locus_tag LOCUS_01790 46664 45912 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251129.1 protein_id gnl|my_center|LOCUS_01790 46864 47751 gene locus_tag LOCUS_01800 46864 47751 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761913.1 protein_id gnl|my_center|LOCUS_01800 47817 48566 gene locus_tag LOCUS_01810 47817 48566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 50376 48682 gene locus_tag LOCUS_01820 gene thrS 50376 48682 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978967.1 protein_id gnl|my_center|LOCUS_01820 51755 50457 gene locus_tag LOCUS_01830 51755 50457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 53076 51781 gene locus_tag LOCUS_01840 53076 51781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867755.1 protein_id gnl|my_center|LOCUS_01840 53822 53076 gene locus_tag LOCUS_01850 53822 53076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146593.1 protein_id gnl|my_center|LOCUS_01850 54199 53864 gene locus_tag LOCUS_01860 54199 53864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 54587 54171 gene locus_tag LOCUS_01870 54587 54171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 55075 54653 gene locus_tag LOCUS_01880 55075 54653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 55501 55157 gene locus_tag LOCUS_01890 55501 55157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 56015 55494 gene locus_tag LOCUS_01900 56015 55494 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762515.1 protein_id gnl|my_center|LOCUS_01900 56303 56124 gene locus_tag LOCUS_01910 56303 56124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 56487 56266 gene locus_tag LOCUS_01920 56487 56266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 56719 58101 gene locus_tag LOCUS_01930 56719 58101 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249112.1 protein_id gnl|my_center|LOCUS_01930 58403 58113 gene locus_tag LOCUS_01940 58403 58113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 58477 59619 gene locus_tag LOCUS_01950 58477 59619 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762578.1 protein_id gnl|my_center|LOCUS_01950 60520 59636 gene locus_tag LOCUS_01960 60520 59636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 61448 60528 gene locus_tag LOCUS_01970 61448 60528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392475.1 protein_id gnl|my_center|LOCUS_01970 63408 61420 gene locus_tag LOCUS_01980 63408 61420 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249703.1 protein_id gnl|my_center|LOCUS_01980 63571 64641 gene locus_tag LOCUS_01990 63571 64641 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762155.1 protein_id gnl|my_center|LOCUS_01990 65841 64666 gene locus_tag LOCUS_02000 65841 64666 CDS product TGS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978498.1 protein_id gnl|my_center|LOCUS_02000 66002 66664 gene locus_tag LOCUS_02010 66002 66664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 66639 67409 gene locus_tag LOCUS_02020 gene cobB 66639 67409 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240270.1 protein_id gnl|my_center|LOCUS_02020 67485 67814 gene locus_tag LOCUS_02030 67485 67814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 67811 68848 gene locus_tag LOCUS_02040 67811 68848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 68850 69302 gene locus_tag LOCUS_02050 68850 69302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 69455 71026 gene locus_tag LOCUS_02060 69455 71026 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979518.1 protein_id gnl|my_center|LOCUS_02060 71363 71151 gene locus_tag LOCUS_02070 71363 71151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 72219 71473 gene locus_tag LOCUS_02080 72219 71473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 72590 72216 gene locus_tag LOCUS_02090 72590 72216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 72821 73402 gene locus_tag LOCUS_02100 72821 73402 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_02100 73399 73740 gene locus_tag LOCUS_02110 73399 73740 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762971.1 protein_id gnl|my_center|LOCUS_02110 73737 74948 gene locus_tag LOCUS_02120 73737 74948 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240382.1 protein_id gnl|my_center|LOCUS_02120 74948 75919 gene locus_tag LOCUS_02130 74948 75919 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762081.1 protein_id gnl|my_center|LOCUS_02130 76894 75965 gene locus_tag LOCUS_02140 76894 75965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 <80074 76937 gene locus_tag LOCUS_02150 <80074 76937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846290.1:reverse gyrase >Feature sequence03 485 1051 gene locus_tag LOCUS_02160 gene rpoE 485 1051 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_02160 1051 1287 gene locus_tag LOCUS_02170 1051 1287 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762672.1 protein_id gnl|my_center|LOCUS_02170 1413 1820 gene locus_tag LOCUS_02180 1413 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 1890 2228 gene locus_tag LOCUS_02190 1890 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 2245 2424 gene locus_tag LOCUS_02200 2245 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 2372 3424 gene locus_tag LOCUS_02210 gene kae1 2372 3424 CDS product KEOPS complex N(6)-L-threonylcarbamoyladenine synthase Kae1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978326.1 protein_id gnl|my_center|LOCUS_02210 3412 4140 gene locus_tag LOCUS_02220 3412 4140 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978327.1 protein_id gnl|my_center|LOCUS_02220 4091 4675 gene locus_tag LOCUS_02230 4091 4675 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978328.1 protein_id gnl|my_center|LOCUS_02230 4736 5200 gene locus_tag LOCUS_02240 4736 5200 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978348.1 protein_id gnl|my_center|LOCUS_02240 5338 6618 gene locus_tag LOCUS_02250 5338 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 6611 6898 gene locus_tag LOCUS_02260 6611 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 6951 7601 gene locus_tag LOCUS_02270 6951 7601 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978426.1 protein_id gnl|my_center|LOCUS_02270 7682 8743 gene locus_tag LOCUS_02280 7682 8743 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250208.1 protein_id gnl|my_center|LOCUS_02280 8736 10010 gene locus_tag LOCUS_02290 gene glmU 8736 10010 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870613.1 protein_id gnl|my_center|LOCUS_02290 10018 11553 gene locus_tag LOCUS_02300 10018 11553 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877491.1 protein_id gnl|my_center|LOCUS_02300 12135 11509 gene locus_tag LOCUS_02310 12135 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 12584 12120 gene locus_tag LOCUS_02320 12584 12120 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868849.1 protein_id gnl|my_center|LOCUS_02320 13411 12734 gene locus_tag LOCUS_02330 13411 12734 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978423.1 protein_id gnl|my_center|LOCUS_02330 13586 14803 gene locus_tag LOCUS_02340 13586 14803 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_02340 15280 14819 gene locus_tag LOCUS_02350 15280 14819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 15624 16373 gene locus_tag LOCUS_02360 gene psmA 15624 16373 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846326.1 protein_id gnl|my_center|LOCUS_02360 16493 17191 gene locus_tag LOCUS_02370 16493 17191 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978418.1 protein_id gnl|my_center|LOCUS_02370 17196 17897 gene locus_tag LOCUS_02380 gene rrp4 17196 17897 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978417.1 protein_id gnl|my_center|LOCUS_02380 17912 18643 gene locus_tag LOCUS_02390 gene rrp41 17912 18643 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846320.1 protein_id gnl|my_center|LOCUS_02390 18654 19496 gene locus_tag LOCUS_02400 gene rrp42 18654 19496 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978415.1 protein_id gnl|my_center|LOCUS_02400 19512 19796 gene locus_tag LOCUS_02410 19512 19796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 19888 20427 gene locus_tag LOCUS_02420 19888 20427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 20396 20641 gene locus_tag LOCUS_02430 20396 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 20680 21051 gene locus_tag LOCUS_02440 20680 21051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 21142 21414 gene locus_tag LOCUS_02450 21142 21414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 21398 22444 gene locus_tag LOCUS_02460 21398 22444 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870502.1 protein_id gnl|my_center|LOCUS_02460 22428 23114 gene locus_tag LOCUS_02470 gene xpf 22428 23114 CDS product 3'-flap repair endonuclease Xpf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978411.1 protein_id gnl|my_center|LOCUS_02470 23199 25409 gene locus_tag LOCUS_02480 23199 25409 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846316.1 protein_id gnl|my_center|LOCUS_02480 25521 25928 gene locus_tag LOCUS_02490 25521 25928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 25935 26510 gene locus_tag LOCUS_02500 gene nuoB 25935 26510 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979576.1 protein_id gnl|my_center|LOCUS_02500 26514 26978 gene locus_tag LOCUS_02510 26514 26978 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846746.1 protein_id gnl|my_center|LOCUS_02510 26975 28192 gene locus_tag LOCUS_02520 26975 28192 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980299.1 protein_id gnl|my_center|LOCUS_02520 28199 29236 gene locus_tag LOCUS_02530 gene nuoH 28199 29236 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591312.1 protein_id gnl|my_center|LOCUS_02530 29236 29772 gene locus_tag LOCUS_02540 gene nuoI 29236 29772 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847026.1 protein_id gnl|my_center|LOCUS_02540 29772 30245 gene locus_tag LOCUS_02550 29772 30245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 30252 30575 gene locus_tag LOCUS_02560 30252 30575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 30578 32125 gene locus_tag LOCUS_02570 30578 32125 CDS product complex I subunit 5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879320.1 protein_id gnl|my_center|LOCUS_02570 32131 34146 gene locus_tag LOCUS_02580 32131 34146 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763355.1 protein_id gnl|my_center|LOCUS_02580 34154 35560 gene locus_tag LOCUS_02590 gene nuoN 34154 35560 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980305.1 protein_id gnl|my_center|LOCUS_02590 35622 36326 gene locus_tag LOCUS_02600 35622 36326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 37884 36880 gene locus_tag LOCUS_02610 37884 36880 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978164.1 protein_id gnl|my_center|LOCUS_02610 38553 37903 gene locus_tag LOCUS_02620 38553 37903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 39110 38589 gene locus_tag LOCUS_02630 gene ppa 39110 38589 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881004.1 protein_id gnl|my_center|LOCUS_02630 39219 39590 gene locus_tag LOCUS_02640 gene rpl7ae 39219 39590 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979469.1 protein_id gnl|my_center|LOCUS_02640 40008 39634 gene locus_tag LOCUS_02650 40008 39634 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868764.1 protein_id gnl|my_center|LOCUS_02650 40156 40614 gene locus_tag LOCUS_02660 40156 40614 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980145.1 protein_id gnl|my_center|LOCUS_02660 40627 41139 gene locus_tag LOCUS_02670 40627 41139 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_02670 41139 41540 gene locus_tag LOCUS_02680 41139 41540 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762295.1 protein_id gnl|my_center|LOCUS_02680 41580 42455 gene locus_tag LOCUS_02690 41580 42455 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980142.1 protein_id gnl|my_center|LOCUS_02690 42455 42820 gene locus_tag LOCUS_02700 42455 42820 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_02700 42813 43283 gene locus_tag LOCUS_02710 gene rplM 42813 43283 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_02710 43283 43720 gene locus_tag LOCUS_02720 43283 43720 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762448.1 protein_id gnl|my_center|LOCUS_02720 43727 43951 gene locus_tag LOCUS_02730 43727 43951 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250450.1 protein_id gnl|my_center|LOCUS_02730 43966 44598 gene locus_tag LOCUS_02740 gene rpsB 43966 44598 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980137.1 protein_id gnl|my_center|LOCUS_02740 44688 45503 gene locus_tag LOCUS_02750 44688 45503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 45490 46257 gene locus_tag LOCUS_02760 45490 46257 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869535.1 protein_id gnl|my_center|LOCUS_02760 46283 47431 gene locus_tag LOCUS_02770 gene fni 46283 47431 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980133.1 protein_id gnl|my_center|LOCUS_02770 47422 48420 gene locus_tag LOCUS_02780 47422 48420 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496935.1 protein_id gnl|my_center|LOCUS_02780 48423 48899 gene locus_tag LOCUS_02790 48423 48899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 48868 50586 gene locus_tag LOCUS_02800 48868 50586 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979468.1 protein_id gnl|my_center|LOCUS_02800 50579 51031 gene locus_tag LOCUS_02810 50579 51031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 51135 51049 gene locus_tag LOCUS_t00070 51135 51049 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 51954 51181 gene locus_tag LOCUS_02820 51954 51181 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762874.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02820 52245 51979 gene locus_tag LOCUS_02830 52245 51979 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978367.1 protein_id gnl|my_center|LOCUS_02830 52647 52357 gene locus_tag LOCUS_02840 52647 52357 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978366.1 protein_id gnl|my_center|LOCUS_02840 53290 52685 gene locus_tag LOCUS_02850 53290 52685 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 protein_id gnl|my_center|LOCUS_02850 53508 53227 gene locus_tag LOCUS_02860 53508 53227 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870160.1 protein_id gnl|my_center|LOCUS_02860 54005 53574 gene locus_tag LOCUS_02870 54005 53574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 54635 54027 gene locus_tag LOCUS_02880 54635 54027 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846302.1 protein_id gnl|my_center|LOCUS_02880 56023 54635 gene locus_tag LOCUS_02890 gene secY 56023 54635 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978380.1 protein_id gnl|my_center|LOCUS_02890 56444 56109 gene locus_tag LOCUS_02900 gene metG 56444 56109 CDS product methionine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762104.1 protein_id gnl|my_center|LOCUS_02900 58095 56446 gene locus_tag LOCUS_02910 58095 56446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02910 59580 58423 gene locus_tag LOCUS_02920 gene glmU 59580 58423 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870613.1 protein_id gnl|my_center|LOCUS_02920 61441 59591 gene locus_tag LOCUS_02930 gene glmS 61441 59591 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762183.1 protein_id gnl|my_center|LOCUS_02930 63712 62438 gene locus_tag LOCUS_02940 63712 62438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 63902 63663 gene locus_tag LOCUS_02950 63902 63663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 63858 64844 gene locus_tag LOCUS_02960 gene radA 63858 64844 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846870.1 protein_id gnl|my_center|LOCUS_02960 65253 66008 gene locus_tag LOCUS_02970 65253 66008 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429827.1 protein_id gnl|my_center|LOCUS_02970 66001 66549 gene locus_tag LOCUS_02980 66001 66549 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_02980 66556 67554 gene locus_tag LOCUS_02990 66556 67554 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978561.1 protein_id gnl|my_center|LOCUS_02990 67638 68675 gene locus_tag LOCUS_03000 67638 68675 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978402.1 protein_id gnl|my_center|LOCUS_03000 68697 69515 gene locus_tag LOCUS_03010 gene rpl4p 68697 69515 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846313.1 protein_id gnl|my_center|LOCUS_03010 69517 69780 gene locus_tag LOCUS_03020 69517 69780 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250491.1 protein_id gnl|my_center|LOCUS_03020 70638 69787 gene locus_tag LOCUS_03030 70638 69787 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846190.1 protein_id gnl|my_center|LOCUS_03030 71590 70868 gene locus_tag LOCUS_03040 71590 70868 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978236.1 protein_id gnl|my_center|LOCUS_03040 71751 72104 gene locus_tag LOCUS_03050 71751 72104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 72104 73705 gene locus_tag LOCUS_03060 72104 73705 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979307.1 protein_id gnl|my_center|LOCUS_03060 74588 73710 gene locus_tag LOCUS_03070 gene sucD 74588 73710 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762776.1 protein_id gnl|my_center|LOCUS_03070 75744 74605 gene locus_tag LOCUS_03080 gene sucC 75744 74605 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762775.1 protein_id gnl|my_center|LOCUS_03080 75992 76603 gene locus_tag LOCUS_03090 75992 76603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 76707 76988 gene locus_tag LOCUS_03100 76707 76988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 77490 76981 gene locus_tag LOCUS_03110 77490 76981 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980232.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence04 1008 2048 gene locus_tag LOCUS_03120 1008 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871153.1 protein_id gnl|my_center|LOCUS_03120 2201 2881 gene locus_tag LOCUS_03130 2201 2881 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477233.1 protein_id gnl|my_center|LOCUS_03130 4073 2907 gene locus_tag LOCUS_03140 4073 2907 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318704.1 protein_id gnl|my_center|LOCUS_03140 5039 4161 gene locus_tag LOCUS_03150 5039 4161 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940211.1 protein_id gnl|my_center|LOCUS_03150 5993 5076 gene locus_tag LOCUS_03160 5993 5076 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250918.1 protein_id gnl|my_center|LOCUS_03160 6098 6760 gene locus_tag LOCUS_03170 6098 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6865 8385 gene locus_tag LOCUS_03180 6865 8385 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_03180 8382 9854 gene locus_tag LOCUS_03190 8382 9854 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_03190 10179 9907 gene locus_tag LOCUS_03200 10179 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 11264 10167 gene locus_tag LOCUS_03210 11264 10167 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755814.1 protein_id gnl|my_center|LOCUS_03210 11372 13261 gene locus_tag LOCUS_03220 gene aor 11372 13261 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_03220 15277 13271 gene locus_tag LOCUS_03230 15277 13271 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978175.1 protein_id gnl|my_center|LOCUS_03230 16167 15277 gene locus_tag LOCUS_03240 16167 15277 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022486.1 protein_id gnl|my_center|LOCUS_03240 16217 16639 gene locus_tag LOCUS_03250 16217 16639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 18269 16647 gene locus_tag LOCUS_03260 18269 16647 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978180.1 protein_id gnl|my_center|LOCUS_03260 18684 18364 gene locus_tag LOCUS_03270 18684 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 18758 20761 gene locus_tag LOCUS_03280 gene rqcH 18758 20761 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650963.1 protein_id gnl|my_center|LOCUS_03280 20808 21281 gene locus_tag LOCUS_03290 20808 21281 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980432.1 protein_id gnl|my_center|LOCUS_03290 21347 22156 gene locus_tag LOCUS_03300 21347 22156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 22228 22722 gene locus_tag LOCUS_03310 22228 22722 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249247.1 protein_id gnl|my_center|LOCUS_03310 22755 23396 gene locus_tag LOCUS_03320 22755 23396 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867133.1 protein_id gnl|my_center|LOCUS_03320 23473 23649 gene locus_tag LOCUS_03330 23473 23649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 23725 24192 gene locus_tag LOCUS_03340 23725 24192 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979409.1 protein_id gnl|my_center|LOCUS_03340 24195 24716 gene locus_tag LOCUS_03350 24195 24716 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979408.1 protein_id gnl|my_center|LOCUS_03350 24797 25426 gene locus_tag LOCUS_03360 24797 25426 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_03360 25431 26468 gene locus_tag LOCUS_03370 25431 26468 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742658.1 protein_id gnl|my_center|LOCUS_03370 26541 26867 gene locus_tag LOCUS_03380 gene rpl12p 26541 26867 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878989.1 protein_id gnl|my_center|LOCUS_03380 26988 29726 gene locus_tag LOCUS_03390 gene alaS 26988 29726 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979404.1 protein_id gnl|my_center|LOCUS_03390 29843 30406 gene locus_tag LOCUS_03400 29843 30406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 31105 30653 gene locus_tag LOCUS_03410 31105 30653 CDS product DUF2153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846228.1 protein_id gnl|my_center|LOCUS_03410 31514 31122 gene locus_tag LOCUS_03420 31514 31122 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978185.1 protein_id gnl|my_center|LOCUS_03420 32896 31520 gene locus_tag LOCUS_03430 gene glmM 32896 31520 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978186.1 protein_id gnl|my_center|LOCUS_03430 32954 33163 gene locus_tag LOCUS_03440 32954 33163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 33175 34206 gene locus_tag LOCUS_03450 33175 34206 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868308.1 protein_id gnl|my_center|LOCUS_03450 34228 34914 gene locus_tag LOCUS_03460 gene rnhB 34228 34914 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978497.1 protein_id gnl|my_center|LOCUS_03460 34941 35966 gene locus_tag LOCUS_03470 34941 35966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 35984 36676 gene locus_tag LOCUS_03480 35984 36676 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980208.1 protein_id gnl|my_center|LOCUS_03480 37412 36696 gene locus_tag LOCUS_03490 37412 36696 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978399.1 protein_id gnl|my_center|LOCUS_03490 38294 37560 gene locus_tag LOCUS_03500 38294 37560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846227.1 protein_id gnl|my_center|LOCUS_03500 38385 38591 gene locus_tag LOCUS_03510 38385 38591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 39303 38596 gene locus_tag LOCUS_03520 39303 38596 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762139.1 protein_id gnl|my_center|LOCUS_03520 39804 39346 gene locus_tag LOCUS_03530 gene ribH 39804 39346 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846879.1 protein_id gnl|my_center|LOCUS_03530 40321 39857 gene locus_tag LOCUS_03540 gene ribC 40321 39857 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978357.1 protein_id gnl|my_center|LOCUS_03540 40989 40306 gene locus_tag LOCUS_03550 40989 40306 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978356.1 protein_id gnl|my_center|LOCUS_03550 42371 41763 gene locus_tag LOCUS_03560 42371 41763 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878128.1 protein_id gnl|my_center|LOCUS_03560 42500 43231 gene locus_tag LOCUS_03570 42500 43231 CDS product DUF2192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846962.1 protein_id gnl|my_center|LOCUS_03570 43312 44208 gene locus_tag LOCUS_03580 43312 44208 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979450.1 protein_id gnl|my_center|LOCUS_03580 44217 44651 gene locus_tag LOCUS_03590 44217 44651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 45765 44659 gene locus_tag LOCUS_03600 45765 44659 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979254.1 protein_id gnl|my_center|LOCUS_03600 45840 46151 gene locus_tag LOCUS_03610 45840 46151 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763443.1 protein_id gnl|my_center|LOCUS_03610 46176 46673 gene locus_tag LOCUS_03620 46176 46673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 46913 47206 gene locus_tag LOCUS_03630 46913 47206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 47291 47779 gene locus_tag LOCUS_03640 47291 47779 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250047.1 protein_id gnl|my_center|LOCUS_03640 48795 48007 gene locus_tag LOCUS_03650 48795 48007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 48919 49149 gene locus_tag LOCUS_03660 48919 49149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846510.1 protein_id gnl|my_center|LOCUS_03660 49195 49488 gene locus_tag LOCUS_03670 49195 49488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 49498 50796 gene locus_tag LOCUS_03680 gene asnS 49498 50796 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249710.1 protein_id gnl|my_center|LOCUS_03680 50805 51518 gene locus_tag LOCUS_03690 50805 51518 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980120.1 protein_id gnl|my_center|LOCUS_03690 51813 51499 gene locus_tag LOCUS_03700 51813 51499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 52497 51889 gene locus_tag LOCUS_03710 52497 51889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 52580 53935 gene locus_tag LOCUS_03720 gene hemL 52580 53935 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_03720 54171 53932 gene locus_tag LOCUS_03730 54171 53932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 55262 54546 gene locus_tag LOCUS_03740 55262 54546 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978977.1 protein_id gnl|my_center|LOCUS_03740 55324 56280 gene locus_tag LOCUS_03750 55324 56280 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847023.1 protein_id gnl|my_center|LOCUS_03750 56849 56283 gene locus_tag LOCUS_03760 56849 56283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 57854 56928 gene locus_tag LOCUS_03770 57854 56928 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980384.1 protein_id gnl|my_center|LOCUS_03770 59769 57844 gene locus_tag LOCUS_03780 59769 57844 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 protein_id gnl|my_center|LOCUS_03780 60115 59771 gene locus_tag LOCUS_03790 60115 59771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 61388 60177 gene locus_tag LOCUS_03800 61388 60177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 61575 62096 gene locus_tag LOCUS_03810 61575 62096 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096934.1 protein_id gnl|my_center|LOCUS_03810 62107 62814 gene locus_tag LOCUS_03820 62107 62814 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980156.1 protein_id gnl|my_center|LOCUS_03820 62815 63858 gene locus_tag LOCUS_03830 62815 63858 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846717.1 protein_id gnl|my_center|LOCUS_03830 64764 63838 gene locus_tag LOCUS_03840 64764 63838 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978553.1 protein_id gnl|my_center|LOCUS_03840 65561 64776 gene locus_tag LOCUS_03850 gene udp 65561 64776 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_03850 65635 65838 gene locus_tag LOCUS_03860 65635 65838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence05 386 78 gene locus_tag LOCUS_03870 386 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03870 1876 440 gene locus_tag LOCUS_03880 1876 440 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763048.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03880 2693 2019 gene locus_tag LOCUS_03890 2693 2019 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 protein_id gnl|my_center|LOCUS_03890 3733 2714 gene locus_tag LOCUS_03900 3733 2714 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879294.1 protein_id gnl|my_center|LOCUS_03900 3947 5320 gene locus_tag LOCUS_03910 3947 5320 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869394.1 protein_id gnl|my_center|LOCUS_03910 6368 5322 gene locus_tag LOCUS_03920 6368 5322 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868027.1 protein_id gnl|my_center|LOCUS_03920 6510 7421 gene locus_tag LOCUS_03930 gene menA 6510 7421 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536364.1 protein_id gnl|my_center|LOCUS_03930 8159 7434 gene locus_tag LOCUS_03940 8159 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 8938 8156 gene locus_tag LOCUS_03950 gene wtpB 8938 8156 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248973.1 protein_id gnl|my_center|LOCUS_03950 9953 8913 gene locus_tag LOCUS_03960 gene wtpA 9953 8913 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248970.1 protein_id gnl|my_center|LOCUS_03960 10993 10100 gene locus_tag LOCUS_03970 10993 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 11058 11828 gene locus_tag LOCUS_03980 11058 11828 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249754.1 protein_id gnl|my_center|LOCUS_03980 11818 12612 gene locus_tag LOCUS_03990 11818 12612 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886337.1 protein_id gnl|my_center|LOCUS_03990 12613 13053 gene locus_tag LOCUS_04000 12613 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 13460 13023 gene locus_tag LOCUS_04010 13460 13023 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761914.1 protein_id gnl|my_center|LOCUS_04010 13621 16392 gene locus_tag LOCUS_04020 gene acnA 13621 16392 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_04020 17216 16635 gene locus_tag LOCUS_04030 17216 16635 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439009.1 protein_id gnl|my_center|LOCUS_04030 17359 19326 gene locus_tag LOCUS_04040 17359 19326 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013267177.1 protein_id gnl|my_center|LOCUS_04040 19323 20222 gene locus_tag LOCUS_04050 gene cysK 19323 20222 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261709.1 protein_id gnl|my_center|LOCUS_04050 21112 20219 gene locus_tag LOCUS_04060 gene amrB 21112 20219 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980136.1 protein_id gnl|my_center|LOCUS_04060 21245 23452 gene locus_tag LOCUS_04070 21245 23452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 24624 23464 gene locus_tag LOCUS_04080 24624 23464 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867337.1 protein_id gnl|my_center|LOCUS_04080 24554 24754 gene locus_tag LOCUS_04090 24554 24754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 25893 24721 gene locus_tag LOCUS_04100 25893 24721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 26150 26076 gene locus_tag LOCUS_t00080 26150 26076 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 27118 26195 gene locus_tag LOCUS_04110 27118 26195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 27869 27171 gene locus_tag LOCUS_04120 27869 27171 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249663.1 protein_id gnl|my_center|LOCUS_04120 28841 27882 gene locus_tag LOCUS_04130 28841 27882 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007467.1 protein_id gnl|my_center|LOCUS_04130 29136 30983 gene locus_tag LOCUS_04140 29136 30983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 31396 31058 gene locus_tag LOCUS_04150 31396 31058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 32471 31446 gene locus_tag LOCUS_04160 32471 31446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 33244 32795 gene locus_tag LOCUS_04170 33244 32795 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761996.1 protein_id gnl|my_center|LOCUS_04170 33476 33225 gene locus_tag LOCUS_04180 33476 33225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 33891 33816 gene locus_tag LOCUS_t00090 33891 33816 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 34696 33965 gene locus_tag LOCUS_04190 34696 33965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387006.1 protein_id gnl|my_center|LOCUS_04190 35640 34696 gene locus_tag LOCUS_04200 35640 34696 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_04200 35870 37237 gene locus_tag LOCUS_04210 gene lpdA 35870 37237 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118855.1 protein_id gnl|my_center|LOCUS_04210 37365 38627 gene locus_tag LOCUS_04220 37365 38627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 38634 41378 gene locus_tag LOCUS_04230 gene rad50 38634 41378 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868338.1 protein_id gnl|my_center|LOCUS_04230 41381 42634 gene locus_tag LOCUS_04240 41381 42634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 42631 44169 gene locus_tag LOCUS_04250 gene herA 42631 44169 CDS product DNA double-strand break repair helicase HerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980185.1 protein_id gnl|my_center|LOCUS_04250 45126 44269 gene locus_tag LOCUS_04260 45126 44269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 45952 45119 gene locus_tag LOCUS_04270 45952 45119 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228395.1 protein_id gnl|my_center|LOCUS_04270 47043 45964 gene locus_tag LOCUS_04280 47043 45964 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868286.1 protein_id gnl|my_center|LOCUS_04280 47129 47884 gene locus_tag LOCUS_04290 47129 47884 CDS product DUF432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879042.1 protein_id gnl|my_center|LOCUS_04290 47839 48717 gene locus_tag LOCUS_04300 47839 48717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 48821 49375 gene locus_tag LOCUS_04310 48821 49375 CDS product protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846965.1 protein_id gnl|my_center|LOCUS_04310 49389 50564 gene locus_tag LOCUS_04320 49389 50564 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879038.1 protein_id gnl|my_center|LOCUS_04320 51084 50521 gene locus_tag LOCUS_04330 51084 50521 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251082.1 protein_id gnl|my_center|LOCUS_04330 51238 52134 gene locus_tag LOCUS_04340 51238 52134 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762701.1 protein_id gnl|my_center|LOCUS_04340 52141 52767 gene locus_tag LOCUS_04350 52141 52767 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_04350 52894 54642 gene locus_tag LOCUS_04360 52894 54642 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_04360 54653 55114 gene locus_tag LOCUS_04370 54653 55114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 55120 55470 gene locus_tag LOCUS_04380 55120 55470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 55484 56398 gene locus_tag LOCUS_04390 55484 56398 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762424.1 protein_id gnl|my_center|LOCUS_04390 56469 57227 gene locus_tag LOCUS_04400 56469 57227 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978941.1 protein_id gnl|my_center|LOCUS_04400 57289 58674 gene locus_tag LOCUS_04410 57289 58674 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_04410 58680 59372 gene locus_tag LOCUS_04420 58680 59372 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762240.1 protein_id gnl|my_center|LOCUS_04420 59412 60290 gene locus_tag LOCUS_04430 59412 60290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979293.1 protein_id gnl|my_center|LOCUS_04430 60391 61551 gene locus_tag LOCUS_04440 60391 61551 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846947.1 protein_id gnl|my_center|LOCUS_04440 62257 61508 gene locus_tag LOCUS_04450 gene uppS 62257 61508 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978127.1 protein_id gnl|my_center|LOCUS_04450 62354 62947 gene locus_tag LOCUS_04460 gene yjjX 62354 62947 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763127.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence06 <1 857 gene locus_tag LOCUS_04470 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867839.1:phosphoadenosine phosphosulfate reductase family protein 859 1947 gene locus_tag LOCUS_04480 859 1947 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_04480 2004 4394 gene locus_tag LOCUS_04490 2004 4394 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980151.1 protein_id gnl|my_center|LOCUS_04490 5640 4387 gene locus_tag LOCUS_04500 gene dnaG 5640 4387 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980150.1 protein_id gnl|my_center|LOCUS_04500 7129 5864 gene locus_tag LOCUS_04510 7129 5864 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980326.1 protein_id gnl|my_center|LOCUS_04510 7303 8142 gene locus_tag LOCUS_04520 7303 8142 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011277600.1 protein_id gnl|my_center|LOCUS_04520 8555 8139 gene locus_tag LOCUS_04530 8555 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 8720 9295 gene locus_tag LOCUS_04540 8720 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 9900 9292 gene locus_tag LOCUS_04550 9900 9292 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867717.1 protein_id gnl|my_center|LOCUS_04550 10716 9940 gene locus_tag LOCUS_04560 10716 9940 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846354.1 protein_id gnl|my_center|LOCUS_04560 11063 10734 gene locus_tag LOCUS_04570 11063 10734 CDS product translation initiation factor aIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846355.1 protein_id gnl|my_center|LOCUS_04570 12219 11089 gene locus_tag LOCUS_04580 12219 11089 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877370.1 protein_id gnl|my_center|LOCUS_04580 12523 12191 gene locus_tag LOCUS_04590 12523 12191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 12971 12546 gene locus_tag LOCUS_04600 12971 12546 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013749.1 protein_id gnl|my_center|LOCUS_04600 13046 14344 gene locus_tag LOCUS_04610 13046 14344 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011277826.1 protein_id gnl|my_center|LOCUS_04610 14328 15233 gene locus_tag LOCUS_04620 14328 15233 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496430.1 protein_id gnl|my_center|LOCUS_04620 15514 15840 gene locus_tag LOCUS_04630 15514 15840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 16224 15937 gene locus_tag LOCUS_04640 16224 15937 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979487.1 protein_id gnl|my_center|LOCUS_04640 17728 16277 gene locus_tag LOCUS_04650 gene proS 17728 16277 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979486.1 protein_id gnl|my_center|LOCUS_04650 17854 18432 gene locus_tag LOCUS_04660 17854 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 18988 18410 gene locus_tag LOCUS_04670 gene pgsA 18988 18410 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061121.1 protein_id gnl|my_center|LOCUS_04670 19835 18933 gene locus_tag LOCUS_04680 19835 18933 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_04680 20277 19957 gene locus_tag LOCUS_04690 20277 19957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 20455 21315 gene locus_tag LOCUS_04700 20455 21315 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022038.1 protein_id gnl|my_center|LOCUS_04700 21504 22502 gene locus_tag LOCUS_04710 21504 22502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 22490 23065 gene locus_tag LOCUS_04720 22490 23065 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763584.1 protein_id gnl|my_center|LOCUS_04720 23109 24386 gene locus_tag LOCUS_04730 23109 24386 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_04730 25067 24354 gene locus_tag LOCUS_04740 25067 24354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 25497 25090 gene locus_tag LOCUS_04750 25497 25090 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762564.1 protein_id gnl|my_center|LOCUS_04750 26625 25504 gene locus_tag LOCUS_04760 26625 25504 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 protein_id gnl|my_center|LOCUS_04760 27696 26641 gene locus_tag LOCUS_04770 27696 26641 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868484.1 protein_id gnl|my_center|LOCUS_04770 28899 27790 gene locus_tag LOCUS_04780 28899 27790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_04780 29867 28914 gene locus_tag LOCUS_04790 29867 28914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_04790 32733 30052 gene locus_tag LOCUS_04800 32733 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 34423 32876 gene locus_tag LOCUS_04810 34423 32876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868868.1 protein_id gnl|my_center|LOCUS_04810 35444 34434 gene locus_tag LOCUS_04820 35444 34434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670594.1 protein_id gnl|my_center|LOCUS_04820 35600 36193 gene locus_tag LOCUS_04830 35600 36193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 36326 36916 gene locus_tag LOCUS_04840 36326 36916 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_04840 37671 36913 gene locus_tag LOCUS_04850 37671 36913 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979296.1 protein_id gnl|my_center|LOCUS_04850 39292 37931 gene locus_tag LOCUS_04860 39292 37931 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763420.1 protein_id gnl|my_center|LOCUS_04860 39413 39679 gene locus_tag LOCUS_04870 39413 39679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 39698 40780 gene locus_tag LOCUS_04880 39698 40780 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146468.1 protein_id gnl|my_center|LOCUS_04880 40767 41411 gene locus_tag LOCUS_04890 gene udg 40767 41411 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879766.1 protein_id gnl|my_center|LOCUS_04890 43290 41404 gene locus_tag LOCUS_04900 43290 41404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 43389 43868 gene locus_tag LOCUS_04910 43389 43868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 43889 44446 gene locus_tag LOCUS_04920 43889 44446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 44428 44940 gene locus_tag LOCUS_04930 44428 44940 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978442.1 protein_id gnl|my_center|LOCUS_04930 44997 45806 gene locus_tag LOCUS_04940 44997 45806 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978935.1 protein_id gnl|my_center|LOCUS_04940 45828 46001 gene locus_tag LOCUS_04950 45828 46001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 46032 46649 gene locus_tag LOCUS_04960 46032 46649 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980346.1 protein_id gnl|my_center|LOCUS_04960 46712 47383 gene locus_tag LOCUS_04970 46712 47383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 47368 47649 gene locus_tag LOCUS_04980 47368 47649 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218258902.1 protein_id gnl|my_center|LOCUS_04980 47764 47970 gene locus_tag LOCUS_04990 47764 47970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 47951 48292 gene locus_tag LOCUS_05000 47951 48292 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980344.1 protein_id gnl|my_center|LOCUS_05000 48285 48482 gene locus_tag LOCUS_05010 48285 48482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 48538 49278 gene locus_tag LOCUS_05020 48538 49278 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249537.1 protein_id gnl|my_center|LOCUS_05020 49256 50326 gene locus_tag LOCUS_05030 gene priS 49256 50326 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978939.1 protein_id gnl|my_center|LOCUS_05030 50319 50840 gene locus_tag LOCUS_05040 50319 50840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 50876 51163 gene locus_tag LOCUS_05050 50876 51163 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 protein_id gnl|my_center|LOCUS_05050 51170 51376 gene locus_tag LOCUS_05060 51170 51376 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978936.1 protein_id gnl|my_center|LOCUS_05060 52512 51418 gene locus_tag LOCUS_05070 gene dph2 52512 51418 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980347.1 protein_id gnl|my_center|LOCUS_05070 52634 53341 gene locus_tag LOCUS_05080 52634 53341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 53495 54157 gene locus_tag LOCUS_05090 53495 54157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 54862 54086 gene locus_tag LOCUS_05100 54862 54086 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978509.1 protein_id gnl|my_center|LOCUS_05100 55755 54886 gene locus_tag LOCUS_05110 55755 54886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763101.1 protein_id gnl|my_center|LOCUS_05110 56606 55776 gene locus_tag LOCUS_05120 56606 55776 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240426.1 protein_id gnl|my_center|LOCUS_05120 57848 56610 gene locus_tag LOCUS_05130 gene coaBC 57848 56610 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978206.1 protein_id gnl|my_center|LOCUS_05130 57940 58464 gene locus_tag LOCUS_05140 gene rimI 57940 58464 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762816.1 protein_id gnl|my_center|LOCUS_05140 59838 58471 gene locus_tag LOCUS_05150 59838 58471 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_05150 >Feature sequence07 <1 1240 gene locus_tag LOCUS_05160 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978500.1:type II/IV secretion system ATPase subunit 1243 2463 gene locus_tag LOCUS_05170 1243 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 3528 2431 gene locus_tag LOCUS_05180 3528 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3647 6097 gene locus_tag LOCUS_05190 gene ppsA 3647 6097 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846514.1 protein_id gnl|my_center|LOCUS_05190 6667 6101 gene locus_tag LOCUS_05200 6667 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 6695 7987 gene locus_tag LOCUS_05210 gene hisS 6695 7987 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258794.1 protein_id gnl|my_center|LOCUS_05210 8169 8005 gene locus_tag LOCUS_05220 8169 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8490 8242 gene locus_tag LOCUS_05230 8490 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 10404 8578 gene locus_tag LOCUS_05240 10404 8578 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240328.1 protein_id gnl|my_center|LOCUS_05240 10539 11195 gene locus_tag LOCUS_05250 10539 11195 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763553.1 protein_id gnl|my_center|LOCUS_05250 11303 12040 gene locus_tag LOCUS_05260 gene sufC 11303 12040 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846505.1 protein_id gnl|my_center|LOCUS_05260 12057 13481 gene locus_tag LOCUS_05270 gene sufB 12057 13481 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979219.1 protein_id gnl|my_center|LOCUS_05270 13450 14598 gene locus_tag LOCUS_05280 13450 14598 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979218.1 protein_id gnl|my_center|LOCUS_05280 15950 14589 gene locus_tag LOCUS_05290 15950 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 16127 17398 gene locus_tag LOCUS_05300 gene icd 16127 17398 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878150.1 protein_id gnl|my_center|LOCUS_05300 18764 17673 gene locus_tag LOCUS_05310 gene mtnA 18764 17673 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_05310 18897 19397 gene locus_tag LOCUS_05320 18897 19397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 20547 19480 gene locus_tag LOCUS_05330 20547 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 20507 20659 gene locus_tag LOCUS_05340 20507 20659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 20681 21781 gene locus_tag LOCUS_05350 20681 21781 CDS product DUF711 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762695.1 protein_id gnl|my_center|LOCUS_05350 22063 21800 gene locus_tag LOCUS_05360 22063 21800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 22169 22246 gene locus_tag LOCUS_t00100 22169 22246 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22275 23114 gene locus_tag LOCUS_05370 22275 23114 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084207595.1 protein_id gnl|my_center|LOCUS_05370 23224 23832 gene locus_tag LOCUS_05380 23224 23832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250948.1 protein_id gnl|my_center|LOCUS_05380 24091 24930 gene locus_tag LOCUS_05390 24091 24930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 24997 25944 gene locus_tag LOCUS_05400 24997 25944 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_05400 25954 27000 gene locus_tag LOCUS_05410 25954 27000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 26990 28522 gene locus_tag LOCUS_05420 26990 28522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 28503 29462 gene locus_tag LOCUS_05430 28503 29462 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_05430 29847 29530 gene locus_tag LOCUS_05440 29847 29530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 30029 30826 gene locus_tag LOCUS_05450 30029 30826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 30816 32129 gene locus_tag LOCUS_05460 30816 32129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 32120 32359 gene locus_tag LOCUS_05470 32120 32359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 33148 32363 gene locus_tag LOCUS_05480 33148 32363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 34131 33163 gene locus_tag LOCUS_05490 34131 33163 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878041.1 protein_id gnl|my_center|LOCUS_05490 34400 34579 gene locus_tag LOCUS_05500 34400 34579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 34746 35351 gene locus_tag LOCUS_05510 34746 35351 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_05510 35446 36996 gene locus_tag LOCUS_05520 gene gapN 35446 36996 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980562.1 protein_id gnl|my_center|LOCUS_05520 37045 37683 gene locus_tag LOCUS_05530 37045 37683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 37756 39360 gene locus_tag LOCUS_05540 37756 39360 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_05540 39870 39352 gene locus_tag LOCUS_05550 39870 39352 CDS product Holliday junction resolvase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081152.1 protein_id gnl|my_center|LOCUS_05550 40051 41058 gene locus_tag LOCUS_05560 40051 41058 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 protein_id gnl|my_center|LOCUS_05560 41075 42760 gene locus_tag LOCUS_05570 41075 42760 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879276.1 protein_id gnl|my_center|LOCUS_05570 43826 42765 gene locus_tag LOCUS_05580 43826 42765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 43962 47726 gene locus_tag LOCUS_05590 43962 47726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 47733 48245 gene locus_tag LOCUS_05600 47733 48245 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146602.1 protein_id gnl|my_center|LOCUS_05600 49143 48226 gene locus_tag LOCUS_05610 49143 48226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 49229 49864 gene locus_tag LOCUS_05620 49229 49864 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762097.1 protein_id gnl|my_center|LOCUS_05620 49894 51117 gene locus_tag LOCUS_05630 49894 51117 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228877.1 protein_id gnl|my_center|LOCUS_05630 51942 51118 gene locus_tag LOCUS_05640 51942 51118 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762744.1 protein_id gnl|my_center|LOCUS_05640 52454 52143 gene locus_tag LOCUS_05650 52454 52143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 52868 53674 gene locus_tag LOCUS_05660 52868 53674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 54314 53637 gene locus_tag LOCUS_05670 54314 53637 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025306754.1 protein_id gnl|my_center|LOCUS_05670 54611 54351 gene locus_tag LOCUS_05680 54611 54351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 54820 55983 gene locus_tag LOCUS_05690 54820 55983 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403266.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence08 <1 897 gene locus_tag LOCUS_05700 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162484757.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein 894 2852 gene locus_tag LOCUS_05710 894 2852 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927008.1 protein_id gnl|my_center|LOCUS_05710 2857 3144 gene locus_tag LOCUS_05720 2857 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 3148 4245 gene locus_tag LOCUS_05730 gene qmoC 3148 4245 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878164.1 protein_id gnl|my_center|LOCUS_05730 4314 4484 gene locus_tag LOCUS_05740 4314 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 4622 4951 gene locus_tag LOCUS_05750 4622 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 5177 5629 gene locus_tag LOCUS_05760 5177 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 5661 8351 gene locus_tag LOCUS_05770 5661 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 8348 9217 gene locus_tag LOCUS_05780 8348 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 9313 10146 gene locus_tag LOCUS_05790 gene fba 9313 10146 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249940.1 protein_id gnl|my_center|LOCUS_05790 10143 11072 gene locus_tag LOCUS_05800 10143 11072 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762863.1 protein_id gnl|my_center|LOCUS_05800 11261 12994 gene locus_tag LOCUS_05810 11261 12994 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979811.1 protein_id gnl|my_center|LOCUS_05810 15148 13397 gene locus_tag LOCUS_05820 15148 13397 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249837.1 protein_id gnl|my_center|LOCUS_05820 17377 16133 gene locus_tag LOCUS_05830 17377 16133 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980086.1 protein_id gnl|my_center|LOCUS_05830 17818 17612 gene locus_tag LOCUS_05840 17818 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 17919 19160 gene locus_tag LOCUS_05850 17919 19160 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980086.1 protein_id gnl|my_center|LOCUS_05850 19390 19977 gene locus_tag LOCUS_05860 19390 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 20055 20525 gene locus_tag LOCUS_05870 20055 20525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 20592 21137 gene locus_tag LOCUS_05880 20592 21137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 21148 21423 gene locus_tag LOCUS_05890 21148 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 22222 21596 gene locus_tag LOCUS_05900 22222 21596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 22388 22879 gene locus_tag LOCUS_05910 22388 22879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 24126 23116 gene locus_tag LOCUS_05920 24126 23116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05920 24567 24166 gene locus_tag LOCUS_05930 24567 24166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05930 25408 24614 gene locus_tag LOCUS_05940 25408 24614 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879006.1 protein_id gnl|my_center|LOCUS_05940 27084 25405 gene locus_tag LOCUS_05950 27084 25405 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879007.1 protein_id gnl|my_center|LOCUS_05950 27185 27481 gene locus_tag LOCUS_05960 27185 27481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 27579 28412 gene locus_tag LOCUS_05970 27579 28412 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064266.1 protein_id gnl|my_center|LOCUS_05970 30103 28430 gene locus_tag LOCUS_05980 30103 28430 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376481.1 protein_id gnl|my_center|LOCUS_05980 30674 30189 gene locus_tag LOCUS_05990 30674 30189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 31962 30661 gene locus_tag LOCUS_06000 31962 30661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 33197 32109 gene locus_tag LOCUS_06010 33197 32109 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_06010 34129 33197 gene locus_tag LOCUS_06020 34129 33197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 34438 35160 gene locus_tag LOCUS_06030 34438 35160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 35355 35233 gene locus_tag LOCUS_06040 35355 35233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 37467 35572 gene locus_tag LOCUS_06050 gene feoB 37467 35572 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060770.1 protein_id gnl|my_center|LOCUS_06050 38071 37493 gene locus_tag LOCUS_06060 38071 37493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 38277 39629 gene locus_tag LOCUS_06070 38277 39629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 39726 40583 gene locus_tag LOCUS_06080 39726 40583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 40864 42300 gene locus_tag LOCUS_06090 40864 42300 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249650.1 protein_id gnl|my_center|LOCUS_06090 42297 43625 gene locus_tag LOCUS_06100 42297 43625 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249649.1 protein_id gnl|my_center|LOCUS_06100 44425 43796 gene locus_tag LOCUS_06110 44425 43796 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249239.1 protein_id gnl|my_center|LOCUS_06110 46006 44441 gene locus_tag LOCUS_06120 46006 44441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867421.1 protein_id gnl|my_center|LOCUS_06120 47933 46182 gene locus_tag LOCUS_06130 47933 46182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867422.1 protein_id gnl|my_center|LOCUS_06130 48427 48188 gene locus_tag LOCUS_06140 48427 48188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 48610 49878 gene locus_tag LOCUS_06150 48610 49878 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583698.1 protein_id gnl|my_center|LOCUS_06150 49871 50200 gene locus_tag LOCUS_06160 49871 50200 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583697.1 protein_id gnl|my_center|LOCUS_06160 50197 51507 gene locus_tag LOCUS_06170 50197 51507 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 protein_id gnl|my_center|LOCUS_06170 52159 51488 gene locus_tag LOCUS_06180 52159 51488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 52448 52669 gene locus_tag LOCUS_06190 52448 52669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence09 428 925 gene locus_tag LOCUS_06200 428 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1076 2896 gene locus_tag LOCUS_06210 1076 2896 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978165.1 protein_id gnl|my_center|LOCUS_06210 2880 3221 gene locus_tag LOCUS_06220 2880 3221 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020348.1 protein_id gnl|my_center|LOCUS_06220 3236 3502 gene locus_tag LOCUS_06230 3236 3502 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020250.1 protein_id gnl|my_center|LOCUS_06230 3545 4006 gene locus_tag LOCUS_06240 3545 4006 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 protein_id gnl|my_center|LOCUS_06240 4111 4452 gene locus_tag LOCUS_06250 4111 4452 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014597.1 protein_id gnl|my_center|LOCUS_06250 4499 4654 gene locus_tag LOCUS_06260 4499 4654 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877221.1 protein_id gnl|my_center|LOCUS_06260 4666 4965 gene locus_tag LOCUS_06270 4666 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 5059 5745 gene locus_tag LOCUS_06280 5059 5745 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979414.1 protein_id gnl|my_center|LOCUS_06280 5747 6010 gene locus_tag LOCUS_06290 gene rpl18a 5747 6010 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846956.1 protein_id gnl|my_center|LOCUS_06290 6007 6459 gene locus_tag LOCUS_06300 6007 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 6558 7487 gene locus_tag LOCUS_06310 gene ftsY 6558 7487 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922948.1 protein_id gnl|my_center|LOCUS_06310 8350 7499 gene locus_tag LOCUS_06320 8350 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 9294 8356 gene locus_tag LOCUS_06330 9294 8356 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013684142.1 protein_id gnl|my_center|LOCUS_06330 9931 9338 gene locus_tag LOCUS_06340 9931 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 12014 10194 gene locus_tag LOCUS_06350 12014 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 12160 13329 gene locus_tag LOCUS_06360 12160 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 14041 13319 gene locus_tag LOCUS_06370 14041 13319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 14589 14035 gene locus_tag LOCUS_06380 14589 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 15403 14606 gene locus_tag LOCUS_06390 15403 14606 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978403.1 protein_id gnl|my_center|LOCUS_06390 15654 16559 gene locus_tag LOCUS_06400 gene prpB 15654 16559 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846659.1 protein_id gnl|my_center|LOCUS_06400 16632 18572 gene locus_tag LOCUS_06410 16632 18572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 18604 18843 gene locus_tag LOCUS_06420 18604 18843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846299.1 protein_id gnl|my_center|LOCUS_06420 18854 20299 gene locus_tag LOCUS_06430 18854 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 20309 21628 gene locus_tag LOCUS_06440 20309 21628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 21656 22891 gene locus_tag LOCUS_06450 gene guaB 21656 22891 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868777.1 protein_id gnl|my_center|LOCUS_06450 23881 22886 gene locus_tag LOCUS_06460 gene meaB 23881 22886 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846722.1 protein_id gnl|my_center|LOCUS_06460 24269 23847 gene locus_tag LOCUS_06470 24269 23847 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_06470 25981 24281 gene locus_tag LOCUS_06480 25981 24281 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878783.1 protein_id gnl|my_center|LOCUS_06480 26149 26958 gene locus_tag LOCUS_06490 26149 26958 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980282.1 protein_id gnl|my_center|LOCUS_06490 26972 28015 gene locus_tag LOCUS_06500 26972 28015 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868647.1 protein_id gnl|my_center|LOCUS_06500 28012 28617 gene locus_tag LOCUS_06510 28012 28617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 28610 29197 gene locus_tag LOCUS_06520 28610 29197 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_06520 29223 29588 gene locus_tag LOCUS_06530 29223 29588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 30245 29718 gene locus_tag LOCUS_06540 30245 29718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867695.1 protein_id gnl|my_center|LOCUS_06540 31738 30251 gene locus_tag LOCUS_06550 31738 30251 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810219.1 protein_id gnl|my_center|LOCUS_06550 31910 33349 gene locus_tag LOCUS_06560 31910 33349 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 protein_id gnl|my_center|LOCUS_06560 33504 34481 gene locus_tag LOCUS_06570 33504 34481 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544937.1 protein_id gnl|my_center|LOCUS_06570 34488 35513 gene locus_tag LOCUS_06580 34488 35513 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763252.1 protein_id gnl|my_center|LOCUS_06580 35525 36286 gene locus_tag LOCUS_06590 35525 36286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_06590 36292 37008 gene locus_tag LOCUS_06600 36292 37008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_06600 38375 37155 gene locus_tag LOCUS_06610 38375 37155 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978176.1 protein_id gnl|my_center|LOCUS_06610 38994 38500 gene locus_tag LOCUS_06620 38994 38500 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256302.1 protein_id gnl|my_center|LOCUS_06620 40178 38997 gene locus_tag LOCUS_06630 40178 38997 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979420.1 protein_id gnl|my_center|LOCUS_06630 40294 41757 gene locus_tag LOCUS_06640 40294 41757 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868194.1 protein_id gnl|my_center|LOCUS_06640 42216 41752 gene locus_tag LOCUS_06650 42216 41752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 42446 43276 gene locus_tag LOCUS_06660 42446 43276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 43360 43692 gene locus_tag LOCUS_06670 43360 43692 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240464.1 protein_id gnl|my_center|LOCUS_06670 43798 44712 gene locus_tag LOCUS_06680 gene tatC 43798 44712 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880807.1 protein_id gnl|my_center|LOCUS_06680 44814 46292 gene locus_tag LOCUS_06690 44814 46292 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846662.1 protein_id gnl|my_center|LOCUS_06690 47321 46296 gene locus_tag LOCUS_06700 47321 46296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 48060 47386 gene locus_tag LOCUS_06710 48060 47386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 48945 48151 gene locus_tag LOCUS_06720 48945 48151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 <49963 48960 gene locus_tag LOCUS_06730 <49963 48960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879871.1:molybdopterin-dependent oxidoreductase >Feature sequence10 863 51 gene locus_tag LOCUS_06740 863 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 1469 873 gene locus_tag LOCUS_06750 1469 873 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_06750 2287 1472 gene locus_tag LOCUS_06760 2287 1472 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979496.1 protein_id gnl|my_center|LOCUS_06760 3029 2418 gene locus_tag LOCUS_06770 3029 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 3633 3205 gene locus_tag LOCUS_06780 3633 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4056 3649 gene locus_tag LOCUS_06790 gene trxA 4056 3649 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021055.1 protein_id gnl|my_center|LOCUS_06790 4189 5943 gene locus_tag LOCUS_06800 4189 5943 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978239.1 protein_id gnl|my_center|LOCUS_06800 6031 6372 gene locus_tag LOCUS_06810 6031 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 6432 7574 gene locus_tag LOCUS_06820 6432 7574 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846293.1 protein_id gnl|my_center|LOCUS_06820 7635 8387 gene locus_tag LOCUS_06830 7635 8387 CDS product DUF2208 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978354.1 protein_id gnl|my_center|LOCUS_06830 9837 8410 gene locus_tag LOCUS_06840 gene glmM 9837 8410 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250728.1 protein_id gnl|my_center|LOCUS_06840 10384 9839 gene locus_tag LOCUS_06850 10384 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 10480 11142 gene locus_tag LOCUS_06860 10480 11142 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762140.1 protein_id gnl|my_center|LOCUS_06860 11284 12474 gene locus_tag LOCUS_06870 11284 12474 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 protein_id gnl|my_center|LOCUS_06870 12480 13028 gene locus_tag LOCUS_06880 12480 13028 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978019.1 protein_id gnl|my_center|LOCUS_06880 13102 14298 gene locus_tag LOCUS_06890 13102 14298 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978015.1 protein_id gnl|my_center|LOCUS_06890 15017 14361 gene locus_tag LOCUS_06900 15017 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 15119 15289 gene locus_tag LOCUS_06910 15119 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 15547 15296 gene locus_tag LOCUS_06920 15547 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 16765 15584 gene locus_tag LOCUS_06930 gene cdvC 16765 15584 CDS product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_06930 17657 16866 gene locus_tag LOCUS_06940 17657 16866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 17928 19949 gene locus_tag LOCUS_06950 17928 19949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 19951 21102 gene locus_tag LOCUS_06960 19951 21102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 21736 21095 gene locus_tag LOCUS_06970 21736 21095 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_06970 22178 22411 gene locus_tag LOCUS_06980 22178 22411 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868845.1 protein_id gnl|my_center|LOCUS_06980 23891 22464 gene locus_tag LOCUS_06990 gene cysS 23891 22464 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847028.1 protein_id gnl|my_center|LOCUS_06990 24536 23994 gene locus_tag LOCUS_07000 24536 23994 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249257.1 protein_id gnl|my_center|LOCUS_07000 24782 26014 gene locus_tag LOCUS_07010 gene thrC 24782 26014 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867870.1 protein_id gnl|my_center|LOCUS_07010 26088 26810 gene locus_tag LOCUS_07020 26088 26810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 26816 28093 gene locus_tag LOCUS_07030 26816 28093 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986509.1 protein_id gnl|my_center|LOCUS_07030 28083 28805 gene locus_tag LOCUS_07040 28083 28805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 28809 29228 gene locus_tag LOCUS_07050 28809 29228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 29228 29860 gene locus_tag LOCUS_07060 29228 29860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 30174 29851 gene locus_tag LOCUS_07070 30174 29851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 30342 31202 gene locus_tag LOCUS_07080 gene dph5 30342 31202 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870787.1 protein_id gnl|my_center|LOCUS_07080 31204 32325 gene locus_tag LOCUS_07090 31204 32325 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875890.1 protein_id gnl|my_center|LOCUS_07090 32990 32322 gene locus_tag LOCUS_07100 32990 32322 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_07100 34852 32975 gene locus_tag LOCUS_07110 34852 32975 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146458.1 protein_id gnl|my_center|LOCUS_07110 34999 35835 gene locus_tag LOCUS_07120 34999 35835 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064299.1 protein_id gnl|my_center|LOCUS_07120 35858 36415 gene locus_tag LOCUS_07130 35858 36415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 36464 40840 gene locus_tag LOCUS_07140 36464 40840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 41280 40837 gene locus_tag LOCUS_07150 41280 40837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 41466 43952 gene locus_tag LOCUS_07160 41466 43952 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763175.1 protein_id gnl|my_center|LOCUS_07160 44302 43949 gene locus_tag LOCUS_07170 44302 43949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 44383 44694 gene locus_tag LOCUS_07180 44383 44694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 44713 45663 gene locus_tag LOCUS_07190 44713 45663 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878818.1 protein_id gnl|my_center|LOCUS_07190 45750 46043 gene locus_tag LOCUS_07200 gene albA 45750 46043 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979310.1 protein_id gnl|my_center|LOCUS_07200 46929 46135 gene locus_tag LOCUS_07210 46929 46135 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762180.1 protein_id gnl|my_center|LOCUS_07210 47048 48178 gene locus_tag LOCUS_07220 47048 48178 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763494.1 protein_id gnl|my_center|LOCUS_07220 48519 48187 gene locus_tag LOCUS_07230 48519 48187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979309.1 protein_id gnl|my_center|LOCUS_07230 48670 49053 gene locus_tag LOCUS_07240 48670 49053 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762119.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence11 136 351 gene locus_tag LOCUS_07250 136 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 1149 586 gene locus_tag LOCUS_07260 1149 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 1236 1496 gene locus_tag LOCUS_07270 1236 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 1935 1507 gene locus_tag LOCUS_07280 gene lrpA 1935 1507 CDS product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251084.1 protein_id gnl|my_center|LOCUS_07280 2722 2015 gene locus_tag LOCUS_07290 2722 2015 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080855.1 protein_id gnl|my_center|LOCUS_07290 3559 2816 gene locus_tag LOCUS_07300 3559 2816 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763546.1 protein_id gnl|my_center|LOCUS_07300 3809 3573 gene locus_tag LOCUS_07310 3809 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4310 3876 gene locus_tag LOCUS_07320 4310 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 4639 5508 gene locus_tag LOCUS_07330 4639 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 5560 6663 gene locus_tag LOCUS_07340 gene gcvT 5560 6663 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979225.1 protein_id gnl|my_center|LOCUS_07340 6676 7095 gene locus_tag LOCUS_07350 gene gcvH 6676 7095 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846941.1 protein_id gnl|my_center|LOCUS_07350 7432 7034 gene locus_tag LOCUS_07360 7432 7034 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978437.1 protein_id gnl|my_center|LOCUS_07360 7516 7791 gene locus_tag LOCUS_07370 7516 7791 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978435.1 protein_id gnl|my_center|LOCUS_07370 7867 9315 gene locus_tag LOCUS_07380 7867 9315 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978827.1 protein_id gnl|my_center|LOCUS_07380 9330 10880 gene locus_tag LOCUS_07390 9330 10880 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762431.1 protein_id gnl|my_center|LOCUS_07390 11002 12054 gene locus_tag LOCUS_07400 11002 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 12212 13534 gene locus_tag LOCUS_07410 12212 13534 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871009.1 protein_id gnl|my_center|LOCUS_07410 13714 14874 gene locus_tag LOCUS_07420 13714 14874 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763686.1 protein_id gnl|my_center|LOCUS_07420 14982 16175 gene locus_tag LOCUS_07430 14982 16175 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868011.1 protein_id gnl|my_center|LOCUS_07430 16247 17671 gene locus_tag LOCUS_07440 gene glpK 16247 17671 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_07440 17676 18557 gene locus_tag LOCUS_07450 17676 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 18554 19936 gene locus_tag LOCUS_07460 18554 19936 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_07460 19939 20982 gene locus_tag LOCUS_07470 19939 20982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 21406 20969 gene locus_tag LOCUS_07480 21406 20969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 22607 21447 gene locus_tag LOCUS_07490 22607 21447 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064153.1 protein_id gnl|my_center|LOCUS_07490 25297 22670 gene locus_tag LOCUS_07500 25297 22670 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429806.1 protein_id gnl|my_center|LOCUS_07500 25460 28462 gene locus_tag LOCUS_07510 gene leuS 25460 28462 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846570.1 protein_id gnl|my_center|LOCUS_07510 29457 28474 gene locus_tag LOCUS_07520 29457 28474 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978607.1 protein_id gnl|my_center|LOCUS_07520 29863 29549 gene locus_tag LOCUS_07530 29863 29549 CDS product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761814.1 protein_id gnl|my_center|LOCUS_07530 30071 31378 gene locus_tag LOCUS_07540 30071 31378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 31767 31372 gene locus_tag LOCUS_07550 31767 31372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 31880 32851 gene locus_tag LOCUS_07560 31880 32851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 33321 32848 gene locus_tag LOCUS_07570 33321 32848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978455.1 protein_id gnl|my_center|LOCUS_07570 33460 34746 gene locus_tag LOCUS_07580 33460 34746 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762402.1 protein_id gnl|my_center|LOCUS_07580 34760 35065 gene locus_tag LOCUS_07590 34760 35065 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762401.1 protein_id gnl|my_center|LOCUS_07590 35078 35881 gene locus_tag LOCUS_07600 35078 35881 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762400.1 protein_id gnl|my_center|LOCUS_07600 35894 36973 gene locus_tag LOCUS_07610 35894 36973 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762399.1 protein_id gnl|my_center|LOCUS_07610 37096 38415 gene locus_tag LOCUS_07620 37096 38415 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545236.1 protein_id gnl|my_center|LOCUS_07620 38907 38620 gene locus_tag LOCUS_07630 38907 38620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 39590 38931 gene locus_tag LOCUS_07640 39590 38931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 40095 39697 gene locus_tag LOCUS_07650 40095 39697 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_07650 41089 40664 gene locus_tag LOCUS_07660 41089 40664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 41894 41115 gene locus_tag LOCUS_07670 41894 41115 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979223.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence12 352 1437 gene locus_tag LOCUS_07680 352 1437 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980153.1 protein_id gnl|my_center|LOCUS_07680 1656 1417 gene locus_tag LOCUS_07690 1656 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 1772 4195 gene locus_tag LOCUS_07700 1772 4195 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_07700 4515 4192 gene locus_tag LOCUS_07710 4515 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4580 4858 gene locus_tag LOCUS_07720 4580 4858 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_07720 5955 5062 gene locus_tag LOCUS_07730 5955 5062 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429779.1 protein_id gnl|my_center|LOCUS_07730 6050 7054 gene locus_tag LOCUS_07740 6050 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 7104 8015 gene locus_tag LOCUS_07750 7104 8015 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_07750 9077 8007 gene locus_tag LOCUS_07760 9077 8007 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_07760 9948 9040 gene locus_tag LOCUS_07770 9948 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 10223 10717 gene locus_tag LOCUS_07780 10223 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 10763 11077 gene locus_tag LOCUS_07790 10763 11077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 11558 11052 gene locus_tag LOCUS_07800 11558 11052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 11638 12858 gene locus_tag LOCUS_07810 11638 12858 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979245.1 protein_id gnl|my_center|LOCUS_07810 14087 12885 gene locus_tag LOCUS_07820 14087 12885 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943960.1 protein_id gnl|my_center|LOCUS_07820 15351 14257 gene locus_tag LOCUS_07830 gene amrS 15351 14257 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979564.1 protein_id gnl|my_center|LOCUS_07830 16083 15373 gene locus_tag LOCUS_07840 gene alaXM 16083 15373 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_07840 16407 17033 gene locus_tag LOCUS_07850 16407 17033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 17378 17037 gene locus_tag LOCUS_07860 17378 17037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 17453 18460 gene locus_tag LOCUS_07870 17453 18460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 18527 19375 gene locus_tag LOCUS_07880 gene rnz 18527 19375 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978944.1 protein_id gnl|my_center|LOCUS_07880 19372 19551 gene locus_tag LOCUS_07890 19372 19551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 20545 19796 gene locus_tag LOCUS_07900 20545 19796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 21834 20491 gene locus_tag LOCUS_07910 gene cca 21834 20491 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978948.1 protein_id gnl|my_center|LOCUS_07910 22283 22693 gene locus_tag LOCUS_07920 22283 22693 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979318.1 protein_id gnl|my_center|LOCUS_07920 22797 24134 gene locus_tag LOCUS_07930 22797 24134 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979319.1 protein_id gnl|my_center|LOCUS_07930 24251 24604 gene locus_tag LOCUS_07940 24251 24604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 24611 26467 gene locus_tag LOCUS_07950 24611 26467 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762145.1 protein_id gnl|my_center|LOCUS_07950 26471 27265 gene locus_tag LOCUS_07960 26471 27265 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496764.1 protein_id gnl|my_center|LOCUS_07960 27336 27686 gene locus_tag LOCUS_07970 27336 27686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 28500 27625 gene locus_tag LOCUS_07980 28500 27625 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868373.1 protein_id gnl|my_center|LOCUS_07980 28625 29365 gene locus_tag LOCUS_07990 gene cobB 28625 29365 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_07990 29734 29357 gene locus_tag LOCUS_08000 29734 29357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 29841 30245 gene locus_tag LOCUS_08010 29841 30245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 30336 31565 gene locus_tag LOCUS_08020 30336 31565 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_08020 31616 31945 gene locus_tag LOCUS_08030 31616 31945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 31979 32701 gene locus_tag LOCUS_08040 31979 32701 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978563.1 protein_id gnl|my_center|LOCUS_08040 32770 33024 gene locus_tag LOCUS_08050 32770 33024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 33118 34116 gene locus_tag LOCUS_08060 33118 34116 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846928.1 protein_id gnl|my_center|LOCUS_08060 34233 36251 gene locus_tag LOCUS_08070 34233 36251 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763166.1 protein_id gnl|my_center|LOCUS_08070 36938 36699 gene locus_tag LOCUS_08080 36938 36699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence13 1398 1697 gene locus_tag LOCUS_08090 1398 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1878 2369 gene locus_tag LOCUS_08100 1878 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 2718 5501 gene locus_tag LOCUS_08110 2718 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 5572 7653 gene locus_tag LOCUS_08120 5572 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 8450 7650 gene locus_tag LOCUS_08130 8450 7650 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762787.1 protein_id gnl|my_center|LOCUS_08130 8786 8454 gene locus_tag LOCUS_08140 8786 8454 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880624.1 protein_id gnl|my_center|LOCUS_08140 10332 8809 gene locus_tag LOCUS_08150 10332 8809 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980182.1 protein_id gnl|my_center|LOCUS_08150 10452 11051 gene locus_tag LOCUS_08160 10452 11051 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762168.1 protein_id gnl|my_center|LOCUS_08160 11973 11044 gene locus_tag LOCUS_08170 11973 11044 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_08170 12753 11974 gene locus_tag LOCUS_08180 12753 11974 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_08180 14969 12909 gene locus_tag LOCUS_08190 14969 12909 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979478.1 protein_id gnl|my_center|LOCUS_08190 15117 15422 gene locus_tag LOCUS_08200 15117 15422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 15429 16034 gene locus_tag LOCUS_08210 15429 16034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 16043 19390 gene locus_tag LOCUS_08220 16043 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 19404 20798 gene locus_tag LOCUS_08230 19404 20798 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979482.1 protein_id gnl|my_center|LOCUS_08230 20999 20814 gene locus_tag LOCUS_08240 20999 20814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 21105 21749 gene locus_tag LOCUS_08250 21105 21749 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979483.1 protein_id gnl|my_center|LOCUS_08250 21938 24130 gene locus_tag LOCUS_08260 21938 24130 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978339.1 protein_id gnl|my_center|LOCUS_08260 24388 24140 gene locus_tag LOCUS_08270 24388 24140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 24736 25314 gene locus_tag LOCUS_08280 24736 25314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 25422 26390 gene locus_tag LOCUS_08290 25422 26390 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_08290 27347 26427 gene locus_tag LOCUS_08300 27347 26427 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762507.1 protein_id gnl|my_center|LOCUS_08300 28164 27361 gene locus_tag LOCUS_08310 28164 27361 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762508.1 protein_id gnl|my_center|LOCUS_08310 30046 28301 gene locus_tag LOCUS_08320 30046 28301 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763167.1 protein_id gnl|my_center|LOCUS_08320 30163 30238 gene locus_tag LOCUS_t00110 30163 30238 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 30741 30247 gene locus_tag LOCUS_08330 30741 30247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 31409 30642 gene locus_tag LOCUS_08340 31409 30642 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762886.1 protein_id gnl|my_center|LOCUS_08340 31956 31465 gene locus_tag LOCUS_08350 31956 31465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 32207 32476 gene locus_tag LOCUS_08360 32207 32476 CDS product DNA-directed RNA polymerase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979520.1 protein_id gnl|my_center|LOCUS_08360 33177 32485 gene locus_tag LOCUS_08370 33177 32485 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978969.1 protein_id gnl|my_center|LOCUS_08370 33339 34547 gene locus_tag LOCUS_08380 33339 34547 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429732.1 protein_id gnl|my_center|LOCUS_08380 34552 34803 gene locus_tag LOCUS_08390 34552 34803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 34826 35275 gene locus_tag LOCUS_08400 gene moaC 34826 35275 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867492.1 protein_id gnl|my_center|LOCUS_08400 36670 35267 gene locus_tag LOCUS_08410 36670 35267 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846342.1 protein_id gnl|my_center|LOCUS_08410 <37990 36677 gene locus_tag LOCUS_08420 <37990 36677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978451.1:replication factor C small subunit >Feature sequence14 398 1324 gene locus_tag LOCUS_08430 398 1324 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979438.1 protein_id gnl|my_center|LOCUS_08430 2350 1286 gene locus_tag LOCUS_08440 2350 1286 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846754.1 protein_id gnl|my_center|LOCUS_08440 2459 2374 gene locus_tag LOCUS_t00120 2459 2374 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2617 3135 gene locus_tag LOCUS_08450 2617 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3128 4159 gene locus_tag LOCUS_08460 3128 4159 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762504.1 protein_id gnl|my_center|LOCUS_08460 5242 4148 gene locus_tag LOCUS_08470 gene rtcA 5242 4148 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250566.1 protein_id gnl|my_center|LOCUS_08470 5767 5243 gene locus_tag LOCUS_08480 5767 5243 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060754.1 protein_id gnl|my_center|LOCUS_08480 5838 6836 gene locus_tag LOCUS_08490 5838 6836 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846871.1 protein_id gnl|my_center|LOCUS_08490 6812 7354 gene locus_tag LOCUS_08500 6812 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 7361 8116 gene locus_tag LOCUS_08510 7361 8116 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867875.1 protein_id gnl|my_center|LOCUS_08510 9161 8106 gene locus_tag LOCUS_08520 9161 8106 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978305.1 protein_id gnl|my_center|LOCUS_08520 9268 9912 gene locus_tag LOCUS_08530 gene psmB 9268 9912 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 protein_id gnl|my_center|LOCUS_08530 10061 12052 gene locus_tag LOCUS_08540 10061 12052 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978304.1 protein_id gnl|my_center|LOCUS_08540 12346 12059 gene locus_tag LOCUS_08550 12346 12059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 12685 12906 gene locus_tag LOCUS_08560 12685 12906 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_08560 12917 13108 gene locus_tag LOCUS_08570 12917 13108 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978307.1 protein_id gnl|my_center|LOCUS_08570 13248 14360 gene locus_tag LOCUS_08580 gene pepQ 13248 14360 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146836.1 protein_id gnl|my_center|LOCUS_08580 14372 14962 gene locus_tag LOCUS_08590 gene psmB 14372 14962 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 protein_id gnl|my_center|LOCUS_08590 14949 15677 gene locus_tag LOCUS_08600 gene nfi 14949 15677 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_08600 16367 15663 gene locus_tag LOCUS_08610 16367 15663 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979298.1 protein_id gnl|my_center|LOCUS_08610 16704 16961 gene locus_tag LOCUS_08620 16704 16961 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846238.1 protein_id gnl|my_center|LOCUS_08620 16975 20511 gene locus_tag LOCUS_08630 16975 20511 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978227.1 protein_id gnl|my_center|LOCUS_08630 20518 23160 gene locus_tag LOCUS_08640 gene rpoA1 20518 23160 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846236.1 protein_id gnl|my_center|LOCUS_08640 23164 24333 gene locus_tag LOCUS_08650 gene rpoA2 23164 24333 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846867.1 protein_id gnl|my_center|LOCUS_08650 24348 24653 gene locus_tag LOCUS_08660 24348 24653 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870557.1 protein_id gnl|my_center|LOCUS_08660 24660 25094 gene locus_tag LOCUS_08670 24660 25094 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_08670 25163 25606 gene locus_tag LOCUS_08680 25163 25606 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978222.1 protein_id gnl|my_center|LOCUS_08680 26094 25630 gene locus_tag LOCUS_08690 26094 25630 CDS product DUF151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978221.1 protein_id gnl|my_center|LOCUS_08690 26247 26846 gene locus_tag LOCUS_08700 26247 26846 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_08700 26917 28224 gene locus_tag LOCUS_08710 gene tuf 26917 28224 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978219.1 protein_id gnl|my_center|LOCUS_08710 28462 28376 gene locus_tag LOCUS_t00130 28462 28376 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28860 28552 gene locus_tag LOCUS_08720 gene rpsJ 28860 28552 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978218.1 protein_id gnl|my_center|LOCUS_08720 28988 29896 gene locus_tag LOCUS_08730 gene map 28988 29896 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979464.1 protein_id gnl|my_center|LOCUS_08730 29911 31035 gene locus_tag LOCUS_08740 29911 31035 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_08740 31046 31345 gene locus_tag LOCUS_08750 31046 31345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 31447 31623 gene locus_tag LOCUS_08760 31447 31623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 31583 33316 gene locus_tag LOCUS_08770 gene metG 31583 33316 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979477.1 protein_id gnl|my_center|LOCUS_08770 33373 33448 gene locus_tag LOCUS_t00140 33373 33448 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 33773 34504 gene locus_tag LOCUS_08780 33773 34504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 34557 34634 gene locus_tag LOCUS_t00150 34557 34634 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 34778 36130 gene locus_tag LOCUS_08790 34778 36130 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978269.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence15 622 362 gene locus_tag LOCUS_08800 622 362 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_08800 1061 651 gene locus_tag LOCUS_08810 1061 651 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878062.1 protein_id gnl|my_center|LOCUS_08810 1781 1173 gene locus_tag LOCUS_08820 1781 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1947 2105 gene locus_tag LOCUS_08830 1947 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 3641 2112 gene locus_tag LOCUS_08840 3641 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3726 4730 gene locus_tag LOCUS_08850 3726 4730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250530.1 protein_id gnl|my_center|LOCUS_08850 4732 5457 gene locus_tag LOCUS_08860 4732 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 6886 5486 gene locus_tag LOCUS_08870 6886 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 7109 8383 gene locus_tag LOCUS_08880 7109 8383 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867576.1 protein_id gnl|my_center|LOCUS_08880 8452 9957 gene locus_tag LOCUS_08890 8452 9957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867577.1 protein_id gnl|my_center|LOCUS_08890 9954 10985 gene locus_tag LOCUS_08900 9954 10985 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867578.1 protein_id gnl|my_center|LOCUS_08900 10993 11913 gene locus_tag LOCUS_08910 10993 11913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867579.1 protein_id gnl|my_center|LOCUS_08910 12920 11919 gene locus_tag LOCUS_08920 12920 11919 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763671.1 protein_id gnl|my_center|LOCUS_08920 13000 13761 gene locus_tag LOCUS_08930 13000 13761 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978033.1 protein_id gnl|my_center|LOCUS_08930 13734 14906 gene locus_tag LOCUS_08940 13734 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 15180 15875 gene locus_tag LOCUS_08950 15180 15875 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042684532.1 protein_id gnl|my_center|LOCUS_08950 15944 16633 gene locus_tag LOCUS_08960 15944 16633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 16615 17106 gene locus_tag LOCUS_08970 16615 17106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 17115 17669 gene locus_tag LOCUS_08980 17115 17669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 17662 18384 gene locus_tag LOCUS_08990 17662 18384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 18402 20111 gene locus_tag LOCUS_09000 18402 20111 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980611.1 protein_id gnl|my_center|LOCUS_09000 20133 21764 gene locus_tag LOCUS_09010 20133 21764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 22087 23655 gene locus_tag LOCUS_09020 22087 23655 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249027.1 protein_id gnl|my_center|LOCUS_09020 24624 23644 gene locus_tag LOCUS_09030 24624 23644 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978014.1 protein_id gnl|my_center|LOCUS_09030 24686 25840 gene locus_tag LOCUS_09040 24686 25840 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250249.1 protein_id gnl|my_center|LOCUS_09040 25863 26648 gene locus_tag LOCUS_09050 25863 26648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 27422 26655 gene locus_tag LOCUS_09060 gene fabG 27422 26655 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_09060 27736 27449 gene locus_tag LOCUS_09070 27736 27449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 27857 28741 gene locus_tag LOCUS_09080 27857 28741 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895799.1 protein_id gnl|my_center|LOCUS_09080 28738 29670 gene locus_tag LOCUS_09090 28738 29670 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877604.1 protein_id gnl|my_center|LOCUS_09090 30005 29661 gene locus_tag LOCUS_09100 30005 29661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 30555 30085 gene locus_tag LOCUS_09110 30555 30085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 31626 30637 gene locus_tag LOCUS_09120 31626 30637 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249652.1 protein_id gnl|my_center|LOCUS_09120 32530 31640 gene locus_tag LOCUS_09130 32530 31640 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053679.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence16 139 1050 gene locus_tag LOCUS_09140 139 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1151 2536 gene locus_tag LOCUS_09150 1151 2536 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875835.1 protein_id gnl|my_center|LOCUS_09150 3198 2533 gene locus_tag LOCUS_09160 3198 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3277 3540 gene locus_tag LOCUS_09170 3277 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4263 3532 gene locus_tag LOCUS_09180 4263 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 5270 4260 gene locus_tag LOCUS_09190 5270 4260 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868388.1 protein_id gnl|my_center|LOCUS_09190 6582 5296 gene locus_tag LOCUS_09200 6582 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 6879 7187 gene locus_tag LOCUS_09210 6879 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 8533 7184 gene locus_tag LOCUS_09220 gene glnA 8533 7184 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_09220 8637 8921 gene locus_tag LOCUS_09230 8637 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 8918 9316 gene locus_tag LOCUS_09240 8918 9316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 9322 9780 gene locus_tag LOCUS_09250 9322 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 9855 10148 gene locus_tag LOCUS_09260 9855 10148 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846969.1 protein_id gnl|my_center|LOCUS_09260 10153 10500 gene locus_tag LOCUS_09270 10153 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 10635 13667 gene locus_tag LOCUS_09280 10635 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 13670 14623 gene locus_tag LOCUS_09290 13670 14623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 15183 14620 gene locus_tag LOCUS_09300 15183 14620 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868582.1 protein_id gnl|my_center|LOCUS_09300 16391 15273 gene locus_tag LOCUS_09310 16391 15273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 18231 16504 gene locus_tag LOCUS_09320 18231 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 19258 18326 gene locus_tag LOCUS_09330 19258 18326 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 protein_id gnl|my_center|LOCUS_09330 20079 19255 gene locus_tag LOCUS_09340 20079 19255 CDS product GTP cyclohydrolase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146537.1 protein_id gnl|my_center|LOCUS_09340 21718 20069 gene locus_tag LOCUS_09350 gene pheT 21718 20069 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979460.1 protein_id gnl|my_center|LOCUS_09350 23183 21720 gene locus_tag LOCUS_09360 23183 21720 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979461.1 protein_id gnl|my_center|LOCUS_09360 24699 23254 gene locus_tag LOCUS_09370 24699 23254 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590803.1 protein_id gnl|my_center|LOCUS_09370 24863 24684 gene locus_tag LOCUS_09380 24863 24684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 24957 25925 gene locus_tag LOCUS_09390 24957 25925 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979430.1 protein_id gnl|my_center|LOCUS_09390 26410 25898 gene locus_tag LOCUS_09400 26410 25898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 28061 26460 gene locus_tag LOCUS_09410 28061 26460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 29203 28172 gene locus_tag LOCUS_09420 29203 28172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence17 160 708 gene locus_tag LOCUS_09430 160 708 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868694.1 protein_id gnl|my_center|LOCUS_09430 686 1297 gene locus_tag LOCUS_09440 686 1297 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978294.1 protein_id gnl|my_center|LOCUS_09440 1281 2282 gene locus_tag LOCUS_09450 1281 2282 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763402.1 protein_id gnl|my_center|LOCUS_09450 2295 2780 gene locus_tag LOCUS_09460 2295 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 2758 3936 gene locus_tag LOCUS_09470 2758 3936 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_09470 3939 5171 gene locus_tag LOCUS_09480 3939 5171 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846515.1 protein_id gnl|my_center|LOCUS_09480 5270 6040 gene locus_tag LOCUS_09490 5270 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846943.1 protein_id gnl|my_center|LOCUS_09490 6932 6282 gene locus_tag LOCUS_09500 6932 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 7173 6877 gene locus_tag LOCUS_09510 7173 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 7254 8195 gene locus_tag LOCUS_09520 gene argF 7254 8195 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_09520 8529 8221 gene locus_tag LOCUS_09530 8529 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 9190 8591 gene locus_tag LOCUS_09540 9190 8591 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015966.1 protein_id gnl|my_center|LOCUS_09540 9277 10386 gene locus_tag LOCUS_09550 gene prf1 9277 10386 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742617.1 protein_id gnl|my_center|LOCUS_09550 10913 10389 gene locus_tag LOCUS_09560 10913 10389 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878985.1 protein_id gnl|my_center|LOCUS_09560 10998 12122 gene locus_tag LOCUS_09570 10998 12122 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250252.1 protein_id gnl|my_center|LOCUS_09570 12115 12735 gene locus_tag LOCUS_09580 12115 12735 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846192.1 protein_id gnl|my_center|LOCUS_09580 13042 12767 gene locus_tag LOCUS_09590 13042 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 13208 13534 gene locus_tag LOCUS_09600 13208 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846516.1 protein_id gnl|my_center|LOCUS_09600 13867 13523 gene locus_tag LOCUS_09610 13867 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 14025 14399 gene locus_tag LOCUS_09620 14025 14399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 14684 14427 gene locus_tag LOCUS_09630 14684 14427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 16101 14758 gene locus_tag LOCUS_09640 16101 14758 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_09640 16172 16993 gene locus_tag LOCUS_09650 gene surE 16172 16993 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762060.1 protein_id gnl|my_center|LOCUS_09650 17030 19417 gene locus_tag LOCUS_09660 17030 19417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 19535 20041 gene locus_tag LOCUS_09670 19535 20041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 20061 20390 gene locus_tag LOCUS_09680 20061 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 21793 20387 gene locus_tag LOCUS_09690 gene serS 21793 20387 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979517.1 protein_id gnl|my_center|LOCUS_09690 22355 21963 gene locus_tag LOCUS_09700 22355 21963 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979516.1 protein_id gnl|my_center|LOCUS_09700 22608 22399 gene locus_tag LOCUS_09710 22608 22399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 23389 22583 gene locus_tag LOCUS_09720 23389 22583 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240366.1 protein_id gnl|my_center|LOCUS_09720 24873 23578 gene locus_tag LOCUS_09730 24873 23578 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979394.1 protein_id gnl|my_center|LOCUS_09730 25143 25511 gene locus_tag LOCUS_09740 25143 25511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 25803 25567 gene locus_tag LOCUS_09750 25803 25567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 25920 27074 gene locus_tag LOCUS_09760 25920 27074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 27639 28250 gene locus_tag LOCUS_09770 gene hxlB 27639 28250 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978137.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence18 746 1144 gene locus_tag LOCUS_09780 746 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1872 1141 gene locus_tag LOCUS_09790 gene sfsA 1872 1141 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_09790 4100 1944 gene locus_tag LOCUS_09800 4100 1944 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871078.1 protein_id gnl|my_center|LOCUS_09800 4348 4674 gene locus_tag LOCUS_09810 4348 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 5492 4671 gene locus_tag LOCUS_09820 5492 4671 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250014.1 protein_id gnl|my_center|LOCUS_09820 6342 5557 gene locus_tag LOCUS_09830 6342 5557 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541103.1 protein_id gnl|my_center|LOCUS_09830 6623 7027 gene locus_tag LOCUS_09840 6623 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 7396 7007 gene locus_tag LOCUS_09850 7396 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 8668 7466 gene locus_tag LOCUS_09860 8668 7466 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762777.1 protein_id gnl|my_center|LOCUS_09860 9216 8785 gene locus_tag LOCUS_09870 9216 8785 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979395.1 protein_id gnl|my_center|LOCUS_09870 10256 9231 gene locus_tag LOCUS_09880 10256 9231 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979396.1 protein_id gnl|my_center|LOCUS_09880 11507 10260 gene locus_tag LOCUS_09890 11507 10260 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979397.1 protein_id gnl|my_center|LOCUS_09890 11617 13017 gene locus_tag LOCUS_09900 11617 13017 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249457.1 protein_id gnl|my_center|LOCUS_09900 13038 14396 gene locus_tag LOCUS_09910 13038 14396 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251120.1 protein_id gnl|my_center|LOCUS_09910 14409 15071 gene locus_tag LOCUS_09920 14409 15071 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978516.1 protein_id gnl|my_center|LOCUS_09920 15253 15086 gene locus_tag LOCUS_09930 15253 15086 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742691.1 protein_id gnl|my_center|LOCUS_09930 15453 15800 gene locus_tag LOCUS_09940 15453 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846359.1 protein_id gnl|my_center|LOCUS_09940 16828 15797 gene locus_tag LOCUS_09950 16828 15797 CDS product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218267286.1 protein_id gnl|my_center|LOCUS_09950 17646 16897 gene locus_tag LOCUS_09960 17646 16897 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867490.1 protein_id gnl|my_center|LOCUS_09960 18787 17630 gene locus_tag LOCUS_09970 18787 17630 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978564.1 protein_id gnl|my_center|LOCUS_09970 18929 19354 gene locus_tag LOCUS_09980 18929 19354 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762119.1 protein_id gnl|my_center|LOCUS_09980 20042 19359 gene locus_tag LOCUS_09990 20042 19359 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867624.1 protein_id gnl|my_center|LOCUS_09990 20167 20718 gene locus_tag LOCUS_10000 20167 20718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 20891 20724 gene locus_tag LOCUS_10010 20891 20724 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978144.1 protein_id gnl|my_center|LOCUS_10010 21057 21584 gene locus_tag LOCUS_10020 21057 21584 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978145.1 protein_id gnl|my_center|LOCUS_10020 22627 21581 gene locus_tag LOCUS_10030 gene fen 22627 21581 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_10030 22853 22635 gene locus_tag LOCUS_10040 22853 22635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 25183 22970 gene locus_tag LOCUS_10050 25183 22970 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429724.1 protein_id gnl|my_center|LOCUS_10050 25604 25326 gene locus_tag LOCUS_10060 25604 25326 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978151.1 protein_id gnl|my_center|LOCUS_10060 25826 25617 gene locus_tag LOCUS_10070 25826 25617 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088862262.1 protein_id gnl|my_center|LOCUS_10070 25934 26284 gene locus_tag LOCUS_10080 gene pth2 25934 26284 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320039.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence19 172 471 gene locus_tag LOCUS_10090 172 471 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 protein_id gnl|my_center|LOCUS_10090 661 996 gene locus_tag LOCUS_10100 661 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1035 2126 gene locus_tag LOCUS_10110 1035 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2261 2662 gene locus_tag LOCUS_10120 2261 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979290.1 protein_id gnl|my_center|LOCUS_10120 3875 2667 gene locus_tag LOCUS_10130 3875 2667 CDS product tRNA (guanine(26)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979289.1 protein_id gnl|my_center|LOCUS_10130 4437 3898 gene locus_tag LOCUS_10140 4437 3898 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023327.1 protein_id gnl|my_center|LOCUS_10140 5399 4434 gene locus_tag LOCUS_10150 5399 4434 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429766.1 protein_id gnl|my_center|LOCUS_10150 5855 5412 gene locus_tag LOCUS_10160 5855 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 6565 5852 gene locus_tag LOCUS_10170 6565 5852 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846944.1 protein_id gnl|my_center|LOCUS_10170 7824 6562 gene locus_tag LOCUS_10180 7824 6562 CDS product C/D box methylation guide ribonucleoprotein complex aNOP56 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014546.1 protein_id gnl|my_center|LOCUS_10180 7961 8131 gene locus_tag LOCUS_10190 7961 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 8286 9647 gene locus_tag LOCUS_10200 gene gatD 8286 9647 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_10200 9640 11568 gene locus_tag LOCUS_10210 gene gatE 9640 11568 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979281.1 protein_id gnl|my_center|LOCUS_10210 11911 11675 gene locus_tag LOCUS_10220 11911 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 12023 12925 gene locus_tag LOCUS_10230 12023 12925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 12968 13306 gene locus_tag LOCUS_10240 12968 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 13358 15496 gene locus_tag LOCUS_10250 gene feoB 13358 15496 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249908.1 protein_id gnl|my_center|LOCUS_10250 15598 16824 gene locus_tag LOCUS_10260 15598 16824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 17204 16827 gene locus_tag LOCUS_10270 17204 16827 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877696.1 protein_id gnl|my_center|LOCUS_10270 18007 17294 gene locus_tag LOCUS_10280 18007 17294 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978168.1 protein_id gnl|my_center|LOCUS_10280 20812 18161 gene locus_tag LOCUS_10290 20812 18161 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979278.1 protein_id gnl|my_center|LOCUS_10290 21112 21426 gene locus_tag LOCUS_10300 21112 21426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 21448 22182 gene locus_tag LOCUS_10310 21448 22182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 22884 22108 gene locus_tag LOCUS_10320 22884 22108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 23030 24715 gene locus_tag LOCUS_10330 gene thsA 23030 24715 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846517.1 protein_id gnl|my_center|LOCUS_10330 25503 24745 gene locus_tag LOCUS_10340 25503 24745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 <26128 25481 gene locus_tag LOCUS_10350 <26128 25481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000521268.1:uroporphyrinogen-III C-methyltransferase >Feature sequence20 383 727 gene locus_tag LOCUS_10360 383 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1218 928 gene locus_tag LOCUS_10370 1218 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1489 2694 gene locus_tag LOCUS_10380 1489 2694 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_10380 2691 3533 gene locus_tag LOCUS_10390 2691 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 5207 4410 gene locus_tag LOCUS_10400 5207 4410 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099211500.1 protein_id gnl|my_center|LOCUS_10400 6256 5204 gene locus_tag LOCUS_10410 6256 5204 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099211502.1 protein_id gnl|my_center|LOCUS_10410 7037 6240 gene locus_tag LOCUS_10420 7037 6240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249669.1 protein_id gnl|my_center|LOCUS_10420 7858 7025 gene locus_tag LOCUS_10430 gene modA 7858 7025 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249668.1 protein_id gnl|my_center|LOCUS_10430 8053 8286 gene locus_tag LOCUS_10440 8053 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 8679 8918 gene locus_tag LOCUS_10450 8679 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 8911 9420 gene locus_tag LOCUS_10460 8911 9420 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_10460 9513 9436 gene locus_tag LOCUS_t00160 9513 9436 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10950 9595 gene locus_tag LOCUS_10470 10950 9595 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762251.1 protein_id gnl|my_center|LOCUS_10470 11663 10938 gene locus_tag LOCUS_10480 11663 10938 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_10480 11780 12367 gene locus_tag LOCUS_10490 11780 12367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 13228 12383 gene locus_tag LOCUS_10500 13228 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10500 13230 13490 gene locus_tag LOCUS_10510 13230 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 13940 13473 gene locus_tag LOCUS_10520 13940 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 14146 15426 gene locus_tag LOCUS_10530 14146 15426 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240344.1 protein_id gnl|my_center|LOCUS_10530 15548 17083 gene locus_tag LOCUS_10540 15548 17083 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_10540 17267 18274 gene locus_tag LOCUS_10550 17267 18274 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422090.1 protein_id gnl|my_center|LOCUS_10550 18969 18367 gene locus_tag LOCUS_10560 18969 18367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 19403 19104 gene locus_tag LOCUS_10570 19403 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 19402 21438 gene locus_tag LOCUS_10580 19402 21438 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867868.1 protein_id gnl|my_center|LOCUS_10580 21633 22631 gene locus_tag LOCUS_10590 21633 22631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867867.1 protein_id gnl|my_center|LOCUS_10590 22644 23822 gene locus_tag LOCUS_10600 22644 23822 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867866.1 protein_id gnl|my_center|LOCUS_10600 23819 24817 gene locus_tag LOCUS_10610 23819 24817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146644.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence21 863 285 gene locus_tag LOCUS_10620 863 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867709.1 protein_id gnl|my_center|LOCUS_10620 1317 874 gene locus_tag LOCUS_10630 1317 874 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287838.1 protein_id gnl|my_center|LOCUS_10630 1397 2299 gene locus_tag LOCUS_10640 1397 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3276 2296 gene locus_tag LOCUS_10650 3276 2296 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 protein_id gnl|my_center|LOCUS_10650 4053 3340 gene locus_tag LOCUS_10660 gene deoC 4053 3340 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880038.1 protein_id gnl|my_center|LOCUS_10660 5296 4115 gene locus_tag LOCUS_10670 5296 4115 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546088.1 protein_id gnl|my_center|LOCUS_10670 5440 6456 gene locus_tag LOCUS_10680 5440 6456 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_10680 6462 7271 gene locus_tag LOCUS_10690 6462 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 7258 8070 gene locus_tag LOCUS_10700 7258 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 9401 8073 gene locus_tag LOCUS_10710 9401 8073 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_10710 10656 9403 gene locus_tag LOCUS_10720 10656 9403 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_10720 12316 10880 gene locus_tag LOCUS_10730 12316 10880 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979012.1 protein_id gnl|my_center|LOCUS_10730 12549 12923 gene locus_tag LOCUS_10740 12549 12923 CDS product COG2426 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867635.1 protein_id gnl|my_center|LOCUS_10740 12960 13748 gene locus_tag LOCUS_10750 12960 13748 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847027.1 protein_id gnl|my_center|LOCUS_10750 13941 14543 gene locus_tag LOCUS_10760 13941 14543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 15326 14739 gene locus_tag LOCUS_10770 15326 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 15418 16923 gene locus_tag LOCUS_10780 15418 16923 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980439.1 protein_id gnl|my_center|LOCUS_10780 17432 16920 gene locus_tag LOCUS_10790 17432 16920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 18362 17484 gene locus_tag LOCUS_10800 18362 17484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 18924 19277 gene locus_tag LOCUS_10810 18924 19277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 19486 20145 gene locus_tag LOCUS_10820 19486 20145 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240534.1 protein_id gnl|my_center|LOCUS_10820 20164 20991 gene locus_tag LOCUS_10830 20164 20991 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846346.1 protein_id gnl|my_center|LOCUS_10830 21016 21873 gene locus_tag LOCUS_10840 21016 21873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 22010 21888 gene locus_tag LOCUS_10850 22010 21888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 23557 22127 gene locus_tag LOCUS_10860 23557 22127 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004068250.1 protein_id gnl|my_center|LOCUS_10860 23986 23612 gene locus_tag LOCUS_10870 23986 23612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence22 604 68 gene locus_tag LOCUS_10880 604 68 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979867.1 protein_id gnl|my_center|LOCUS_10880 1789 611 gene locus_tag LOCUS_10890 1789 611 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979868.1 protein_id gnl|my_center|LOCUS_10890 2952 1786 gene locus_tag LOCUS_10900 2952 1786 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979869.1 protein_id gnl|my_center|LOCUS_10900 3179 4570 gene locus_tag LOCUS_10910 3179 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 5492 4590 gene locus_tag LOCUS_10920 5492 4590 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763484.1 protein_id gnl|my_center|LOCUS_10920 6449 5577 gene locus_tag LOCUS_10930 6449 5577 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979837.1 protein_id gnl|my_center|LOCUS_10930 7435 6449 gene locus_tag LOCUS_10940 7435 6449 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 protein_id gnl|my_center|LOCUS_10940 7578 7850 gene locus_tag LOCUS_10950 7578 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 8668 7958 gene locus_tag LOCUS_10960 8668 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 8809 9483 gene locus_tag LOCUS_10970 gene cdvB1/B2 8809 9483 CDS product cell division protein CdvB1/B2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_10970 10710 9568 gene locus_tag LOCUS_10980 10710 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 11005 10691 gene locus_tag LOCUS_10990 11005 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 11536 11063 gene locus_tag LOCUS_11000 11536 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 12357 11554 gene locus_tag LOCUS_11010 gene panB 12357 11554 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978510.1 protein_id gnl|my_center|LOCUS_11010 12867 12406 gene locus_tag LOCUS_11020 12867 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 12952 14040 gene locus_tag LOCUS_11030 12952 14040 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250771.1 protein_id gnl|my_center|LOCUS_11030 14069 15229 gene locus_tag LOCUS_11040 14069 15229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 15655 15242 gene locus_tag LOCUS_11050 15655 15242 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879721.1 protein_id gnl|my_center|LOCUS_11050 15755 16309 gene locus_tag LOCUS_11060 gene dps 15755 16309 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250010.1 protein_id gnl|my_center|LOCUS_11060 17035 16367 gene locus_tag LOCUS_11070 17035 16367 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209478368.1 protein_id gnl|my_center|LOCUS_11070 17748 17098 gene locus_tag LOCUS_11080 17748 17098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 18066 18869 gene locus_tag LOCUS_11090 18066 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 19375 19172 gene locus_tag LOCUS_11100 19375 19172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 21619 19496 gene locus_tag LOCUS_11110 21619 19496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 22844 21627 gene locus_tag LOCUS_11120 22844 21627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 23082 24206 gene locus_tag LOCUS_11130 23082 24206 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980418.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence23 758 234 gene locus_tag LOCUS_11140 758 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 834 1262 gene locus_tag LOCUS_11150 834 1262 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251148.1 protein_id gnl|my_center|LOCUS_11150 1425 2159 gene locus_tag LOCUS_11160 1425 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2224 2529 gene locus_tag LOCUS_11170 2224 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2526 3941 gene locus_tag LOCUS_11180 gene gatA 2526 3941 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846522.1 protein_id gnl|my_center|LOCUS_11180 3952 5391 gene locus_tag LOCUS_11190 gene gatB 3952 5391 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846244.1 protein_id gnl|my_center|LOCUS_11190 5861 5388 gene locus_tag LOCUS_11200 5861 5388 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763493.1 protein_id gnl|my_center|LOCUS_11200 7037 5928 gene locus_tag LOCUS_11210 7037 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 7163 8377 gene locus_tag LOCUS_11220 7163 8377 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320021.1 protein_id gnl|my_center|LOCUS_11220 8428 8823 gene locus_tag LOCUS_11230 8428 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 9691 8804 gene locus_tag LOCUS_11240 9691 8804 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248984.1 protein_id gnl|my_center|LOCUS_11240 10410 9721 gene locus_tag LOCUS_11250 10410 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 10753 11265 gene locus_tag LOCUS_11260 10753 11265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 11311 12369 gene locus_tag LOCUS_11270 11311 12369 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 protein_id gnl|my_center|LOCUS_11270 13452 12349 gene locus_tag LOCUS_11280 13452 12349 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_11280 13579 14427 gene locus_tag LOCUS_11290 13579 14427 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146582.1 protein_id gnl|my_center|LOCUS_11290 14445 15593 gene locus_tag LOCUS_11300 14445 15593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 16089 15595 gene locus_tag LOCUS_11310 16089 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 17246 16143 gene locus_tag LOCUS_11320 17246 16143 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763350.1 protein_id gnl|my_center|LOCUS_11320 18221 17256 gene locus_tag LOCUS_11330 18221 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 18490 19512 gene locus_tag LOCUS_11340 18490 19512 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761873.1 protein_id gnl|my_center|LOCUS_11340 19509 20480 gene locus_tag LOCUS_11350 19509 20480 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429777.1 protein_id gnl|my_center|LOCUS_11350 20487 21665 gene locus_tag LOCUS_11360 20487 21665 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240521.1 protein_id gnl|my_center|LOCUS_11360 21671 22363 gene locus_tag LOCUS_11370 21671 22363 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240232.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence24 9 1400 gene locus_tag LOCUS_11380 9 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1758 1402 gene locus_tag LOCUS_11390 1758 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3391 2195 gene locus_tag LOCUS_11400 3391 2195 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064554.1 protein_id gnl|my_center|LOCUS_11400 5061 3388 gene locus_tag LOCUS_11410 5061 3388 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763089.1 protein_id gnl|my_center|LOCUS_11410 5982 5209 gene locus_tag LOCUS_11420 5982 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 6752 5979 gene locus_tag LOCUS_11430 6752 5979 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250859.1 protein_id gnl|my_center|LOCUS_11430 7624 6749 gene locus_tag LOCUS_11440 gene lipA 7624 6749 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174105.1 protein_id gnl|my_center|LOCUS_11440 7876 7628 gene locus_tag LOCUS_11450 7876 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 9119 7932 gene locus_tag LOCUS_11460 9119 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 9273 10409 gene locus_tag LOCUS_11470 9273 10409 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877746.1 protein_id gnl|my_center|LOCUS_11470 11096 10386 gene locus_tag LOCUS_11480 11096 10386 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846565.1 protein_id gnl|my_center|LOCUS_11480 11653 11093 gene locus_tag LOCUS_11490 gene thpR 11653 11093 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762325.1 protein_id gnl|my_center|LOCUS_11490 11784 12512 gene locus_tag LOCUS_11500 11784 12512 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_11500 12515 13264 gene locus_tag LOCUS_11510 12515 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 13225 13938 gene locus_tag LOCUS_11520 13225 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 13931 14533 gene locus_tag LOCUS_11530 13931 14533 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250285.1 protein_id gnl|my_center|LOCUS_11530 14481 14903 gene locus_tag LOCUS_11540 14481 14903 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978945.1 protein_id gnl|my_center|LOCUS_11540 14988 16484 gene locus_tag LOCUS_11550 14988 16484 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868688.1 protein_id gnl|my_center|LOCUS_11550 16510 17325 gene locus_tag LOCUS_11560 16510 17325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 18218 18874 gene locus_tag LOCUS_11570 gene upp 18218 18874 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978234.1 protein_id gnl|my_center|LOCUS_11570 19088 19621 gene locus_tag LOCUS_11580 gene dcd 19088 19621 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846226.1 protein_id gnl|my_center|LOCUS_11580 19690 21222 gene locus_tag LOCUS_11590 19690 21222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 21225 21491 gene locus_tag LOCUS_11600 21225 21491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 21607 21383 gene locus_tag LOCUS_11610 21607 21383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 21835 21614 gene locus_tag LOCUS_11620 21835 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence25 1618 518 gene locus_tag LOCUS_11630 1618 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 5163 1636 gene locus_tag LOCUS_11640 gene cas10 5163 1636 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846691.1 protein_id gnl|my_center|LOCUS_11640 6212 5190 gene locus_tag LOCUS_11650 6212 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 7822 6224 gene locus_tag LOCUS_11660 7822 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 8366 7827 gene locus_tag LOCUS_11670 8366 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 9275 8382 gene locus_tag LOCUS_11680 gene cmr4 9275 8382 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980046.1 protein_id gnl|my_center|LOCUS_11680 9424 11097 gene locus_tag LOCUS_11690 9424 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 11869 11225 gene locus_tag LOCUS_11700 gene csa3 11869 11225 CDS product CRISPR-associated CARF protein Csa3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846494.1 protein_id gnl|my_center|LOCUS_11700 12039 12419 gene locus_tag LOCUS_11710 12039 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 12422 13393 gene locus_tag LOCUS_11720 gene cas7a 12422 13393 CDS product type I-A CRISPR-associated protein Cas7/Csa2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125740408.1 protein_id gnl|my_center|LOCUS_11720 13431 14261 gene locus_tag LOCUS_11730 gene cas5a 13431 14261 CDS product type I-A CRISPR-associated protein Cas5a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879365.1 protein_id gnl|my_center|LOCUS_11730 14254 15687 gene locus_tag LOCUS_11740 14254 15687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 15629 17389 gene locus_tag LOCUS_11750 gene cas3 15629 17389 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879367.1 protein_id gnl|my_center|LOCUS_11750 17396 18220 gene locus_tag LOCUS_11760 17396 18220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 19260 18229 gene locus_tag LOCUS_11770 gene cas1 19260 18229 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977959.1 protein_id gnl|my_center|LOCUS_11770 20214 19264 gene locus_tag LOCUS_11780 gene cas4a 20214 19264 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977960.1 protein_id gnl|my_center|LOCUS_11780 20267 20878 gene locus_tag LOCUS_11790 20267 20878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 21180 20875 gene locus_tag LOCUS_11800 gene cas2 21180 20875 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846123.1 protein_id gnl|my_center|LOCUS_11800 21376 21647 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acaagtatccagcaaggaattgagag >Feature sequence26 551 120 gene locus_tag LOCUS_11810 551 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1362 514 gene locus_tag LOCUS_11820 1362 514 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251074.1 protein_id gnl|my_center|LOCUS_11820 1387 2430 gene locus_tag LOCUS_11830 1387 2430 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249452.1 protein_id gnl|my_center|LOCUS_11830 2615 2761 gene locus_tag LOCUS_11840 2615 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2890 3564 gene locus_tag LOCUS_11850 2890 3564 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020593.1 protein_id gnl|my_center|LOCUS_11850 3744 4205 gene locus_tag LOCUS_11860 3744 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 4253 7030 gene locus_tag LOCUS_11870 4253 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 7033 7935 gene locus_tag LOCUS_11880 7033 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 8178 9407 gene locus_tag LOCUS_11890 8178 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 10291 9419 gene locus_tag LOCUS_11900 10291 9419 CDS product ARMT1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762322.1 protein_id gnl|my_center|LOCUS_11900 10380 11927 gene locus_tag LOCUS_11910 10380 11927 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878821.1 protein_id gnl|my_center|LOCUS_11910 11966 13387 gene locus_tag LOCUS_11920 11966 13387 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274415.1 protein_id gnl|my_center|LOCUS_11920 13923 13384 gene locus_tag LOCUS_11930 gene pfpI 13923 13384 CDS product deglycase PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867593.1 protein_id gnl|my_center|LOCUS_11930 13999 14541 gene locus_tag LOCUS_11940 13999 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 14873 14511 gene locus_tag LOCUS_11950 14873 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 14960 15235 gene locus_tag LOCUS_11960 14960 15235 CDS product U6 snRNA-associated Sm-like protein LSm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846864.1 protein_id gnl|my_center|LOCUS_11960 15996 15226 gene locus_tag LOCUS_11970 gene nucS 15996 15226 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867250.1 protein_id gnl|my_center|LOCUS_11970 16087 16752 gene locus_tag LOCUS_11980 16087 16752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 16759 17454 gene locus_tag LOCUS_11990 16759 17454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 17551 20376 gene locus_tag LOCUS_12000 17551 20376 CDS product DNA-directed DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979471.1 protein_id gnl|my_center|LOCUS_12000 20845 20758 gene locus_tag LOCUS_t00170 20845 20758 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence27 789 1100 gene locus_tag LOCUS_12010 789 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1100 1375 gene locus_tag LOCUS_12020 1100 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1378 1929 gene locus_tag LOCUS_12030 1378 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2795 2307 gene locus_tag LOCUS_12040 2795 2307 CDS product COG2426 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249640.1 protein_id gnl|my_center|LOCUS_12040 3582 3031 gene locus_tag LOCUS_12050 3582 3031 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392986.1 protein_id gnl|my_center|LOCUS_12050 4916 4137 gene locus_tag LOCUS_12060 4916 4137 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146811.1 protein_id gnl|my_center|LOCUS_12060 5755 4913 gene locus_tag LOCUS_12070 gene pstA 5755 4913 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868165.1 protein_id gnl|my_center|LOCUS_12070 6681 5740 gene locus_tag LOCUS_12080 gene pstC 6681 5740 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496699.1 protein_id gnl|my_center|LOCUS_12080 7861 6731 gene locus_tag LOCUS_12090 gene pstS 7861 6731 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250815.1 protein_id gnl|my_center|LOCUS_12090 8964 7963 gene locus_tag LOCUS_12100 8964 7963 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979533.1 protein_id gnl|my_center|LOCUS_12100 9767 9465 gene locus_tag LOCUS_12110 9767 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 11045 9894 gene locus_tag LOCUS_12120 11045 9894 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763686.1 protein_id gnl|my_center|LOCUS_12120 12131 11298 gene locus_tag LOCUS_12130 12131 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 12635 12399 gene locus_tag LOCUS_12140 12635 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 12803 12934 gene locus_tag LOCUS_12150 12803 12934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 13430 12906 gene locus_tag LOCUS_12160 13430 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 13610 14263 gene locus_tag LOCUS_12170 13610 14263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 14435 15736 gene locus_tag LOCUS_12180 14435 15736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 15902 17056 gene locus_tag LOCUS_12190 15902 17056 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 protein_id gnl|my_center|LOCUS_12190 17309 17926 gene locus_tag LOCUS_12200 17309 17926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 18236 18943 gene locus_tag LOCUS_12210 18236 18943 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440228.1 protein_id gnl|my_center|LOCUS_12210 19650 19075 gene locus_tag LOCUS_12220 19650 19075 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763284.1 protein_id gnl|my_center|LOCUS_12220 19919 20113 gene locus_tag LOCUS_12230 19919 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 20378 20166 gene locus_tag LOCUS_12240 20378 20166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence28 162 1631 gene locus_tag LOCUS_12250 162 1631 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763483.1 protein_id gnl|my_center|LOCUS_12250 1628 2542 gene locus_tag LOCUS_12260 gene ubiA 1628 2542 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879665.1 protein_id gnl|my_center|LOCUS_12260 2960 3964 gene locus_tag LOCUS_12270 2960 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3978 4730 gene locus_tag LOCUS_12280 3978 4730 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837710.1 protein_id gnl|my_center|LOCUS_12280 4727 5422 gene locus_tag LOCUS_12290 4727 5422 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878142.1 protein_id gnl|my_center|LOCUS_12290 7068 5563 gene locus_tag LOCUS_12300 7068 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 8636 7611 gene locus_tag LOCUS_12310 8636 7611 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868111.1 protein_id gnl|my_center|LOCUS_12310 9515 10204 gene locus_tag LOCUS_12320 9515 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 10201 10485 gene locus_tag LOCUS_12330 10201 10485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 10940 11092 gene locus_tag LOCUS_12340 10940 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 11284 11520 gene locus_tag LOCUS_12350 11284 11520 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_12350 11498 11839 gene locus_tag LOCUS_12360 11498 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 12419 12042 gene locus_tag LOCUS_12370 12419 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 12681 12436 gene locus_tag LOCUS_12380 12681 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 13225 13488 gene locus_tag LOCUS_12390 13225 13488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 13451 13954 gene locus_tag LOCUS_12400 13451 13954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 14152 14379 gene locus_tag LOCUS_12410 14152 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 14628 14849 gene locus_tag LOCUS_12420 14628 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 14846 15076 gene locus_tag LOCUS_12430 14846 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 15475 15397 gene locus_tag LOCUS_t00180 15475 15397 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16807 15518 gene locus_tag LOCUS_12440 16807 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 17992 16964 gene locus_tag LOCUS_12450 gene arsB 17992 16964 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029172.1 protein_id gnl|my_center|LOCUS_12450 18332 19138 gene locus_tag LOCUS_12460 18332 19138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 19242 19424 gene locus_tag LOCUS_12470 19242 19424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 19447 19617 gene locus_tag LOCUS_12480 19447 19617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence29 1269 331 gene locus_tag LOCUS_12490 1269 331 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_12490 1649 1825 gene locus_tag LOCUS_12500 1649 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1825 1992 gene locus_tag LOCUS_12510 1825 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 2915 1974 gene locus_tag LOCUS_12520 2915 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3009 3470 gene locus_tag LOCUS_12530 3009 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3523 4992 gene locus_tag LOCUS_12540 3523 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4996 6165 gene locus_tag LOCUS_12550 4996 6165 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250736.1 protein_id gnl|my_center|LOCUS_12550 7848 6160 gene locus_tag LOCUS_12560 7848 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8195 7875 gene locus_tag LOCUS_12570 8195 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 8593 8300 gene locus_tag LOCUS_12580 8593 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 8607 9971 gene locus_tag LOCUS_12590 8607 9971 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 protein_id gnl|my_center|LOCUS_12590 10013 11437 gene locus_tag LOCUS_12600 gene glcD 10013 11437 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878311.1 protein_id gnl|my_center|LOCUS_12600 11479 11808 gene locus_tag LOCUS_12610 11479 11808 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827732.1 protein_id gnl|my_center|LOCUS_12610 11820 12791 gene locus_tag LOCUS_12620 11820 12791 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878312.1 protein_id gnl|my_center|LOCUS_12620 12960 14018 gene locus_tag LOCUS_12630 12960 14018 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763086.1 protein_id gnl|my_center|LOCUS_12630 14645 14893 gene locus_tag LOCUS_12640 14645 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 15210 16613 gene locus_tag LOCUS_12650 15210 16613 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868529.1 protein_id gnl|my_center|LOCUS_12650 16604 16681 gene locus_tag LOCUS_t00190 16604 16681 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17240 16758 gene locus_tag LOCUS_12660 17240 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 17431 17222 gene locus_tag LOCUS_12670 17431 17222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 18594 18175 gene locus_tag LOCUS_12680 18594 18175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 18833 18606 gene locus_tag LOCUS_12690 18833 18606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence30 268 789 gene locus_tag LOCUS_12700 268 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 794 1765 gene locus_tag LOCUS_12710 794 1765 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762027.1 protein_id gnl|my_center|LOCUS_12710 1759 2013 gene locus_tag LOCUS_12720 1759 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2020 2223 gene locus_tag LOCUS_12730 2020 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2595 4019 gene locus_tag LOCUS_12740 2595 4019 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274415.1 protein_id gnl|my_center|LOCUS_12740 4038 5231 gene locus_tag LOCUS_12750 4038 5231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064776.1 protein_id gnl|my_center|LOCUS_12750 6903 5242 gene locus_tag LOCUS_12760 6903 5242 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229182.1 protein_id gnl|my_center|LOCUS_12760 8018 7035 gene locus_tag LOCUS_12770 gene hisC 8018 7035 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152940674.1 protein_id gnl|my_center|LOCUS_12770 9112 8015 gene locus_tag LOCUS_12780 9112 8015 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146565.1 protein_id gnl|my_center|LOCUS_12780 9266 10003 gene locus_tag LOCUS_12790 9266 10003 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_12790 10092 11030 gene locus_tag LOCUS_12800 10092 11030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064248.1 protein_id gnl|my_center|LOCUS_12800 11197 11847 gene locus_tag LOCUS_12810 11197 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 12276 11848 gene locus_tag LOCUS_12820 12276 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 12893 12699 gene locus_tag LOCUS_12830 12893 12699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12830 13086 13418 gene locus_tag LOCUS_12840 13086 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 13312 15264 gene locus_tag LOCUS_12850 13312 15264 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979739.1 protein_id gnl|my_center|LOCUS_12850 16419 15247 gene locus_tag LOCUS_12860 16419 15247 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475604.1 protein_id gnl|my_center|LOCUS_12860 17992 16478 gene locus_tag LOCUS_12870 17992 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 18965 18159 gene locus_tag LOCUS_12880 18965 18159 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence31 1608 2165 gene locus_tag LOCUS_12890 1608 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2173 4278 gene locus_tag LOCUS_12900 2173 4278 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846340.1 protein_id gnl|my_center|LOCUS_12900 4319 6490 gene locus_tag LOCUS_12910 4319 6490 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868004.1 protein_id gnl|my_center|LOCUS_12910 7416 6487 gene locus_tag LOCUS_12920 gene speE 7416 6487 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978308.1 protein_id gnl|my_center|LOCUS_12920 7589 9637 gene locus_tag LOCUS_12930 7589 9637 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_12930 9721 10653 gene locus_tag LOCUS_12940 gene speB 9721 10653 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224492.1 protein_id gnl|my_center|LOCUS_12940 10650 11888 gene locus_tag LOCUS_12950 gene hutI 10650 11888 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011285756.1 protein_id gnl|my_center|LOCUS_12950 13611 11890 gene locus_tag LOCUS_12960 gene hutU 13611 11890 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_12960 14615 13680 gene locus_tag LOCUS_12970 14615 13680 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846506.1 protein_id gnl|my_center|LOCUS_12970 15584 14688 gene locus_tag LOCUS_12980 15584 14688 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846246.1 protein_id gnl|my_center|LOCUS_12980 15761 16342 gene locus_tag LOCUS_12990 15761 16342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 16431 17150 gene locus_tag LOCUS_13000 16431 17150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 17168 17770 gene locus_tag LOCUS_13010 17168 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 17773 18945 gene locus_tag LOCUS_13020 17773 18945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence32 1532 999 gene locus_tag LOCUS_13030 1532 999 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978291.1 protein_id gnl|my_center|LOCUS_13030 1676 2896 gene locus_tag LOCUS_13040 1676 2896 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846270.1 protein_id gnl|my_center|LOCUS_13040 2914 3447 gene locus_tag LOCUS_13050 2914 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4931 3444 gene locus_tag LOCUS_13060 gene tgtA 4931 3444 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978287.1 protein_id gnl|my_center|LOCUS_13060 5438 4998 gene locus_tag LOCUS_13070 5438 4998 CDS product Lsm family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762704.1 protein_id gnl|my_center|LOCUS_13070 5539 5895 gene locus_tag LOCUS_13080 5539 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 6287 7627 gene locus_tag LOCUS_13090 6287 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 8150 7560 gene locus_tag LOCUS_13100 8150 7560 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023634.1 protein_id gnl|my_center|LOCUS_13100 9926 8277 gene locus_tag LOCUS_13110 gene thsB 9926 8277 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846874.1 protein_id gnl|my_center|LOCUS_13110 10084 10284 gene locus_tag LOCUS_13120 10084 10284 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762842.1 protein_id gnl|my_center|LOCUS_13120 10357 11097 gene locus_tag LOCUS_13130 10357 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 11094 11582 gene locus_tag LOCUS_13140 11094 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 11750 13558 gene locus_tag LOCUS_13150 11750 13558 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978275.1 protein_id gnl|my_center|LOCUS_13150 13638 14792 gene locus_tag LOCUS_13160 gene fbp 13638 14792 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846263.1 protein_id gnl|my_center|LOCUS_13160 14834 15493 gene locus_tag LOCUS_13170 gene tpiA 14834 15493 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence33 200 937 gene locus_tag LOCUS_13180 200 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 994 1752 gene locus_tag LOCUS_13190 994 1752 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013805.1 protein_id gnl|my_center|LOCUS_13190 2718 1759 gene locus_tag LOCUS_13200 2718 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3567 2803 gene locus_tag LOCUS_13210 3567 2803 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878463.1 protein_id gnl|my_center|LOCUS_13210 3635 3820 gene locus_tag LOCUS_13220 3635 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4264 3863 gene locus_tag LOCUS_13230 4264 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4461 4258 gene locus_tag LOCUS_13240 4461 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 4599 4686 gene locus_tag LOCUS_t00200 4599 4686 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4873 4691 gene locus_tag LOCUS_13250 4873 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 5208 6539 gene locus_tag LOCUS_13260 5208 6539 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240264.1 protein_id gnl|my_center|LOCUS_13260 6739 7500 gene locus_tag LOCUS_13270 6739 7500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762347.1 protein_id gnl|my_center|LOCUS_13270 7507 8223 gene locus_tag LOCUS_13280 7507 8223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546217.1 protein_id gnl|my_center|LOCUS_13280 8237 9241 gene locus_tag LOCUS_13290 8237 9241 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496774.1 protein_id gnl|my_center|LOCUS_13290 9244 10356 gene locus_tag LOCUS_13300 9244 10356 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762344.1 protein_id gnl|my_center|LOCUS_13300 11291 10383 gene locus_tag LOCUS_13310 11291 10383 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240278.1 protein_id gnl|my_center|LOCUS_13310 11918 11445 gene locus_tag LOCUS_13320 11918 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 <13920 12011 gene locus_tag LOCUS_13330 <13920 12011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978720.1:acetate--CoA ligase >Feature sequence34 1 1452 gene locus_tag LOCUS_13340 1 1452 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319319.1 protein_id gnl|my_center|LOCUS_13340 1502 2311 gene locus_tag LOCUS_13350 1502 2311 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_13350 4808 2496 gene locus_tag LOCUS_13360 4808 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 5513 4824 gene locus_tag LOCUS_13370 5513 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 6684 5506 gene locus_tag LOCUS_13380 6684 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 7458 6736 gene locus_tag LOCUS_13390 7458 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 8562 7600 gene locus_tag LOCUS_13400 8562 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 8890 8555 gene locus_tag LOCUS_13410 8890 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 9329 9700 gene locus_tag LOCUS_13420 9329 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 9932 10426 gene locus_tag LOCUS_13430 9932 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 10387 10980 gene locus_tag LOCUS_13440 10387 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 11752 11150 gene locus_tag LOCUS_13450 11752 11150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 12194 12766 gene locus_tag LOCUS_13460 12194 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 12773 13390 gene locus_tag LOCUS_13470 12773 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 13568 13490 gene locus_tag LOCUS_t00210 13568 13490 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence35 154 1098 gene locus_tag LOCUS_13480 154 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1381 2949 gene locus_tag LOCUS_13490 1381 2949 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_13490 2951 3955 gene locus_tag LOCUS_13500 2951 3955 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_13500 4116 5174 gene locus_tag LOCUS_13510 4116 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 5822 5745 gene locus_tag LOCUS_t00220 5822 5745 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5908 7200 gene locus_tag LOCUS_13520 5908 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 7685 10342 gene locus_tag LOCUS_13530 7685 10342 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877994.1 protein_id gnl|my_center|LOCUS_13530 10349 10705 gene locus_tag LOCUS_13540 10349 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 10761 11399 gene locus_tag LOCUS_13550 10761 11399 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763581.1 protein_id gnl|my_center|LOCUS_13550 11459 11534 gene locus_tag LOCUS_t00230 11459 11534 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11707 12198 gene locus_tag LOCUS_13560 11707 12198 CDS product PaREP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978623.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence36 1316 72 gene locus_tag LOCUS_13570 gene eif2g 1316 72 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846878.1 protein_id gnl|my_center|LOCUS_13570 2084 1386 gene locus_tag LOCUS_13580 2084 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2201 4033 gene locus_tag LOCUS_13590 gene infB 2201 4033 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978230.1 protein_id gnl|my_center|LOCUS_13590 4456 4034 gene locus_tag LOCUS_13600 gene ndk 4456 4034 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_13600 4645 4463 gene locus_tag LOCUS_13610 4645 4463 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 protein_id gnl|my_center|LOCUS_13610 4764 4997 gene locus_tag LOCUS_13620 4764 4997 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978233.1 protein_id gnl|my_center|LOCUS_13620 5482 5012 gene locus_tag LOCUS_13630 5482 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 5799 5497 gene locus_tag LOCUS_13640 5799 5497 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461381.1 protein_id gnl|my_center|LOCUS_13640 7094 5796 gene locus_tag LOCUS_13650 7094 5796 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903809.1 protein_id gnl|my_center|LOCUS_13650 7964 7143 gene locus_tag LOCUS_13660 7964 7143 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762507.1 protein_id gnl|my_center|LOCUS_13660 8817 8047 gene locus_tag LOCUS_13670 8817 8047 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189750.1 protein_id gnl|my_center|LOCUS_13670 10132 8882 gene locus_tag LOCUS_13680 10132 8882 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763576.1 protein_id gnl|my_center|LOCUS_13680 10314 11672 gene locus_tag LOCUS_13690 gene gcvPA 10314 11672 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979226.1 protein_id gnl|my_center|LOCUS_13690 11669 13210 gene locus_tag LOCUS_13700 gene gcvPB 11669 13210 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979227.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence37 1072 89 gene locus_tag LOCUS_13710 1072 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1171 1716 gene locus_tag LOCUS_13720 1171 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2153 1713 gene locus_tag LOCUS_13730 2153 1713 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_13730 5003 2157 gene locus_tag LOCUS_13740 5003 2157 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867684.1 protein_id gnl|my_center|LOCUS_13740 5108 5647 gene locus_tag LOCUS_13750 gene cyaB 5108 5647 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762860.1 protein_id gnl|my_center|LOCUS_13750 5755 7095 gene locus_tag LOCUS_13760 5755 7095 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763417.1 protein_id gnl|my_center|LOCUS_13760 7095 7574 gene locus_tag LOCUS_13770 7095 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 7575 8057 gene locus_tag LOCUS_13780 7575 8057 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978052.1 protein_id gnl|my_center|LOCUS_13780 8641 8054 gene locus_tag LOCUS_13790 gene tmk 8641 8054 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_13790 9038 8634 gene locus_tag LOCUS_13800 9038 8634 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868733.1 protein_id gnl|my_center|LOCUS_13800 10235 9045 gene locus_tag LOCUS_13810 10235 9045 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250200.1 protein_id gnl|my_center|LOCUS_13810 11552 10263 gene locus_tag LOCUS_13820 11552 10263 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762608.1 protein_id gnl|my_center|LOCUS_13820 11885 11649 gene locus_tag LOCUS_13830 11885 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 11964 12200 gene locus_tag LOCUS_13840 11964 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 <13158 12197 gene locus_tag LOCUS_13850 <13158 12197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763469.1:acetyl ornithine aminotransferase family protein >Feature sequence38 1910 654 gene locus_tag LOCUS_13860 1910 654 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_13860 5110 2003 gene locus_tag LOCUS_13870 5110 2003 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080568.1 protein_id gnl|my_center|LOCUS_13870 5673 5122 gene locus_tag LOCUS_13880 5673 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 9242 5670 gene locus_tag LOCUS_13890 9242 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 12275 9249 gene locus_tag LOCUS_13900 12275 9249 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868000.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence39 1043 171 gene locus_tag LOCUS_13910 1043 171 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880521.1 protein_id gnl|my_center|LOCUS_13910 2169 1060 gene locus_tag LOCUS_13920 2169 1060 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_13920 2313 3698 gene locus_tag LOCUS_13930 2313 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 3816 3739 gene locus_tag LOCUS_t00240 3816 3739 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3881 5098 gene locus_tag LOCUS_13940 3881 5098 CDS product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762601.1 protein_id gnl|my_center|LOCUS_13940 5115 5480 gene locus_tag LOCUS_13950 5115 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 5770 6255 gene locus_tag LOCUS_13960 5770 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 6259 7254 gene locus_tag LOCUS_13970 6259 7254 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979503.1 protein_id gnl|my_center|LOCUS_13970 7281 7499 gene locus_tag LOCUS_13980 7281 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 7547 7624 gene locus_tag LOCUS_t00250 7547 7624 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7656 8432 gene locus_tag LOCUS_13990 7656 8432 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877881.1 protein_id gnl|my_center|LOCUS_13990 8567 9274 gene locus_tag LOCUS_14000 8567 9274 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978067.1 protein_id gnl|my_center|LOCUS_14000 10011 9271 gene locus_tag LOCUS_14010 10011 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 10148 10063 gene locus_tag LOCUS_t00260 10148 10063 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10275 11258 gene locus_tag LOCUS_14020 10275 11258 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878138.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence40 2091 1468 gene locus_tag LOCUS_14030 2091 1468 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248985.1 protein_id gnl|my_center|LOCUS_14030 2708 2385 gene locus_tag LOCUS_14040 2708 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 4340 3051 gene locus_tag LOCUS_14050 4340 3051 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_14050 4438 5364 gene locus_tag LOCUS_14060 4438 5364 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433612.1 protein_id gnl|my_center|LOCUS_14060 5515 6768 gene locus_tag LOCUS_14070 5515 6768 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879506.1 protein_id gnl|my_center|LOCUS_14070 6782 7693 gene locus_tag LOCUS_14080 6782 7693 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879509.1 protein_id gnl|my_center|LOCUS_14080 7672 9330 gene locus_tag LOCUS_14090 7672 9330 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879507.1 protein_id gnl|my_center|LOCUS_14090 9435 10313 gene locus_tag LOCUS_14100 9435 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 10388 10684 gene locus_tag LOCUS_14110 10388 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence41 811 251 gene locus_tag LOCUS_14120 811 251 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146717.1 protein_id gnl|my_center|LOCUS_14120 1761 964 gene locus_tag LOCUS_14130 1761 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2676 1765 gene locus_tag LOCUS_14140 2676 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 3058 2636 gene locus_tag LOCUS_14150 3058 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 4830 3172 gene locus_tag LOCUS_14160 4830 3172 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_14160 5328 4915 gene locus_tag LOCUS_14170 5328 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 5744 5361 gene locus_tag LOCUS_14180 gene hypA 5744 5361 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867705.1 protein_id gnl|my_center|LOCUS_14180 6465 5773 gene locus_tag LOCUS_14190 gene hypB 6465 5773 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869941.1 protein_id gnl|my_center|LOCUS_14190 7870 6944 gene locus_tag LOCUS_14200 7870 6944 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942741.1 protein_id gnl|my_center|LOCUS_14200 9174 7867 gene locus_tag LOCUS_14210 9174 7867 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_14210 <10647 9229 gene locus_tag LOCUS_14220 <10647 9229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066467.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit >Feature sequence42 2342 1125 gene locus_tag LOCUS_14230 gene nrfD 2342 1125 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762020.1 protein_id gnl|my_center|LOCUS_14230 2522 2830 gene locus_tag LOCUS_14240 2522 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3308 2844 gene locus_tag LOCUS_14250 3308 2844 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980181.1 protein_id gnl|my_center|LOCUS_14250 3438 5189 gene locus_tag LOCUS_14260 3438 5189 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205437.1 protein_id gnl|my_center|LOCUS_14260 5495 5355 gene locus_tag LOCUS_14270 5495 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 5553 6638 gene locus_tag LOCUS_14280 5553 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 7155 6643 gene locus_tag LOCUS_14290 7155 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 8994 7258 gene locus_tag LOCUS_14300 8994 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 9599 9000 gene locus_tag LOCUS_14310 9599 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence43 1138 629 gene locus_tag LOCUS_14320 1138 629 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846759.1 protein_id gnl|my_center|LOCUS_14320 2263 1211 gene locus_tag LOCUS_14330 gene trm14 2263 1211 CDS product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147322.1 protein_id gnl|my_center|LOCUS_14330 2976 2260 gene locus_tag LOCUS_14340 2976 2260 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250920.1 protein_id gnl|my_center|LOCUS_14340 3243 3437 gene locus_tag LOCUS_14350 3243 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 4416 3595 gene locus_tag LOCUS_14360 4416 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 5318 4419 gene locus_tag LOCUS_14370 5318 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 5763 5425 gene locus_tag LOCUS_14380 5763 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 6145 5846 gene locus_tag LOCUS_14390 6145 5846 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978432.1 protein_id gnl|my_center|LOCUS_14390 7508 6192 gene locus_tag LOCUS_14400 7508 6192 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496374.1 protein_id gnl|my_center|LOCUS_14400 8301 7489 gene locus_tag LOCUS_14410 gene surE 8301 7489 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880503.1 protein_id gnl|my_center|LOCUS_14410 8370 9344 gene locus_tag LOCUS_14420 8370 9344 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980330.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence44 54 569 gene locus_tag LOCUS_14430 54 569 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048151762.1 protein_id gnl|my_center|LOCUS_14430 2245 869 gene locus_tag LOCUS_14440 2245 869 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250495.1 protein_id gnl|my_center|LOCUS_14440 2999 2880 gene locus_tag LOCUS_14450 2999 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 3463 2999 gene locus_tag LOCUS_14460 3463 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3738 4649 gene locus_tag LOCUS_14470 3738 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5033 4791 gene locus_tag LOCUS_14480 5033 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5244 5041 gene locus_tag LOCUS_14490 5244 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 6022 5852 gene locus_tag LOCUS_14500 6022 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 6210 6019 gene locus_tag LOCUS_14510 6210 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 6971 6207 gene locus_tag LOCUS_14520 6971 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 7775 7503 gene locus_tag LOCUS_14530 7775 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 8296 8108 gene locus_tag LOCUS_14540 8296 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 <9418 8389 gene locus_tag LOCUS_14550 <9418 8389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008783193.1:ATP-binding protein >Feature sequence45 1245 760 gene locus_tag LOCUS_14560 1245 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1638 3278 gene locus_tag LOCUS_14570 1638 3278 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762392.1 protein_id gnl|my_center|LOCUS_14570 3396 4346 gene locus_tag LOCUS_14580 3396 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4505 4356 gene locus_tag LOCUS_14590 4505 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4627 5358 gene locus_tag LOCUS_14600 4627 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 5398 6057 gene locus_tag LOCUS_14610 5398 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 6074 6898 gene locus_tag LOCUS_14620 6074 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 6950 7255 gene locus_tag LOCUS_14630 6950 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979229.1 protein_id gnl|my_center|LOCUS_14630 7387 7632 gene locus_tag LOCUS_14640 7387 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 7640 8041 gene locus_tag LOCUS_14650 7640 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 <9040 7990 gene locus_tag LOCUS_14660 <9040 7990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015590753.1:AMP-binding protein >Feature sequence46 223 618 gene locus_tag LOCUS_14670 223 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 731 3763 gene locus_tag LOCUS_14680 731 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3766 4719 gene locus_tag LOCUS_14690 3766 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 5279 4716 gene locus_tag LOCUS_14700 5279 4716 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868582.1 protein_id gnl|my_center|LOCUS_14700 6493 5375 gene locus_tag LOCUS_14710 6493 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 8333 6606 gene locus_tag LOCUS_14720 8333 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 <8938 8427 gene locus_tag LOCUS_14730 <8938 8427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240546.1:ROK family protein >Feature sequence47 507 3101 gene locus_tag LOCUS_14740 507 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3569 3114 gene locus_tag LOCUS_14750 3569 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 5097 3625 gene locus_tag LOCUS_14760 5097 3625 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250133.1 protein_id gnl|my_center|LOCUS_14760 5351 5575 gene locus_tag LOCUS_14770 5351 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 6850 5579 gene locus_tag LOCUS_14780 6850 5579 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980269.1 protein_id gnl|my_center|LOCUS_14780 6938 7315 gene locus_tag LOCUS_14790 6938 7315 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 protein_id gnl|my_center|LOCUS_14790 8033 7320 gene locus_tag LOCUS_14800 8033 7320 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867812.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence48 1481 96 gene locus_tag LOCUS_14810 gene aspS 1481 96 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966262.1 protein_id gnl|my_center|LOCUS_14810 1561 3633 gene locus_tag LOCUS_14820 1561 3633 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979235.1 protein_id gnl|my_center|LOCUS_14820 4084 3623 gene locus_tag LOCUS_14830 4084 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 4148 4792 gene locus_tag LOCUS_14840 4148 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 4834 5628 gene locus_tag LOCUS_14850 4834 5628 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_14850 5744 7900 gene locus_tag LOCUS_14860 5744 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence49 2091 1177 gene locus_tag LOCUS_14870 2091 1177 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868592.1 protein_id gnl|my_center|LOCUS_14870 4104 2104 gene locus_tag LOCUS_14880 4104 2104 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147045.1 protein_id gnl|my_center|LOCUS_14880 5550 4111 gene locus_tag LOCUS_14890 5550 4111 CDS product hydrogenase 4 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147047.1 protein_id gnl|my_center|LOCUS_14890 6056 5556 gene locus_tag LOCUS_14900 6056 5556 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868595.1 protein_id gnl|my_center|LOCUS_14900 <7941 6068 gene locus_tag LOCUS_14910 <7941 6068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868596.1:molybdopterin-dependent oxidoreductase >Feature sequence50 47 355 gene locus_tag LOCUS_14920 47 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 837 352 gene locus_tag LOCUS_14930 837 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1002 1169 gene locus_tag LOCUS_14940 1002 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1607 1368 gene locus_tag LOCUS_14950 1607 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1747 2004 gene locus_tag LOCUS_14960 1747 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1997 2383 gene locus_tag LOCUS_14970 1997 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2395 2790 gene locus_tag LOCUS_14980 2395 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2796 3047 gene locus_tag LOCUS_14990 2796 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3050 3439 gene locus_tag LOCUS_15000 3050 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3526 4179 gene locus_tag LOCUS_15010 3526 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4186 4347 gene locus_tag LOCUS_15020 4186 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4337 5005 gene locus_tag LOCUS_15030 4337 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5321 5569 gene locus_tag LOCUS_15040 5321 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 5573 6787 gene locus_tag LOCUS_15050 5573 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 6784 6948 gene locus_tag LOCUS_15060 6784 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence51 1108 266 gene locus_tag LOCUS_15070 1108 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1827 1108 gene locus_tag LOCUS_15080 1827 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3307 1811 gene locus_tag LOCUS_15090 3307 1811 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763137.1 protein_id gnl|my_center|LOCUS_15090 6250 3392 gene locus_tag LOCUS_15100 6250 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6686 6225 gene locus_tag LOCUS_15110 6686 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7199 6729 gene locus_tag LOCUS_15120 7199 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence52 666 743 gene locus_tag LOCUS_t00270 666 743 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1244 798 gene locus_tag LOCUS_15130 1244 798 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877824.1 protein_id gnl|my_center|LOCUS_15130 1528 1241 gene locus_tag LOCUS_15140 1528 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2224 1790 gene locus_tag LOCUS_15150 2224 1790 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877824.1 protein_id gnl|my_center|LOCUS_15150 2447 2244 gene locus_tag LOCUS_15160 2447 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence53 1217 552 gene locus_tag LOCUS_15170 1217 552 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083177.1 protein_id gnl|my_center|LOCUS_15170 4164 1366 gene locus_tag LOCUS_15180 4164 1366 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979313.1 protein_id gnl|my_center|LOCUS_15180 4306 4542 gene locus_tag LOCUS_15190 4306 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846524.1 protein_id gnl|my_center|LOCUS_15190 4556 5248 gene locus_tag LOCUS_15200 4556 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 5422 5252 gene locus_tag LOCUS_15210 5422 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence54 205 292 gene locus_tag LOCUS_t00280 205 292 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1585 1082 gene locus_tag LOCUS_15220 1585 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1706 2662 gene locus_tag LOCUS_15230 1706 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 4329 2659 gene locus_tag LOCUS_15240 4329 2659 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870477.1 protein_id gnl|my_center|LOCUS_15240 <5822 4336 gene locus_tag LOCUS_15250 <5822 4336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870478.1:hydantoinase/oxoprolinase family protein >Feature sequence55 1037 1306 gene locus_tag LOCUS_15260 1037 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1866 1303 gene locus_tag LOCUS_15270 1866 1303 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868582.1 protein_id gnl|my_center|LOCUS_15270 3077 1959 gene locus_tag LOCUS_15280 3077 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4917 3190 gene locus_tag LOCUS_15290 4917 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 <5524 5013 gene locus_tag LOCUS_15300 <5524 5013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240546.1:ROK family protein >Feature sequence56 <1 3644 gene locus_tag LOCUS_15310 <1 3644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868381.1:reverse gyrase 3928 3641 gene locus_tag LOCUS_15320 3928 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 5312 4008 gene locus_tag LOCUS_15330 5312 4008 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257300.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence57 112 858 gene locus_tag LOCUS_15340 112 858 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070105199.1 protein_id gnl|my_center|LOCUS_15340 842 1027 gene locus_tag LOCUS_15350 842 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1242 1075 gene locus_tag LOCUS_15360 1242 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1561 1397 gene locus_tag LOCUS_15370 1561 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1908 1558 gene locus_tag LOCUS_15380 1908 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2438 1905 gene locus_tag LOCUS_15390 2438 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2600 2442 gene locus_tag LOCUS_15400 2600 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 3022 2696 gene locus_tag LOCUS_15410 3022 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3411 3019 gene locus_tag LOCUS_15420 3411 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3881 3423 gene locus_tag LOCUS_15430 3881 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4150 3884 gene locus_tag LOCUS_15440 4150 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 4630 4151 gene locus_tag LOCUS_15450 4630 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 4814 4620 gene locus_tag LOCUS_15460 4814 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence58 2095 260 gene locus_tag LOCUS_15470 2095 260 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249378.1 protein_id gnl|my_center|LOCUS_15470 2411 2148 gene locus_tag LOCUS_15480 2411 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 2609 2442 gene locus_tag LOCUS_15490 2609 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 2896 3024 gene locus_tag LOCUS_15500 2896 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 3604 3209 gene locus_tag LOCUS_15510 3604 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3763 3996 gene locus_tag LOCUS_15520 3763 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 4718 3993 gene locus_tag LOCUS_15530 4718 3993 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990032.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence59 <1 1657 gene locus_tag LOCUS_15540 <1 1657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763167.1:long-chain fatty acid--CoA ligase 1690 2010 gene locus_tag LOCUS_15550 1690 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2022 3314 gene locus_tag LOCUS_15560 2022 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3592 3317 gene locus_tag LOCUS_15570 3592 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence60 212 1402 gene locus_tag LOCUS_15580 gene hemA 212 1402 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879467.1 protein_id gnl|my_center|LOCUS_15580 1412 2413 gene locus_tag LOCUS_15590 gene hemB 1412 2413 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761803.1 protein_id gnl|my_center|LOCUS_15590 2418 3695 gene locus_tag LOCUS_15600 gene hemL 2418 3695 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846220.1 protein_id gnl|my_center|LOCUS_15600 3698 4591 gene locus_tag LOCUS_15610 gene hemC 3698 4591 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761811.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence61 801 424 gene locus_tag LOCUS_15620 gene lrs14 801 424 CDS product HTH-type transcriptional regulator Lrs14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979935.1 protein_id gnl|my_center|LOCUS_15620 1151 828 gene locus_tag LOCUS_15630 1151 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1477 1253 gene locus_tag LOCUS_15640 1477 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1643 1987 gene locus_tag LOCUS_15650 1643 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2994 1984 gene locus_tag LOCUS_15660 2994 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 3787 2933 gene locus_tag LOCUS_15670 3787 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4479 3793 gene locus_tag LOCUS_15680 4479 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence62 964 2430 gene locus_tag LOCUS_15690 964 2430 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250882.1 protein_id gnl|my_center|LOCUS_15690 2433 2750 gene locus_tag LOCUS_15700 2433 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 3188 4411 gene locus_tag LOCUS_15710 3188 4411 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053786.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence63 549 1163 gene locus_tag LOCUS_15720 549 1163 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979589.1 protein_id gnl|my_center|LOCUS_15720 1695 1210 gene locus_tag LOCUS_15730 1695 1210 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence64 18 206 gene locus_tag LOCUS_15740 18 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 368 784 gene locus_tag LOCUS_15750 368 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1550 813 gene locus_tag LOCUS_15760 gene phbB 1550 813 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250412.1 protein_id gnl|my_center|LOCUS_15760 2951 1599 gene locus_tag LOCUS_15770 2951 1599 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence65 296 469 gene locus_tag LOCUS_15780 296 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 606 833 gene locus_tag LOCUS_15790 606 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1193 1116 gene locus_tag LOCUS_t00290 1193 1116 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1570 2673 gene locus_tag LOCUS_15800 1570 2673 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978129.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence66 1845 2492 gene locus_tag LOCUS_15810 1845 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2479 3327 gene locus_tag LOCUS_15820 2479 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence67 >Feature sequence68 937 1134 gene locus_tag LOCUS_15830 937 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1131 1577 gene locus_tag LOCUS_15840 1131 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1858 2067 gene locus_tag LOCUS_15850 1858 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2085 2531 gene locus_tag LOCUS_15860 2085 2531 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877824.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence69 1127 147 gene locus_tag LOCUS_15870 1127 147 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249945.1 protein_id gnl|my_center|LOCUS_15870 1362 1135 gene locus_tag LOCUS_15880 1362 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 <2641 1466 gene locus_tag LOCUS_15890 <2641 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249942.1:carbon starvation protein A >Feature sequence70 1241 966 gene locus_tag LOCUS_15900 1241 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1718 1500 gene locus_tag LOCUS_15910 1718 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence71 491 30 gene locus_tag LOCUS_15920 491 30 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877963.1 protein_id gnl|my_center|LOCUS_15920 970 1437 gene locus_tag LOCUS_15930 970 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930