COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..120520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..1749 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268117.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 1752..2738 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385705.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 2735..3568 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3568..5196 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268118.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 5529..6755 product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105350.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 6766..7974 product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105351.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 7971..9350 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 9368..10177 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 10249..11280 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101828078.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 11264..11914 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403166.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 12280..12699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 12757..13824 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 13915..14742 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082561.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 14782..15444 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 15447..16103 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114963.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 16100..16840 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114964.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 16881..17642 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818730.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 17778..18200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(18299..19000) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189595320.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(19164..19901) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(19935..20681) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(20681..21355) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(21561..22367) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 23466..24497 product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705347.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 24515..25324 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 25324..26115 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705346.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 26100..26771 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161798788.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(27373..27543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 28202..28705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 29021..30433 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 30435..31439 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene cydB CDS 31439..31600 product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366503.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 31760..33997 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104229.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 34009..34842 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104230.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 35249..37363 product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704704.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene fepA CDS 37497..38384 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703472.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(38486..38653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(38640..39122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 39288..39833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 note possible pseudo, internal stop codon CDS 39972..40208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 note possible pseudo, internal stop codon CDS 40242..40928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 note possible pseudo, internal stop codon, frameshifted CDS 40850..41023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 note possible pseudo, internal stop codon, frameshifted CDS 41120..41440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 note possible pseudo, internal stop codon, frameshifted CDS complement(41535..42962) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968148.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(42959..43291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(43272..44384) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968147.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(44381..45100) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968146.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(45339..46664) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968144.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(46674..47426) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968143.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene hutC CDS 47692..49182 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968142.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 49199..50884 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 50988..52010 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968140.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 52047..53195 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968139.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 53196..54056 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 54053..54847 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(55029..55418) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398711.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 55524..56444 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811205.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(56628..57653) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077984631.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 58171..59349 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886447.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 59504..60445 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244504.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(60557..60748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 60759..62141 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(62295..63119) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393373.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(63677..63862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 63912..64751 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157438.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(64823..65647) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174807.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene iolB CDS complement(65667..67175) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368538.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(67812..69734) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050164505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene iolC CDS 70147..72084 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817368.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene iolD CDS 72109..72993 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368532.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 73389..74843 product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene xylE CDS 74856..75779 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 75803..76981 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 77026..77511 product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 77561..78559 product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene iolG CDS complement(78753..79739) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036367.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(79922..80902) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705350.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 81194..81544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 81541..82032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 note possible pseudo, frameshifted CDS complement(82319..83350) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 83643..84689 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 84754..85575 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 85572..86831 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369724.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 86861..87589 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 88049..89029 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene pfkA CDS 89040..89330 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292534.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 89345..90682 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296769.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 90748..91023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 91030..91467 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 91464..91997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 92041..92937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 93012..93692 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(93877..94956) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene lptG CDS complement(94953..96023) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779645.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene lptF CDS 96651..97988 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896889.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 97988..98821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984964.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 99363..99920 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704190.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(100154..101326) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(101313..101552) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248104.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(101605..102519) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077173.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(102516..104162) product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 104976..106106 product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388786.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene yghO CDS 106195..106554 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(106716..107471) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339531.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(107514..108227) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076250.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 108378..109103 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190682.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(109153..111111) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104349.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 111885..112898 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104350.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 112898..113677 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764492.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 113754..114677 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764495.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(114868..115617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 note possible pseudo, frameshifted CDS complement(115689..116384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 note possible pseudo, frameshifted CDS complement(116381..117358) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(117355..118854) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892598.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(119407..120312) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200344113.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene gcvA sequence002 source 1..113453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1337..1996) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209957.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene rpiA CDS 2185..3096 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(3135..3860) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173525.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(4021..4641) product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene argO CDS complement(4803..5657) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098633.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 6128..6649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 note possible pseudo, frameshifted CDS complement(7555..8634) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173534.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene fbaA CDS complement(8842..10005) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene pgk CDS complement(10057..11076) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene epd CDS complement(11390..13381) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098601.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene tkt CDS complement(13627..14043) product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369693.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(14111..15031) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105550.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene speB CDS complement(15330..17228) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278580.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene speA CDS 18066..19217 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene metK CDS 19528..20028 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860035.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 20112..20825 product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286517.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene endA CDS 20902..21633 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300912.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene rsmE CDS 21739..22683 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene gshB CDS 22778..23341 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 23341..23766 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811925.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene ruvX CDS complement(23812..24810) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703454.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 24772..25533 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997790.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 25546..26100 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209984.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 26126..26719 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173616.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 26712..27848 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817047.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene hemW CDS complement(27916..28629) product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817048.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(28737..29063) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(29067..29786) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786887.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene trmB CDS 29936..31021 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847823.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene mutY CDS 31021..31293 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 31343..32422 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene mltC CDS complement(32558..33388) product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211478.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(33391..34617) product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176149.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 34924..35550 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(35570..37714) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(38208..39161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(39158..40423) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(40451..42868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(42870..44000) product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707830.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(44043..45296) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(45636..46280) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391752.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(46284..47000) product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene pepE CDS complement(47018..47698) product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(47711..48640) product DUF1177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391755.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(48702..50327) product OPT/YSL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(50384..51127) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086029.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(51473..52792) product gnt-II system L-idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128335.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene idnT CDS complement(52839..53603) product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene idnO CDS complement(53618..54649) product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197416.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene idnD CDS 54916..56931 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098853.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(56939..58066) product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018672.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene rlmG CDS 58271..58774 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369584.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(58771..60459) product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 60625..61623 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098856.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 61905..62870 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703564.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 63066..64325 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235369.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene sstT CDS 64802..65479 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 65476..65859 product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174198.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene mzrA CDS 66057..66428 product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877297.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 66480..66785 product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 66788..67186 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 67183..67467 product YqjK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095496.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 67630..68616 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098870.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(68695..69594) product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041008.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene yhaJ CDS 69731..70435 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633552.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(70516..71088) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene dolP CDS complement(71103..71690) product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861754.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene diaA CDS complement(71705..72100) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210147.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(72058..74094) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 74157..75020 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812294.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene rsmI CDS 75612..75809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(76181..76447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 76796..77218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 77451..78554 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929634.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 78600..79880 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 79891..80802 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 80799..81641 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 81654..82616 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385340.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(82611..84521) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174285.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(84794..85534) product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095353.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(85531..86652) product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174293.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(86636..87769) product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062758500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(87825..88472) product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(88487..89263) product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368574.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(89297..89593) product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368575.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(89599..89955) product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435389.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(90093..90431) product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027887.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(90891..92231) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852994.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene pmbA CDS 92434..92976 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174310.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene yjgA CDS complement(93125..94492) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368582.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene mpl CDS 94661..95668 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene fbp CDS 95840..96289 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500737.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 96392..96919 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055072.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene ppa CDS complement(97011..97304) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704194.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(97361..101086) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154295113.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(101128..102867) product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704192.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene tamA CDS 103467..104789 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(104994..105200) product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501430.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 105522..106079 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704190.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(106119..106865) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124233367.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene cysQ CDS complement(107118..107738) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502892.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene fklB CDS 108115..108687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(108902..109354) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196065.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene rplI CDS complement(109394..109621) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene rpsR CDS complement(109626..109943) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210154.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene priB CDS complement(109950..110345) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004098001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene rpsF CDS complement(110590..111339) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815429.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene yjfP CDS complement(111336..111494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 111438..111761 product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175485.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene bsmA CDS complement(111965..112180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 note possible pseudo, frameshifted CDS 112322..112519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 112886..113158 product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179111.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 sequence003 source 1..108215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(308..1132) product propanediol diffusion facilitator PduF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004699353.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene pduF CDS complement(1240..2157) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388671.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(2266..4803) product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(4883..5443) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388657.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(5469..5771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(5793..7301) product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(7351..8136) product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388661.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene pduB CDS complement(8158..8439) product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene pduA CDS complement(8640..9851) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389133.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(9878..10390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(10411..10683) product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(10665..11420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(11424..11621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(11614..12306) product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388664.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(12432..13547) product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626060.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(13893..15359) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(15399..16787) product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(17792..18712) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 19330..21474 product TonB-dependent ferrichrome receptor FiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113264.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene fiuA CDS 21491..22609 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209997.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 22998..23447 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene nrdR CDS 23451..24554 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132452414.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene ribD CDS 24643..25113 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene ribE CDS 25130..25549 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801125.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene nusB CDS 25604..26581 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene thiL CDS 26571..27065 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154049.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene pgpA CDS complement(27121..28986) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367989.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene dxs CDS complement(29006..29905) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367988.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene ispA CDS complement(29905..30147) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393512.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene xseB CDS 30370..31818 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367986.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene thiI CDS complement(31893..32489) product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367984.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene yajL CDS complement(32443..33363) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene panE CDS 33500..33991 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(34085..35479) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216662111.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(35608..36501) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene cyoE CDS complement(36512..36841) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(36841..37455) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704586.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(37455..39437) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704587.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene cyoB CDS complement(39442..40368) product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239436.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene cyoA CDS complement(40817..42301) product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098442.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene ampG CDS complement(42355..42933) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208646.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 43389..43706 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene bolA CDS 44027..45331 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095856.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene tig CDS 45676..46299 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095857.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene clpP CDS 46435..47709 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095858.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene clpX CDS 47899..50253 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367948.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene lon CDS 50455..50736 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392663.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene hupB CDS 50947..52815 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095860.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene ppiD CDS 52955..53311 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(53491..54186) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene queC CDS complement(54256..55959) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 56053..56868 product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113040.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene cof CDS complement(56908..57948) product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704598.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 58062..58523 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163482.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 58571..59335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 note possible pseudo, internal stop codon CDS 59366..60340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 note possible pseudo, internal stop codon CDS 60333..62102 product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256174.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 62368..62706 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208627.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene glnK CDS 62762..64027 product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene amtB CDS complement(64187..65047) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367933.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene tesB CDS complement(65076..65273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 65276..65785 product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779802.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(65810..66121) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017800955.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(66551..66856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 67102..67575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(68488..68706) product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095889.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(68736..69116) product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367917.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene tomB CDS 70192..70806 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816887.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 70869..71711 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816886.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 71738..72616 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816885.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(72808..73065) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208617.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 73249..73776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 note possible pseudo, frameshifted CDS 73751..74686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 note possible pseudo, frameshifted CDS complement(74812..77955) product multidrug efflux RND transporter permease subunit AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095890.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene acrB CDS complement(77973..79160) product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095891.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene acrA CDS 79301..79945 product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208614.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene acrR CDS complement(79954..80100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(80257..80784) product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208610.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 80852..81229 product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095896.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 81384..81935 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene apt CDS 82016..83947 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121969.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene dnaX CDS 84001..84330 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 84330..84935 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095898.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene recR CDS 85034..86908 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene htpG CDS 87025..87669 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220235.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene adk CDS 87786..88745 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene hemH CDS complement(88811..90499) product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546228.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene ybaL CDS complement(90717..91922) product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene fsr CDS 92213..92377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 92319..93932 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816863.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene ushA CDS complement(94326..94565) product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 94942..95394 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207064.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(95778..96215) product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211616.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 96304..97173 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(97170..97649) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene ybaK CDS complement(97823..98626) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208580.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(98753..101266) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083954.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene copA CDS 101362..101772 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene cueR CDS complement(101792..102262) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095908.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(102262..103179) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158246.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(103243..104100) product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene cnoX CDS complement(104181..104993) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(105031..105684) product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene tesA CDS 105622..106308 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 sequence004 source 1..83164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(476..730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(723..1946) product VirB10/TraB/TrbI family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039326147.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene virB10 CDS complement(1960..2865) product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976329.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene virB9 CDS complement(2865..3548) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(3541..3678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(3770..4813) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513454.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(4824..5051) product EexN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949385.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(5063..5767) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848059.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(5788..8532) product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096399.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(8543..8836) product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(8836..9546) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001446637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(9621..9851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(10243..10452) product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(10442..11026) product DUF2857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937857.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(11043..11237) product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(11380..12150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 note possible pseudo, frameshifted CDS complement(12594..13169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 note possible pseudo, frameshifted CDS 13459..14691 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894372.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 14696..16957 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(17046..18560) product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257231.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(18600..20549) product phenazine biosynthesis protein PhzE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118954.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene phzE CDS complement(20579..21211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(21230..22015) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(22005..23174) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083700.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 23621..25141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 note possible pseudo, internal stop codon, frameshifted CDS 25144..25374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 25542..29810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 29853..30245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 30360..30857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 31540..32157 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082696.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 32366..32761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(32799..35042) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103467.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 35251..36435 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384188.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 36432..37718 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 37864..39360 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 39484..39630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(40057..41232) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615166.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(41447..42538) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene ychF CDS complement(42730..43323) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene pth CDS 43584..43847 product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096227.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene ychH CDS complement(43911..44858) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene prs CDS complement(44998..45855) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133845424.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene ispE CDS complement(45852..46475) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130702.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene lolB CDS 46690..47946 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173208.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene hemA CDS 47984..49066 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096233.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene prfA CDS 49068..49898 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705084.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene prmC CDS 49920..50318 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 50315..51124 product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874130.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene sirB1 CDS 51161..52015 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367105.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene kdsA CDS complement(52080..53177) product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene chaA CDS 54093..54794 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(54808..56184) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705448.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(56260..57198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705454.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(57213..57989) product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705455.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(57986..59152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(59188..59865) product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene tagF CDS complement(59873..61990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(61990..63210) product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705462.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(63308..63799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096174.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(64296..64592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 note possible pseudo, internal stop codon CDS complement(64594..65133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 note possible pseudo, internal stop codon, frameshifted CDS complement(65748..66848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 67722..68756 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989419.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene astA CDS 68753..70222 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene astD CDS 70219..71547 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994973.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene astB CDS 71622..72593 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705766.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene astE CDS 73004..73492 product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228972.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene spy CDS complement(73597..74502) product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene yddG CDS complement(74563..75390) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097024.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene nadE CDS 75688..76023 product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366182.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene osmE CDS complement(76084..76476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(76639..78918) product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene katE CDS complement(79042..79710) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106834.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene hxpB CDS 79879..80415 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(80425..81318) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 81758..82513 product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097007.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 sequence005 source 1..76774 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(241..477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(791..1522) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095294.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene rlmB CDS complement(1605..4049) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076357.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene rnr CDS complement(4066..4308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(4455..5753) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006178975.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(5906..6106) product DUF2065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175502.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(6295..6873) product S-(hydroxymethyl)glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268116.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene gfa CDS complement(6942..8051) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842109.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene frmA CDS complement(8092..8367) product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038488.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(8679..9683) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene hflC CDS complement(9687..10931) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene hflK CDS complement(11000..12280) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095288.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene hflX CDS complement(12361..12675) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095287.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene hfq CDS complement(12779..13717) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130832081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene miaA CDS complement(13722..15551) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene mutL CDS complement(15636..17312) product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628029.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene amiB CDS complement(17309..17785) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene tsaE CDS complement(17782..19305) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418520.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene nnr CDS 19304..20443 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene queG CDS complement(21082..22911) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533482.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(23217..24785) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206021.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 24941..25540 product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202513.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene betI CDS 25554..27026 product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114436.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene betB CDS 27043..28719 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402225.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene betA CDS 29265..29984 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 30123..31706 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064865.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 31803..32792 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815564.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 32794..33639 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815566.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 33636..35294 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 35291..37012 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089435.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 36978..37202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 37202..38650 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 38687..39712 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173775.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 40242..40388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(40726..41913) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420964.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 42153..43658 product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene pitA CDS complement(43731..44066) product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene uspB CDS 44683..45120 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene uspA CDS complement(45278..46030) product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686608.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene rsmJ CDS complement(46038..48080) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184173.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene prlC CDS 48471..49313 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388937.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(49330..50241) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene rnz CDS 50526..51878 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160795.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene gorA CDS 52227..53915 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 53909..54628 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097930.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene btsR CDS complement(54670..55632) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene yjiA CDS complement(55652..55855) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467859.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(55942..58098) product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene btsT CDS complement(59128..60024) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971744.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 60322..61473 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(61443..63275) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247023.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(63392..63769) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001318207.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene crcB CDS complement(64096..65358) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(65638..66198) product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene mntP CDS 66270..66470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 66475..66849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 67375..68991 product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758077.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene mqo CDS complement(69042..70349) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(70543..71127) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076557.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 71266..72720 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(72761..73519) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 73680..74534 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099205.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 74708..75715 product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157374.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene yhjD CDS complement(75795..76277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 sequence006 source 1..76655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(89..165) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(386..2053) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene asnB CDS complement(2339..3091) product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene nagD CDS complement(3133..4353) product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(4361..5509) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097569.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene nagA CDS complement(5653..6453) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene nagB CDS 6901..8931 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816827.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene nagE CDS 9085..10752 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704748.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene glnS CDS complement(10857..11300) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene fur CDS complement(11803..12333) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367697.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene fldA CDS complement(12477..12758) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602226.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene ybfE CDS complement(12915..13679) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704754.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene ybfF CDS 13935..14492 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816824.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene seqA CDS 14517..16157 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene pgm CDS 16349..17092 product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 17643..18299 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168006.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene pxpB CDS 18293..19225 product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene pxpC CDS 19215..19952 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene pxpA CDS 20072..20800 product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209660.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 20800..21822 product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209661.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(21922..23205) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367676.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene gltA CDS 23935..24222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 24216..24563 product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700691.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene sdhD CDS 24563..26329 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene sdhA CDS 26346..27062 product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235263.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene sdhB CDS 27324..30131 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622290.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene sucA CDS 30147..31367 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099820.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene odhB CDS 31433..32599 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene sucC CDS 32599..33474 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene sucD CDS 34429..35997 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene cydA CDS 36010..37149 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene cydB CDS 37278..37571 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene ybgE CDS 37680..38348 product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173921.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(38469..39752) product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(40039..41727) product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171180.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 42017..42388 product inner membrane protein YbjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 42509..43237 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097374.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene nfsA CDS 43561..44040 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162876.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 44542..45651 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene potF CDS 45766..46905 product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene potG CDS 46916..47872 product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene potH CDS 47869..48714 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097369.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene potI CDS 48800..49279 product YbjO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 49339..50484 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208756.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene rlmC CDS complement(50487..51155) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene artM CDS complement(51155..51871) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097362.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene artQ CDS complement(51876..52610) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene artJ CDS complement(52623..53402) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027186.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene artP CDS 53637..53957 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 53954..54781 product N-acetylmuramoyl-L-alanine amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255157.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene amiD CDS complement(54808..55812) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211362.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene ltaE CDS complement(55873..57594) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816024.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene poxB CDS complement(57838..58755) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(59028..59255) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene cspD CDS 59572..59892 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520781.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene clpS CDS 59949..62225 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162786.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene clpA CDS complement(62511..62729) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211347.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene infA CDS complement(63087..63773) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241650.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene aat CDS complement(63912..65651) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene cydC CDS complement(65651..67420) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217690.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene cydD CDS complement(67578..68546) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097321.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene trxB CDS 69067..69561 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene lrp CDS 69682..72960 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 73152..73766 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene lolA CDS 73774..75117 product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067785.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene rarA CDS 75220..76512 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211336.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene serS sequence007 source 1..74979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 249..1232 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169583.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene zntB CDS complement(1557..2477) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene ttcA CDS 2664..4043 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816168.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene dbpA CDS complement(4121..4414) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 4969..5241 product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705621.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(5295..6290) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene ldhA CDS 6491..9109 product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705618.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 9109..9303 product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688201.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(9450..10049) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene azoR CDS 10374..14216 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420907.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene hrpA CDS complement(14226..15029) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260865.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(15528..15893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(16086..17390) product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192505.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene rstB CDS complement(17387..18118) product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene rstA CDS 18295..18708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816341.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(19145..20098) product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211018.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene ydgH CDS 20214..20387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 20612..22144 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene pntA CDS 22153..23544 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096868.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene pntB CDS 23734..24051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 24070..24426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 note possible pseudo, internal stop codon CDS 24432..24617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 24916..25122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 note possible pseudo, internal stop codon, frameshifted CDS complement(25431..26396) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262145.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene uspE CDS complement(26517..27269) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene fnr CDS complement(27478..28941) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706072.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene xylB CDS complement(29085..29294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 29473..30432 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211003.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(30501..31424) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096674.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(31697..32134) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704866.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(32282..33130) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 33388..34557 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705579.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 34581..35357 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705578.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 35548..35883 product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 36353..37387 product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099333.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene rhaT CDS complement(37422..39122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 39424..40896 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209105.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene rhaB CDS 40893..42149 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene rhaA CDS 42161..43003 product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene rhaD CDS 42993..43307 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619493.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene rhaM CDS complement(43360..44022) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 44342..44599 product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210240.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 44688..44945 product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene bhsA CDS 45030..46271 product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene zigA CDS complement(46372..47556) product L-arabinose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene ydeA CDS 48149..48634 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(48782..49345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 49494..49640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 50248..50601 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096738.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 50695..51159 product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214288.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 51168..51428 product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(51437..52630) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816265.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 52727..53302 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705566.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(53306..55222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 55496..56671 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528162.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene ssuD CDS 56713..58122 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 58237..59652 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268048.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 59649..60668 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730807.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 60665..61366 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 61369..62247 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730809.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 62585..63898 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205514.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 63911..65131 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(65178..66128) product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091913.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(67423..67803) product DUF4354 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(67932..68159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(68347..68544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(68799..70841) product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene pqqU CDS 71726..74131 product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267786.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(74330..74524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(74481..74669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 sequence008 source 1..74609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 126..2384 product cyclic-guanylate-specific phosphodiesterase PdeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772738.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene pdeF CDS complement(2381..2989) product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene tehB CDS complement(3161..4699) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832869.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene ppx CDS complement(4706..6766) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene ppk1 CDS complement(6949..7587) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene purN CDS complement(7584..8624) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098241.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene purM CDS 8868..9494 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene upp CDS 9498..9695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 9741..11024 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703151.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene uraA CDS 11107..11814 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(11842..12195) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815819.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene arsC CDS complement(12426..13187) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039297.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(13433..14899) product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489659.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene bepA CDS 15254..16291 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763739.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 16291..17310 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402156.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 17400..18194 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763744.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 18191..19012 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244499.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 19012..20028 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 20018..20848 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(20954..21421) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene bcp CDS complement(21399..21998) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098228.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 22157..23035 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene dapA CDS 23050..24084 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331881.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene bamC CDS 24279..24992 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 25198..26058 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267503.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 26062..28050 product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829314.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene tmcA CDS 28135..28833 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene ypfH CDS complement(28881..29069) product YpfN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383836.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(29092..30219) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene dapE CDS complement(30221..30604) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 30940..31125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 31135..31407 product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 31374..31583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 note possible pseudo, internal stop codon, frameshifted CDS 31614..31868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 note possible pseudo, internal stop codon CDS 32046..32336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(32552..35665) product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263083.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene acrD CDS 36163..37659 product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684770.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene ansP CDS complement(37684..38358) product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070487.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene narL CDS complement(38370..40157) product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816562.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene narX CDS 40508..41902 product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705095.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 42191..45952 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 45949..47490 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702629.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene narH CDS 47487..48212 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571695.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene narJ CDS 48215..48892 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160113.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene narI CDS 49037..49621 product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138361092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene nudK CDS 49806..50870 product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(50892..52076) product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene ampH CDS 52139..52312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(52313..53263) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703140.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene tal CDS complement(53582..54040) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209402.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene rpiB CDS 54480..55820 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 55817..57580 product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027218.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 57577..58365 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027216.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 58367..59173 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 59178..60035 product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027214.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 60181..61143 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209407.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 61306..63585 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172316.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene maeB CDS complement(63715..64644) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208526.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene hemF CDS complement(64655..65551) product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098210.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene amiA CDS 65760..66185 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 66213..66671 product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 66738..67352 product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 67634..68602 product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene cysP CDS 68602..69435 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208511.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene cysT CDS 69435..70310 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098203.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene cysW CDS 70300..71388 product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene cysA CDS 71465..72349 product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene cysM CDS 72555..73235 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 73232..74587 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815859.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 sequence009 source 1..74198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(145..582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 note possible pseudo, frameshifted CDS complement(592..1548) product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene tauA CDS complement(1752..2354) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 2660..2878 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099053.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(2875..4260) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(4270..5031) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615650.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(5131..5454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(5458..6396) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(6393..7508) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(7492..9045) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(9062..10069) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850162.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 10182..11081 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084073.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(11110..11910) product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382904.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 12077..12946 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(13010..13423) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 13721..14353 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene crp CDS 14419..15927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 note possible pseudo, internal stop codon CDS 16006..16494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 note possible pseudo, internal stop codon CDS complement(16528..17754) product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963789.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene argD CDS complement(17843..18418) product aminodeoxychorismate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174674.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(18476..19048) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene ppiA CDS 19419..21965 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817340.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene nirB CDS 21962..22288 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene nirD CDS 22370..23734 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene cysG CDS complement(23774..24778) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene trpS CDS complement(24798..25475) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(25459..26145) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369389.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene rpe CDS complement(26209..27024) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene dam CDS complement(27176..28243) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817345.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(28376..29464) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene aroB CDS complement(29505..30026) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920267.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene aroK CDS complement(30425..31675) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298773.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene hofQ CDS complement(31614..32003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(31993..32490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(32483..33028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(33028..33855) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051840.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene pilM CDS 34050..36527 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene mrcA CDS complement(36600..37166) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099080.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene nudE CDS complement(37627..37806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 37766..39829 product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 39884..40555 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703664.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene yrfG CDS 40584..40991 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene hslR CDS 41012..41902 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099084.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene hslO CDS 42233..43852 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703667.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene pckA CDS complement(43911..45266) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174760.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene envZ CDS complement(45272..45991) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene ompR CDS complement(46211..46699) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458979.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene greB CDS 46908..49235 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980687.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(49292..50068) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817359.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene bioH CDS 50435..50791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 50850..51425 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099096.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene nfuA CDS complement(51524..53605) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208925.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene malQ CDS complement(53621..56023) product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene malP CDS complement(56260..57018) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(57096..57929) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928734.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene glpG CDS complement(58057..58377) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene glpE CDS 58609..60117 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene glpD CDS complement(60187..62634) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993423.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene glgP CDS complement(62656..64089) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099109.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene glgA CDS complement(64167..65450) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099110.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene glgC CDS complement(65443..67446) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene glgX CDS complement(67443..69629) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene glgB CDS complement(70025..71134) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038629675.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene asd CDS 71361..71954 product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(72018..72557) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108342.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene gntK CDS complement(72571..72726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(72689..73663) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene gntR sequence010 source 1..69654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 193..999 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene xthA CDS complement(1000..2922) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(2922..3065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(3220..3771) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211673.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 3943..5799 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene sppA CDS 5887..6903 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366152.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene ansA CDS complement(6974..7255) product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(7259..7669) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene msrB CDS 8010..9008 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene gapA CDS 9085..9966 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 10164..10367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 10896..12830 product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene yeaG CDS 12930..14204 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097061.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 14455..15003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 note possible pseudo, frameshifted CDS 15009..16181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 note possible pseudo, frameshifted CDS 16260..16493 product DUF1480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164922.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 16834..18300 product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 18602..19789 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816438.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(19853..20923) product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705840.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene dadX CDS complement(20943..22247) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705841.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 22862..24397 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240763.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(24462..25181) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366064.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene fadR CDS 25402..26934 product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene nhaB CDS 27047..27577 product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943475.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene dsbB CDS complement(27640..28089) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(28148..28807) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284280.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(28861..29949) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298239.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(30045..30320) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295992.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 30481..31182 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169220.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene minC CDS 31208..32020 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366054.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene minD CDS 32024..32293 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211180.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene minE CDS complement(32353..33480) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109156.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene rnd CDS complement(33582..35288) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene fadD CDS complement(35472..36059) product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096141.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(36114..36815) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220976.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene tsaB CDS complement(36875..38785) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128847.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 39134..39478 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211186.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(39493..39690) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 39804..41177 product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978456.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene pabB CDS 41167..41751 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705928.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 41998..43362 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene sdaA CDS 43652..45214 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192512.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(45315..46874) product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394983.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene yoaE CDS 47411..48373 product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene manX CDS 48453..49259 product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene manY CDS 49275..50123 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175979.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 50168..50617 product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211066.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(50750..51406) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211061.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene rlmA CDS complement(51922..52131) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene cspE CDS complement(52826..53830) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(53863..54135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 54369..54608 product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096123.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 54872..56251 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705935.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(56314..57195) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene htpX CDS complement(57430..59475) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096119.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene prc CDS complement(59495..60196) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170218.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene proQ CDS complement(60293..60793) product L-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene msrC CDS complement(60790..60978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 60993..62255 product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170219.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene yebS CDS 62206..64845 product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 65057..66496 product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene rsmF CDS complement(66603..67253) product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986169.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene pphA CDS complement(68648..68872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 misc_feature complement(68962..>69654) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096391.1:IS5-like element IS903B family transposase note possible pseudo, internal stop codon locus_tag LOCUS_08060 sequence011 source 1..69140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1221 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009966488.1:YfcC family protein locus_tag LOCUS_08070 CDS 1649..4357 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989569.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(4428..4991) product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene hxlB CDS complement(4992..6038) product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004058044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(6080..6916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(6949..7692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(7742..8224) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(8243..8632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 note possible pseudo, internal stop codon CDS 9371..9781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(9939..11309) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(11351..11623) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699818.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(11662..12126) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901818.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(12173..14167) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088084.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene tkt CDS complement(14275..14457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 14677..15411 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363775.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(16021..16536) product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095367.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(16648..18090) product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267884.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene arcD CDS complement(18212..19216) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237033.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene argF CDS complement(19269..20186) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene arcC CDS complement(20212..21432) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314369.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene arcA CDS 22915..23058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 23143..24231 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202471.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 24498..25781 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703236.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 26017..27183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 27164..28390 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 29041..29946 product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136613.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene yagE CDS 30137..30964 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141977.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(31057..33366) product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292679.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene opgB CDS 33827..34864 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869097.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 35329..36549 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(36563..37063) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368396.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 37230..37526 product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 tRNA complement(37561..37647) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(37678..37764) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(37939..38964) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272345.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene rsmC CDS 39138..39551 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368390.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 39520..39963 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene rimI CDS 40049..40732 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene yjjG CDS 41655..42152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096174.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 42176..42691 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096175.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene tssJ CDS 42716..44059 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene tssK CDS 44079..45320 product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 45324..48962 product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096178.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene tssM CDS 48979..49680 product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366557.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene tagF CDS 49705..50724 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene tssA CDS 50804..51331 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366559.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene tssB CDS 51335..52834 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096181.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene tssC CDS 53146..53628 product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366565.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 53841..54332 product type VI secretion system amidase effector protein Tae4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096182.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 54478..54705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 note possible pseudo, internal stop codon CDS 55098..56954 product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene tagH CDS 56954..57748 product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096185.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 57774..58751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096186.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 58803..59633 product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705453.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 59626..60207 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene tssE CDS 60210..62084 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420938.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene tssF CDS 62081..63142 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096190.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene tssG CDS 63269..65884 product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096191.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene tssH CDS 65914..67371 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 67468..68166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 note possible pseudo, internal stop codon, frameshifted sequence012 source 1..67460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(76..168) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(456..641) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene csrA CDS complement(1064..3691) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene alaS CDS 4090..4626 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095614.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene hpt CDS complement(4684..5367) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651604.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene can CDS 5457..6383 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 6380..7150 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095617.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(7226..8662) product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706057.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(9241..10128) product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366502.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 10436..10783 product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704423.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 10893..11762 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene speE CDS 11759..12595 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368213.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene speD CDS complement(13162..13446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 note possible pseudo, internal stop codon CDS complement(13477..13686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 note possible pseudo, internal stop codon, frameshifted CDS 14044..14229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(14226..14408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(14442..14570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(14656..15018) product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384306.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene yacL CDS complement(15332..17929) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene acnB CDS 18552..18734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 18784..18921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 note possible pseudo, internal stop codon, frameshifted CDS complement(19600..21075) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(21394..21693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 22255..22473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(22873..23244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(23620..23763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 note possible pseudo, internal stop codon, frameshifted CDS complement(24313..24606) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene cas2e CDS complement(24611..24847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(24822..25352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(25540..26967) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102483.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene lpdA CDS complement(27184..28809) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene aceF CDS complement(28824..31487) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368222.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene aceE CDS complement(31612..32376) product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389026.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene pdhR CDS 32893..34245 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815579.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(34302..35156) product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene ampE CDS complement(35153..35728) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene ampD CDS 35952..36842 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095589.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene nadC CDS 37047..37490 product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360891.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene ppdD CDS 37490..38890 product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene gspE CDS 38895..40082 product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene hofC CDS complement(40364..41404) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 41647..42258 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209319.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene coaE CDS 42263..43006 product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194736.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene zapD CDS 43022..43237 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368237.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene yacG CDS complement(43283..43669) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167088.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene mutT CDS complement(43821..46526) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905780.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene secA CDS complement(46615..47148) product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210427.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene secM CDS complement(47452..48384) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095578.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene lpxC CDS complement(48471..49622) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389003.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene ftsZ CDS complement(49695..50951) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210431.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene ftsA CDS complement(50948..51793) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368242.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene ftsQ CDS complement(51795..52715) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(52708..54225) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095575.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene murC CDS complement(54263..55321) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016582.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene murG CDS complement(55318..56532) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156865.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene ftsW CDS complement(56532..57848) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704401.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene murD CDS complement(57851..58933) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167069.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene mraY CDS complement(58927..60288) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704400.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene murF CDS complement(60285..61772) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene murE CDS complement(61759..63525) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156878.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(63541..63861) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029684613.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene ftsL CDS complement(63858..64799) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene rsmH CDS complement(64802..65260) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene mraZ CDS complement(65784..66794) product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762406.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene cra sequence013 source 1..65118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(357..695) product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059386398.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(840..1148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 note possible pseudo, frameshifted CDS complement(1219..1344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 1482..1682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(1641..1994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(2139..2618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(2697..3023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(3120..3329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 4151..4372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 4369..5175 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114411.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene map CDS 5520..6116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 note possible pseudo, frameshifted CDS complement(6627..7742) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 7793..8260 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(8285..8917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(8954..9499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(10153..10347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 note possible pseudo, frameshifted CDS complement(10498..10965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 11871..13004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 16165..17892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(18114..19052) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(19641..20411) product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168938.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene ygbI CDS 20677..21591 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 21591..22853 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 22850..23473 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168943.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 23473..24261 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 24408..25769 product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104441.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 26159..27346 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815999.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 27336..29810 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815998.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene torA CDS complement(29962..31071) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097927.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene apbC CDS 31265..33298 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195338.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene metG CDS 33486..33869 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295452.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 33871..34563 product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162334.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 34657..35547 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211969.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene cdd CDS 35801..37498 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 37647..38369 product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097950.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene sanA CDS complement(38401..39564) product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001765111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene yeiB CDS complement(39619..40284) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097957.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene folE CDS complement(40419..41546) product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 41695..42606 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 42707..43549 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene yeiG CDS complement(43713..44501) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161751.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(44501..45583) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215451.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(45830..47296) product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene lysP CDS complement(47485..48351) product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097962.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene yieE CDS 48607..49662 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706115.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 49722..50567 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873892.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene nfo CDS complement(50602..52293) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097965.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene fruA CDS complement(52310..53248) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091249.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene fruK CDS complement(53245..54378) product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171391.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene fruB CDS 54781..55959 product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551969.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene setB CDS 56398..56970 product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene yeiP CDS 57022..58005 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 58042..58755 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 59366..59935 product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene mepS CDS 60604..62022 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470593.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 62058..62246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 62212..64020 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 sequence014 source 1..63075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..541 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001831126.1:HAD-IIB family hydrolase locus_tag LOCUS_09850 CDS complement(669..1844) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338817.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1939..2991) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972870.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(3062..3988) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246965.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(4092..5123) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(5138..6622) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972980.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(6802..7917) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(7947..8942) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene iolG CDS complement(8983..9975) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207240953.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(9977..10798) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(10808..12241) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene gabD CDS 12762..13703 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 13855..15702 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223774.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene iolD CDS 15720..16631 product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene iolE CDS complement(16801..17085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 note possible pseudo, internal stop codon CDS complement(17216..17404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001683522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(17441..18169) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145007.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene phoU CDS complement(18187..18960) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene pstB CDS complement(19005..19892) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099412.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene pstA CDS complement(19889..20851) product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099411.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene pstC CDS complement(20935..21975) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867129.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene pstS CDS complement(22342..22980) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 23085..23975 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(24168..26000) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene glmS CDS complement(26155..27531) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099408.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene glmU CDS 28111..30738 product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705445.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene tssI CDS complement(30878..31297) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024912932.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(31322..32704) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene atpD CDS complement(32860..33726) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862364.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene atpG CDS complement(33779..35320) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene atpA CDS complement(35335..35868) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288593.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene atpH CDS complement(35883..36353) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393038.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene atpF CDS complement(36448..36690) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene atpE CDS complement(36740..37558) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135618.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene atpB CDS complement(37567..37947) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene atpI CDS complement(38759..39418) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene rsmG CDS complement(39442..40386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 note possible pseudo, frameshifted CDS complement(40425..41330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 note possible pseudo, frameshifted CDS complement(41795..42235) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene mioC CDS complement(42395..42856) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene asnC CDS complement(42963..44423) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703920.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene viaA CDS complement(44420..45913) product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene ravA CDS 46143..48011 product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099398.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene kup CDS complement(48028..49422) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098726.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene qseC CDS complement(49419..50081) product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene qseB CDS 50343..50741 product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 51412..52209 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172561.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 52206..52976 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 52999..54021 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530798.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 54036..55334 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226151.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 55538..55957 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene rbsD CDS 55965..57476 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387762.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene rbsA CDS 57473..58444 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene rbsC CDS 58471..59352 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368990.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene rbsB CDS 59411..60343 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene rbsK CDS 60350..61351 product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175187.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene rbsR CDS complement(61348..62751) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene mdtD sequence015 source 1..59832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 441..752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(718..1197) product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094807.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene tssD CDS complement(1411..2085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165356698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 2258..2518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(2567..2920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 tRNA complement(3168..3243) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 3510..4037 product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703525.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene mug CDS complement(4114..5958) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369628.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene rpoD CDS complement(6152..7894) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210358.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene dnaG CDS complement(8014..8229) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene rpsU CDS 8526..9539 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene tsaD CDS complement(9570..10175) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene plsY CDS 10282..10641 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene folB CDS 10783..11601 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene bacA CDS complement(11672..12907) product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708517.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene cca CDS complement(13027..13650) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098761.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 13856..15160 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817221.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 15237..18083 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640211.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene glnE CDS 18171..19601 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817219.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene hldE CDS complement(19697..19990) product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297598.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene ubiK CDS 20400..21056 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076997.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene ribB CDS 21303..22088 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098747.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene ygiD CDS complement(22175..23335) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160795.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(23345..24031) product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831528.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(24196..25779) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene tolC CDS 25882..26517 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098743.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene nudF CDS 26514..26939 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862516.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 26987..27814 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217438.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene cpdA CDS 27818..28399 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene yqiA CDS 28453..30348 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212181.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene parE CDS 30363..31280 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174098.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(31352..31933) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 32403..34676 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene parC CDS 34801..35538 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369660.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene plsC CDS 35706..37124 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817210.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene ftsP CDS complement(37209..38033) product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene dkgA CDS complement(38087..39244) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene yqhD CDS 39421..40314 product DNA-binding transcriptional regulator YqhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene yqhC CDS complement(40343..41002) product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene yghB CDS complement(41129..42457) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315867.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene metC CDS 42702..43442 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene exbB CDS 43448..43870 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene exbD CDS 44056..45375 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188918.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 45509..46957 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096471.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(46961..47443) product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214045.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 47943..49379 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 49373..50302 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174267.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 50299..51099 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817266.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 51120..51824 product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 51989..53257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(53356..53859) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170444.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene ftnA CDS complement(54234..55853) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(55882..57264) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(57353..58840) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112672.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 sequence016 source 1..59143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 328..1479 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097314.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(1546..2286) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene pflA CDS complement(2455..4743) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene pflB CDS complement(4838..5698) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene focA CDS complement(6184..7941) product 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420898.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene ycaO CDS 8253..9338 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882989.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene serC CDS 9426..10712 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704884.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene aroA CDS 10917..11606 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097305.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene cmk CDS 11723..13405 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367470.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene rpsA CDS 13479..13763 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211322.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene ihfB CDS 14204..16468 product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705794.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 16504..18252 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene msbA CDS 18249..19223 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene lpxK CDS 19282..20511 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704888.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 20575..20757 product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097300.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene ycaR CDS 20754..21503 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene kdsB CDS 21679..22572 product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170979.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(22552..23337) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899599.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene elyC CDS 23412..24248 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301572.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene cmoM CDS 24245..25567 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170970.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene mukF CDS 25548..26279 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene mukE CDS 26276..30724 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene mukB CDS 31100..32914 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816041.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene ldtD CDS 33102..33650 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357053.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 33701..34330 product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene gloC CDS complement(34387..35580) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene aspC CDS complement(35891..36967) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene ompF CDS complement(37266..38666) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159985.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene asnS CDS complement(38835..40040) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305916.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene pncB CDS 40299..42914 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704896.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene pepN CDS complement(42966..43754) product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090500.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene ssuB CDS complement(43751..44545) product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene ssuC CDS complement(44651..45202) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097270.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene ssuE CDS 45459..46469 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene pyrD CDS 46648..47193 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005020285.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene zapC CDS 47512..49629 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene rlmKL CDS 49636..51549 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038019873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 51568..52836 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333164.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene pqiA CDS 52823..54466 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029684982.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene pqiB CDS 54463..55026 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene pqiC CDS 54975..55178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 55297..55464 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene rmf CDS complement(55745..56263) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene fabA CDS complement(56332..58077) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 58384..58842 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097258.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene matP sequence017 source 1..59060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1814..2542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 2567..3052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 3055..4029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 4041..4295 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001443095.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 4295..5707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 5700..9065 product type VI secretion system membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211936.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 9052..9585 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096443.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene tssJ CDS 9585..11360 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155110255.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene tssF CDS 11360..12436 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene tssG CDS complement(12532..13206) product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene yecA CDS complement(13203..13463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(13490..14350) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(14360..17083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(17207..18199) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(18281..18778) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 19340..21037 product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene aspT CDS 21124..22725 product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073522.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 22959..23213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(23379..23750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(23942..24712) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene fabG CDS complement(24752..25810) product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene rhaT CDS complement(25818..26732) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092846703.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(26732..27082) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene rhaM CDS complement(27072..28259) product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174589.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene rhmD CDS complement(28393..29613) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113702.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(29738..30661) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966109.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(31354..31590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(31601..32782) product Bcr/CflA family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957917.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(32786..33505) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532982.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(33499..34284) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(34281..35168) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 note possible pseudo, frameshifted CDS complement(35161..36054) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(36118..37215) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314633.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(37246..37962) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(37950..38735) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(38732..39985) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533606.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(40005..40319) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070702.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 tRNA 41041..41116 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 41118..41191 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(41488..42405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(42554..43510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(43708..44940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(44937..46274) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148528493.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene ectB CDS complement(46295..47632) product L-ornithine N(5)-monooxygenase PvdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene pvdA CDS complement(47658..48026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(48121..48519) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211247.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(48506..49417) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211248.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(49414..50313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(50337..51383) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188514.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(51383..52036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(52033..53661) product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(53721..54185) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089251.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(54176..54640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531514.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(54627..56087) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(57019..57291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(57348..57584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 note possible pseudo, frameshifted CDS complement(57644..57826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 note possible pseudo, frameshifted CDS complement(57873..58061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(58064..58756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165356698.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 sequence018 source 1..57592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..888 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063787.1:substrate-binding domain-containing protein locus_tag LOCUS_11980 CDS 910..2481 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063789.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 2515..3498 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063788.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 3684..4118 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811574.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 4128..5012 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811576.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 5202..6200 product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 6432..7598 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270078.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 7689..8570 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 9312..10469 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 10480..11505 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 11498..12112 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 12144..12593 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene aroQ CDS 12590..13528 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510794.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(13592..14554) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040706.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 15049..16077 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968140.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 16176..17030 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 17032..17853 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383453.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 18030..19280 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114443.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(19345..21036) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498066.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(21033..21902) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729788.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(21904..22803) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384277.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(22835..24445) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(24621..26117) product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(26493..28175) product type II secretion system effector nodulation protein NopX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857555.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene nopX CDS 28554..29132 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 29327..30241 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(30334..31215) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737007.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(31212..32042) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(32076..33098) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(33415..34599) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(34918..35346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 note possible pseudo, frameshifted CDS complement(35294..35743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 note possible pseudo, frameshifted CDS complement(35740..36597) product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene sitC CDS complement(36594..36938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 note possible pseudo, frameshifted CDS complement(36899..37273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 note possible pseudo, frameshifted CDS complement(37395..37688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 note possible pseudo, frameshifted CDS 38230..38769 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 38957..39493 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041165625.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 39603..42089 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 42089..43144 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704500.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 43293..43904 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704499.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(44211..44909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(45521..45790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(46001..46465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 46911..47411 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096428.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene tssB CDS 47465..49015 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023324775.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene tssC CDS 49033..50373 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096430.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene tssK CDS 50370..51059 product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096431.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene tssL CDS 51056..52753 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120158270.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 52901..53392 product type VI secretion system effector Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366299.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene hcp repeat_region 53772..54042 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccagacccgcgcgcacgcggaaatcct CDS 54113..56491 product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705822.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 56491..57270 product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878141.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 sequence019 source 1..57212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(325..1056) product class II aldolase and adducin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1126..1968) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(2046..2918) product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976953.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene thpD CDS complement(3309..4829) product amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315104.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(4853..5683) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726714.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(5806..6321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 6631..7056 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369686.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(7343..8290) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703484.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 8637..10391 product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186447661.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(10476..10781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(10795..10965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210867.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(11241..11477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(11793..12449) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142908.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 13126..13455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 note possible pseudo, internal stop codon, frameshifted CDS 13592..13936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 14201..14413 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 14756..15973 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 16260..16412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 16354..16515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 16856..17110 product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518423.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene iraP CDS 17382..17681 product PsiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(17859..18674) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412190.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene proC CDS 18929..19372 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158137.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(19409..20041) product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 20344..20868 product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208693.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene aroL CDS 20990..21274 product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene ppnP CDS complement(21459..22370) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160563.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene rdgC CDS 22516..23430 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219315.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene mak CDS complement(23471..24934) product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene eat CDS 25104..26108 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 26260..27330 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(27333..27722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(27793..31476) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816917.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(31473..32714) product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208687.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene sbcD CDS 32917..33606 product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene phoB CDS 33621..34952 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704551.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene phoR CDS 35153..36256 product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 36661..37980 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167571.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene brnQ CDS 38047..39402 product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295329.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene proY CDS complement(39478..40725) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(41138..41719) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167576.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 41825..42895 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene queA CDS 43263..44387 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene tgt CDS 44412..44744 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene yajC CDS 44772..46619 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208670.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene secD CDS 46630..47598 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene secF CDS complement(47855..48646) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene hisN CDS 48746..49516 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095418.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(49770..50126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367842.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(50544..51059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 51468..52940 product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167861.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 53299..53649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 53840..56017 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 56112..56438 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165309.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 sequence020 source 1..56702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1004..4231) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene carB CDS complement(4234..5394) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298633.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene carA CDS complement(5852..6667) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene dapB CDS 6999..8312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(8362..9315) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815541.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene ispH CDS complement(9296..9766) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004655.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene fkpB CDS complement(9763..10275) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157006.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene lspA CDS complement(10275..13091) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286823.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene ileS CDS complement(13119..14006) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210510.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene ribF CDS 14378..14641 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene rpsT CDS complement(15108..16241) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene dnaJ CDS complement(16348..18264) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene dnaK CDS complement(18449..19750) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209244.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(19886..20464) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209243.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene mog CDS complement(20608..21561) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130185.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene tal CDS 21775..22551 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704335.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene yaaA CDS 22769..23821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(23970..24254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 24156..25367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(25426..26712) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209239.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene thrC CDS complement(26715..27644) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209238.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene thrB CDS complement(27647..30109) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704333.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene thrA CDS complement(30440..31141) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704332.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 31774..32490 product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene arcA CDS complement(32559..33032) product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene creA CDS 33237..34118 product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371679.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene robA CDS complement(34155..34802) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704328.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene gpmB CDS 34853..35371 product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815530.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene yjjX CDS complement(35472..35804) product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene trpR CDS complement(35991..37922) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815528.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene sltY CDS 38210..40012 product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene atzF CDS 40005..43625 product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140960.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene uca CDS 43636..44346 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 44370..45641 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene urtA CDS 45821..47395 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210793.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene urtB CDS 47395..48471 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene urtC CDS 48464..49255 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096633.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene urtD CDS 49236..49955 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096632.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene urtE CDS 50035..50799 product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450106.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene deoR CDS complement(50826..51773) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970705.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 51978..53645 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene ettA CDS 53893..54102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 note possible pseudo, frameshifted CDS complement(54273..54932) product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228082.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(54923..55372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 misc_feature complement(55399..>56702) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463563.1:DUF2235 domain-containing protein note possible pseudo, frameshifted locus_tag LOCUS_13480 sequence021 source 1..56613 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6..1277) product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1293..2801) product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene dhaS CDS complement(2798..3094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(3118..3849) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096632.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene urtE CDS complement(3827..4552) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene urtD CDS complement(4549..5565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(5562..6428) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene urtB CDS complement(6442..7506) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(7508..8737) product substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083028.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(8868..10037) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966651.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 10199..10621 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(10766..11761) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(11829..13313) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(13317..14261) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209439.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(14254..15084) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(15170..16270) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(16272..17792) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(17792..18403) product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(18416..19354) product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 19560..20507 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209443.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(20945..21088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 21206..21358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(21428..22639) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(22643..23347) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973715.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 23452..24408 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816771.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 tRNA complement(24769..24844) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(25005..25553) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170287.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene pgsA CDS complement(25619..26311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 note possible pseudo, internal stop codon CDS complement(26336..27391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 note possible pseudo, internal stop codon CDS complement(27450..28199) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211176.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene uvrY CDS 28874..29098 product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160184.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(29584..30192) product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113896.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene rhlI CDS 31706..33103 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174531811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene cycA CDS complement(33180..33815) product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367241.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene rutR CDS 34124..35215 product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene rutA CDS 35215..35949 product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307708.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene rutB CDS 36093..36479 product pyrimidine utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene rutC CDS 36489..37316 product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene rutD CDS 37301..37891 product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 37901..38437 product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene rutF CDS 38472..39803 product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764407.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene rutG CDS 40120..40719 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062894.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene wrbA CDS 40740..40970 product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499832.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(41268..42779) product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044266.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene agp tRNA complement(43206..43293) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 43512..44168 product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374046.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene yccA CDS 44274..44600 product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene tusE CDS complement(44617..44895) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704915.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene yccX CDS 44983..46173 product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116288.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene rlmI CDS 46235..46552 product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367415.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene hspQ CDS complement(46595..47011) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 47349..47993 product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097250.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 48087..48545 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367424.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene mgsA CDS complement(48577..50631) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816055.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene helD CDS 50771..51217 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 51232..53373 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene yccS CDS complement(53674..54294) product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097255.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 54507..55013 product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene sulA CDS 55364..56431 product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989142.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene ompA sequence022 source 1..55277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..664 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968133.1:amino acid ABC transporter ATP-binding protein locus_tag LOCUS_14060 CDS 712..1188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 1227..1652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 2281..4293 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035647.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 4294..5277 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729925.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 5278..6033 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088221.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 6037..7065 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510662.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(7450..7683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 8107..8979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(9021..10070) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095060.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene dusA CDS complement(10450..11229) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 11843..12040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 12042..12500 product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080443.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene gatA CDS 12532..12819 product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824293.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene gatB CDS 12822..14195 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490608.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 14244..15302 product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844177.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene gatD CDS complement(15602..15880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 note possible pseudo, frameshifted CDS complement(16489..17475) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357245.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene lacD CDS complement(17521..18468) product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775547.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene lacC CDS complement(18872..19699) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175238.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(19714..21123) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719918.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(21135..22055) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763021.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene pfkB CDS complement(22052..22201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 22530..23366 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 23370..24335 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027808.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 24492..24677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 24795..25307 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416263.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene zur CDS complement(25485..26093) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene lexA CDS complement(26209..26565) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368764.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 26694..29117 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017354.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene plsB CDS complement(29298..30167) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene ubiA CDS complement(30169..30696) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095049.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene ubiC CDS complement(31274..31672) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202963.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene psiE CDS complement(31825..33915) product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(33915..34658) product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095036.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(34655..35302) product lipoprotein GfcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247610.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene gfcB CDS complement(35380..35628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(36275..37921) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene pgi CDS 38592..39947 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136394.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene lysC CDS 40150..40842 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704870.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene aqpZ CDS 41029..41970 product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704027.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene panS CDS complement(42008..43633) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956807.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(43881..47564) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096047.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene metH CDS 47770..48603 product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368798.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene iclR CDS complement(48656..50386) product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene aceK CDS complement(50501..51805) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857886.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene aceA CDS complement(51823..53421) product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene aceB CDS complement(53765..54694) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122786.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene metA sequence023 source 1..54182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..1471) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048103.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1443..2252) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261025.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(2339..3223) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene rfbA CDS complement(3312..4397) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699404.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene rfbB CDS complement(5107..6120) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene galE CDS complement(6174..7070) product GalU regulator GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981469.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene galF CDS complement(7236..8255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(8356..9522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(9900..11390) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(11631..13676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 13675..13893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(14186..15229) product lipooligosaccharide biosynthesis family 4 glycosyltransferase LsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694187.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene lsgC CDS complement(15276..16028) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031644.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(16247..17158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(17264..19444) product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097881.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene wzc CDS complement(19457..19891) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(19909..21042) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014170829.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(21349..22782) product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 23728..25308 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097884.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(25355..27172) product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene asmA CDS complement(27193..27774) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene dcd CDS complement(27905..28480) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene udk CDS 28934..29554 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 29697..31049 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469681.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene yegD CDS 31261..32487 product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678993.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene mdtA CDS 32487..35609 product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097900.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 35606..38677 product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667528.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene mdtC CDS 38720..40132 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706067.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 40138..41511 product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097903.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene baeS CDS 41524..42231 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365781.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene baeR CDS 42389..43762 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001517981.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene yegQ CDS 44041..44940 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273393.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene yegS CDS 45283..46497 product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298659.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene rspA CDS 46508..47518 product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836057.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 47620..48903 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824230.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 48952..50415 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096786.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 50505..51191 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215563.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(51215..52267) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365768.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene fbaB CDS complement(52425..53225) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822268.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene thiD CDS complement(53222..54013) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene thiM sequence024 source 1..50331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..2549 product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667608.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene mdtC CDS 2556..3974 product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene opmB CDS complement(3978..4880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(4901..7033) product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(7043..8068) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088527.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(8091..9584) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095096.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(9587..10570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(11281..11709) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200865.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 11785..12147 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 12144..12599 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529580.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 12864..15020 product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896085.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene aas CDS 15017..16225 product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816987.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene lplT CDS complement(16289..17329) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209839.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(17494..17637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(17651..17782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(17828..18538) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(18612..19298) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165371.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene mutH CDS complement(19643..19831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 19983..20510 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165374.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene rppH CDS 20523..22769 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene ptsP CDS 22971..23843 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816984.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene lgt CDS 23850..24644 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816983.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene thyA CDS complement(24645..25304) product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285824.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene ddpX CDS 25635..26096 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 26087..26641 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211630.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 26638..27066 product YgdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 27056..27358 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019280.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 27457..30840 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816979.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene recC CDS 30967..33861 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene ptrA CDS 33854..37402 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816977.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene recB CDS 37399..39237 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816976.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene recD CDS complement(39414..39764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 note possible pseudo, internal stop codon CDS complement(39921..40247) product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886449.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(40241..40804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133086100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(41094..42422) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098542.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene argA CDS 42309..42569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 42584..43900 product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene amiC CDS complement(43985..45007) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705075.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 45463..46224 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 46266..46553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 46638..47036 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 47184..47795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 note possible pseudo, internal stop codon CDS 47796..48233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 note possible pseudo, internal stop codon CDS complement(48196..48882) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168864.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 49161..49820 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444385.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene gstA sequence025 source 1..49736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1997..2668) product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387039.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(2665..4524) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084105269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(4529..4879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(4889..5011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(5101..5658) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 5821..8826 product Tn3-like element Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(8982..12587) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096802.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene uca CDS complement(12669..13304) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(13315..14025) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(14037..14795) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090873437.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(14808..15620) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(15636..16751) product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 17374..18090 product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175086.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 18549..20471 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene mtlA CDS 20582..21730 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645420.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene mtlD CDS 21730..22332 product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene mtlR CDS 22395..22757 product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209618.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(22830..23564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(23944..24561) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122632.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene sodA CDS complement(24762..26105) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 26326..27102 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727633.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(27206..28009) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753617.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene fdhD CDS 28278..29204 product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027727.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene fdhE CDS 29321..29932 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766681.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 30007..30747 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097911.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(30734..31714) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012008.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(31701..32726) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846217.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(32747..34012) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(34197..35120) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118645.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 36066..36800 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211859.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(36781..37431) product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211858.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(37877..38686) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209641.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene yidA CDS complement(38927..41335) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703899.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene gyrB CDS complement(41353..42438) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene recF CDS complement(42599..43699) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673462.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene dnaN CDS complement(43704..45038) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014068246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene dnaA CDS 46019..46345 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239725.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene rnpA CDS 46309..46566 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703903.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene yidD CDS 46569..48212 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene yidC CDS 48340..49704 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703904.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene mnmE sequence026 source 1..48359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..926 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369971.1:7-carboxy-7-deazaguanine synthase QueE locus_tag LOCUS_15790 CDS complement(1073..2461) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903720.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 3163..3408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 3497..3940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 3937..4737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 4754..6049 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817199.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 6063..6509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 6534..7655 product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213784.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 7659..8933 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079097.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 9242..9868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 9872..10723 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261284.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 10716..11483 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 11524..12072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 12050..12649 product tight adherence pilus pseudopilin TadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817205.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene tadF CDS 12630..13064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 13055..14725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(14898..15260) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001329795.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene queD CDS 15560..17365 product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703301.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene cysJ CDS 17365..19077 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene cysI CDS 19087..19824 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(19851..20135) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211043.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(20138..21163) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490486.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 21420..22835 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815607.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene cysG CDS 22845..23753 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499613.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene cysD CDS 23765..25204 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090348.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene cysN CDS 25206..25814 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098503.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene cysC CDS 25873..26193 product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209389.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(26246..26968) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705159.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(26955..27719) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(27768..28529) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705157.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 28557..29048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 29045..29743 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246155.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene ispD CDS 29762..30244 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene ispF CDS 30244..31293 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene truD CDS complement(31305..31757) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727266.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(31835..33226) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(33371..34219) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(34254..34451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 35511..36086 product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 36464..36856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 note possible pseudo, frameshifted CDS 36856..37503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 note possible pseudo, frameshifted CDS complement(38042..39256) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967628.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene hmpA CDS 39508..39960 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene nsrR CDS 40916..41668 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305779.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene surE CDS 41662..42288 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369988.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 42602..43528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 43579..44571 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene rpoS CDS complement(44706..47267) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005807.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene mutS CDS 47784..48206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 sequence027 source 1..48121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(30..105) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 686..1630 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245931.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1744..2538) product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302302.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene mtfA CDS complement(2583..3065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 note possible pseudo, frameshifted CDS 3772..4485 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097750.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 4789..5139 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene hinT CDS 5160..5528 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225269.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 5539..6138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 6122..6949 product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene thiK CDS 7021..8064 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene nagZ CDS 8104..8646 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene ycfP CDS 9123..10427 product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene ndh CDS 10712..11254 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170666.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(11299..14745) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097100.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene mfd CDS complement(14990..15199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 15460..16659 product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene lolC CDS 16652..17356 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158007.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene lolD CDS 17356..18597 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705054.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene lolE CDS 18818..19651 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene cobB CDS 19791..21017 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816138.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene pepT CDS complement(21105..22229) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097085.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(22286..23749) product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170639.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene phoQ CDS complement(23753..24421) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158018.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene phoP CDS complement(24641..26011) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene purB CDS complement(26061..26702) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024131182.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene hflD CDS complement(26742..27899) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097080.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene mnmA CDS complement(27985..28419) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097079.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 28673..29923 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene icd CDS 30237..30656 product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394197.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 30659..31921 product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096856.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene umuC CDS complement(32216..33958) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(33964..35343) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031070.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(35510..36298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 note possible pseudo, frameshifted CDS complement(36295..37188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 note possible pseudo, frameshifted CDS complement(37442..37774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 38049..38228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(38351..38713) product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(38814..39758) product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705839.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene ldcA CDS 40058..40615 product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103057843.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene emtA CDS 41085..43490 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(43610..43903) product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703275.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 44215..44412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 44423..44671 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(44903..45766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 note possible pseudo, frameshifted CDS complement(45691..46578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 note possible pseudo, frameshifted CDS 46974..47915 product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705016.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene ghrA sequence028 source 1..46945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(489..3167) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210657.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene adhE CDS 3657..4304 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164160.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(4351..4674) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425070.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(4719..6179) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene cls CDS complement(6551..6847) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367051.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 7051..7779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(7822..8250) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210641.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene yciA CDS complement(8309..8845) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808682.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(8900..9637) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366197.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(9648..10082) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 10335..10967 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705753.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene ompW CDS complement(11016..11330) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(11480..12283) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene trpA CDS complement(12283..13473) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096356.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene trpB CDS complement(13521..14882) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050075568.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene trpCF CDS complement(14885..15886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 note possible pseudo, internal stop codon CDS complement(15899..16477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 note possible pseudo, internal stop codon CDS complement(16477..18039) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816407.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 18349..19191 product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705744.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene rnm CDS 19228..19848 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 20216..21082 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291216.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene rluB CDS complement(21128..21721) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene cobO CDS complement(21721..22482) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118664067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 22700..23749 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816401.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene sohB CDS complement(23757..24029) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210623.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 24425..27022 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513593.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene topA CDS 27344..28318 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175683.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene cysB CDS 28777..28950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 28954..29118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 29626..32304 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099547.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene acnA CDS complement(32380..32994) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176295.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene ribA CDS 33211..33975 product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420925.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene pgpB CDS 34131..34439 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096374.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 34446..35615 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096375.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene lapB CDS 35818..36540 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763993.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene pyrF CDS 36537..36860 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705734.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene yciH CDS complement(36947..37162) product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene osmB CDS complement(37622..39688) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169907.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(39877..41811) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096382.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(41935..44241) product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816272.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 44562..45467 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816367.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(45502..46668) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705732.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 sequence029 source 1..46370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..1731) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525720.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(2511..3284) product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene sseB CDS complement(3321..4607) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene pepB CDS complement(5029..6243) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene iscS CDS complement(6404..6898) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene iscR CDS complement(7052..7780) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940018.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene trmJ CDS 7901..8704 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553451.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene suhB CDS complement(8743..9747) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081833.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(9738..10397) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098298.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 10581..11807 product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703176.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene csiE CDS complement(11875..13128) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919178.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(13460..13798) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231018.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene glnB CDS complement(14050..15387) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene glrR CDS complement(15384..16148) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446608.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene qseG CDS complement(16152..17579) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049561091.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(18186..22076) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970087.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene purL CDS 22344..23801 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene mltF CDS complement(23809..24306) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene tadA CDS complement(24390..25025) product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098310.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene yfhb CDS complement(26683..26961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(26971..27930) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974240.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(28080..28511) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 28611..29531 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 29870..31249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(31330..31581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 31854..32108 product 4Fe-4S dicluster ferredoxin YfhL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196297.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene yfhL CDS complement(32111..32491) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene acpS CDS complement(32491..33222) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815755.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene pdxJ CDS complement(33300..34037) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209680.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene recO CDS complement(34045..34953) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159414.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene era CDS complement(34950..35630) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068343.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene rnc CDS complement(35767..36741) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002559.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene lepB CDS complement(36751..38550) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172749.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene lepA CDS complement(38792..39148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(39259..40221) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812041.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene rseB CDS complement(40221..40871) product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168379.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene rseA CDS complement(40901..41476) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176728.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene rpoE CDS 41944..43563 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094491.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene nadB CDS complement(43545..44285) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098325.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 44418..45743 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene srmB sequence030 source 1..46219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 670..1248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 1541..2341 product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 2552..2755 product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859519.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene tatE CDS complement(2912..3877) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004712243.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene lipA CDS complement(4052..4744) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218201.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene lipB CDS complement(4796..5059) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210322.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene ybeD CDS complement(5257..6468) product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167886.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene dacA CDS complement(6817..7917) product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167887.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene rlpA CDS complement(7928..9052) product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene mrdB CDS complement(9049..10953) product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene mrdA CDS complement(10985..11455) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210328.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene rlmH CDS complement(11459..11776) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene rsfS CDS complement(11805..12035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(12091..12744) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210330.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene nadD CDS complement(12737..13768) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210331.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene holA CDS complement(13765..14361) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene lptE CDS complement(14376..16958) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210333.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene leuS CDS 17196..17678 product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831082.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 17830..18141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 18407..20074 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene menD CDS 20071..20841 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210246.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene menH CDS 20868..21725 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640013.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene menB CDS 21725..22693 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210244.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene menC CDS 22681..24057 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298357.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene menE CDS complement(24106..25542) product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175627974.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene katA CDS 25904..27100 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171600.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(27199..27927) product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365620.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene ubiG CDS 28105..30741 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098009.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene gyrA CDS complement(30886..31503) product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 31941..34733 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene rcsC CDS complement(34813..35463) product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210824.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene rcsB CDS complement(35456..38125) product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619743.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene rcsD tRNA complement(36178..36250) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(38150..39325) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210825.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 40050..41168 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171545.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 41616..42539 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784304.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene apbE CDS 42642..43274 product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365631.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene alkB CDS complement(43341..44075) product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213120.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(44167..44388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095877.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 44630..45496 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208318.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 sequence031 source 1..45999 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(370..2028) product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095079.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene actP CDS complement(2028..2336) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999620.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(2512..4467) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078206.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene acs CDS 5185..6486 product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene gltP CDS 6452..7459 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817228.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene murQ CDS complement(7481..8704) product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301663.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene sbmA CDS complement(8910..10313) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366510.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 10492..10902 product SMR family multidrug efflux protein EmrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070440.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene emrE CDS 11434..12693 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206429.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 12703..14613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533061.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 14727..15464 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817006.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(15702..16679) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095798.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene hemB CDS complement(16859..18364) product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296882.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene proP CDS complement(18650..19615) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(19861..20094) product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882582.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(20139..20675) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069273.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 note possible pseudo, frameshifted CDS 21070..22281 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703713.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(22458..23168) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157438.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 note possible pseudo, frameshifted CDS complement(23378..25300) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050164505.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene iolC CDS complement(25634..26740) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168094.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(26749..27876) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070131.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(27873..29609) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(29602..30594) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704812.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene hlyD CDS complement(30873..31433) product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245277.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(31559..32227) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815353.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 32465..32713 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215973.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene tusA CDS complement(32783..33412) product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 33601..33969 product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815355.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(34099..34374) product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163952.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(34364..34966) product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene rsmD CDS 35155..36468 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099141.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene ftsY CDS 36465..37133 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211504.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene ftsE CDS 37123..38106 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084329.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene ftsX CDS 38379..39236 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500093.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene rpoH CDS complement(39320..39715) product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703707.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene panM CDS 40166..41281 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163937.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 41479..42405 product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211509.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene livH CDS 42402..43676 product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369324.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene livM CDS 43673..44440 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082101.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene livG CDS 44442..45155 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099128.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene livF misc_feature complement(45194..>45999) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044973.1:formylglycine-generating enzyme family protein locus_tag LOCUS_18340 sequence032 source 1..44797 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 552..1466 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365554.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene accD CDS 1538..2806 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706173.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene folC CDS 2796..3692 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171804.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene dedD CDS 3930..4433 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene cvpA CDS 4470..5987 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098134.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene purF CDS 6202..6771 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825691.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene ubiX CDS 7047..7829 product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365563.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene hisJ CDS 7906..8592 product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365564.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 8589..9305 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502590.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 9314..10087 product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171791.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene hisP CDS complement(10153..11046) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(11160..11786) product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene yfcG CDS 11975..12616 product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042440.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene yfcF CDS 12900..13445 product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene yfcD CDS complement(13584..15725) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082007.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene pta CDS complement(15794..16996) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095707.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene ackA CDS 17333..17785 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171754.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene yfbV CDS 17936..18430 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159196.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 18444..19103 product hexitol phosphatase HxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203403.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene hxpA CDS 19182..20999 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082012.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(21073..21672) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098110.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene yfbR CDS complement(21936..23207) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098109.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene alaA CDS 24152..25078 product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881734.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene lrhA CDS 25744..26181 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene nuoA CDS 26197..26871 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene nuoB CDS 26993..28792 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247855.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene nuoC CDS 28795..29310 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545038.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene nuoE CDS 29307..30653 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861487.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene nuoF CDS 30795..33518 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706161.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene nuoG CDS 33515..34492 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365589.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene nuoH CDS 34505..35047 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172747.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene nuoI CDS 35058..35612 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393511.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene nuoJ CDS 35609..35911 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159229.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene nuoK CDS 35908..37743 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832758.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene nuoL CDS 37872..39392 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926441.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene nuoM CDS 39399..40856 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815945.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene nuoN CDS 41037..41486 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365596.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(41693..43297) product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081955.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 sequence033 source 1..44575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(3..79) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(84..160) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(290..1663) product MdtK family multidrug efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096934.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene mdtK CDS 1885..2532 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096933.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(2618..3766) product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098902.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene cfa CDS complement(4198..5223) product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210943.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene purR CDS 5391..5591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(5709..6596) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169450.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 7073..7405 product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108176.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene grxD CDS complement(7627..8307) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096924.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene rnt CDS complement(8410..8817) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165939.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene gloA CDS complement(9004..10104) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816376.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(10146..10745) product DNA-binding transcriptional regulator NemR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032947.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene nemR CDS complement(10916..11560) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705819.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 11667..12596 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705820.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(12676..14697) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169471.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(14705..15562) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096915.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 15959..16396 product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078997.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene slyA CDS complement(16444..16911) product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597179.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene slyB CDS 17196..18314 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096911.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene anmK CDS 18380..18694 product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218323.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 18761..19417 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene pdxH CDS 19550..20824 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene tyrS CDS 20891..21751 product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165910.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene pdxY CDS complement(21834..22439) product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene gstA CDS 22891..24312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 note possible pseudo, frameshifted CDS 24263..24454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 note possible pseudo, frameshifted CDS complement(24673..25308) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene nth CDS complement(25305..26003) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169892.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(25996..26628) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210600.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene rsxG CDS complement(26633..27691) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene rsxD CDS complement(27692..29830) product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124232787.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene rsxC CDS complement(29823..30401) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096899.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene rsxB CDS complement(30401..30982) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133193.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene rsxA CDS complement(31106..31549) product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816280.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(31654..31869) product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217950.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene ydgT CDS complement(32128..32757) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812213.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 33049..33900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 33910..35022 product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 35038..36591 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 36605..37549 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066663.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 37558..38364 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066662.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 38364..40007 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970010.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 40112..41152 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096894.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(41564..42364) product IS110-like element IS1618 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 note possible pseudo, internal stop codon CDS complement(42743..43138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(43141..44319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 sequence034 source 1..43408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 375..1397 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816078.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene mltG CDS 1387..2019 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213082.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene tmk CDS 2220..3002 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830395.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene holB CDS 3030..3824 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097114.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 3952..5388 product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157966.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene ptsG CDS complement(5473..6129) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703367.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 6487..6978 product VSPR family DNA mismatch endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785988.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene vsr CDS complement(7135..7281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 7348..7623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 7638..8549 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922685.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(8634..8858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(9125..10216) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 10881..19457 product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705673.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(19545..19784) product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369996.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(19808..21232) product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863165.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 21634..22044 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703289.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 22267..22617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 22784..23092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(23184..24827) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972717.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 25260..25739 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972716.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 25981..27312 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 27385..29055 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 29176..30123 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 30134..31015 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972711.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 31079..31783 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972715.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(31831..32556) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091922.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(32563..33396) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104191.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(33398..34375) product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 34936..35874 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202597.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 35864..37417 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268053.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 37414..38421 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205509.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 38414..39400 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205508.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(39546..40484) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705475.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(40510..41280) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705474.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(41277..42047) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705473.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(42047..42748) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene tenA sequence035 source 1..41319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..996 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704428.1:ATP-dependent helicase HrpB locus_tag LOCUS_19540 CDS 1106..3571 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene mrcB CDS complement(3644..4924) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167221.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene hemL CDS 5274..5621 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene erpA CDS complement(5693..6493) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704438.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene btuF CDS complement(6486..7184) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene mtnN CDS 7283..8773 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene dgt CDS 8926..10365 product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753942.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene degP CDS complement(10576..10968) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164058.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(11317..12141) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene dapD CDS complement(12261..14909) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095651.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene glnD CDS complement(15052..15843) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266399.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene map CDS 16177..16902 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246882.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene rpsB CDS 17109..17960 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173227.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene tsf CDS 18104..18835 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164053.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene pyrH CDS 18974..19531 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368165.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene frr CDS 19667..20869 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811923.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene ispC CDS 21055..21807 product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028110.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene ispU CDS 21826..22683 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095657.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene cdsA CDS 22697..24052 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene rseP CDS 24103..26508 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene bamA CDS 26574..27131 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816966.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene skp CDS 27134..28159 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368156.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene lpxD CDS 28317..28772 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210739.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene fabZ CDS 28776..29564 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173176.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene lpxA CDS 29569..30717 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139667.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene lpxB CDS 30710..31309 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569412.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene rnhB CDS 31373..34855 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294791.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene dnaE CDS 34868..35827 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391685.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene accA CDS 36169..36558 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 36618..37922 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176578.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene tilS CDS complement(38001..38264) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368146.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene rof CDS complement(38251..38451) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212152.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 38587..39141 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173162.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 39114..39548 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635537.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene arfB CDS complement(39676..40659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 40643..40867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 sequence036 source 1..41294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(271..645) product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(642..866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(994..1437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(1776..2432) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365553.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(2470..3273) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192683.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene truA CDS complement(3273..4283) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209726.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(4409..5545) product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120453040.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene pdxB CDS 5837..6850 product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209721.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene flk CDS complement(6973..8166) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 8795..9781 product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210043.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 9882..11381 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210044.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 11374..12360 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210045.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 12362..13315 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210046.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 13334..14971 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(15058..16275) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene fabB CDS 16433..18445 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene mnmC CDS complement(18493..18813) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098147.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(18807..19355) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089220.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene epmC CDS complement(19549..20352) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209713.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(20362..21186) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750429.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene mepA CDS complement(21191..22276) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene aroC CDS complement(22300..23232) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098152.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene prmB CDS 23444..23992 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098153.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene smrB CDS complement(24065..24547) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365538.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene sixA CDS complement(24719..26875) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425046.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene fadJ CDS complement(26879..28189) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531990.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene fadI CDS complement(28364..28660) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227845.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 29061..30344 product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420287.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene fadL CDS complement(30423..31184) product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209701.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene mlaA CDS complement(31220..32434) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815901.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene ccmI CDS complement(32431..32895) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703210.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(32895..33449) product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene dsbE CDS complement(33446..35401) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158627.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(35398..35880) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158631.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene ccmE CDS complement(35873..36109) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815899.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene ccmD CDS complement(36106..36849) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815898.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(36909..37568) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815897.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene ccmB CDS complement(37553..38191) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene ccmA tRNA 38586..38660 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(39054..39443) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 sequence037 source 1..37905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 55..378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 379..576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 959..1792 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182015315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 1807..2634 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704527.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 2618..3424 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 3414..4097 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704525.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 4578..5591 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807522.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 5588..6034 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809022.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 6037..7680 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529488.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 7684..8649 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389766.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 8650..9534 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968090.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 9654..11195 product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064659.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(11332..12399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(12399..13670) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973043.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(13667..15691) product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061689.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene fhuB CDS complement(15688..16629) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821935.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(16626..17453) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(17504..19951) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974567.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(20173..21195) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836262.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(21296..21805) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836263.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(22234..23280) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853200.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(23291..24604) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(24703..25974) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(26433..27380) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814047.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(27432..28316) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126955.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(28335..29483) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096618.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 29720..30991 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410744.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 30984..31964 product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096616.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 31971..32732 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366720.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 33197..33805 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479655.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 33982..34749 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198602.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 34755..35444 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740602.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 35441..36133 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103715.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 36157..37041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(37115..37303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(37352..37645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 sequence038 source 1..37579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..2414) product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953444.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene fhuE CDS complement(2680..3165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 note possible pseudo, internal stop codon CDS 3339..3566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(3741..4280) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene ssb1 CDS complement(4313..4510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 4509..7337 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368747.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene uvrA CDS 7673..8737 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198300.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(8812..9156) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155657.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(9325..10518) product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene tyrB CDS complement(10669..12075) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067434228.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene dnaB CDS 12180..13163 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209094.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(13384..14163) product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098381.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 15118..16122 product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene iolG CDS 16124..17083 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153439942.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(17171..17950) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(17947..18711) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974810.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(18722..19738) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315613.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 20419..21447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 21444..22832 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099324.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 23122..23826 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 23829..24722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(24946..25377) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705656.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(25424..26347) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(26344..27144) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(27157..28422) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222248.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(28434..28721) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 28835..29674 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 29839..30423 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206572.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(30515..31546) product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 31870..32766 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366436.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 32763..33689 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726715.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 33682..34305 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 note possible pseudo, internal stop codon CDS 34472..36772 product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 misc_feature complement(36847..>37579) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039574.1:Ldh family oxidoreductase locus_tag LOCUS_20990 sequence039 source 1..37558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(490..924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 note possible pseudo, internal stop codon, frameshifted CDS complement(925..1287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 note possible pseudo, internal stop codon CDS complement(1345..1767) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002940.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene rraB CDS 1930..2940 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene argF CDS 3195..4130 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095365.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene pyrB CDS 4147..4608 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148583.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene pyrI CDS 4647..5033 product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162498.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene ridA CDS 5366..6226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 note possible pseudo, internal stop codon CDS 6296..7024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 note possible pseudo, internal stop codon CDS 7208..9349 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187798.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene nrdD CDS 9346..9840 product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095356.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene nrdG CDS 10043..10960 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312133.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 11100..12614 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385764.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 12651..14243 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538185.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 14206..15318 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385765.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 15315..16250 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385766.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 16243..17109 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008282.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 17106..17864 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385768.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 17875..18792 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 18792..20099 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538186.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(20107..20532) product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080672.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 20631..20930 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156248.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(20914..21420) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098905.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(21414..21938) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815454.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 22142..23137 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098907.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 23146..24033 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309784.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 24162..25169 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130415.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(25351..27252) product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305131.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene deaD CDS complement(27419..28336) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098912.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene nlpI CDS complement(28431..30557) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369529.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene pnp CDS complement(30869..31138) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene rpsO CDS complement(31246..32190) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098915.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene truB CDS complement(32190..32621) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene rbfA CDS complement(32659..35346) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703597.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene infB CDS complement(35364..36851) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369524.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene nusA CDS complement(36877..37329) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833432.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene rimP sequence040 source 1..36654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(476..988) product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233466.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene cpxP CDS 1141..1839 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033719.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene cpxR CDS 1836..3209 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368938.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene cpxA CDS 3248..3724 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094923.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene trmL CDS complement(3792..4613) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene cysE CDS complement(4686..5705) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene gpsA CDS complement(5705..6166) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003370.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene secB CDS complement(6214..6465) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene grxC CDS complement(6485..6916) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094920.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 7566..8756 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216228.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene envC CDS 8760..9665 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135520.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 9880..11112 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023331731.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 11105..12016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111964309.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 12199..13131 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815275.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene rfaD CDS 13149..14210 product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094907.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene rfaF CDS 14198..15175 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815273.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene rfaC CDS 15183..16094 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094904.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(16126..16404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 note possible pseudo, internal stop codon CDS complement(16575..17549) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094902.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(17695..17880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 18067..19155 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703805.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 19237..20313 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094905.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 20329..21336 product UDP-glucuronate:LPS(HepIII) glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982122.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene waaH CDS 21409..22485 product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094901.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene rfaQ CDS 22478..23614 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 23704..24978 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094897.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene waaA CDS 24979..25758 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208987.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 25755..26231 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703808.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene coaD CDS complement(26270..27079) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208989.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene mutM CDS complement(27155..27322) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208990.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene rpmG CDS complement(27334..27570) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164747.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene rpmB CDS complement(27860..28522) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene radC CDS 28714..29925 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050149.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene coaBC CDS 29903..30361 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976070.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene dut CDS 30723..31274 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094890.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene slmA CDS complement(31280..31759) product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(31752..33803) product DUF4401 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209756.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(33837..34478) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094889.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene pyrE CDS complement(34569..35300) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247078.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene rph CDS 35631..36494 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094887.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 sequence041 source 1..36387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(377..2062) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174873167.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(2077..3633) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704356.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene hutH CDS 3942..4697 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211280.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene hutC CDS 5253..5594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 5663..5884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(6138..6680) product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097026.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene ves CDS complement(6677..8032) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816556.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 8120..9337 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211281.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene hutI CDS 9334..10125 product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169047.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene hutG CDS complement(10292..10549) product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210240.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(10717..11349) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704818.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 11477..12406 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704819.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene rlmF CDS complement(12425..12688) product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097470.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(12767..13270) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704821.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene dps CDS complement(13742..14560) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097462.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene rhtA CDS 15005..15520 product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097460.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene ompX CDS 16353..16814 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091019.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene mntR CDS 17171..18748 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367567.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(18810..20351) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038812.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(20602..21381) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829250.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene moeB CDS complement(21383..22618) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397340.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene moeA CDS 22852..23817 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704837.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene iaaA CDS 23827..25704 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065127.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 25756..27294 product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097435.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene gsiB CDS 27347..28267 product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936066.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene gsiC CDS 28277..29182 product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097433.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene gsiD CDS 29509..29913 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859689.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene ybgC CDS 29910..30596 product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097532.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene tolQ CDS 30610..31038 product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393306.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene tolR CDS 31067..32326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 32459..33751 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165502.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene tolB CDS 33755..34315 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859700.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene pal CDS 34325..35131 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165506.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene cpoB tRNA 35295..35370 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 35447..35522 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 35714..35944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 sequence042 source 1..34489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1205..1366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(1535..2302) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 2971..3648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 note possible pseudo, internal stop codon CDS 3933..5543 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115437.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 5568..6482 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524222.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene ppk2 CDS complement(6664..8715) product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306080.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene dcp CDS complement(8849..10195) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097233.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene guaD CDS 10385..11149 product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366753.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene ydfG CDS complement(11221..11550) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921383.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 11809..12096 product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066440.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 12148..12444 product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165762.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(12536..13198) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366772.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene bioD CDS complement(13325..14545) product ROK family transcriptional regulator Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169799.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene mlc CDS complement(14692..15591) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705289.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 15689..16945 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091829.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(16997..18394) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096878.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene fumC CDS 18597..19772 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096880.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene manA CDS 19913..21415 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705246.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(21433..22464) product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169835.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene malI CDS 22661..24247 product maltose/glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816293.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene malX CDS 24301..25473 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046052024.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 25605..26603 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565566.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene add CDS complement(26622..27575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(27785..28150) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311244.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(28150..28422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069541.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(28654..29352) product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524693.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene hutG note possible pseudo, internal stop codon, frameshifted CDS complement(29432..30811) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527395.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(30870..31649) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811719.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(31649..32335) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811721.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(32379..33134) product glutamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930601.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(33179..33874) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926578.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 sequence043 source 1..34176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(164..517) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(652..1440) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269155.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 tRNA 1862..1937 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 1981..2056 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(2123..3730) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113365.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(3723..4313) product 3-mercaptopropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113364.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(4313..5284) product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113358.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(5284..6366) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138358771.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(6473..7381) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767686.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 7528..8448 product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974800.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 8450..9757 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974868.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(9816..11003) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098187.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 11367..12605 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131734.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(12625..12876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 13305..14270 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170346.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene glk CDS 14725..15252 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391901.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 15372..16607 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098178.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene alaC CDS complement(16902..17930) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114760.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(17933..19531) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114761.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 19753..20532 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 20551..21003 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114763.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 21104..21856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 22080..22361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(22589..22957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 note possible pseudo, frameshifted CDS complement(23011..23286) product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228052.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(23528..23722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(23942..24679) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212239.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene lpxH CDS complement(24679..25173) product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095923.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene ppiB CDS 25415..26800 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222677.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene cysS CDS complement(27015..28040) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224898.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 28312..28563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(28788..28964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(29553..30806) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817956.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(30871..31794) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene dapA CDS complement(31926..32702) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 32828..33877 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099539.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 sequence044 source 1..34174 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 511..1296 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840119.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene otsB CDS 1301..2737 product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089042.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene otsA CDS complement(2821..3240) product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene uspC CDS complement(3366..5096) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025331.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene argS CDS 5730..6290 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096073.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 6651..7403 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211209.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene cutC CDS complement(7613..8179) product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366764.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene speG CDS 8552..9415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(9551..10519) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816529.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene cmoB CDS complement(10516..11319) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096076.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene cmoA CDS complement(11419..12243) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705960.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(12282..12851) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705959.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 13168..14946 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705958.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene aspS CDS 14948..15382 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653696.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene nudB CDS 15510..16253 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211202.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 16297..16821 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974712.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene ruvC CDS 16895..17509 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene ruvA CDS 17518..18525 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene ruvB CDS complement(18597..19382) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571518.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene znuB CDS complement(19379..20134) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene znuC CDS 20212..21159 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096089.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene znuA CDS 21333..22511 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene mepM CDS 22736..23707 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032705956.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene lpxM CDS complement(23854..25296) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene pyk CDS complement(25450..26319) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056719.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 26685..28160 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301727.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene zwf CDS 28422..29060 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800493.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene kdgA CDS complement(29112..30290) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419918.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene purT CDS complement(30529..31194) product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944282.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene exoX CDS complement(31238..31468) product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366007.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 31775..32653 product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705947.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene copD CDS 32714..33055 product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096105.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 33687..34031 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422760.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 sequence045 source 1..34115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 139..489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 594..857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(776..2272) product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097232.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 2416..3147 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097231.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 3135..3872 product allantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097230.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene hpxA CDS 3955..4914 product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097229.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene puuE CDS complement(4954..5337) product oxalurate catabolism protein HpxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705418.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene hpxZ CDS complement(5342..6736) product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208739.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(6733..6918) product oxalurate catabolism protein HpxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097226.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene hpxX CDS complement(6931..8517) product oxamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705415.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene hpxW CDS 8685..9524 product MurR/RpiR family transcriptional regulator HpxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097225.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene hpxU CDS 9721..10494 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446864.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 10504..11169 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705412.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 11166..11825 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689664.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 11806..12543 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097221.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 12589..13827 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419062.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 13827..15095 product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097219.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene hpxK CDS complement(15214..15981) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704468.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(15969..17129) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097611.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 17828..18904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(19006..21456) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973055.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene fadE CDS 21682..22260 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004099149.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene lpcA CDS 22355..23122 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208719.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(23093..23833) product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene dpaA CDS 24093..25148 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704475.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene dinB CDS complement(25282..26739) product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292984.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene pepD CDS 27073..27531 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889733.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene gpt CDS 27640..28887 product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095741.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene frsA CDS 28945..29346 product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174696.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene crl CDS 29695..30798 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167536.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene proB CDS 30808..32061 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704510.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene proA tRNA 32161..32236 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 32412..33626 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772650.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 sequence046 source 1..31694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(466..1500) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(1512..3275) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121537498.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(3325..4410) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970337.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(4523..6898) product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705740.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 7643..8563 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920469.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 9052..9243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 9392..10105 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816375.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 10105..11868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 11858..12655 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171842.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 12987..14252 product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107493.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 14441..15349 product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236427.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 15524..17074 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536654.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 17088..18077 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969807.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 18121..18939 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528250.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 18932..20572 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536648.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(20598..21326) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379556.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(21383..22147) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104269.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(22152..22847) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104270.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(22880..23632) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104271.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(23632..23838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(23814..24251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(24639..25562) product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101817188.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene nac CDS 26041..27267 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395882.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(27409..28179) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395884.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(28209..29195) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(29192..29902) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395888.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene pxpB CDS complement(29906..30745) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379555.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 sequence047 source 1..31146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(623..1402) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530487.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(1579..2565) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173753.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 2857..4023 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366979.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 4036..5028 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815950.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(5055..6020) product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386538.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene ybiB CDS complement(6022..8202) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704815.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene dinG CDS complement(8295..8933) product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704095.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene leuE CDS complement(9305..9835) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890634.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene idi CDS complement(10022..11131) product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210785.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(11219..12091) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266655.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(12192..14489) product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene bglX CDS 14665..16410 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097938.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene dld CDS complement(16534..19014) product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298473.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(19305..20255) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097940.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene pbpG CDS complement(20436..21023) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017057.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 21230..21805 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955285.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 22218..23414 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689864.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene ldtB CDS 24271..25533 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 25535..27655 product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105688.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(27686..28618) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706102.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene dusC CDS complement(28755..30089) product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007092.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene rhlE CDS complement(30333..30725) product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704808.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 sequence048 source 1..31031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(311..1606) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095114.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(2213..3058) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227679.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(3239..5218) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930025.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(5208..7268) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038771.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(7284..7733) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(7900..8406) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555947.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(8549..9865) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103055.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene gabT CDS complement(9994..11118) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820761.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(11120..12046) product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(12046..12897) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446937.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(12907..14238) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973451.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(14386..16047) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103050.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(16044..16895) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153436039.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(16895..17848) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771075.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(17866..19470) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401719.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(19503..20780) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103048.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(20800..21471) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612858.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(21517..22989) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973008.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(23637..25094) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(25286..26242) product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705998.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene cbl CDS complement(26498..27415) product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432103.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene nac CDS complement(27707..28741) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380853.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(28757..30241) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392224.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 sequence049 source 1..30282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(63..1787) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425651.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene ilvI CDS 2734..4302 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095562.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene leuA CDS 4299..5396 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042324.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene leuB CDS 5399..6799 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167044.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene leuC CDS 6809..7414 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025800380.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene leuD CDS 7604..9265 product DNA-binding transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640096.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene sgrR CDS 9501..10487 product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640095.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene thiB CDS 10463..12073 product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235671.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene thiP CDS 12057..12758 product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704381.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene thiQ CDS complement(12773..13537) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148377.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(13631..14023) product DUF4150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366584.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(14034..14645) product DUF3540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705433.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(14658..15728) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705434.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(15725..18265) product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705435.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(18446..18802) product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705439.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(18811..21258) product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705445.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene tssI CDS 21870..24236 product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035641.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene polB CDS 24367..27273 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117038.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene rapA CDS 27273..27992 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525176.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene rluA CDS complement(28044..28871) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167009.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene djlA sequence050 source 1..29988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(311..904) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(1264..1593) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004706812.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene zapA CDS 1834..2346 product UPF0149 family protein YgfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640201.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene ygfB CDS 2434..3756 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209952.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene pepP CDS 3753..4931 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052899460.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene ubiH CDS 4945..6147 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192216.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene ubiI CDS 6626..7720 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068693.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene gcvT CDS 7746..8132 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173499.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene gcvH CDS 8189..11092 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209947.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene gcvP CDS 11322..11975 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863433.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(12017..13000) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703421.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene ygfZ CDS 13207..13485 product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098615.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene sdhE CDS 13466..13861 product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244781.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(13908..14426) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055874.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene fldB CDS 14535..15428 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173453.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene xerD CDS 15454..16158 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817020.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene dsbC CDS 16165..16326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 16353..17894 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173449.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene recJ CDS 18218..19099 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989230.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene prfB note possible pseudo, frameshifted CDS 19109..20629 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369798.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene lysS CDS 21063..22094 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168576.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 22161..24236 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168575.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 24247..25320 product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816658.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene fbpC CDS complement(25390..26013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 26541..27704 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209848.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(27680..28621) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703333.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 sequence051 source 1..29374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..602 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000487668.1:lysophospholipase L2 locus_tag LOCUS_24590 CDS 676..1476 product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038628922.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene yigL CDS complement(1540..2595) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098017.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene glpQ CDS complement(2608..3954) product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365615.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene glpT CDS 4356..5219 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703990.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(5226..5705) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409371.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(5805..6743) product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211525.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene metR CDS 6900..9176 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176312.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene metE CDS complement(9227..10063) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099243.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 10419..11180 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181652.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene udp CDS 11361..12890 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211532.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene rmuC CDS 12965..13720 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224024.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene ubiE CDS 13733..14338 product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099240.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene ubiJ CDS 14335..15972 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099239.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene ubiB CDS 16093..16341 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099238.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene tatA CDS 16350..16883 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene tatB CDS 16886..17650 product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368842.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene tatC CDS 17741..18523 product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815374.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene tatD CDS complement(18592..19080) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192400.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene rfaH CDS 19351..20835 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368839.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene ubiD CDS 20879..21580 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807928.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene fre CDS complement(21660..22823) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099231.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene fadA CDS complement(22834..25020) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703999.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene fadB CDS 25206..26537 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444545.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene pepQ CDS 26537..27154 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378910.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 27185..28636 product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545661.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene trkH CDS 28659..29195 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368833.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene hemG sequence052 source 1..28954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 note possible pseudo, internal stop codon CDS 761..1231 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210173.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene argR CDS 1849..2112 product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210172.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene yhcN CDS 2205..2474 product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175416.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene yhcN CDS complement(2700..4664) product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369470.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene aaeB CDS complement(4677..5609) product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098978.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene aaeA CDS complement(5618..5821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 6104..7021 product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098979.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene aaeR CDS complement(7077..8522) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174328.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene tldD CDS complement(8587..12357) product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253536.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene yhdP CDS complement(12750..14219) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123197.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene rng CDS complement(14209..14802) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(14811..15299) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210077.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene mreD CDS complement(15296..16432) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802540.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene mreC CDS complement(16404..17447) product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene mreB CDS complement(17762..19696) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241469.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene csrD CDS 19863..20840 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210074.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 21109..21555 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174343.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene aroQ CDS 21583..22044 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene accB CDS 22056..23261 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817284.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene accC CDS 23258..23404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 note possible pseudo, frameshifted CDS 23481..23723 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340020.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 23713..25167 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175744.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene panF CDS 25179..26060 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145827.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene prmA CDS 26495..27367 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene dusB CDS 27392..27688 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210061.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene fis CDS complement(28199..28639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 sequence053 source 1..27986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(118..2748) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211927.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene tssH CDS complement(2930..3421) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210014.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(3517..5175) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243153.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(5190..5834) product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710992.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene tssL CDS complement(5831..7168) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686687.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene tssK CDS complement(7315..8853) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214707.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene tssC CDS complement(8887..9384) product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213014.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene tssB CDS 9383..9577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(10286..11437) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 11725..12405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 12795..13571 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(13720..14367) product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440828.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene fucA CDS 14937..16247 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528619.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene fucP CDS 16279..18054 product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724126.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene fucI CDS 18109..19527 product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763972.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene fucK CDS 19529..19951 product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920840.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene fucU CDS 19992..20747 product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642344.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene fucR CDS 20835..21563 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 21663..22328 product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175148.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene yieH CDS 22460..23788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 note possible pseudo, internal stop codon CDS 23855..24511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 24953..25369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 25366..26823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25350 note possible pseudo, frameshifted CDS 26814..27446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 note possible pseudo, frameshifted sequence054 source 1..27754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 704..1807 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974269.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 1833..2612 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197330.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(2659..2844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 2927..4111 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528042.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(4256..5218) product Ni(II)/Co(II) efflux transporter permease subunit NcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196366.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 5463..5768 product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019953.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene rcnR CDS complement(5907..6692) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064849.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(6744..7640) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047183.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 7831..8643 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974708.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 8673..9398 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313622.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 9395..10141 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313623.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 10155..11330 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 11327..12430 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974706.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 12414..13583 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974705.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 13593..14516 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642619.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene dapA CDS complement(14500..15600) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974704.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 15669..16883 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817956.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(17485..18753) product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032715566.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(19050..19634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 20294..21436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 21452..22738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 22787..23518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207465.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 24481..25410 product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972408.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene thiO CDS 25410..25541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 25609..26373 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529413.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 26370..27347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 sequence055 source 1..27630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..873 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098937.1:arabinose-5-phosphate isomerase KdsD locus_tag LOCUS_25630 CDS 888..1454 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene kdsC CDS 1451..2026 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369495.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene lptC CDS 2010..2549 product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669770.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene lptA CDS 2555..3280 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene lptB CDS 3314..4765 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703606.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene rpoN CDS 4790..5077 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098943.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene hpf CDS 5296..5781 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609332.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene ptsN CDS 5852..6706 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369491.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene rapZ CDS 6703..6975 product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162489.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene npr CDS complement(6972..7694) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210144.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene mtgA CDS complement(7691..7873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(8567..10513) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817254.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene arcB note possible pseudo, internal stop codon CDS complement(10526..10909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 note possible pseudo, internal stop codon CDS 11908..17439 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651396.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 17463..19265 product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970681.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(19390..19872) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366129.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene sspB CDS complement(19879..20019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 note possible pseudo, internal stop codon CDS complement(20029..20520) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210135.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene sspA note possible pseudo, internal stop codon CDS complement(20856..21248) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene rpsI CDS complement(21264..21692) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene rplM CDS complement(21938..23065) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191224.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene zapE CDS 23231..23635 product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295270.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene zapG CDS 23760..25127 product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817258.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene degQ CDS 25222..26283 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098970.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene degS CDS complement(26363..27298) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861588.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene mdh sequence056 source 1..27450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(504..1241) product IclR family transcriptional regulator BlcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974399.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene blcR CDS 1417..2871 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974400.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 2905..4071 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974401.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 4113..4904 product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019565706.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 5145..6566 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112617.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(6590..7795) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388890.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(7855..9162) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972973.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(9179..10183) product hydroxycarboxylate dehydrogenase HcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120415.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene hcxA CDS 10686..11483 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 11652..13034 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345327.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene purB CDS 13031..13564 product sulfur-containing aminoacid acetyltransferase SnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242734.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene snaB CDS 13584..14372 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 14438..15109 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243465.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 15119..15880 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243284.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 15958..17112 product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157892.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(17187..19253) product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208882.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(19515..20000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 20486..21397 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198844.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 21612..22658 product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 22663..23346 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081171.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(23635..24411) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171844.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene surE CDS 24737..25078 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209688.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 25235..25744 product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene pncC CDS 25825..26898 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209446.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene recA CDS complement(26986..27204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 note possible pseudo, internal stop codon sequence057 source 1..27363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(184..1035) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420807.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene murI CDS complement(980..2854) product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703958.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene btuB CDS 3231..4334 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368905.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene trmA CDS complement(4386..4733) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501783.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(4754..5395) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163800.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene fabR CDS 5573..6988 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120810.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene sthA CDS complement(6971..7888) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025919.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene oxyR CDS complement(8302..9678) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230038.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene argH CDS complement(9796..11010) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874007.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(11036..11812) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686923.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene argB CDS complement(11833..12837) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815301.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene argC CDS 13017..14168 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309894.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene argE CDS 14414..17065 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368915.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene ppc CDS complement(17121..18020) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007509.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene metF CDS complement(18295..20730) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208934.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(20733..21893) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368924.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene metB CDS 22159..22476 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852811.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene metJ CDS complement(22545..22757) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715284.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene rpmE CDS 22970..25165 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815293.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene priA CDS 25376..26422 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368928.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene cytR sequence058 source 1..26291 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1078..3051) product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209560.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene hmsP CDS complement(3318..4325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(4329..4775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(4778..8719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(8729..11164) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602570.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene bcsB CDS complement(11161..13263) product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770918.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene bcsA CDS complement(13441..14202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(14229..14789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(15238..16230) product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103574.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene dppF CDS complement(16220..17212) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703765.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene dppD CDS complement(17219..18121) product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209563.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene dppC CDS complement(18135..19154) product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174906.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene dppB CDS complement(19366..20979) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418419.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 tRNA complement(21749..21825) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(21957..23636) product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817403.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene eptB CDS complement(23909..24526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095513.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(24683..25021) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(25450..26103) product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228082.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 sequence059 source 1..25485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(153..701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(762..1226) product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466823.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(1255..2124) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015241121.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(2149..3279) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413981.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(3296..4048) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525108.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(4048..5664) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(5661..9023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 9615..11057 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228258.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(11105..11746) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 11925..12419 product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525781.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(12452..12616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 13036..14538 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120833.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 14532..16136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 16209..17231 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449622.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(17566..18333) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(18414..19454) product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197408.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene idnD CDS complement(19487..20800) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496901.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(20853..22001) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703894.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene dgoD CDS complement(21998..22615) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094785.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(22599..23483) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(23480..24178) product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861109.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene dgoR CDS complement(24657..25283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 sequence060 source 1..25411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(81..157) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 364..1515 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678621.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene mltA CDS 1574..2386 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703318.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene tcdA CDS complement(2419..2859) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184261.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene csdE CDS complement(2856..4067) product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703316.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene csdA CDS 4423..4647 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166349.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 4943..5902 product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene gcvA CDS 5902..6351 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369946.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 6344..7444 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212119.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene rlmM CDS complement(7540..7845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 note possible pseudo, frameshifted CDS complement(8384..9748) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene ppnN CDS complement(9935..10780) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100435.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene queF CDS 10896..11441 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369954.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene syd CDS 11899..12147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 12144..12353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 note possible pseudo, frameshifted CDS 12468..12914 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807735.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 13038..14177 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098521.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(14278..17010) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene barA CDS 17173..18489 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098519.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene rlmD CDS 18523..20760 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167242.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene relA CDS 20908..21690 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703306.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene mazG CDS 21663..21869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 21957..23594 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167247.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene pyrG CDS 23673..24968 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036723.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene eno sequence061 source 1..25268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..239 product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908860.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(447..1388) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165628.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(1461..1877) product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096952.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene sufE CDS complement(1911..3134) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143859.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene sufS CDS complement(3131..4411) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096954.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene sufD CDS complement(4386..5165) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096955.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene sufC CDS complement(5183..6679) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705129.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene sufB CDS complement(6688..7062) product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165616.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene sufA CDS 7454..7858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(7892..8317) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169420.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(8317..11370) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419180.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 11641..12774 product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096976.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene ydiK CDS complement(13221..15605) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069375.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene ppsA CDS 16129..16962 product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620693.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene ppsR CDS 17355..17621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 note possible pseudo, frameshifted CDS 17666..18013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 note possible pseudo, internal stop codon, frameshifted CDS 18023..18220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 note possible pseudo, internal stop codon CDS 18696..19742 product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419178.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene aroH CDS complement(19860..21263) product multidrug efflux MFS transporter NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722177.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(21349..22521) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366269.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 22841..25162 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705665.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 sequence062 source 1..25090 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 823..2250 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816708.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene sbcB CDS 2413..3024 product YkoF family thiamine/hydroxymethylpyrimidine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368488.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(3299..4369) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309930.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 4435..4803 product IS200/IS605-like element IS609 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604943.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene tnpA CDS complement(4912..5796) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208318.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(5793..7241) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393205.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 7592..9082 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196023.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 9294..9479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(9426..11051) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 11411..12214 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806976.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 12211..12987 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 13010..13993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 14002..15669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 16206..17201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 17198..17998 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393480.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 17998..18753 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810701.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 18763..19443 product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400923.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene nthB CDS 19455..20072 product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879389.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene nthA CDS 20069..20455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 20452..21168 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081171.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 21165..22214 product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266608.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 22274..23188 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245546.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(23123..23707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(23824..24732) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113788.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 sequence063 source 1..24886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..1058) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098288.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene sseA CDS 1309..4980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 note possible pseudo, internal stop codon CDS 5014..6279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 note possible pseudo, internal stop codon CDS 6313..8637 product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703167.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene pbpC CDS 8820..9251 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963841.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene ndk CDS 9441..10610 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003206.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 10707..11444 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172603.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene pilW CDS 11434..12444 product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098278.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene rodZ CDS 12485..13606 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene ispG CDS 13683..14993 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159557.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene hisS CDS 15033..15650 product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409203.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene yfgM CDS 15670..16851 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177033.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene bamB CDS 17015..18508 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249413.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene der CDS complement(18960..20321) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815788.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene xseA CDS 20491..21957 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944174.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene guaB CDS 22029..23609 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098264.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene guaA sequence064 source 1..24795 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(380..709) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204123.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(726..1136) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095890.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(1169..1843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705237.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(1856..2476) product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704257.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(2473..2931) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368475.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(2944..3891) product choline TMA-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704258.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene cutD CDS complement(3947..7342) product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819602.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene cutC CDS complement(7373..8533) product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704260.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(8549..8806) product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599365.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(8833..10446) product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704261.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(10495..10773) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002442217.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(10770..11084) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002442227.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(11101..11379) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012542984.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(11845..12363) product FidL-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217010.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(12360..13160) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704262.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 13692..14234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 14236..15168 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094967.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(15153..16148) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094968.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(16164..16397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 16435..17346 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene glyQ CDS 17356..19425 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703776.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene glyS CDS 19978..20937 product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044314.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene mhpF CDS 20934..21956 product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013510.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene dmpG CDS 22136..23533 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190513.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(23570..24346) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103889.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 sequence065 source 1..24551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1145..1381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 1503..2222 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(2267..3343) product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392002.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 3653..5080 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705730.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 5217..5465 product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063447014.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(5728..6675) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530058.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene choX CDS complement(6678..8219) product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene betC CDS 8325..9257 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011857652.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 9371..10210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 10231..11067 product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200833.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene choW CDS 11266..12177 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 12245..13072 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532488.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 13192..13596 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025999094.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(13673..14332) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087077.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 14463..15380 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727037.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 15373..16155 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 16172..17014 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726986.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 17017..18027 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726985.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 18037..18252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 18252..19625 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 19622..20503 product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987753.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene eamA CDS complement(20588..21496) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387792.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 21856..22698 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387789.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 22961..23365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 23431..24012 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 24117..24377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 sequence066 source 1..24368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 649..1272 product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176125.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene rhtB CDS complement(1335..1958) product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176129.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene rhtC CDS complement(2043..3869) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420793.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene recQ CDS 4281..4751 product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004097567.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene yigI CDS 5003..9001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(9111..10064) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166238.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene corA CDS complement(10356..12518) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383407.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene uvrD CDS complement(12576..13292) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211474.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene yigB CDS complement(13292..14200) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211473.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene xerC CDS complement(14197..14901) product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176169.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(14898..15746) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176172.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene dapF CDS complement(15749..15943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(16146..18704) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene cyaA CDS 18718..18966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 18995..19936 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001338644.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene hemC CDS 19933..20673 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883127.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene hemD CDS 20697..21833 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211463.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene hemX CDS 21836..23026 product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene hemY CDS 23696..24094 product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173442.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 sequence067 source 1..24083 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(681..2039) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949265.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene pssA CDS complement(2149..4806) product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082943.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene pat CDS complement(4992..5735) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183640.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene tapT CDS complement(5807..6226) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098330.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene trxC CDS 6433..7470 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098329.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(7603..9138) product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295176.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene emrB CDS complement(9153..10328) product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098428.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene emrA CDS complement(10477..11010) product multidrug efflux transporter EmrAB transcriptional repressor EmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378442.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene emrR CDS complement(11100..11441) product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119759.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene ygaH CDS complement(11438..12178) product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445658.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene ygaZ CDS complement(12313..13497) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165770.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(13647..14642) product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370071.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene proX CDS complement(14711..15874) product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815703.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene proW CDS complement(15867..17066) product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985490.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene proV CDS complement(17367..18332) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815704.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene nrdF CDS complement(18477..20627) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212212.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene nrdE CDS complement(20600..21010) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215935.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene nrdI CDS complement(21015..21257) product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815707.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 21929..22276 product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098417.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 22678..23265 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366891.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 23255..23668 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087887.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 sequence068 source 1..23543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(370..1428) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144640.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 1636..2730 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705363.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 2900..3820 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816068.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 3838..5073 product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074159.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene mdtG CDS 5334..5732 product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097161.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(5734..5952) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237185.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(6054..8630) product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602389.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene mdoH CDS complement(8623..10188) product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene mdoG CDS 10571..11743 product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097165.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene mdoC CDS 12008..13198 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461355.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 13386..15770 product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(15939..16580) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313420.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(16916..17098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 17856..19892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 20368..20538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 20740..21777 product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088491.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene waaO CDS 22532..23068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 tRNA complement(23369..23455) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(23466..23539) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 sequence069 source 1..23452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 324..1343 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742148.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 1343..1879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 1885..2976 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113360.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 3101..3847 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(3962..4897) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529870.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(4894..6000) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529869.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(5997..7553) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529868.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(7718..8740) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529867.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 8836..9282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529866.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 9925..11394 product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene hpaB CDS 11468..11857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 11862..13328 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105036.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 13325..14623 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 14826..15773 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331260.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 15773..16306 product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103444.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene rutF CDS 16358..17401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929892.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(17420..18598) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529872.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 18925..19740 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529856.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 19786..20460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 note possible pseudo, internal stop codon CDS 20578..21321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 note possible pseudo, internal stop codon CDS 21494..22429 product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817008.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene cbpA CDS 22432..22740 product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173425.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene cbpM misc_feature complement(22805..>23452) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385500.1:DMT family transporter locus_tag LOCUS_28880 sequence070 source 1..22497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(999..1769) product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001553608.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene lldR CDS complement(1769..3424) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295233.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene lldP CDS complement(3858..6641) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815400.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(6631..8217) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161803513.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(8419..11046) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084281.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(11268..12254) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084282.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(12251..12796) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156585.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 13109..13888 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046052102.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(13923..14864) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206478.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 14997..15734 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206477.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 15904..16548 product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028480.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(16677..18875) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704681.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(19194..19616) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704866.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(19804..20760) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383348.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(20951..22408) product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815285.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 sequence071 source 1..21464 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(187..384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 736..1422 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 1910..2443 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259181.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(2509..3843) product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228605.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(3887..4645) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086017.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(4642..5439) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970050.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(5439..6326) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339156.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(6323..7279) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268897.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(7280..8785) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(9686..10822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 11120..12793 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255514.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 12796..14280 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973394.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 14307..15323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 15345..16298 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033042345.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(16694..16867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 16946..19321 product membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211139558.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 19783..20229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 sequence072 source 1..20875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 22..98 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 176..252 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 499..1065 product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167426.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene yqaB CDS 1347..2909 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848972.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene gshA CDS 3062..3577 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209453.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene luxS CDS complement(3667..4953) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028086.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(4977..5768) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537507.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 5934..7295 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene ffh CDS 7521..7769 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209458.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene rpsP CDS 7776..8336 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703198.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene rimM CDS 8372..9136 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene trmD CDS 9179..9526 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene rplS CDS 9716..10243 product IS200/IS605-like element ISSod23 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072537.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene tnpA CDS complement(10223..11338) product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170765.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene solA CDS complement(11551..11805) product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500827.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene bssS CDS complement(12195..12473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(12809..13054) product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097151.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene dinI CDS complement(13136..14182) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097150.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene pyrC CDS complement(14417..14980) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097149.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(15143..16345) product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097148.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene mdtH CDS 16768..17358 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367203.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene rimJ CDS 17485..18129 product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877111.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 18389..19927 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367200.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene murJ CDS complement(20108..20719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 sequence073 source 1..20513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..1590 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099283.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene ilvC CDS complement(1673..1954) product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096806.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene ppiC CDS 2073..4097 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099281.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene rep CDS complement(4170..5654) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032900842.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene ppx CDS complement(5662..6954) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047525.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene rhlB CDS 7072..7404 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883224.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene trxA CDS 7742..9001 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883293.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene rho CDS 9282..10379 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene wecA CDS 10415..11446 product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299252.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene wzzE CDS 11494..12630 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176215.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene wecB CDS 12627..13889 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703971.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene wecC CDS 13962..14654 product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211982.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene rffC CDS 14659..15789 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene rffA CDS 15791..17041 product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050302.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene wzxE CDS 17038..18111 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211979.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 18108..19454 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815334.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene wzyE CDS 19494..20234 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183613.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene wecG tRNA 20415..20491 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 sequence074 source 1..20224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 427..981 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099006.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(957..1208) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420723.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(1205..2023) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451217.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene aroE CDS complement(2030..2602) product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420961.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene tsaC CDS complement(2595..3149) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099010.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(3175..3648) product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369440.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene smg CDS complement(3620..4744) product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228567.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene dprA CDS 4874..5383 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209021.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene def CDS 5405..6352 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099014.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene fmt CDS 6410..7699 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215705.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene rsmB CDS 7751..9127 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691382.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene trkA CDS 9260..9667 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099017.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene mscL CDS complement(10005..10982) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211003.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 11186..12577 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211002.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 12587..14086 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706072.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene xylB CDS 14240..15199 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210001.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 15218..16747 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210000.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 16764..17744 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209999.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 18138..19589 product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089363.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 sequence075 source 1..20155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1318..6312) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103907.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(6455..7645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(8096..9436) product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368823.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene dcuB CDS 10263..11378 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366474.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 11496..12410 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705514.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 12420..13712 product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705513.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene livM CDS 13705..14583 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366477.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 14576..15292 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366478.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 15418..16845 product multidrug efflux MATE transporter EmmdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120727113.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene emmdR CDS 17132..17311 product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009307.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(17450..18670) product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(18712..19515) product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 sequence076 source 1..20133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(693..1310) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038852.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(1436..1645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(1581..2345) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210870.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 2850..3881 product hematinate-forming heme oxygenase ChuS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017190.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene chuS CDS 3878..4696 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156544.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 4693..5694 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096986.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 5687..6466 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815405.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(6463..7902) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816391.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(8130..8588) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169395.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 8817..9590 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193030.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 9681..10655 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064105.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(10613..11380) product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096997.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene btuD CDS complement(11381..11926) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096998.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(11973..12956) product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956518.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene btuC CDS 12969..13172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(13090..13389) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229266.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene ihfA CDS complement(13394..15781) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672340.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene pheT CDS complement(15797..16780) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097003.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene pheS CDS complement(17096..17452) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene rplT CDS complement(17496..17693) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene rpmI CDS complement(17789..18262) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189469.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene infC CDS complement(18335..20131) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144226.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene thrS sequence077 source 1..19935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(344..862) product 4-hydroxyphenylacetate 3-monooxygenase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887467.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(875..2437) product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887473.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene hpaB CDS complement(2673..3563) product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093495.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene hpaA CDS complement(3574..4872) product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887477.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene hpaX CDS complement(4954..5751) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704294.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene hpaI CDS complement(5762..6565) product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095451.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene hpaH CDS complement(6639..7019) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119872.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(7090..8166) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528545.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene hpaD CDS complement(8304..9758) product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095454.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene hpaE CDS complement(9755..11017) product 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679210.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene hpaG CDS 11351..11821 product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095456.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene hpaR CDS complement(12027..12644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 note possible pseudo, internal stop codon CDS complement(12913..13575) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667095.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 repeat_region 13750..15220 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttctaagctgcctgtgcggcagtgaac CDS 15588..16064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 16054..16239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(16244..16453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 note possible pseudo, internal stop codon, frameshifted CDS complement(16689..16949) product Insertion element iso-IS1N protein insA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179084.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(16989..17246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 note possible pseudo, internal stop codon, frameshifted CDS complement(17330..18127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 note possible pseudo, internal stop codon, frameshifted CDS complement(18410..18883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059234286.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(18886..19608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 sequence078 source 1..18960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(671..934) product type III secretion system export apparatus subunit SctS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375712.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene sctS CDS complement(942..1607) product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406534.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene sctR CDS complement(1604..2686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(2683..3396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(3393..3860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(3844..5184) product type III secretion system ATPase HrcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266891.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene hrcN CDS complement(5205..6161) product type III secretion system inner membrane ring subunit SctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763855.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene sctD CDS complement(6173..8272) product type III secretion system export apparatus subunit SctV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266893.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene sctV CDS complement(8269..9450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 9726..10283 product RNA polymerase sigma factor HrpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103538.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene hrpL CDS complement(10457..11089) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768051.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(11242..11781) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096732.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(11964..13010) product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705181.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS 13996..14574 product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170942738.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene pagP CDS 14724..14933 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439184.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene cspE CDS 15724..16353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 16424..17842 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728113.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 sequence079 source 1..18905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(87..923) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966391.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene sseA CDS complement(980..1948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(1945..2745) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230261.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(2720..3493) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965193.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(3490..4302) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(4295..5704) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973043.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(5701..6816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS complement(6881..8350) product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920255.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(8361..10097) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726806.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(10497..12332) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113000.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 12849..15065 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207286.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 15117..16139 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965288.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 16220..16831 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097992.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 16980..18194 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047157.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 tRNA 18359..18434 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 18661..18780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30650 sequence080 source 1..18475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(637..1062) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095077.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 1167..2069 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174372.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(2103..3749) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095075.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(4029..5378) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080104.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(5693..6166) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368733.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene soxR CDS 6255..6668 product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368734.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene soxS CDS 7240..7515 product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503385.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(7623..8573) product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(8567..9838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 10355..10750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 11443..11646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(11929..12453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 note possible pseudo, frameshifted CDS complement(12483..12677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(12726..15020) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032466356.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(15041..15373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(15384..15923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(16129..16665) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213971.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 sequence081 source 1..17862 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 68..397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 note possible pseudo, frameshifted CDS complement(607..2430) product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368970.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene typA CDS 2871..4280 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213150.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene glnA CDS 4422..5471 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501857.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene glnL CDS 5479..6888 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334023.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene glnG CDS complement(7325..8698) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099379.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene hemN CDS complement(8945..9454) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099380.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene yihI CDS 10065..10688 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183327.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene yihA CDS complement(11135..13918) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene polA CDS 13961..14122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(14493..15122) product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725344.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene dsbA CDS complement(15148..16134) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213169.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(16214..16483) product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 16561..17148 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703924.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene mobA CDS 17149..17658 product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989262.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene mobB sequence082 source 1..17735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 936..2639 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811710.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 2636..3256 product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 3310..4644 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083711.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 4746..5135 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815583.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(5164..6087) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941352.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(6071..7579) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 7727..9001 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099137.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(9392..10780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(10805..12340) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112370.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(12539..13711) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384188.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(13711..15855) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103467.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 16131..17255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 sequence083 source 1..17239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(7526..8107) product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(8159..8686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(8686..10356) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704284.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 tRNA complement(10558..10634) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(10766..11497) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368125.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene dnaQ CDS 11550..12017 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368126.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene rnhA CDS complement(12002..12736) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298887.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 12779..13534 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704465.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene gloB CDS 13608..14981 product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228041.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene mltD CDS complement(15077..15850) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368130.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(15934..16626) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 tRNA complement(17100..17176) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 sequence084 source 1..16805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 405..596 product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097741.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene dsrB CDS complement(767..1402) product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097740.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene rcsA CDS complement(2610..2933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 3149..3628 product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754694.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene yedD CDS complement(3692..5170) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245699.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene amyA CDS 5384..6391 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069418.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene dcyD CDS 6688..7488 product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096020.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene tcyJ CDS 7488..8156 product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096022.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene tcyL CDS 8153..8905 product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273005.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene yecC CDS complement(9068..9502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31290 note possible pseudo, internal stop codon, frameshifted CDS complement(9608..9898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 note possible pseudo, internal stop codon, frameshifted CDS 9997..10155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 note possible pseudo, internal stop codon CDS 10201..10728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31320 note possible pseudo, internal stop codon, frameshifted CDS complement(11009..14950) product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305899.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene putA CDS 14996..15175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 15694..16482 product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001617488.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene phoH sequence085 source 1..16594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2626 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_155030720.1:Ig-like domain-containing protein locus_tag LOCUS_31360 CDS 2729..4891 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095715.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 4925..6241 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095714.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 6253..7794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(7852..8919) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816855.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene purK CDS complement(8916..9425) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167785.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene purE CDS 10425..11075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 note possible pseudo, internal stop codon, frameshifted CDS 11179..11361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 note possible pseudo, internal stop codon, frameshifted CDS complement(11528..11959) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168621.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(12015..13412) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816648.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(13648..14769) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(14892..15788) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817366.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene iolE sequence086 source 1..16364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(322..1110) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366239.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene fabI CDS complement(1265..2071) product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096393.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene sapF CDS complement(2071..3063) product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210970.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene sapD CDS complement(3063..3953) product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366244.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene sapC CDS complement(4250..5215) product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366265.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene sapB CDS complement(5212..6801) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816365.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene sapA CDS complement(7174..8169) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816362.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene pspF CDS 8335..9000 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511000.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene pspA CDS 9071..9292 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161022.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene pspB CDS 9295..9657 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096405.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene pspC CDS 9707..9955 product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096406.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene pspD CDS 9936..11333 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096419.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 11330..12394 product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169550.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 12605..14170 product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210983.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene tyrR CDS complement(14259..14762) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210984.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene tpx CDS 14774..14956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 15637..16026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 sequence087 source 1..16189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(485..1474) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530761.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 1580..2512 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368401.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(2566..3381) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726998.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(3381..4253) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776866.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(4313..5653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 6180..6782 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971767.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 6795..7886 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252937.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene ugpC CDS complement(7903..9027) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705629.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(9076..9939) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110418.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 10223..11383 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310749.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(11478..12347) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704700.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 12452..13816 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729040.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(14171..14515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(14972..15463) product type VI secretion system effector Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366299.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene hcp CDS complement(15467..15853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 sequence088 source 1..16155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1547..1729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 1726..3405 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974807.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 3634..4485 product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211044.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(4649..5914) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730522.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene efeB CDS complement(5918..7153) product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(7198..8673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(9372..10373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103344.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(10669..11037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 11221..12042 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104230.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 12312..12506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 12513..13004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 13089..14474 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098348.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 14655..15029 product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042893410.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene yobA CDS 15282..15533 product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366132.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 15877..16029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 sequence089 source 1..16049 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(294..557) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209637.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 946..1362 product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene ibpA CDS complement(1475..2389) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987753.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene eamA CDS complement(2413..2910) product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705788.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(2942..3742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(3746..4447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(4435..5730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(5730..7199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764454.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 7512..8951 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(9031..10284) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144354.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene avtA CDS 10626..11834 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096422.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(11880..12854) product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817452.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene ghrB CDS complement(12993..13568) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094984.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene tag CDS 13908..14234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 note possible pseudo, frameshifted CDS 14155..14460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 note possible pseudo, frameshifted CDS 14647..15192 product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098821.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene dnaT CDS 15231..15932 product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873982.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene dnaC sequence090 source 1..15566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 325..1152 product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114601.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene tauC CDS 1149..1997 product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004027.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene tauD CDS complement(2044..3945) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634840.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 4062..4613 product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081510.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene kefG CDS 4614..6422 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399099.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene kefB CDS 6426..6662 product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099038.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 6814..7362 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861345.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene slyD CDS complement(7527..7745) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861693.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 8034..8864 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085068497.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene fkpA CDS 8839..9033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 9047..9769 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091472.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 9769..10155 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268013.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene tusD CDS 10155..10514 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212321.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene tusC CDS 10526..10813 product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903373.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene tusB CDS 10938..11312 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene rpsL CDS 11409..11879 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene rpsG CDS 11974..14082 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212325.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene fusA CDS 14153..15337 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620081.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene tuf sequence091 source 1..15436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(281..556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 note possible pseudo, frameshifted CDS 954..1550 product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965695.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene yihX CDS 1640..2398 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 2422..2859 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175741.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene dtd CDS 2919..3860 product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099362.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene fabY CDS complement(4056..4520) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143849.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 4601..5179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(5260..6939) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094876.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(7079..8455) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094877.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 9422..11173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(11509..13590) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016758.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene recG CDS complement(13587..14285) product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369142.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene trmH misc_feature complement(14289..>15436) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369143.1:bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase locus_tag LOCUS_32420 sequence092 source 1..15350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..813) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941119.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(876..1541) product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095016.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene nfi CDS complement(1543..2610) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175675.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene hemE CDS complement(2649..3422) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166081.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 gene nudC CDS 3518..4033 product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934302.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene rsd CDS 4444..5109 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284576.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene thiE CDS 5119..5463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(5867..6097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 note possible pseudo, internal stop codon CDS complement(6107..10087) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene rpoC CDS complement(10169..14197) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263103.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene rpoB CDS complement(14522..14890) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095002.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene rplL sequence093 source 1..15321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 733..1278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32540 note possible pseudo, frameshifted CDS 1260..1445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32550 note possible pseudo, frameshifted CDS 1635..1871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 1951..3075 product ISAs1-like element ISSod22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(3327..5357) product siderophore yersiniabactin receptor FyuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784550.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene fyuA CDS 5479..6375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(6365..6499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 7100..8701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 8709..9110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 9128..10897 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388619.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 10884..12611 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626054.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 12595..13647 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097455.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 13650..15146 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827567.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 sequence094 source 1..14742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 1..76 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 131..206 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 211..286 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(581..904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 909..1130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 note possible pseudo, frameshifted CDS complement(1116..1283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(1401..2027) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406576.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(2336..2722) product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787381.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(2750..3106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 3269..3742 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(3911..4831) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098193.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 4927..5949 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878163.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(5952..6170) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114688.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(6148..8190) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443697.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene ligA CDS complement(8261..9226) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227089.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene zipA CDS 9443..10201 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213487.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene cysZ CDS 10359..11330 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036904.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene cysK CDS 11849..12106 product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene ptsH CDS 12268..13995 product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208490.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene ptsI CDS 14039..14542 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392561.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene crr sequence095 source 1..14580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 143..1042 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388789.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene hisG CDS 1047..2354 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386882.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene hisD CDS 2351..3442 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168372.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene hisC CDS 3439..4506 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097845.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene hisB CDS 4506..5096 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168362.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene hisH CDS 5102..5839 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816714.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene hisA CDS 5821..6597 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706032.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene hisF CDS 6591..7202 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954830.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene hisIE CDS complement(7271..8203) product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215243.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene wzzB CDS complement(8474..9880) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211888.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene gndA CDS complement(9975..10523) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261024.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene rfbC CDS complement(10545..11099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(11089..12387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(12391..13389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674024.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(13389..13814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 sequence096 source 1..14537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..749) product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098815.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(980..1963) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940510.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene epmB CDS 2050..2616 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257282.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene efp CDS 2628..2807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 2921..3055 product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368653.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene ecnB CDS complement(3122..3478) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299198.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene frdD CDS complement(3489..3884) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208749.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene frdC CDS complement(3895..4629) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175554.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(4622..6415) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815417.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene frdA CDS 6737..7714 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene epmA CDS complement(7760..11086) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236760.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene mscM CDS complement(11112..11999) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095278.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene asd CDS complement(12105..13160) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene rsgA CDS 13213..13803 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene orn tRNA 13967..14042 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 sequence097 source 1..14421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(688..3849) product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene muxB CDS complement(3846..4910) product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931666.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(5275..6684) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268044.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(6674..9805) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268787.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(9815..10762) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406318.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(11149..11337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(11551..13266) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642212.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 gene ftsI CDS complement(13671..14132) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098560.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(14173..14421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 sequence098 source 1..13745 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(251..976) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640685.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(969..1418) product GlcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853257.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 1738..2286 product DNA-binding transcriptional regulator NfeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018003.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene nfeR CDS complement(2498..3085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(3241..3426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(3540..4325) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742177.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(4322..5140) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160723.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene mhpD CDS complement(5164..5349) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831035.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 5968..6858 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 6923..7468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 7854..8930 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550689.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 9108..11309 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705755.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS complement(11381..13075) product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816539.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 gene dauA sequence099 source 1..13721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 53..844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 855..2471 product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097633.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene entE CDS 2491..3345 product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367768.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene entB CDS 3348..4100 product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367767.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene entA CDS 4143..4556 product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097630.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene entH CDS complement(4684..6261) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979839.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene ahpF CDS complement(6334..6897) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859485.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene ahpC CDS complement(7425..8138) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(8152..8757) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020996754.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(8767..10263) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704601.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 10659..11597 product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene bsdA CDS complement(11623..12411) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817158.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene map CDS complement(12408..12659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 misc_feature complement(12948..>13721) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000213683.1:siderophore-interacting protein locus_tag LOCUS_33480 sequence100 source 1..13526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 264..1082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 1799..2068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(2119..3645) product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817067.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(3656..4009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095183.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(4009..5418) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162366969.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(5430..6404) product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817069.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(6401..6805) product TIGR03757 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025381164.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 7275..8258 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867479.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 note possible pseudo, internal stop codon CDS complement(8672..9763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123253.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(9763..11553) product restriction system-associated AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123252.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(11550..13103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33590 sequence101 source 1..13404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 685..855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(957..1571) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764720.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 tRNA complement(1912..1988) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(2062..3819) product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256152.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene yejM CDS complement(3842..4069) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208836.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 4228..5232 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365669.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene yejK CDS complement(5305..5589) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494186.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene rplY CDS complement(5752..7506) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706128.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 7799..8503 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097990.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene rsuA CDS 8684..9880 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213351.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 10197..10568 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(10590..12185) product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815989.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene yejF CDS complement(12187..13212) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088798.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 sequence102 source 1..12984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(202..2460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 2767..4086 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene ugpB CDS 4142..5029 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369328.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene ugpA CDS 5026..5871 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176328.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene ugpE CDS 5875..6948 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099124.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 6945..7688 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703700.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene ugpQ CDS complement(7930..8208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS 8463..10160 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene ggt CDS complement(10263..11126) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975713.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 11249..12262 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729983.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 sequence103 source 1..12595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 317..823 product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175227.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 1067..2569 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098956.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 2579..3850 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602676.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(3877..4953) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295681.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene lptG CDS complement(4953..6053) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584114.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene lptF CDS 6322..7830 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175279.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene pepA CDS 7903..8361 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209309.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 8368..11223 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368547.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 11297..11800 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815474.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 sequence104 source 1..12431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3548..3763) product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097641.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(3797..4963) product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656592.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene fes CDS 5280..7559 product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704704.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene fepA CDS 7888..9063 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008806844.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(9084..9860) product DUF218 domain-containing protein YdcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027930.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene ydcF CDS complement(10201..10536) product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880582.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(10682..11740) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200856.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 sequence105 source 1..12416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(373..1716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(1870..2670) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702976.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(2681..3238) product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene hxlB CDS complement(3263..3970) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene rpe CDS complement(4280..5230) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529341.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(5283..6194) product inner-membrane translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529340.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(6303..7850) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529339.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(7888..8661) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086009.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(9185..9613) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246714.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 10213..10992 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281586.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 tRNA complement(11249..11336) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(11583..12116) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene msrA sequence106 source 1..12230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(204..1112) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084035.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(1550..2218) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391478.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 2355..3053 product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811063.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 3086..4462 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063875.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 4515..5168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665896.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 5165..6493 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227747.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(6917..7276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 7367..8353 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 8442..8822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(9017..9343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS 9770..10252 product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138096472.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene tssD CDS 10264..10713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135321903.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 10713..11045 product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023898555.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(11356..11490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 11750..12097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 sequence107 source 1..11886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 485..1525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 1522..4902 product ImcF-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832729.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 4899..6482 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211937.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene tssA CDS 6592..8355 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155110255.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene tssF CDS 8310..9413 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373315.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene tssG CDS 9394..9933 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074160625.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene tssJ CDS 9937..10374 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211943.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene tssE CDS 10387..11769 product type VI secretion system ImpA and VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211944.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 sequence108 source 1..11459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 429..1121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165356698.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS 1420..1698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(1701..3095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(3173..3418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS complement(3589..3924) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242740.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(3982..4560) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314627.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(4640..5410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 note possible pseudo, frameshifted CDS 5835..6107 product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179111.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 6207..6644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 note possible pseudo, frameshifted CDS complement(6650..7744) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704680.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 8187..10388 product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097112.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene fhuE CDS 10736..11035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 11155..11322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34440 sequence109 source 1..11416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 224..706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 note possible pseudo, internal stop codon CDS complement(922..1830) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388594.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 2903..5659 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969653.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 5738..6529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 6755..8563 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 8560..9909 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 9910..11319 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767364.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 sequence110 source 1..11118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 64..140 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 149..224 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(297..1139) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176097.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene hdfR CDS 1261..1599 product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099290.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS complement(1625..3145) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058957.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 3720..5366 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815319.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene ilvG CDS 5363..5620 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176090.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene ilvM CDS 5639..6568 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099287.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene ilvE CDS 6634..8484 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127411.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene ilvD CDS 8490..10037 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176085.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene ilvA CDS complement(10038..10919) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176081.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene ilvY sequence111 source 1..10800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34610 note possible pseudo, internal stop codon CDS complement(566..886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(1030..1677) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530097.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS 1831..2499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(2631..4001) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094825.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(4005..7124) product multidrug efflux RND transporter permease subunit EefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703857.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene eefB CDS complement(7124..8257) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873803.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(8368..9702) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211654.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 sequence112 source 1..10504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(831..1505) product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703481.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(1502..1942) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096732.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(2197..3615) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703476.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(4052..5329) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703482.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 5813..6886 product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene aroF CDS 6895..8019 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098342.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene tyrA CDS complement(8082..9242) product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098340.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene pheA CDS complement(9490..9825) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178456.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene raiA CDS 10032..10256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167337863.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 sequence113 source 1..10444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(810..885) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(996..1574) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704143.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(1650..3359) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068881.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(3335..3658) product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704145.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene cutA CDS complement(3791..5092) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(5211..6647) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368668.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene aspA CDS 7030..7494 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368667.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 gene fxsA CDS 7719..8012 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209127.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 8059..9714 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729117.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene groL CDS 9892..10251 product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209129.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 sequence114 source 1..10339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 487..963 product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097504.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(1027..2040) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097511.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene pgl CDS 2197..3015 product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816800.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(3017..4075) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891683.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene modC CDS complement(4080..4769) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367643.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene modB CDS complement(4766..5539) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210756.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene modA CDS complement(5665..5820) product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045380498.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 6094..6876 product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168058.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene modE CDS 6951..8423 product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096859.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene modF CDS 8551..9126 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190894.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 9253..9462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 9453..10205 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367652.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene gpmA sequence115 source 1..10181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(382..1098) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158946.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 2021..4042 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704798.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene uvrB CDS complement(4074..4979) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097495.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene yvcK CDS 5313..6371 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704804.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene moaA CDS 6389..6904 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097493.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene moaB CDS 6906..7391 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080901.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene moaC CDS 7384..7629 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598624.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene moaD CDS 7631..8110 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210774.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene moaE CDS 8176..9270 product DUF1615 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166493634.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 9412..10122 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 sequence116 source 1..10101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(813..3026) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209433.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene katG CDS complement(3387..3623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(4410..4805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 5491..6201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 6194..6847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(7115..8563) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388869.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 8662..9453 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388870.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 sequence117 source 1..9655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(84..809) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097581.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(810..1490) product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272809.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene gltK CDS complement(1487..2227) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097579.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(2550..3446) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367719.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(3865..5433) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853033.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene lnt CDS complement(5426..6304) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158416.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene corC CDS complement(6383..6859) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084477.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene ybeY CDS complement(6856..7914) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367714.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 misc_feature complement(8201..>9655) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001519200.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB locus_tag LOCUS_35240 sequence118 source 1..9517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 419..1123 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228221.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 gene sfsA CDS 1348..1803 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095632.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene dksA CDS 1876..2784 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937419.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene gluQRS CDS 2930..4264 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026612395.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene pcnB CDS 4261..4740 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215130.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene folK CDS 4839..5633 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368198.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 gene panB CDS 5649..6503 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368199.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 gene panC CDS 6572..6952 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156780.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 gene panD CDS complement(7020..8765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35330 sequence119 source 1..8978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..1205) product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 gene csy3 CDS complement(1223..2164) product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene csy2 CDS complement(2161..3486) product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222491.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 gene csy1 CDS complement(3927..7208) product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene cas3f CDS complement(7205..8185) product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene cas1f repeat_region 8663..>8978 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgcacaggcagcttagaag sequence120 source 1..8944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 181..513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35390 note possible pseudo, internal stop codon, frameshifted CDS 540..1100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35400 note possible pseudo, internal stop codon, frameshifted CDS complement(1171..2466) product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706015.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 gene shiA CDS 3161..3355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(3571..3753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(3841..4074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004132711.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 4396..4632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(4789..5268) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050863361.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 6111..6572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 7518..8489 product transcriptional regulator HrpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763906.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene hrpS CDS 8588..8884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 sequence121 source 1..8938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(46..122) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(180..266) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(324..662) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene secG CDS complement(1050..2384) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210189.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene glmM CDS complement(2392..3225) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764731.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 gene folP CDS complement(3321..5261) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098921.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 gene ftsH CDS complement(5309..5938) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145971.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 gene rlmE CDS 6064..6357 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene yhbY CDS complement(6467..6943) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128178593.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 gene greA CDS 7122..8627 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217314.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene dacB CDS complement(8635..8814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35580 sequence122 source 1..8702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 277..567 product DUF1364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002252.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 564..926 product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008115.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 923..1690 product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705710.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(2155..2475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208841.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS complement(2502..3131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(3106..4671) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109154434.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(4668..5177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(5371..5949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 6072..6284 product phage lysis protein EssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359727.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene essD CDS 6284..6769 product lysozyme RrrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075162.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 gene rrrD CDS 6766..7248 product lysis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098056.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 7245..7514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 8017..8352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35710 sequence123 source 1..8338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..1131) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170737.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS complement(1138..2172) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197594.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene plsX CDS complement(2199..2369) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210931.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene rpmF CDS complement(2388..2909) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174492.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene yceD CDS 3186..3773 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367195.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(3808..4794) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846343.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene rluC CDS 5340..8294 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705034.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene rne sequence124 source 1..7716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4367..5692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(5697..7346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35800 sequence125 source 1..7171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(525..1127) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705104.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene tdk CDS 1471..1878 product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169306.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene hns CDS complement(2063..3076) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(3091..4431) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210664.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(4455..5363) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene galU CDS complement(5553..6566) product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193447.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene rssB misc_feature complement(6667..>7171) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015367078.1:patatin-like phospholipase RssA locus_tag LOCUS_35870 sequence126 source 1..7070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(169..651) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene smpB CDS 811..1245 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 1238..1525 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848491.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(1563..1910) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203437.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene bamE CDS complement(2102..3763) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880931.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 gene recN CDS complement(3850..4728) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059145.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 gene nadK CDS 4851..5432 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172778.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene grpE CDS complement(5529..6035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 note possible pseudo, frameshifted CDS 6481..6864 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166327.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene grcA sequence127 source 1..6954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1263 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704374.1:LPS assembly protein LptD locus_tag LOCUS_35970 CDS 1318..2613 product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800482.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene surA CDS 2597..3595 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241224.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene pdxA CDS 3588..4412 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065364.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene rsmA CDS 4416..4793 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610901.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 gene apaG CDS 4861..5679 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257195.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene apaH CDS complement(5717..6187) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005020907.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 gene folA sequence128 source 1..6572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(339..1751) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816382.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene pykF CDS complement(2260..3474) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651240.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 3808..4809 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103771.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 5013..5465 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090697.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS 5465..6160 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140539.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 sequence129 source 1..6511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(224..1483) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369505.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene murA CDS complement(1558..1812) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900133.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 gene ibaG CDS complement(1931..2233) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210125.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene mlaB CDS complement(2233..2865) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369502.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 gene mlaC CDS complement(2877..3425) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817261.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene mlaD CDS complement(3430..4212) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436044.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene mlaE CDS complement(4217..5035) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032898349.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene mlaF CDS 5265..6242 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162457.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 sequence130 source 1..6469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 944..1498 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045434.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 1595..2281 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044775.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 2350..4875 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136459.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 4886..5977 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816992.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 sequence131 source 1..6137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(481..1095) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388662.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(1108..2295) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098658.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene metK CDS complement(2427..3479) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388674.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(3495..4724) product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388673.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(5325..5780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36250 note possible pseudo, frameshifted CDS complement(5807..6079) product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179111.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 sequence132 source 1..6120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(699..2792) product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745768.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(2789..3532) product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038092.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(3529..4185) product lipoprotein GfcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247610.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene gfcB CDS complement(4260..4475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(4741..5436) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209740.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(5525..6109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36320 sequence133 source 1..6047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 143..514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 561..1319 product type III secretion inner membrane ring lipoprotein SctJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763897.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene sctJ CDS 1337..1951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763896.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 1911..2534 product type III secretion system stator protein SctL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266882.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene sctL CDS 2607..2840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 2950..4998 product type III secretion system outer membrane ring subunit SctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244827.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene sctC CDS 5008..5190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 sequence134 source 1..5929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(458..649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 946..2271 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099207.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 2489..3442 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703756.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(3510..4979) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817388.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 misc_feature complement(5318..>5929) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369244.1:dicarboxylate/amino acid:cation symporter locus_tag LOCUS_36440 sequence135 source 1..5906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 135..485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 note possible pseudo, internal stop codon CDS complement(487..1302) product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367776.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene fepC CDS complement(1299..2291) product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480067.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 gene fepG CDS complement(2288..3292) product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453810.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 gene fepD CDS 3404..4663 product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081657.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene entS CDS complement(4664..5635) product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234314.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene fepB sequence136 source 1..5872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(621..1115) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208442.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 1274..2782 product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(2851..4209) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097840.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(4199..4399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS complement(4811..5635) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754712.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 sequence137 source 1..5847 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(214..774) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140178.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 gene gmhB CDS 954..1985 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368136.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene metN CDS 1978..2631 product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 2668..3483 product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 gene metQ CDS 3741..4148 product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704458.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 gene rcsF CDS 4145..4849 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 gene tsaA sequence138 source 1..5735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 175..363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 note possible pseudo, frameshifted CDS 789..971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 1270..1917 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082696.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 2899..3333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(3533..4639) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437089.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(4716..5249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 sequence139 source 1..5691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..883) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209469.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 gene bamD CDS 1014..1994 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370269.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene rluD CDS 1991..2731 product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815687.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene yfiH CDS 2856..5429 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098336.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene clpB sequence140 source 1..5415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(526..1380) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208954.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 1811..2050 product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392238.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 gene zapB CDS complement(2114..2599) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099315.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene rraA CDS complement(2706..3632) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305044.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene menA CDS complement(3831..4499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 4523..5128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36770 sequence141 source 1..5393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 778..1803 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174361.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 1870..3048 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019643.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 3194..4165 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299298.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 4208..4936 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172654773.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 rRNA complement(5179..5289) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence142 source 1..5393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..854 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005175870.1:glycerol kinase GlpK locus_tag LOCUS_36820 CDS 955..1965 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703815.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene glpX CDS 2220..2966 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796307.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene fpr CDS 3162..3770 product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802217.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 3892..4662 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862019.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene tpiA CDS complement(4848..5273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36870 sequence143 source 1..5009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(226..1512) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704793.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene bioA CDS 1600..2631 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951218.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene bioB CDS 2628..3785 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168073.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene bioF CDS 3766..4521 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704796.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene bioC sequence144 source 1..4761 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(447..1418) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098929.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene ispB CDS 1676..1987 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210178.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene rplU CDS 2003..2260 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene rpmA CDS 2377..3342 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369509.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 3359..4534 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369510.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene cgtA sequence145 source 1..4759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(230..1015) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040904057.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(1035..1256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(1267..2304) product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140538.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS complement(2292..3641) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140537.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 misc_feature complement(3961..>4759) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086016636.1:IS3 family transposase locus_tag LOCUS_37010 sequence146 source 1..4676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 46..318 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044509.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene hupA CDS 616..1281 product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704017.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(1363..2643) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175672.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene purD CDS complement(2663..4252) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095020.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene purH sequence147 source 1..4657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(101..502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(624..1613) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099326.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(1764..2726) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 gene pfkA CDS complement(3057..3959) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368935.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 gene fieF CDS complement(4215..4490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37100 sequence148 source 1..4655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1107..1292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(1600..2229) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(2384..2785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175101.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 3064..3954 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926200.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 sequence149 source 1..4591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(509..2044) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112615.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS complement(2079..3233) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS complement(3259..3714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 sequence150 source 1..4178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 782..1498 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367656.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene pnuC CDS complement(1501..2448) product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 gene zitB CDS 2956..4008 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109211.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 gene aroG sequence151 source 1..3332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(230..1363) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 1479..2396 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767818.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 2524..2670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(2924..3217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37250 sequence152 source 1..3177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 705..911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(1130..1279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 1370..2806 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223883297.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 sequence153 source 1..3133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1266 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005168296.1:NAD-dependent malic enzyme locus_tag LOCUS_37290 CDS complement(1333..2061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 misc_feature complement(2483..>3133) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097688.1:LacI family DNA-binding transcriptional regulator locus_tag LOCUS_37310 sequence154 source 1..3052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(259..1137) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405623.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 1236..1997 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368402.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS 2241..2906 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454937.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 sequence155 source 1..2743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence156 source 1..2662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(421..1383) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704003.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene birA CDS complement(1380..2417) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099225.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 gene murB