>Feature sequence001 124 1749 gene locus_tag LOCUS_00010 124 1749 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268117.1 protein_id gnl|my_center|LOCUS_00010 1752 2738 gene locus_tag LOCUS_00020 1752 2738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385705.1 protein_id gnl|my_center|LOCUS_00020 2735 3568 gene locus_tag LOCUS_00030 2735 3568 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538163.1 protein_id gnl|my_center|LOCUS_00030 3568 5196 gene locus_tag LOCUS_00040 3568 5196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268118.1 protein_id gnl|my_center|LOCUS_00040 5529 6755 gene locus_tag LOCUS_00050 5529 6755 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105350.1 protein_id gnl|my_center|LOCUS_00050 6766 7974 gene locus_tag LOCUS_00060 6766 7974 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105351.1 protein_id gnl|my_center|LOCUS_00060 7971 9350 gene locus_tag LOCUS_00070 7971 9350 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266344.1 protein_id gnl|my_center|LOCUS_00070 9368 10177 gene locus_tag LOCUS_00080 9368 10177 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115004.1 protein_id gnl|my_center|LOCUS_00080 10249 11280 gene locus_tag LOCUS_00090 10249 11280 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101828078.1 protein_id gnl|my_center|LOCUS_00090 11264 11914 gene locus_tag LOCUS_00100 11264 11914 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403166.1 protein_id gnl|my_center|LOCUS_00100 12280 12699 gene locus_tag LOCUS_00110 12280 12699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12757 13824 gene locus_tag LOCUS_00120 12757 13824 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086224.1 protein_id gnl|my_center|LOCUS_00120 13915 14742 gene locus_tag LOCUS_00130 13915 14742 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082561.1 protein_id gnl|my_center|LOCUS_00130 14782 15444 gene locus_tag LOCUS_00140 14782 15444 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082559.1 protein_id gnl|my_center|LOCUS_00140 15447 16103 gene locus_tag LOCUS_00150 15447 16103 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114963.1 protein_id gnl|my_center|LOCUS_00150 16100 16840 gene locus_tag LOCUS_00160 16100 16840 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114964.1 protein_id gnl|my_center|LOCUS_00160 16881 17642 gene locus_tag LOCUS_00170 16881 17642 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818730.1 protein_id gnl|my_center|LOCUS_00170 17778 18200 gene locus_tag LOCUS_00180 17778 18200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19000 18299 gene locus_tag LOCUS_00190 19000 18299 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189595320.1 protein_id gnl|my_center|LOCUS_00190 19901 19164 gene locus_tag LOCUS_00200 19901 19164 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_00200 20681 19935 gene locus_tag LOCUS_00210 20681 19935 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583415.1 protein_id gnl|my_center|LOCUS_00210 21355 20681 gene locus_tag LOCUS_00220 21355 20681 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967258.1 protein_id gnl|my_center|LOCUS_00220 22367 21561 gene locus_tag LOCUS_00230 22367 21561 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938265.1 protein_id gnl|my_center|LOCUS_00230 23466 24497 gene locus_tag LOCUS_00240 23466 24497 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705347.1 protein_id gnl|my_center|LOCUS_00240 24515 25324 gene locus_tag LOCUS_00250 24515 25324 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171322.1 protein_id gnl|my_center|LOCUS_00250 25324 26115 gene locus_tag LOCUS_00260 25324 26115 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705346.1 protein_id gnl|my_center|LOCUS_00260 26100 26771 gene locus_tag LOCUS_00270 26100 26771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161798788.1 protein_id gnl|my_center|LOCUS_00270 27543 27373 gene locus_tag LOCUS_00280 27543 27373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28202 28705 gene locus_tag LOCUS_00290 28202 28705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 29021 30433 gene locus_tag LOCUS_00300 29021 30433 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366505.1 protein_id gnl|my_center|LOCUS_00300 30435 31439 gene locus_tag LOCUS_00310 gene cydB 30435 31439 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705494.1 protein_id gnl|my_center|LOCUS_00310 31439 31600 gene locus_tag LOCUS_00320 31439 31600 CDS product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366503.1 protein_id gnl|my_center|LOCUS_00320 31760 33997 gene locus_tag LOCUS_00330 31760 33997 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104229.1 protein_id gnl|my_center|LOCUS_00330 34009 34842 gene locus_tag LOCUS_00340 34009 34842 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104230.1 protein_id gnl|my_center|LOCUS_00340 35249 37363 gene locus_tag LOCUS_00350 gene fepA 35249 37363 CDS product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704704.1 protein_id gnl|my_center|LOCUS_00350 37497 38384 gene locus_tag LOCUS_00360 37497 38384 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703472.1 protein_id gnl|my_center|LOCUS_00360 38653 38486 gene locus_tag LOCUS_00370 38653 38486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39122 38640 gene locus_tag LOCUS_00380 39122 38640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 39288 39833 gene locus_tag LOCUS_00390 39288 39833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00390 39972 40208 gene locus_tag LOCUS_00400 39972 40208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00400 40242 40928 gene locus_tag LOCUS_00410 40242 40928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00410 40850 41023 gene locus_tag LOCUS_00420 40850 41023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00420 41120 41440 gene locus_tag LOCUS_00430 41120 41440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00430 42962 41535 gene locus_tag LOCUS_00440 42962 41535 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968148.1 protein_id gnl|my_center|LOCUS_00440 43291 42959 gene locus_tag LOCUS_00450 43291 42959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 44384 43272 gene locus_tag LOCUS_00460 44384 43272 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968147.1 protein_id gnl|my_center|LOCUS_00460 45100 44381 gene locus_tag LOCUS_00470 45100 44381 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968146.1 protein_id gnl|my_center|LOCUS_00470 46664 45339 gene locus_tag LOCUS_00480 46664 45339 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968144.1 protein_id gnl|my_center|LOCUS_00480 47426 46674 gene locus_tag LOCUS_00490 gene hutC 47426 46674 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968143.1 protein_id gnl|my_center|LOCUS_00490 47692 49182 gene locus_tag LOCUS_00500 47692 49182 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968142.1 protein_id gnl|my_center|LOCUS_00500 49199 50884 gene locus_tag LOCUS_00510 49199 50884 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968141.1 protein_id gnl|my_center|LOCUS_00510 50988 52010 gene locus_tag LOCUS_00520 50988 52010 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968140.1 protein_id gnl|my_center|LOCUS_00520 52047 53195 gene locus_tag LOCUS_00530 52047 53195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968139.1 protein_id gnl|my_center|LOCUS_00530 53196 54056 gene locus_tag LOCUS_00540 53196 54056 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968138.1 protein_id gnl|my_center|LOCUS_00540 54053 54847 gene locus_tag LOCUS_00550 54053 54847 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968137.1 protein_id gnl|my_center|LOCUS_00550 55418 55029 gene locus_tag LOCUS_00560 55418 55029 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398711.1 protein_id gnl|my_center|LOCUS_00560 55524 56444 gene locus_tag LOCUS_00570 55524 56444 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811205.1 protein_id gnl|my_center|LOCUS_00570 57653 56628 gene locus_tag LOCUS_00580 57653 56628 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077984631.1 protein_id gnl|my_center|LOCUS_00580 58171 59349 gene locus_tag LOCUS_00590 58171 59349 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886447.1 protein_id gnl|my_center|LOCUS_00590 59504 60445 gene locus_tag LOCUS_00600 59504 60445 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244504.1 protein_id gnl|my_center|LOCUS_00600 60748 60557 gene locus_tag LOCUS_00610 60748 60557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 60759 62141 gene locus_tag LOCUS_00620 60759 62141 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704224.1 protein_id gnl|my_center|LOCUS_00620 63119 62295 gene locus_tag LOCUS_00630 63119 62295 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393373.1 protein_id gnl|my_center|LOCUS_00630 63862 63677 gene locus_tag LOCUS_00640 63862 63677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 63912 64751 gene locus_tag LOCUS_00650 63912 64751 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157438.1 protein_id gnl|my_center|LOCUS_00650 65647 64823 gene locus_tag LOCUS_00660 gene iolB 65647 64823 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174807.1 protein_id gnl|my_center|LOCUS_00660 67175 65667 gene locus_tag LOCUS_00670 67175 65667 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368538.1 protein_id gnl|my_center|LOCUS_00670 69734 67812 gene locus_tag LOCUS_00680 gene iolC 69734 67812 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050164505.1 protein_id gnl|my_center|LOCUS_00680 70147 72084 gene locus_tag LOCUS_00690 gene iolD 70147 72084 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817368.1 protein_id gnl|my_center|LOCUS_00690 72109 72993 gene locus_tag LOCUS_00700 72109 72993 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368532.1 protein_id gnl|my_center|LOCUS_00700 73389 74843 gene locus_tag LOCUS_00710 gene xylE 73389 74843 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_00710 74856 75779 gene locus_tag LOCUS_00720 74856 75779 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764417.1 protein_id gnl|my_center|LOCUS_00720 75803 76981 gene locus_tag LOCUS_00730 75803 76981 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974678.1 protein_id gnl|my_center|LOCUS_00730 77026 77511 gene locus_tag LOCUS_00740 77026 77511 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199466.1 protein_id gnl|my_center|LOCUS_00740 77561 78559 gene locus_tag LOCUS_00750 gene iolG 77561 78559 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 protein_id gnl|my_center|LOCUS_00750 79739 78753 gene locus_tag LOCUS_00760 79739 78753 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036367.1 protein_id gnl|my_center|LOCUS_00760 80902 79922 gene locus_tag LOCUS_00770 80902 79922 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705350.1 protein_id gnl|my_center|LOCUS_00770 81194 81544 gene locus_tag LOCUS_00780 81194 81544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 81541 82032 gene locus_tag LOCUS_00790 81541 82032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00790 83350 82319 gene locus_tag LOCUS_00800 83350 82319 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706074.1 protein_id gnl|my_center|LOCUS_00800 83643 84689 gene locus_tag LOCUS_00810 83643 84689 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369725.1 protein_id gnl|my_center|LOCUS_00810 84754 85575 gene locus_tag LOCUS_00820 84754 85575 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181271.1 protein_id gnl|my_center|LOCUS_00820 85572 86831 gene locus_tag LOCUS_00830 85572 86831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369724.1 protein_id gnl|my_center|LOCUS_00830 86861 87589 gene locus_tag LOCUS_00840 86861 87589 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365771.1 protein_id gnl|my_center|LOCUS_00840 88049 89029 gene locus_tag LOCUS_00850 gene pfkA 88049 89029 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_00850 89040 89330 gene locus_tag LOCUS_00860 89040 89330 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292534.1 protein_id gnl|my_center|LOCUS_00860 89345 90682 gene locus_tag LOCUS_00870 89345 90682 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296769.1 protein_id gnl|my_center|LOCUS_00870 90748 91023 gene locus_tag LOCUS_00880 90748 91023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 91030 91467 gene locus_tag LOCUS_00890 91030 91467 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909924.1 protein_id gnl|my_center|LOCUS_00890 91464 91997 gene locus_tag LOCUS_00900 91464 91997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 92041 92937 gene locus_tag LOCUS_00910 92041 92937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 93012 93692 gene locus_tag LOCUS_00920 93012 93692 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971150.1 protein_id gnl|my_center|LOCUS_00920 94956 93877 gene locus_tag LOCUS_00930 gene lptG 94956 93877 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640208.1 protein_id gnl|my_center|LOCUS_00930 96023 94953 gene locus_tag LOCUS_00940 gene lptF 96023 94953 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779645.1 protein_id gnl|my_center|LOCUS_00940 96651 97988 gene locus_tag LOCUS_00950 96651 97988 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896889.1 protein_id gnl|my_center|LOCUS_00950 97988 98821 gene locus_tag LOCUS_00960 97988 98821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984964.1 protein_id gnl|my_center|LOCUS_00960 99363 99920 gene locus_tag LOCUS_00970 99363 99920 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704190.1 protein_id gnl|my_center|LOCUS_00970 101326 100154 gene locus_tag LOCUS_00980 101326 100154 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524929.1 protein_id gnl|my_center|LOCUS_00980 101552 101313 gene locus_tag LOCUS_00990 101552 101313 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248104.1 protein_id gnl|my_center|LOCUS_00990 102519 101605 gene locus_tag LOCUS_01000 102519 101605 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077173.1 protein_id gnl|my_center|LOCUS_01000 104162 102516 gene locus_tag LOCUS_01010 104162 102516 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298766.1 protein_id gnl|my_center|LOCUS_01010 104976 106106 gene locus_tag LOCUS_01020 gene yghO 104976 106106 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388786.1 protein_id gnl|my_center|LOCUS_01020 106195 106554 gene locus_tag LOCUS_01030 106195 106554 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 protein_id gnl|my_center|LOCUS_01030 107471 106716 gene locus_tag LOCUS_01040 107471 106716 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339531.1 protein_id gnl|my_center|LOCUS_01040 108227 107514 gene locus_tag LOCUS_01050 108227 107514 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076250.1 protein_id gnl|my_center|LOCUS_01050 108378 109103 gene locus_tag LOCUS_01060 108378 109103 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190682.1 protein_id gnl|my_center|LOCUS_01060 111111 109153 gene locus_tag LOCUS_01070 111111 109153 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104349.1 protein_id gnl|my_center|LOCUS_01070 111885 112898 gene locus_tag LOCUS_01080 111885 112898 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104350.1 protein_id gnl|my_center|LOCUS_01080 112898 113677 gene locus_tag LOCUS_01090 112898 113677 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764492.1 protein_id gnl|my_center|LOCUS_01090 113754 114677 gene locus_tag LOCUS_01100 113754 114677 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764495.1 protein_id gnl|my_center|LOCUS_01100 115617 114868 gene locus_tag LOCUS_01110 115617 114868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 116384 115689 gene locus_tag LOCUS_01120 116384 115689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01120 117358 116381 gene locus_tag LOCUS_01130 117358 116381 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_01130 118854 117355 gene locus_tag LOCUS_01140 118854 117355 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892598.1 protein_id gnl|my_center|LOCUS_01140 120312 119407 gene locus_tag LOCUS_01150 gene gcvA 120312 119407 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200344113.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence002 1996 1337 gene locus_tag LOCUS_01160 gene rpiA 1996 1337 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209957.1 protein_id gnl|my_center|LOCUS_01160 2185 3096 gene locus_tag LOCUS_01170 2185 3096 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163344.1 protein_id gnl|my_center|LOCUS_01170 3860 3135 gene locus_tag LOCUS_01180 3860 3135 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173525.1 protein_id gnl|my_center|LOCUS_01180 4641 4021 gene locus_tag LOCUS_01190 gene argO 4641 4021 CDS product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493352.1 protein_id gnl|my_center|LOCUS_01190 5657 4803 gene locus_tag LOCUS_01200 5657 4803 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098633.1 protein_id gnl|my_center|LOCUS_01200 6128 6649 gene locus_tag LOCUS_01210 6128 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01210 8634 7555 gene locus_tag LOCUS_01220 gene fbaA 8634 7555 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173534.1 protein_id gnl|my_center|LOCUS_01220 10005 8842 gene locus_tag LOCUS_01230 gene pgk 10005 8842 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157067.1 protein_id gnl|my_center|LOCUS_01230 11076 10057 gene locus_tag LOCUS_01240 gene epd 11076 10057 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098636.1 protein_id gnl|my_center|LOCUS_01240 13381 11390 gene locus_tag LOCUS_01250 gene tkt 13381 11390 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098601.1 protein_id gnl|my_center|LOCUS_01250 14043 13627 gene locus_tag LOCUS_01260 14043 13627 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369693.1 protein_id gnl|my_center|LOCUS_01260 15031 14111 gene locus_tag LOCUS_01270 gene speB 15031 14111 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105550.1 protein_id gnl|my_center|LOCUS_01270 17228 15330 gene locus_tag LOCUS_01280 gene speA 17228 15330 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278580.1 protein_id gnl|my_center|LOCUS_01280 18066 19217 gene locus_tag LOCUS_01290 gene metK 18066 19217 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 protein_id gnl|my_center|LOCUS_01290 19528 20028 gene locus_tag LOCUS_01300 19528 20028 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860035.1 protein_id gnl|my_center|LOCUS_01300 20112 20825 gene locus_tag LOCUS_01310 gene endA 20112 20825 CDS product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286517.1 protein_id gnl|my_center|LOCUS_01310 20902 21633 gene locus_tag LOCUS_01320 gene rsmE 20902 21633 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300912.1 protein_id gnl|my_center|LOCUS_01320 21739 22683 gene locus_tag LOCUS_01330 gene gshB 21739 22683 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703453.1 protein_id gnl|my_center|LOCUS_01330 22778 23341 gene locus_tag LOCUS_01340 22778 23341 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369734.1 protein_id gnl|my_center|LOCUS_01340 23341 23766 gene locus_tag LOCUS_01350 gene ruvX 23341 23766 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811925.1 protein_id gnl|my_center|LOCUS_01350 24810 23812 gene locus_tag LOCUS_01360 24810 23812 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703454.1 protein_id gnl|my_center|LOCUS_01360 24772 25533 gene locus_tag LOCUS_01370 24772 25533 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997790.1 protein_id gnl|my_center|LOCUS_01370 25546 26100 gene locus_tag LOCUS_01380 25546 26100 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209984.1 protein_id gnl|my_center|LOCUS_01380 26126 26719 gene locus_tag LOCUS_01390 26126 26719 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173616.1 protein_id gnl|my_center|LOCUS_01390 26712 27848 gene locus_tag LOCUS_01400 gene hemW 26712 27848 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817047.1 protein_id gnl|my_center|LOCUS_01400 28629 27916 gene locus_tag LOCUS_01410 28629 27916 CDS product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817048.1 protein_id gnl|my_center|LOCUS_01410 29063 28737 gene locus_tag LOCUS_01420 29063 28737 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107565.1 protein_id gnl|my_center|LOCUS_01420 29786 29067 gene locus_tag LOCUS_01430 gene trmB 29786 29067 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786887.1 protein_id gnl|my_center|LOCUS_01430 29936 31021 gene locus_tag LOCUS_01440 gene mutY 29936 31021 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847823.1 protein_id gnl|my_center|LOCUS_01440 31021 31293 gene locus_tag LOCUS_01450 31021 31293 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098674.1 protein_id gnl|my_center|LOCUS_01450 31343 32422 gene locus_tag LOCUS_01460 gene mltC 31343 32422 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157159.1 protein_id gnl|my_center|LOCUS_01460 33388 32558 gene locus_tag LOCUS_01470 33388 32558 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211478.1 protein_id gnl|my_center|LOCUS_01470 34617 33391 gene locus_tag LOCUS_01480 34617 33391 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176149.1 protein_id gnl|my_center|LOCUS_01480 34924 35550 gene locus_tag LOCUS_01490 34924 35550 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080191.1 protein_id gnl|my_center|LOCUS_01490 37714 35570 gene locus_tag LOCUS_01500 37714 35570 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098688.1 protein_id gnl|my_center|LOCUS_01500 39161 38208 gene locus_tag LOCUS_01510 39161 38208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 40423 39158 gene locus_tag LOCUS_01520 40423 39158 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812868.1 protein_id gnl|my_center|LOCUS_01520 42868 40451 gene locus_tag LOCUS_01530 42868 40451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 44000 42870 gene locus_tag LOCUS_01540 44000 42870 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707830.1 protein_id gnl|my_center|LOCUS_01540 45296 44043 gene locus_tag LOCUS_01550 45296 44043 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947134.1 protein_id gnl|my_center|LOCUS_01550 46280 45636 gene locus_tag LOCUS_01560 46280 45636 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391752.1 protein_id gnl|my_center|LOCUS_01560 47000 46284 gene locus_tag LOCUS_01570 gene pepE 47000 46284 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368795.1 protein_id gnl|my_center|LOCUS_01570 47698 47018 gene locus_tag LOCUS_01580 47698 47018 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391756.1 protein_id gnl|my_center|LOCUS_01580 48640 47711 gene locus_tag LOCUS_01590 48640 47711 CDS product DUF1177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391755.1 protein_id gnl|my_center|LOCUS_01590 50327 48702 gene locus_tag LOCUS_01600 50327 48702 CDS product OPT/YSL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285060.1 protein_id gnl|my_center|LOCUS_01600 51127 50384 gene locus_tag LOCUS_01610 51127 50384 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086029.1 protein_id gnl|my_center|LOCUS_01610 52792 51473 gene locus_tag LOCUS_01620 gene idnT 52792 51473 CDS product gnt-II system L-idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128335.1 protein_id gnl|my_center|LOCUS_01620 53603 52839 gene locus_tag LOCUS_01630 gene idnO 53603 52839 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998700.1 protein_id gnl|my_center|LOCUS_01630 54649 53618 gene locus_tag LOCUS_01640 gene idnD 54649 53618 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197416.1 protein_id gnl|my_center|LOCUS_01640 54916 56931 gene locus_tag LOCUS_01650 54916 56931 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098853.1 protein_id gnl|my_center|LOCUS_01650 58066 56939 gene locus_tag LOCUS_01660 gene rlmG 58066 56939 CDS product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018672.1 protein_id gnl|my_center|LOCUS_01660 58271 58774 gene locus_tag LOCUS_01670 58271 58774 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369584.1 protein_id gnl|my_center|LOCUS_01670 60459 58771 gene locus_tag LOCUS_01680 60459 58771 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_01680 60625 61623 gene locus_tag LOCUS_01690 60625 61623 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098856.1 protein_id gnl|my_center|LOCUS_01690 61905 62870 gene locus_tag LOCUS_01700 61905 62870 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703564.1 protein_id gnl|my_center|LOCUS_01700 63066 64325 gene locus_tag LOCUS_01710 gene sstT 63066 64325 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235369.1 protein_id gnl|my_center|LOCUS_01710 64802 65479 gene locus_tag LOCUS_01720 64802 65479 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174197.1 protein_id gnl|my_center|LOCUS_01720 65476 65859 gene locus_tag LOCUS_01730 gene mzrA 65476 65859 CDS product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174198.1 protein_id gnl|my_center|LOCUS_01730 66057 66428 gene locus_tag LOCUS_01740 66057 66428 CDS product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877297.1 protein_id gnl|my_center|LOCUS_01740 66480 66785 gene locus_tag LOCUS_01750 66480 66785 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098866.1 protein_id gnl|my_center|LOCUS_01750 66788 67186 gene locus_tag LOCUS_01760 66788 67186 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 protein_id gnl|my_center|LOCUS_01760 67183 67467 gene locus_tag LOCUS_01770 67183 67467 CDS product YqjK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095496.1 protein_id gnl|my_center|LOCUS_01770 67630 68616 gene locus_tag LOCUS_01780 67630 68616 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098870.1 protein_id gnl|my_center|LOCUS_01780 69594 68695 gene locus_tag LOCUS_01790 gene yhaJ 69594 68695 CDS product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041008.1 protein_id gnl|my_center|LOCUS_01790 69731 70435 gene locus_tag LOCUS_01800 69731 70435 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633552.1 protein_id gnl|my_center|LOCUS_01800 71088 70516 gene locus_tag LOCUS_01810 gene dolP 71088 70516 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098899.1 protein_id gnl|my_center|LOCUS_01810 71690 71103 gene locus_tag LOCUS_01820 gene diaA 71690 71103 CDS product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861754.1 protein_id gnl|my_center|LOCUS_01820 72100 71705 gene locus_tag LOCUS_01830 72100 71705 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210147.1 protein_id gnl|my_center|LOCUS_01830 74094 72058 gene locus_tag LOCUS_01840 74094 72058 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817253.1 protein_id gnl|my_center|LOCUS_01840 74157 75020 gene locus_tag LOCUS_01850 gene rsmI 74157 75020 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812294.1 protein_id gnl|my_center|LOCUS_01850 75612 75809 gene locus_tag LOCUS_01860 75612 75809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 76447 76181 gene locus_tag LOCUS_01870 76447 76181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 76796 77218 gene locus_tag LOCUS_01880 76796 77218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 77451 78554 gene locus_tag LOCUS_01890 77451 78554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929634.1 protein_id gnl|my_center|LOCUS_01890 78600 79880 gene locus_tag LOCUS_01900 78600 79880 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 protein_id gnl|my_center|LOCUS_01900 79891 80802 gene locus_tag LOCUS_01910 79891 80802 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 protein_id gnl|my_center|LOCUS_01910 80799 81641 gene locus_tag LOCUS_01920 80799 81641 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940422.1 protein_id gnl|my_center|LOCUS_01920 81654 82616 gene locus_tag LOCUS_01930 81654 82616 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385340.1 protein_id gnl|my_center|LOCUS_01930 84521 82611 gene locus_tag LOCUS_01940 84521 82611 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174285.1 protein_id gnl|my_center|LOCUS_01940 85534 84794 gene locus_tag LOCUS_01950 85534 84794 CDS product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095353.1 protein_id gnl|my_center|LOCUS_01950 86652 85531 gene locus_tag LOCUS_01960 86652 85531 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174293.1 protein_id gnl|my_center|LOCUS_01960 87769 86636 gene locus_tag LOCUS_01970 87769 86636 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062758500.1 protein_id gnl|my_center|LOCUS_01970 88472 87825 gene locus_tag LOCUS_01980 88472 87825 CDS product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174295.1 protein_id gnl|my_center|LOCUS_01980 89263 88487 gene locus_tag LOCUS_01990 89263 88487 CDS product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368574.1 protein_id gnl|my_center|LOCUS_01990 89593 89297 gene locus_tag LOCUS_02000 89593 89297 CDS product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368575.1 protein_id gnl|my_center|LOCUS_02000 89955 89599 gene locus_tag LOCUS_02010 89955 89599 CDS product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435389.1 protein_id gnl|my_center|LOCUS_02010 90431 90093 gene locus_tag LOCUS_02020 90431 90093 CDS product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027887.1 protein_id gnl|my_center|LOCUS_02020 92231 90891 gene locus_tag LOCUS_02030 gene pmbA 92231 90891 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852994.1 protein_id gnl|my_center|LOCUS_02030 92434 92976 gene locus_tag LOCUS_02040 gene yjgA 92434 92976 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174310.1 protein_id gnl|my_center|LOCUS_02040 94492 93125 gene locus_tag LOCUS_02050 gene mpl 94492 93125 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368582.1 protein_id gnl|my_center|LOCUS_02050 94661 95668 gene locus_tag LOCUS_02060 gene fbp 94661 95668 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 protein_id gnl|my_center|LOCUS_02060 95840 96289 gene locus_tag LOCUS_02070 95840 96289 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500737.1 protein_id gnl|my_center|LOCUS_02070 96392 96919 gene locus_tag LOCUS_02080 gene ppa 96392 96919 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055072.1 protein_id gnl|my_center|LOCUS_02080 97304 97011 gene locus_tag LOCUS_02090 97304 97011 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704194.1 protein_id gnl|my_center|LOCUS_02090 101086 97361 gene locus_tag LOCUS_02100 101086 97361 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154295113.1 protein_id gnl|my_center|LOCUS_02100 102867 101128 gene locus_tag LOCUS_02110 gene tamA 102867 101128 CDS product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704192.1 protein_id gnl|my_center|LOCUS_02110 103467 104789 gene locus_tag LOCUS_02120 103467 104789 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368593.1 protein_id gnl|my_center|LOCUS_02120 105200 104994 gene locus_tag LOCUS_02130 105200 104994 CDS product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501430.1 protein_id gnl|my_center|LOCUS_02130 105522 106079 gene locus_tag LOCUS_02140 105522 106079 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704190.1 protein_id gnl|my_center|LOCUS_02140 106865 106119 gene locus_tag LOCUS_02150 gene cysQ 106865 106119 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124233367.1 protein_id gnl|my_center|LOCUS_02150 107738 107118 gene locus_tag LOCUS_02160 gene fklB 107738 107118 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502892.1 protein_id gnl|my_center|LOCUS_02160 108115 108687 gene locus_tag LOCUS_02170 108115 108687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 109354 108902 gene locus_tag LOCUS_02180 gene rplI 109354 108902 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196065.1 protein_id gnl|my_center|LOCUS_02180 109621 109394 gene locus_tag LOCUS_02190 gene rpsR 109621 109394 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 protein_id gnl|my_center|LOCUS_02190 109943 109626 gene locus_tag LOCUS_02200 gene priB 109943 109626 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210154.1 protein_id gnl|my_center|LOCUS_02200 110345 109950 gene locus_tag LOCUS_02210 gene rpsF 110345 109950 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004098001.1 protein_id gnl|my_center|LOCUS_02210 111339 110590 gene locus_tag LOCUS_02220 gene yjfP 111339 110590 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815429.1 protein_id gnl|my_center|LOCUS_02220 111494 111336 gene locus_tag LOCUS_02230 111494 111336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 111438 111761 gene locus_tag LOCUS_02240 gene bsmA 111438 111761 CDS product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175485.1 protein_id gnl|my_center|LOCUS_02240 112180 111965 gene locus_tag LOCUS_02250 112180 111965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02250 112322 112519 gene locus_tag LOCUS_02260 112322 112519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 112886 113158 gene locus_tag LOCUS_02270 112886 113158 CDS product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179111.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence003 1132 308 gene locus_tag LOCUS_02280 gene pduF 1132 308 CDS product propanediol diffusion facilitator PduF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004699353.1 protein_id gnl|my_center|LOCUS_02280 2157 1240 gene locus_tag LOCUS_02290 2157 1240 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388671.1 protein_id gnl|my_center|LOCUS_02290 4803 2266 gene locus_tag LOCUS_02300 4803 2266 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388658.1 protein_id gnl|my_center|LOCUS_02300 5443 4883 gene locus_tag LOCUS_02310 5443 4883 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388657.1 protein_id gnl|my_center|LOCUS_02310 5771 5469 gene locus_tag LOCUS_02320 5771 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388670.1 protein_id gnl|my_center|LOCUS_02320 7301 5793 gene locus_tag LOCUS_02330 7301 5793 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_02330 8136 7351 gene locus_tag LOCUS_02340 gene pduB 8136 7351 CDS product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388661.1 protein_id gnl|my_center|LOCUS_02340 8439 8158 gene locus_tag LOCUS_02350 gene pduA 8439 8158 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_02350 9851 8640 gene locus_tag LOCUS_02360 9851 8640 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389133.1 protein_id gnl|my_center|LOCUS_02360 10390 9878 gene locus_tag LOCUS_02370 10390 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 10683 10411 gene locus_tag LOCUS_02380 10683 10411 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_02380 11420 10665 gene locus_tag LOCUS_02390 11420 10665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 11621 11424 gene locus_tag LOCUS_02400 11621 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 12306 11614 gene locus_tag LOCUS_02410 12306 11614 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388664.1 protein_id gnl|my_center|LOCUS_02410 13547 12432 gene locus_tag LOCUS_02420 13547 12432 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626060.1 protein_id gnl|my_center|LOCUS_02420 15359 13893 gene locus_tag LOCUS_02430 15359 13893 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_02430 16787 15399 gene locus_tag LOCUS_02440 16787 15399 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 protein_id gnl|my_center|LOCUS_02440 18712 17792 gene locus_tag LOCUS_02450 18712 17792 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551419.1 protein_id gnl|my_center|LOCUS_02450 19330 21474 gene locus_tag LOCUS_02460 gene fiuA 19330 21474 CDS product TonB-dependent ferrichrome receptor FiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113264.1 protein_id gnl|my_center|LOCUS_02460 21491 22609 gene locus_tag LOCUS_02470 21491 22609 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209997.1 protein_id gnl|my_center|LOCUS_02470 22998 23447 gene locus_tag LOCUS_02480 gene nrdR 22998 23447 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 protein_id gnl|my_center|LOCUS_02480 23451 24554 gene locus_tag LOCUS_02490 gene ribD 23451 24554 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132452414.1 protein_id gnl|my_center|LOCUS_02490 24643 25113 gene locus_tag LOCUS_02500 gene ribE 24643 25113 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208666.1 protein_id gnl|my_center|LOCUS_02500 25130 25549 gene locus_tag LOCUS_02510 gene nusB 25130 25549 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801125.1 protein_id gnl|my_center|LOCUS_02510 25604 26581 gene locus_tag LOCUS_02520 gene thiL 25604 26581 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752121.1 protein_id gnl|my_center|LOCUS_02520 26571 27065 gene locus_tag LOCUS_02530 gene pgpA 26571 27065 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154049.1 protein_id gnl|my_center|LOCUS_02530 28986 27121 gene locus_tag LOCUS_02540 gene dxs 28986 27121 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367989.1 protein_id gnl|my_center|LOCUS_02540 29905 29006 gene locus_tag LOCUS_02550 gene ispA 29905 29006 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367988.1 protein_id gnl|my_center|LOCUS_02550 30147 29905 gene locus_tag LOCUS_02560 gene xseB 30147 29905 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393512.1 protein_id gnl|my_center|LOCUS_02560 30370 31818 gene locus_tag LOCUS_02570 gene thiI 30370 31818 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367986.1 protein_id gnl|my_center|LOCUS_02570 32489 31893 gene locus_tag LOCUS_02580 gene yajL 32489 31893 CDS product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367984.1 protein_id gnl|my_center|LOCUS_02580 33363 32443 gene locus_tag LOCUS_02590 gene panE 33363 32443 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705865.1 protein_id gnl|my_center|LOCUS_02590 33500 33991 gene locus_tag LOCUS_02600 33500 33991 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503327.1 protein_id gnl|my_center|LOCUS_02600 35479 34085 gene locus_tag LOCUS_02610 35479 34085 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216662111.1 protein_id gnl|my_center|LOCUS_02610 36501 35608 gene locus_tag LOCUS_02620 gene cyoE 36501 35608 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095848.1 protein_id gnl|my_center|LOCUS_02620 36841 36512 gene locus_tag LOCUS_02630 36841 36512 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706741.1 protein_id gnl|my_center|LOCUS_02630 37455 36841 gene locus_tag LOCUS_02640 37455 36841 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704586.1 protein_id gnl|my_center|LOCUS_02640 39437 37455 gene locus_tag LOCUS_02650 gene cyoB 39437 37455 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704587.1 protein_id gnl|my_center|LOCUS_02650 40368 39442 gene locus_tag LOCUS_02660 gene cyoA 40368 39442 CDS product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239436.1 protein_id gnl|my_center|LOCUS_02660 42301 40817 gene locus_tag LOCUS_02670 gene ampG 42301 40817 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098442.1 protein_id gnl|my_center|LOCUS_02670 42933 42355 gene locus_tag LOCUS_02680 42933 42355 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208646.1 protein_id gnl|my_center|LOCUS_02680 43389 43706 gene locus_tag LOCUS_02690 gene bolA 43389 43706 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208644.1 protein_id gnl|my_center|LOCUS_02690 44027 45331 gene locus_tag LOCUS_02700 gene tig 44027 45331 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095856.1 protein_id gnl|my_center|LOCUS_02700 45676 46299 gene locus_tag LOCUS_02710 gene clpP 45676 46299 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095857.1 protein_id gnl|my_center|LOCUS_02710 46435 47709 gene locus_tag LOCUS_02720 gene clpX 46435 47709 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095858.1 protein_id gnl|my_center|LOCUS_02720 47899 50253 gene locus_tag LOCUS_02730 gene lon 47899 50253 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367948.1 protein_id gnl|my_center|LOCUS_02730 50455 50736 gene locus_tag LOCUS_02740 gene hupB 50455 50736 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392663.1 protein_id gnl|my_center|LOCUS_02740 50947 52815 gene locus_tag LOCUS_02750 gene ppiD 50947 52815 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095860.1 protein_id gnl|my_center|LOCUS_02750 52955 53311 gene locus_tag LOCUS_02760 52955 53311 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680322.1 protein_id gnl|my_center|LOCUS_02760 54186 53491 gene locus_tag LOCUS_02770 gene queC 54186 53491 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817229.1 protein_id gnl|my_center|LOCUS_02770 55959 54256 gene locus_tag LOCUS_02780 55959 54256 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095865.1 protein_id gnl|my_center|LOCUS_02780 56053 56868 gene locus_tag LOCUS_02790 gene cof 56053 56868 CDS product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113040.1 protein_id gnl|my_center|LOCUS_02790 57948 56908 gene locus_tag LOCUS_02800 57948 56908 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704598.1 protein_id gnl|my_center|LOCUS_02800 58062 58523 gene locus_tag LOCUS_02810 58062 58523 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163482.1 protein_id gnl|my_center|LOCUS_02810 58571 59335 gene locus_tag LOCUS_02820 58571 59335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02820 59366 60340 gene locus_tag LOCUS_02830 59366 60340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02830 60333 62102 gene locus_tag LOCUS_02840 60333 62102 CDS product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256174.1 protein_id gnl|my_center|LOCUS_02840 62368 62706 gene locus_tag LOCUS_02850 gene glnK 62368 62706 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208627.1 protein_id gnl|my_center|LOCUS_02850 62762 64027 gene locus_tag LOCUS_02860 gene amtB 62762 64027 CDS product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228344.1 protein_id gnl|my_center|LOCUS_02860 65047 64187 gene locus_tag LOCUS_02870 gene tesB 65047 64187 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367933.1 protein_id gnl|my_center|LOCUS_02870 65273 65076 gene locus_tag LOCUS_02880 65273 65076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 65276 65785 gene locus_tag LOCUS_02890 65276 65785 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779802.1 protein_id gnl|my_center|LOCUS_02890 66121 65810 gene locus_tag LOCUS_02900 66121 65810 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017800955.1 protein_id gnl|my_center|LOCUS_02900 66856 66551 gene locus_tag LOCUS_02910 66856 66551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 67102 67575 gene locus_tag LOCUS_02920 67102 67575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 68706 68488 gene locus_tag LOCUS_02930 68706 68488 CDS product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095889.1 protein_id gnl|my_center|LOCUS_02930 69116 68736 gene locus_tag LOCUS_02940 gene tomB 69116 68736 CDS product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367917.1 protein_id gnl|my_center|LOCUS_02940 70192 70806 gene locus_tag LOCUS_02950 70192 70806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816887.1 protein_id gnl|my_center|LOCUS_02950 70869 71711 gene locus_tag LOCUS_02960 70869 71711 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816886.1 protein_id gnl|my_center|LOCUS_02960 71738 72616 gene locus_tag LOCUS_02970 71738 72616 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816885.1 protein_id gnl|my_center|LOCUS_02970 73065 72808 gene locus_tag LOCUS_02980 73065 72808 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208617.1 protein_id gnl|my_center|LOCUS_02980 73249 73776 gene locus_tag LOCUS_02990 73249 73776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02990 73751 74686 gene locus_tag LOCUS_03000 73751 74686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03000 77955 74812 gene locus_tag LOCUS_03010 gene acrB 77955 74812 CDS product multidrug efflux RND transporter permease subunit AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095890.1 protein_id gnl|my_center|LOCUS_03010 79160 77973 gene locus_tag LOCUS_03020 gene acrA 79160 77973 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095891.1 protein_id gnl|my_center|LOCUS_03020 79301 79945 gene locus_tag LOCUS_03030 gene acrR 79301 79945 CDS product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208614.1 protein_id gnl|my_center|LOCUS_03030 80100 79954 gene locus_tag LOCUS_03040 80100 79954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 80784 80257 gene locus_tag LOCUS_03050 80784 80257 CDS product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208610.1 protein_id gnl|my_center|LOCUS_03050 80852 81229 gene locus_tag LOCUS_03060 80852 81229 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095896.1 protein_id gnl|my_center|LOCUS_03060 81384 81935 gene locus_tag LOCUS_03070 gene apt 81384 81935 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052987.1 protein_id gnl|my_center|LOCUS_03070 82016 83947 gene locus_tag LOCUS_03080 gene dnaX 82016 83947 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121969.1 protein_id gnl|my_center|LOCUS_03080 84001 84330 gene locus_tag LOCUS_03090 84001 84330 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 protein_id gnl|my_center|LOCUS_03090 84330 84935 gene locus_tag LOCUS_03100 gene recR 84330 84935 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095898.1 protein_id gnl|my_center|LOCUS_03100 85034 86908 gene locus_tag LOCUS_03110 gene htpG 85034 86908 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354670.1 protein_id gnl|my_center|LOCUS_03110 87025 87669 gene locus_tag LOCUS_03120 gene adk 87025 87669 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220235.1 protein_id gnl|my_center|LOCUS_03120 87786 88745 gene locus_tag LOCUS_03130 gene hemH 87786 88745 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208599.1 protein_id gnl|my_center|LOCUS_03130 90499 88811 gene locus_tag LOCUS_03140 gene ybaL 90499 88811 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546228.1 protein_id gnl|my_center|LOCUS_03140 91922 90717 gene locus_tag LOCUS_03150 gene fsr 91922 90717 CDS product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251608.1 protein_id gnl|my_center|LOCUS_03150 92213 92377 gene locus_tag LOCUS_03160 92213 92377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 92319 93932 gene locus_tag LOCUS_03170 gene ushA 92319 93932 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816863.1 protein_id gnl|my_center|LOCUS_03170 94565 94326 gene locus_tag LOCUS_03180 94565 94326 CDS product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159352.1 protein_id gnl|my_center|LOCUS_03180 94942 95394 gene locus_tag LOCUS_03190 94942 95394 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207064.1 protein_id gnl|my_center|LOCUS_03190 96215 95778 gene locus_tag LOCUS_03200 96215 95778 CDS product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211616.1 protein_id gnl|my_center|LOCUS_03200 96304 97173 gene locus_tag LOCUS_03210 96304 97173 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211617.1 protein_id gnl|my_center|LOCUS_03210 97649 97170 gene locus_tag LOCUS_03220 gene ybaK 97649 97170 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167764.1 protein_id gnl|my_center|LOCUS_03220 98626 97823 gene locus_tag LOCUS_03230 98626 97823 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208580.1 protein_id gnl|my_center|LOCUS_03230 101266 98753 gene locus_tag LOCUS_03240 gene copA 101266 98753 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083954.1 protein_id gnl|my_center|LOCUS_03240 101362 101772 gene locus_tag LOCUS_03250 gene cueR 101362 101772 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816860.1 protein_id gnl|my_center|LOCUS_03250 102262 101792 gene locus_tag LOCUS_03260 102262 101792 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095908.1 protein_id gnl|my_center|LOCUS_03260 103179 102262 gene locus_tag LOCUS_03270 103179 102262 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158246.1 protein_id gnl|my_center|LOCUS_03270 104100 103243 gene locus_tag LOCUS_03280 gene cnoX 104100 103243 CDS product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295322.1 protein_id gnl|my_center|LOCUS_03280 104993 104181 gene locus_tag LOCUS_03290 104993 104181 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208574.1 protein_id gnl|my_center|LOCUS_03290 105684 105031 gene locus_tag LOCUS_03300 gene tesA 105684 105031 CDS product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 protein_id gnl|my_center|LOCUS_03300 105622 106308 gene locus_tag LOCUS_03310 105622 106308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208572.1 protein_id gnl|my_center|LOCUS_03310 >Feature sequence004 730 476 gene locus_tag LOCUS_03320 730 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 1946 723 gene locus_tag LOCUS_03330 gene virB10 1946 723 CDS product VirB10/TraB/TrbI family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039326147.1 protein_id gnl|my_center|LOCUS_03330 2865 1960 gene locus_tag LOCUS_03340 gene virB9 2865 1960 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976329.1 protein_id gnl|my_center|LOCUS_03340 3548 2865 gene locus_tag LOCUS_03350 3548 2865 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005327.1 protein_id gnl|my_center|LOCUS_03350 3678 3541 gene locus_tag LOCUS_03360 3678 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 4813 3770 gene locus_tag LOCUS_03370 4813 3770 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513454.1 protein_id gnl|my_center|LOCUS_03370 5051 4824 gene locus_tag LOCUS_03380 5051 4824 CDS product EexN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949385.1 protein_id gnl|my_center|LOCUS_03380 5767 5063 gene locus_tag LOCUS_03390 5767 5063 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848059.1 protein_id gnl|my_center|LOCUS_03390 8532 5788 gene locus_tag LOCUS_03400 8532 5788 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096399.1 protein_id gnl|my_center|LOCUS_03400 8836 8543 gene locus_tag LOCUS_03410 8836 8543 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600171.1 protein_id gnl|my_center|LOCUS_03410 9546 8836 gene locus_tag LOCUS_03420 9546 8836 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001446637.1 protein_id gnl|my_center|LOCUS_03420 9851 9621 gene locus_tag LOCUS_03430 9851 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 10452 10243 gene locus_tag LOCUS_03440 10452 10243 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112403.1 protein_id gnl|my_center|LOCUS_03440 11026 10442 gene locus_tag LOCUS_03450 11026 10442 CDS product DUF2857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937857.1 protein_id gnl|my_center|LOCUS_03450 11237 11043 gene locus_tag LOCUS_03460 11237 11043 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 protein_id gnl|my_center|LOCUS_03460 12150 11380 gene locus_tag LOCUS_03470 12150 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039790.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03470 13169 12594 gene locus_tag LOCUS_03480 13169 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03480 13459 14691 gene locus_tag LOCUS_03490 13459 14691 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894372.1 protein_id gnl|my_center|LOCUS_03490 14696 16957 gene locus_tag LOCUS_03500 14696 16957 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964773.1 protein_id gnl|my_center|LOCUS_03500 18560 17046 gene locus_tag LOCUS_03510 18560 17046 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257231.1 protein_id gnl|my_center|LOCUS_03510 20549 18600 gene locus_tag LOCUS_03520 gene phzE 20549 18600 CDS product phenazine biosynthesis protein PhzE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118954.1 protein_id gnl|my_center|LOCUS_03520 21211 20579 gene locus_tag LOCUS_03530 21211 20579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 22015 21230 gene locus_tag LOCUS_03540 22015 21230 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 protein_id gnl|my_center|LOCUS_03540 23174 22005 gene locus_tag LOCUS_03550 23174 22005 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083700.1 protein_id gnl|my_center|LOCUS_03550 23621 25141 gene locus_tag LOCUS_03560 23621 25141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03560 25144 25374 gene locus_tag LOCUS_03570 25144 25374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 25542 29810 gene locus_tag LOCUS_03580 25542 29810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 29853 30245 gene locus_tag LOCUS_03590 29853 30245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 30360 30857 gene locus_tag LOCUS_03600 30360 30857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 31540 32157 gene locus_tag LOCUS_03610 31540 32157 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082696.1 protein_id gnl|my_center|LOCUS_03610 32366 32761 gene locus_tag LOCUS_03620 32366 32761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 35042 32799 gene locus_tag LOCUS_03630 35042 32799 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103467.1 protein_id gnl|my_center|LOCUS_03630 35251 36435 gene locus_tag LOCUS_03640 35251 36435 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384188.1 protein_id gnl|my_center|LOCUS_03640 36432 37718 gene locus_tag LOCUS_03650 36432 37718 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530314.1 protein_id gnl|my_center|LOCUS_03650 37864 39360 gene locus_tag LOCUS_03660 37864 39360 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112370.1 protein_id gnl|my_center|LOCUS_03660 39484 39630 gene locus_tag LOCUS_03670 39484 39630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 41232 40057 gene locus_tag LOCUS_03680 41232 40057 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615166.1 protein_id gnl|my_center|LOCUS_03680 42538 41447 gene locus_tag LOCUS_03690 gene ychF 42538 41447 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705079.1 protein_id gnl|my_center|LOCUS_03690 43323 42730 gene locus_tag LOCUS_03700 gene pth 43323 42730 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705080.1 protein_id gnl|my_center|LOCUS_03700 43584 43847 gene locus_tag LOCUS_03710 gene ychH 43584 43847 CDS product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096227.1 protein_id gnl|my_center|LOCUS_03710 44858 43911 gene locus_tag LOCUS_03720 gene prs 44858 43911 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518537.1 protein_id gnl|my_center|LOCUS_03720 45855 44998 gene locus_tag LOCUS_03730 gene ispE 45855 44998 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133845424.1 protein_id gnl|my_center|LOCUS_03730 46475 45852 gene locus_tag LOCUS_03740 gene lolB 46475 45852 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130702.1 protein_id gnl|my_center|LOCUS_03740 46690 47946 gene locus_tag LOCUS_03750 gene hemA 46690 47946 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173208.1 protein_id gnl|my_center|LOCUS_03750 47984 49066 gene locus_tag LOCUS_03760 gene prfA 47984 49066 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096233.1 protein_id gnl|my_center|LOCUS_03760 49068 49898 gene locus_tag LOCUS_03770 gene prmC 49068 49898 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705084.1 protein_id gnl|my_center|LOCUS_03770 49920 50318 gene locus_tag LOCUS_03780 49920 50318 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169111.1 protein_id gnl|my_center|LOCUS_03780 50315 51124 gene locus_tag LOCUS_03790 gene sirB1 50315 51124 CDS product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874130.1 protein_id gnl|my_center|LOCUS_03790 51161 52015 gene locus_tag LOCUS_03800 gene kdsA 51161 52015 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367105.1 protein_id gnl|my_center|LOCUS_03800 53177 52080 gene locus_tag LOCUS_03810 gene chaA 53177 52080 CDS product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 protein_id gnl|my_center|LOCUS_03810 54093 54794 gene locus_tag LOCUS_03820 54093 54794 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096242.1 protein_id gnl|my_center|LOCUS_03820 56184 54808 gene locus_tag LOCUS_03830 56184 54808 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705448.1 protein_id gnl|my_center|LOCUS_03830 57198 56260 gene locus_tag LOCUS_03840 57198 56260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705454.1 protein_id gnl|my_center|LOCUS_03840 57989 57213 gene locus_tag LOCUS_03850 57989 57213 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705455.1 protein_id gnl|my_center|LOCUS_03850 59152 57986 gene locus_tag LOCUS_03860 59152 57986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 59865 59188 gene locus_tag LOCUS_03870 gene tagF 59865 59188 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366557.1 protein_id gnl|my_center|LOCUS_03870 61990 59873 gene locus_tag LOCUS_03880 61990 59873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 63210 61990 gene locus_tag LOCUS_03890 63210 61990 CDS product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705462.1 protein_id gnl|my_center|LOCUS_03890 63799 63308 gene locus_tag LOCUS_03900 63799 63308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096174.1 protein_id gnl|my_center|LOCUS_03900 64592 64296 gene locus_tag LOCUS_03910 64592 64296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03910 65133 64594 gene locus_tag LOCUS_03920 65133 64594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03920 66848 65748 gene locus_tag LOCUS_03930 66848 65748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 67722 68756 gene locus_tag LOCUS_03940 gene astA 67722 68756 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989419.1 protein_id gnl|my_center|LOCUS_03940 68753 70222 gene locus_tag LOCUS_03950 gene astD 68753 70222 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177206.1 protein_id gnl|my_center|LOCUS_03950 70219 71547 gene locus_tag LOCUS_03960 gene astB 70219 71547 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994973.1 protein_id gnl|my_center|LOCUS_03960 71622 72593 gene locus_tag LOCUS_03970 gene astE 71622 72593 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705766.1 protein_id gnl|my_center|LOCUS_03970 73004 73492 gene locus_tag LOCUS_03980 gene spy 73004 73492 CDS product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228972.1 protein_id gnl|my_center|LOCUS_03980 74502 73597 gene locus_tag LOCUS_03990 gene yddG 74502 73597 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419505.1 protein_id gnl|my_center|LOCUS_03990 75390 74563 gene locus_tag LOCUS_04000 gene nadE 75390 74563 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097024.1 protein_id gnl|my_center|LOCUS_04000 75688 76023 gene locus_tag LOCUS_04010 gene osmE 75688 76023 CDS product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366182.1 protein_id gnl|my_center|LOCUS_04010 76476 76084 gene locus_tag LOCUS_04020 76476 76084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 78918 76639 gene locus_tag LOCUS_04030 gene katE 78918 76639 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097017.1 protein_id gnl|my_center|LOCUS_04030 79710 79042 gene locus_tag LOCUS_04040 gene hxpB 79710 79042 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106834.1 protein_id gnl|my_center|LOCUS_04040 79879 80415 gene locus_tag LOCUS_04050 79879 80415 CDS product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705757.1 protein_id gnl|my_center|LOCUS_04050 81318 80425 gene locus_tag LOCUS_04060 81318 80425 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816220.1 protein_id gnl|my_center|LOCUS_04060 81758 82513 gene locus_tag LOCUS_04070 81758 82513 CDS product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097007.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence005 477 241 gene locus_tag LOCUS_04080 477 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1522 791 gene locus_tag LOCUS_04090 gene rlmB 1522 791 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095294.1 protein_id gnl|my_center|LOCUS_04090 4049 1605 gene locus_tag LOCUS_04100 gene rnr 4049 1605 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076357.1 protein_id gnl|my_center|LOCUS_04100 4308 4066 gene locus_tag LOCUS_04110 4308 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 5753 4455 gene locus_tag LOCUS_04120 5753 4455 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006178975.1 protein_id gnl|my_center|LOCUS_04120 6106 5906 gene locus_tag LOCUS_04130 6106 5906 CDS product DUF2065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175502.1 protein_id gnl|my_center|LOCUS_04130 6873 6295 gene locus_tag LOCUS_04140 gene gfa 6873 6295 CDS product S-(hydroxymethyl)glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268116.1 protein_id gnl|my_center|LOCUS_04140 8051 6942 gene locus_tag LOCUS_04150 gene frmA 8051 6942 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842109.1 protein_id gnl|my_center|LOCUS_04150 8367 8092 gene locus_tag LOCUS_04160 8367 8092 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038488.1 protein_id gnl|my_center|LOCUS_04160 9683 8679 gene locus_tag LOCUS_04170 gene hflC 9683 8679 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 protein_id gnl|my_center|LOCUS_04170 10931 9687 gene locus_tag LOCUS_04180 gene hflK 10931 9687 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095289.1 protein_id gnl|my_center|LOCUS_04180 12280 11000 gene locus_tag LOCUS_04190 gene hflX 12280 11000 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095288.1 protein_id gnl|my_center|LOCUS_04190 12675 12361 gene locus_tag LOCUS_04200 gene hfq 12675 12361 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095287.1 protein_id gnl|my_center|LOCUS_04200 13717 12779 gene locus_tag LOCUS_04210 gene miaA 13717 12779 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130832081.1 protein_id gnl|my_center|LOCUS_04210 15551 13722 gene locus_tag LOCUS_04220 gene mutL 15551 13722 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095285.1 protein_id gnl|my_center|LOCUS_04220 17312 15636 gene locus_tag LOCUS_04230 gene amiB 17312 15636 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628029.1 protein_id gnl|my_center|LOCUS_04230 17785 17309 gene locus_tag LOCUS_04240 gene tsaE 17785 17309 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 protein_id gnl|my_center|LOCUS_04240 19305 17782 gene locus_tag LOCUS_04250 gene nnr 19305 17782 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418520.1 protein_id gnl|my_center|LOCUS_04250 19304 20443 gene locus_tag LOCUS_04260 gene queG 19304 20443 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704164.1 protein_id gnl|my_center|LOCUS_04260 22911 21082 gene locus_tag LOCUS_04270 22911 21082 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533482.1 protein_id gnl|my_center|LOCUS_04270 24785 23217 gene locus_tag LOCUS_04280 24785 23217 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206021.1 protein_id gnl|my_center|LOCUS_04280 24941 25540 gene locus_tag LOCUS_04290 gene betI 24941 25540 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202513.1 protein_id gnl|my_center|LOCUS_04290 25554 27026 gene locus_tag LOCUS_04300 gene betB 25554 27026 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114436.1 protein_id gnl|my_center|LOCUS_04300 27043 28719 gene locus_tag LOCUS_04310 gene betA 27043 28719 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402225.1 protein_id gnl|my_center|LOCUS_04310 29265 29984 gene locus_tag LOCUS_04320 29265 29984 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811701.1 protein_id gnl|my_center|LOCUS_04320 30123 31706 gene locus_tag LOCUS_04330 30123 31706 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064865.1 protein_id gnl|my_center|LOCUS_04330 31803 32792 gene locus_tag LOCUS_04340 31803 32792 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815564.1 protein_id gnl|my_center|LOCUS_04340 32794 33639 gene locus_tag LOCUS_04350 32794 33639 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815566.1 protein_id gnl|my_center|LOCUS_04350 33636 35294 gene locus_tag LOCUS_04360 33636 35294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813166.1 protein_id gnl|my_center|LOCUS_04360 35291 37012 gene locus_tag LOCUS_04370 35291 37012 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089435.1 protein_id gnl|my_center|LOCUS_04370 36978 37202 gene locus_tag LOCUS_04380 36978 37202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 37202 38650 gene locus_tag LOCUS_04390 37202 38650 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_04390 38687 39712 gene locus_tag LOCUS_04400 38687 39712 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173775.1 protein_id gnl|my_center|LOCUS_04400 40242 40388 gene locus_tag LOCUS_04410 40242 40388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 41913 40726 gene locus_tag LOCUS_04420 41913 40726 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420964.1 protein_id gnl|my_center|LOCUS_04420 42153 43658 gene locus_tag LOCUS_04430 gene pitA 42153 43658 CDS product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157393.1 protein_id gnl|my_center|LOCUS_04430 44066 43731 gene locus_tag LOCUS_04440 gene uspB 44066 43731 CDS product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626193.1 protein_id gnl|my_center|LOCUS_04440 44683 45120 gene locus_tag LOCUS_04450 gene uspA 44683 45120 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145166.1 protein_id gnl|my_center|LOCUS_04450 46030 45278 gene locus_tag LOCUS_04460 gene rsmJ 46030 45278 CDS product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686608.1 protein_id gnl|my_center|LOCUS_04460 48080 46038 gene locus_tag LOCUS_04470 gene prlC 48080 46038 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184173.1 protein_id gnl|my_center|LOCUS_04470 48471 49313 gene locus_tag LOCUS_04480 48471 49313 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388937.1 protein_id gnl|my_center|LOCUS_04480 50241 49330 gene locus_tag LOCUS_04490 gene rnz 50241 49330 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706158.1 protein_id gnl|my_center|LOCUS_04490 50526 51878 gene locus_tag LOCUS_04500 gene gorA 50526 51878 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160795.1 protein_id gnl|my_center|LOCUS_04500 52227 53915 gene locus_tag LOCUS_04510 52227 53915 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097931.1 protein_id gnl|my_center|LOCUS_04510 53909 54628 gene locus_tag LOCUS_04520 gene btsR 53909 54628 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097930.1 protein_id gnl|my_center|LOCUS_04520 55632 54670 gene locus_tag LOCUS_04530 gene yjiA 55632 54670 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368442.1 protein_id gnl|my_center|LOCUS_04530 55855 55652 gene locus_tag LOCUS_04540 55855 55652 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467859.1 protein_id gnl|my_center|LOCUS_04540 58098 55942 gene locus_tag LOCUS_04550 gene btsT 58098 55942 CDS product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299714.1 protein_id gnl|my_center|LOCUS_04550 60024 59128 gene locus_tag LOCUS_04560 60024 59128 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971744.1 protein_id gnl|my_center|LOCUS_04560 60322 61473 gene locus_tag LOCUS_04570 60322 61473 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247022.1 protein_id gnl|my_center|LOCUS_04570 63275 61443 gene locus_tag LOCUS_04580 63275 61443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247023.1 protein_id gnl|my_center|LOCUS_04580 63769 63392 gene locus_tag LOCUS_04590 gene crcB 63769 63392 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001318207.1 protein_id gnl|my_center|LOCUS_04590 65358 64096 gene locus_tag LOCUS_04600 65358 64096 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_04600 66198 65638 gene locus_tag LOCUS_04610 gene mntP 66198 65638 CDS product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211065.1 protein_id gnl|my_center|LOCUS_04610 66270 66470 gene locus_tag LOCUS_04620 66270 66470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 66475 66849 gene locus_tag LOCUS_04630 66475 66849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 67375 68991 gene locus_tag LOCUS_04640 gene mqo 67375 68991 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758077.1 protein_id gnl|my_center|LOCUS_04640 70349 69042 gene locus_tag LOCUS_04650 70349 69042 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 protein_id gnl|my_center|LOCUS_04650 71127 70543 gene locus_tag LOCUS_04660 71127 70543 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076557.1 protein_id gnl|my_center|LOCUS_04660 71266 72720 gene locus_tag LOCUS_04670 71266 72720 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817442.1 protein_id gnl|my_center|LOCUS_04670 73519 72761 gene locus_tag LOCUS_04680 73519 72761 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_04680 73680 74534 gene locus_tag LOCUS_04690 73680 74534 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099205.1 protein_id gnl|my_center|LOCUS_04690 74708 75715 gene locus_tag LOCUS_04700 gene yhjD 74708 75715 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157374.1 protein_id gnl|my_center|LOCUS_04700 76277 75795 gene locus_tag LOCUS_04710 76277 75795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence006 165 89 gene locus_tag LOCUS_t00010 165 89 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2053 386 gene locus_tag LOCUS_04720 gene asnB 2053 386 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816830.1 protein_id gnl|my_center|LOCUS_04720 3091 2339 gene locus_tag LOCUS_04730 gene nagD 3091 2339 CDS product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153143.1 protein_id gnl|my_center|LOCUS_04730 4353 3133 gene locus_tag LOCUS_04740 4353 3133 CDS product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097570.1 protein_id gnl|my_center|LOCUS_04740 5509 4361 gene locus_tag LOCUS_04750 gene nagA 5509 4361 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097569.1 protein_id gnl|my_center|LOCUS_04750 6453 5653 gene locus_tag LOCUS_04760 gene nagB 6453 5653 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097568.1 protein_id gnl|my_center|LOCUS_04760 6901 8931 gene locus_tag LOCUS_04770 gene nagE 6901 8931 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816827.1 protein_id gnl|my_center|LOCUS_04770 9085 10752 gene locus_tag LOCUS_04780 gene glnS 9085 10752 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704748.1 protein_id gnl|my_center|LOCUS_04780 11300 10857 gene locus_tag LOCUS_04790 gene fur 11300 10857 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131699.1 protein_id gnl|my_center|LOCUS_04790 12333 11803 gene locus_tag LOCUS_04800 gene fldA 12333 11803 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367697.1 protein_id gnl|my_center|LOCUS_04800 12758 12477 gene locus_tag LOCUS_04810 gene ybfE 12758 12477 CDS product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602226.1 protein_id gnl|my_center|LOCUS_04810 13679 12915 gene locus_tag LOCUS_04820 gene ybfF 13679 12915 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704754.1 protein_id gnl|my_center|LOCUS_04820 13935 14492 gene locus_tag LOCUS_04830 gene seqA 13935 14492 CDS product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816824.1 protein_id gnl|my_center|LOCUS_04830 14517 16157 gene locus_tag LOCUS_04840 gene pgm 14517 16157 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097560.1 protein_id gnl|my_center|LOCUS_04840 16349 17092 gene locus_tag LOCUS_04850 16349 17092 CDS product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621132.1 protein_id gnl|my_center|LOCUS_04850 17643 18299 gene locus_tag LOCUS_04860 gene pxpB 17643 18299 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168006.1 protein_id gnl|my_center|LOCUS_04860 18293 19225 gene locus_tag LOCUS_04870 gene pxpC 18293 19225 CDS product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912729.1 protein_id gnl|my_center|LOCUS_04870 19215 19952 gene locus_tag LOCUS_04880 gene pxpA 19215 19952 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816815.1 protein_id gnl|my_center|LOCUS_04880 20072 20800 gene locus_tag LOCUS_04890 20072 20800 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209660.1 protein_id gnl|my_center|LOCUS_04890 20800 21822 gene locus_tag LOCUS_04900 20800 21822 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209661.1 protein_id gnl|my_center|LOCUS_04900 23205 21922 gene locus_tag LOCUS_04910 gene gltA 23205 21922 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367676.1 protein_id gnl|my_center|LOCUS_04910 23935 24222 gene locus_tag LOCUS_04920 23935 24222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 24216 24563 gene locus_tag LOCUS_04930 gene sdhD 24216 24563 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700691.1 protein_id gnl|my_center|LOCUS_04930 24563 26329 gene locus_tag LOCUS_04940 gene sdhA 24563 26329 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 protein_id gnl|my_center|LOCUS_04940 26346 27062 gene locus_tag LOCUS_04950 gene sdhB 26346 27062 CDS product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235263.1 protein_id gnl|my_center|LOCUS_04950 27324 30131 gene locus_tag LOCUS_04960 gene sucA 27324 30131 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622290.1 protein_id gnl|my_center|LOCUS_04960 30147 31367 gene locus_tag LOCUS_04970 gene odhB 30147 31367 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099820.1 protein_id gnl|my_center|LOCUS_04970 31433 32599 gene locus_tag LOCUS_04980 gene sucC 31433 32599 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210728.1 protein_id gnl|my_center|LOCUS_04980 32599 33474 gene locus_tag LOCUS_04990 gene sucD 32599 33474 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367669.1 protein_id gnl|my_center|LOCUS_04990 34429 35997 gene locus_tag LOCUS_05000 gene cydA 34429 35997 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979005.1 protein_id gnl|my_center|LOCUS_05000 36010 37149 gene locus_tag LOCUS_05010 gene cydB 36010 37149 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 protein_id gnl|my_center|LOCUS_05010 37278 37571 gene locus_tag LOCUS_05020 gene ybgE 37278 37571 CDS product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097534.1 protein_id gnl|my_center|LOCUS_05020 37680 38348 gene locus_tag LOCUS_05030 37680 38348 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173921.1 protein_id gnl|my_center|LOCUS_05030 39752 38469 gene locus_tag LOCUS_05040 39752 38469 CDS product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171308.1 protein_id gnl|my_center|LOCUS_05040 41727 40039 gene locus_tag LOCUS_05050 41727 40039 CDS product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171180.1 protein_id gnl|my_center|LOCUS_05050 42017 42388 gene locus_tag LOCUS_05060 42017 42388 CDS product inner membrane protein YbjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097375.1 protein_id gnl|my_center|LOCUS_05060 42509 43237 gene locus_tag LOCUS_05070 gene nfsA 42509 43237 CDS product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097374.1 protein_id gnl|my_center|LOCUS_05070 43561 44040 gene locus_tag LOCUS_05080 43561 44040 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162876.1 protein_id gnl|my_center|LOCUS_05080 44542 45651 gene locus_tag LOCUS_05090 gene potF 44542 45651 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097372.1 protein_id gnl|my_center|LOCUS_05090 45766 46905 gene locus_tag LOCUS_05100 gene potG 45766 46905 CDS product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069299.1 protein_id gnl|my_center|LOCUS_05100 46916 47872 gene locus_tag LOCUS_05110 gene potH 46916 47872 CDS product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097370.1 protein_id gnl|my_center|LOCUS_05110 47869 48714 gene locus_tag LOCUS_05120 gene potI 47869 48714 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097369.1 protein_id gnl|my_center|LOCUS_05120 48800 49279 gene locus_tag LOCUS_05130 48800 49279 CDS product YbjO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097368.1 protein_id gnl|my_center|LOCUS_05130 49339 50484 gene locus_tag LOCUS_05140 gene rlmC 49339 50484 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208756.1 protein_id gnl|my_center|LOCUS_05140 51155 50487 gene locus_tag LOCUS_05150 gene artM 51155 50487 CDS product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097363.1 protein_id gnl|my_center|LOCUS_05150 51871 51155 gene locus_tag LOCUS_05160 gene artQ 51871 51155 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097362.1 protein_id gnl|my_center|LOCUS_05160 52610 51876 gene locus_tag LOCUS_05170 gene artJ 52610 51876 CDS product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211368.1 protein_id gnl|my_center|LOCUS_05170 53402 52623 gene locus_tag LOCUS_05180 gene artP 53402 52623 CDS product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027186.1 protein_id gnl|my_center|LOCUS_05180 53637 53957 gene locus_tag LOCUS_05190 53637 53957 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174327.1 protein_id gnl|my_center|LOCUS_05190 53954 54781 gene locus_tag LOCUS_05200 gene amiD 53954 54781 CDS product N-acetylmuramoyl-L-alanine amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255157.1 protein_id gnl|my_center|LOCUS_05200 55812 54808 gene locus_tag LOCUS_05210 gene ltaE 55812 54808 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211362.1 protein_id gnl|my_center|LOCUS_05210 57594 55873 gene locus_tag LOCUS_05220 gene poxB 57594 55873 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816024.1 protein_id gnl|my_center|LOCUS_05220 58755 57838 gene locus_tag LOCUS_05230 58755 57838 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097331.1 protein_id gnl|my_center|LOCUS_05230 59255 59028 gene locus_tag LOCUS_05240 gene cspD 59255 59028 CDS product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 protein_id gnl|my_center|LOCUS_05240 59572 59892 gene locus_tag LOCUS_05250 gene clpS 59572 59892 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520781.1 protein_id gnl|my_center|LOCUS_05250 59949 62225 gene locus_tag LOCUS_05260 gene clpA 59949 62225 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162786.1 protein_id gnl|my_center|LOCUS_05260 62729 62511 gene locus_tag LOCUS_05270 gene infA 62729 62511 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211347.1 protein_id gnl|my_center|LOCUS_05270 63773 63087 gene locus_tag LOCUS_05280 gene aat 63773 63087 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241650.1 protein_id gnl|my_center|LOCUS_05280 65651 63912 gene locus_tag LOCUS_05290 gene cydC 65651 63912 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202188.1 protein_id gnl|my_center|LOCUS_05290 67420 65651 gene locus_tag LOCUS_05300 gene cydD 67420 65651 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217690.1 protein_id gnl|my_center|LOCUS_05300 68546 67578 gene locus_tag LOCUS_05310 gene trxB 68546 67578 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097321.1 protein_id gnl|my_center|LOCUS_05310 69067 69561 gene locus_tag LOCUS_05320 gene lrp 69067 69561 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 protein_id gnl|my_center|LOCUS_05320 69682 72960 gene locus_tag LOCUS_05330 69682 72960 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171070.1 protein_id gnl|my_center|LOCUS_05330 73152 73766 gene locus_tag LOCUS_05340 gene lolA 73152 73766 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171053.1 protein_id gnl|my_center|LOCUS_05340 73774 75117 gene locus_tag LOCUS_05350 gene rarA 73774 75117 CDS product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067785.1 protein_id gnl|my_center|LOCUS_05350 75220 76512 gene locus_tag LOCUS_05360 gene serS 75220 76512 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211336.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence007 249 1232 gene locus_tag LOCUS_05370 gene zntB 249 1232 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169583.1 protein_id gnl|my_center|LOCUS_05370 2477 1557 gene locus_tag LOCUS_05380 gene ttcA 2477 1557 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 protein_id gnl|my_center|LOCUS_05380 2664 4043 gene locus_tag LOCUS_05390 gene dbpA 2664 4043 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816168.1 protein_id gnl|my_center|LOCUS_05390 4414 4121 gene locus_tag LOCUS_05400 4414 4121 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104358.1 protein_id gnl|my_center|LOCUS_05400 4969 5241 gene locus_tag LOCUS_05410 4969 5241 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705621.1 protein_id gnl|my_center|LOCUS_05410 6290 5295 gene locus_tag LOCUS_05420 gene ldhA 6290 5295 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762205.1 protein_id gnl|my_center|LOCUS_05420 6491 9109 gene locus_tag LOCUS_05430 6491 9109 CDS product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705618.1 protein_id gnl|my_center|LOCUS_05430 9109 9303 gene locus_tag LOCUS_05440 9109 9303 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688201.1 protein_id gnl|my_center|LOCUS_05440 10049 9450 gene locus_tag LOCUS_05450 gene azoR 10049 9450 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816349.1 protein_id gnl|my_center|LOCUS_05450 10374 14216 gene locus_tag LOCUS_05460 gene hrpA 10374 14216 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420907.1 protein_id gnl|my_center|LOCUS_05460 15029 14226 gene locus_tag LOCUS_05470 15029 14226 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260865.1 protein_id gnl|my_center|LOCUS_05470 15893 15528 gene locus_tag LOCUS_05480 15893 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 17390 16086 gene locus_tag LOCUS_05490 gene rstB 17390 16086 CDS product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192505.1 protein_id gnl|my_center|LOCUS_05490 18118 17387 gene locus_tag LOCUS_05500 gene rstA 18118 17387 CDS product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096874.1 protein_id gnl|my_center|LOCUS_05500 18295 18708 gene locus_tag LOCUS_05510 18295 18708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816341.1 protein_id gnl|my_center|LOCUS_05510 20098 19145 gene locus_tag LOCUS_05520 gene ydgH 20098 19145 CDS product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211018.1 protein_id gnl|my_center|LOCUS_05520 20214 20387 gene locus_tag LOCUS_05530 20214 20387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 20612 22144 gene locus_tag LOCUS_05540 gene pntA 20612 22144 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816338.1 protein_id gnl|my_center|LOCUS_05540 22153 23544 gene locus_tag LOCUS_05550 gene pntB 22153 23544 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096868.1 protein_id gnl|my_center|LOCUS_05550 23734 24051 gene locus_tag LOCUS_05560 23734 24051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 24070 24426 gene locus_tag LOCUS_05570 24070 24426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05570 24432 24617 gene locus_tag LOCUS_05580 24432 24617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 24916 25122 gene locus_tag LOCUS_05590 24916 25122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05590 26396 25431 gene locus_tag LOCUS_05600 gene uspE 26396 25431 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262145.1 protein_id gnl|my_center|LOCUS_05600 27269 26517 gene locus_tag LOCUS_05610 gene fnr 27269 26517 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 protein_id gnl|my_center|LOCUS_05610 28941 27478 gene locus_tag LOCUS_05620 gene xylB 28941 27478 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706072.1 protein_id gnl|my_center|LOCUS_05620 29294 29085 gene locus_tag LOCUS_05630 29294 29085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 29473 30432 gene locus_tag LOCUS_05640 29473 30432 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211003.1 protein_id gnl|my_center|LOCUS_05640 31424 30501 gene locus_tag LOCUS_05650 31424 30501 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096674.1 protein_id gnl|my_center|LOCUS_05650 32134 31697 gene locus_tag LOCUS_05660 32134 31697 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704866.1 protein_id gnl|my_center|LOCUS_05660 33130 32282 gene locus_tag LOCUS_05670 33130 32282 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446327.1 protein_id gnl|my_center|LOCUS_05670 33388 34557 gene locus_tag LOCUS_05680 33388 34557 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705579.1 protein_id gnl|my_center|LOCUS_05680 34581 35357 gene locus_tag LOCUS_05690 34581 35357 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705578.1 protein_id gnl|my_center|LOCUS_05690 35548 35883 gene locus_tag LOCUS_05700 35548 35883 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_05700 36353 37387 gene locus_tag LOCUS_05710 gene rhaT 36353 37387 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099333.1 protein_id gnl|my_center|LOCUS_05710 39122 37422 gene locus_tag LOCUS_05720 39122 37422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 39424 40896 gene locus_tag LOCUS_05730 gene rhaB 39424 40896 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209105.1 protein_id gnl|my_center|LOCUS_05730 40893 42149 gene locus_tag LOCUS_05740 gene rhaA 40893 42149 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311268.1 protein_id gnl|my_center|LOCUS_05740 42161 43003 gene locus_tag LOCUS_05750 gene rhaD 42161 43003 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209103.1 protein_id gnl|my_center|LOCUS_05750 42993 43307 gene locus_tag LOCUS_05760 gene rhaM 42993 43307 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619493.1 protein_id gnl|my_center|LOCUS_05760 44022 43360 gene locus_tag LOCUS_05770 44022 43360 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097103.1 protein_id gnl|my_center|LOCUS_05770 44342 44599 gene locus_tag LOCUS_05780 44342 44599 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210240.1 protein_id gnl|my_center|LOCUS_05780 44688 44945 gene locus_tag LOCUS_05790 gene bhsA 44688 44945 CDS product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097102.1 protein_id gnl|my_center|LOCUS_05790 45030 46271 gene locus_tag LOCUS_05800 gene zigA 45030 46271 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_05800 47556 46372 gene locus_tag LOCUS_05810 gene ydeA 47556 46372 CDS product L-arabinose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210799.1 protein_id gnl|my_center|LOCUS_05810 48149 48634 gene locus_tag LOCUS_05820 48149 48634 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705070.1 protein_id gnl|my_center|LOCUS_05820 49345 48782 gene locus_tag LOCUS_05830 49345 48782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 49494 49640 gene locus_tag LOCUS_05840 49494 49640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 50248 50601 gene locus_tag LOCUS_05850 50248 50601 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096738.1 protein_id gnl|my_center|LOCUS_05850 50695 51159 gene locus_tag LOCUS_05860 50695 51159 CDS product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214288.1 protein_id gnl|my_center|LOCUS_05860 51168 51428 gene locus_tag LOCUS_05870 51168 51428 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210098.1 protein_id gnl|my_center|LOCUS_05870 52630 51437 gene locus_tag LOCUS_05880 52630 51437 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816265.1 protein_id gnl|my_center|LOCUS_05880 52727 53302 gene locus_tag LOCUS_05890 52727 53302 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705566.1 protein_id gnl|my_center|LOCUS_05890 55222 53306 gene locus_tag LOCUS_05900 55222 53306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 55496 56671 gene locus_tag LOCUS_05910 gene ssuD 55496 56671 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528162.1 protein_id gnl|my_center|LOCUS_05910 56713 58122 gene locus_tag LOCUS_05920 56713 58122 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393161.1 protein_id gnl|my_center|LOCUS_05920 58237 59652 gene locus_tag LOCUS_05930 58237 59652 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268048.1 protein_id gnl|my_center|LOCUS_05930 59649 60668 gene locus_tag LOCUS_05940 59649 60668 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730807.1 protein_id gnl|my_center|LOCUS_05940 60665 61366 gene locus_tag LOCUS_05950 60665 61366 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730808.1 protein_id gnl|my_center|LOCUS_05950 61369 62247 gene locus_tag LOCUS_05960 61369 62247 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730809.1 protein_id gnl|my_center|LOCUS_05960 62585 63898 gene locus_tag LOCUS_05970 62585 63898 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205514.1 protein_id gnl|my_center|LOCUS_05970 63911 65131 gene locus_tag LOCUS_05980 63911 65131 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539126.1 protein_id gnl|my_center|LOCUS_05980 66128 65178 gene locus_tag LOCUS_05990 66128 65178 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091913.1 protein_id gnl|my_center|LOCUS_05990 67803 67423 gene locus_tag LOCUS_06000 67803 67423 CDS product DUF4354 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114920.1 protein_id gnl|my_center|LOCUS_06000 68159 67932 gene locus_tag LOCUS_06010 68159 67932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 68544 68347 gene locus_tag LOCUS_06020 68544 68347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 70841 68799 gene locus_tag LOCUS_06030 gene pqqU 70841 68799 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446029.1 protein_id gnl|my_center|LOCUS_06030 71726 74131 gene locus_tag LOCUS_06040 71726 74131 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267786.1 protein_id gnl|my_center|LOCUS_06040 74524 74330 gene locus_tag LOCUS_06050 74524 74330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 74669 74481 gene locus_tag LOCUS_06060 74669 74481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence008 126 2384 gene locus_tag LOCUS_06070 gene pdeF 126 2384 CDS product cyclic-guanylate-specific phosphodiesterase PdeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772738.1 protein_id gnl|my_center|LOCUS_06070 2989 2381 gene locus_tag LOCUS_06080 gene tehB 2989 2381 CDS product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705573.1 protein_id gnl|my_center|LOCUS_06080 4699 3161 gene locus_tag LOCUS_06090 gene ppx 4699 3161 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832869.1 protein_id gnl|my_center|LOCUS_06090 6766 4706 gene locus_tag LOCUS_06100 gene ppk1 6766 4706 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529576.1 protein_id gnl|my_center|LOCUS_06100 7587 6949 gene locus_tag LOCUS_06110 gene purN 7587 6949 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098242.1 protein_id gnl|my_center|LOCUS_06110 8624 7584 gene locus_tag LOCUS_06120 gene purM 8624 7584 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098241.1 protein_id gnl|my_center|LOCUS_06120 8868 9494 gene locus_tag LOCUS_06130 gene upp 8868 9494 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162121.1 protein_id gnl|my_center|LOCUS_06130 9498 9695 gene locus_tag LOCUS_06140 9498 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 9741 11024 gene locus_tag LOCUS_06150 gene uraA 9741 11024 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703151.1 protein_id gnl|my_center|LOCUS_06150 11107 11814 gene locus_tag LOCUS_06160 11107 11814 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100388.1 protein_id gnl|my_center|LOCUS_06160 12195 11842 gene locus_tag LOCUS_06170 gene arsC 12195 11842 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815819.1 protein_id gnl|my_center|LOCUS_06170 13187 12426 gene locus_tag LOCUS_06180 13187 12426 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039297.1 protein_id gnl|my_center|LOCUS_06180 14899 13433 gene locus_tag LOCUS_06190 gene bepA 14899 13433 CDS product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489659.1 protein_id gnl|my_center|LOCUS_06190 15254 16291 gene locus_tag LOCUS_06200 15254 16291 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763739.1 protein_id gnl|my_center|LOCUS_06200 16291 17310 gene locus_tag LOCUS_06210 16291 17310 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402156.1 protein_id gnl|my_center|LOCUS_06210 17400 18194 gene locus_tag LOCUS_06220 17400 18194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763744.1 protein_id gnl|my_center|LOCUS_06220 18191 19012 gene locus_tag LOCUS_06230 18191 19012 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244499.1 protein_id gnl|my_center|LOCUS_06230 19012 20028 gene locus_tag LOCUS_06240 19012 20028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269175.1 protein_id gnl|my_center|LOCUS_06240 20018 20848 gene locus_tag LOCUS_06250 20018 20848 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763753.1 protein_id gnl|my_center|LOCUS_06250 21421 20954 gene locus_tag LOCUS_06260 gene bcp 21421 20954 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098229.1 protein_id gnl|my_center|LOCUS_06260 21998 21399 gene locus_tag LOCUS_06270 21998 21399 CDS product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098228.1 protein_id gnl|my_center|LOCUS_06270 22157 23035 gene locus_tag LOCUS_06280 gene dapA 22157 23035 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295469.1 protein_id gnl|my_center|LOCUS_06280 23050 24084 gene locus_tag LOCUS_06290 gene bamC 23050 24084 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331881.1 protein_id gnl|my_center|LOCUS_06290 24279 24992 gene locus_tag LOCUS_06300 24279 24992 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501631.1 protein_id gnl|my_center|LOCUS_06300 25198 26058 gene locus_tag LOCUS_06310 25198 26058 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267503.1 protein_id gnl|my_center|LOCUS_06310 26062 28050 gene locus_tag LOCUS_06320 gene tmcA 26062 28050 CDS product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829314.1 protein_id gnl|my_center|LOCUS_06320 28135 28833 gene locus_tag LOCUS_06330 gene ypfH 28135 28833 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679799.1 protein_id gnl|my_center|LOCUS_06330 29069 28881 gene locus_tag LOCUS_06340 29069 28881 CDS product YpfN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383836.1 protein_id gnl|my_center|LOCUS_06340 30219 29092 gene locus_tag LOCUS_06350 gene dapE 30219 29092 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277830.1 protein_id gnl|my_center|LOCUS_06350 30604 30221 gene locus_tag LOCUS_06360 30604 30221 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172345.1 protein_id gnl|my_center|LOCUS_06360 30940 31125 gene locus_tag LOCUS_06370 30940 31125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 31135 31407 gene locus_tag LOCUS_06380 31135 31407 CDS product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179111.1 protein_id gnl|my_center|LOCUS_06380 31374 31583 gene locus_tag LOCUS_06390 31374 31583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06390 31614 31868 gene locus_tag LOCUS_06400 31614 31868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06400 32046 32336 gene locus_tag LOCUS_06410 32046 32336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 35665 32552 gene locus_tag LOCUS_06420 gene acrD 35665 32552 CDS product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263083.1 protein_id gnl|my_center|LOCUS_06420 36163 37659 gene locus_tag LOCUS_06430 gene ansP 36163 37659 CDS product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684770.1 protein_id gnl|my_center|LOCUS_06430 38358 37684 gene locus_tag LOCUS_06440 gene narL 38358 37684 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070487.1 protein_id gnl|my_center|LOCUS_06440 40157 38370 gene locus_tag LOCUS_06450 gene narX 40157 38370 CDS product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816562.1 protein_id gnl|my_center|LOCUS_06450 40508 41902 gene locus_tag LOCUS_06460 40508 41902 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705095.1 protein_id gnl|my_center|LOCUS_06460 42191 45952 gene locus_tag LOCUS_06470 42191 45952 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032955.1 protein_id gnl|my_center|LOCUS_06470 45949 47490 gene locus_tag LOCUS_06480 gene narH 45949 47490 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702629.1 protein_id gnl|my_center|LOCUS_06480 47487 48212 gene locus_tag LOCUS_06490 gene narJ 47487 48212 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571695.1 protein_id gnl|my_center|LOCUS_06490 48215 48892 gene locus_tag LOCUS_06500 gene narI 48215 48892 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160113.1 protein_id gnl|my_center|LOCUS_06500 49037 49621 gene locus_tag LOCUS_06510 gene nudK 49037 49621 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138361092.1 protein_id gnl|my_center|LOCUS_06510 49806 50870 gene locus_tag LOCUS_06520 49806 50870 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270663.1 protein_id gnl|my_center|LOCUS_06520 52076 50892 gene locus_tag LOCUS_06530 gene ampH 52076 50892 CDS product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368035.1 protein_id gnl|my_center|LOCUS_06530 52139 52312 gene locus_tag LOCUS_06540 52139 52312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 53263 52313 gene locus_tag LOCUS_06550 gene tal 53263 52313 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703140.1 protein_id gnl|my_center|LOCUS_06550 54040 53582 gene locus_tag LOCUS_06560 gene rpiB 54040 53582 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209402.1 protein_id gnl|my_center|LOCUS_06560 54480 55820 gene locus_tag LOCUS_06570 54480 55820 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978280.1 protein_id gnl|my_center|LOCUS_06570 55817 57580 gene locus_tag LOCUS_06580 55817 57580 CDS product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027218.1 protein_id gnl|my_center|LOCUS_06580 57577 58365 gene locus_tag LOCUS_06590 57577 58365 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027216.1 protein_id gnl|my_center|LOCUS_06590 58367 59173 gene locus_tag LOCUS_06600 58367 59173 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027215.1 protein_id gnl|my_center|LOCUS_06600 59178 60035 gene locus_tag LOCUS_06610 59178 60035 CDS product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027214.1 protein_id gnl|my_center|LOCUS_06610 60181 61143 gene locus_tag LOCUS_06620 60181 61143 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209407.1 protein_id gnl|my_center|LOCUS_06620 61306 63585 gene locus_tag LOCUS_06630 gene maeB 61306 63585 CDS product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172316.1 protein_id gnl|my_center|LOCUS_06630 64644 63715 gene locus_tag LOCUS_06640 gene hemF 64644 63715 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208526.1 protein_id gnl|my_center|LOCUS_06640 65551 64655 gene locus_tag LOCUS_06650 gene amiA 65551 64655 CDS product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098210.1 protein_id gnl|my_center|LOCUS_06650 65760 66185 gene locus_tag LOCUS_06660 65760 66185 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208525.1 protein_id gnl|my_center|LOCUS_06660 66213 66671 gene locus_tag LOCUS_06670 66213 66671 CDS product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296281.1 protein_id gnl|my_center|LOCUS_06670 66738 67352 gene locus_tag LOCUS_06680 66738 67352 CDS product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838971.1 protein_id gnl|my_center|LOCUS_06680 67634 68602 gene locus_tag LOCUS_06690 gene cysP 67634 68602 CDS product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290267.1 protein_id gnl|my_center|LOCUS_06690 68602 69435 gene locus_tag LOCUS_06700 gene cysT 68602 69435 CDS product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208511.1 protein_id gnl|my_center|LOCUS_06700 69435 70310 gene locus_tag LOCUS_06710 gene cysW 69435 70310 CDS product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098203.1 protein_id gnl|my_center|LOCUS_06710 70300 71388 gene locus_tag LOCUS_06720 gene cysA 70300 71388 CDS product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365491.1 protein_id gnl|my_center|LOCUS_06720 71465 72349 gene locus_tag LOCUS_06730 gene cysM 71465 72349 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365492.1 protein_id gnl|my_center|LOCUS_06730 72555 73235 gene locus_tag LOCUS_06740 72555 73235 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172242.1 protein_id gnl|my_center|LOCUS_06740 73232 74587 gene locus_tag LOCUS_06750 73232 74587 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815859.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence009 582 145 gene locus_tag LOCUS_06760 582 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06760 1548 592 gene locus_tag LOCUS_06770 gene tauA 1548 592 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095793.1 protein_id gnl|my_center|LOCUS_06770 2354 1752 gene locus_tag LOCUS_06780 2354 1752 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174663.1 protein_id gnl|my_center|LOCUS_06780 2660 2878 gene locus_tag LOCUS_06790 2660 2878 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099053.1 protein_id gnl|my_center|LOCUS_06790 4260 2875 gene locus_tag LOCUS_06800 4260 2875 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_06800 5031 4270 gene locus_tag LOCUS_06810 5031 4270 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615650.1 protein_id gnl|my_center|LOCUS_06810 5454 5131 gene locus_tag LOCUS_06820 5454 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 6396 5458 gene locus_tag LOCUS_06830 6396 5458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_06830 7508 6393 gene locus_tag LOCUS_06840 7508 6393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 protein_id gnl|my_center|LOCUS_06840 9045 7492 gene locus_tag LOCUS_06850 9045 7492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_06850 10069 9062 gene locus_tag LOCUS_06860 10069 9062 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850162.1 protein_id gnl|my_center|LOCUS_06860 10182 11081 gene locus_tag LOCUS_06870 10182 11081 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084073.1 protein_id gnl|my_center|LOCUS_06870 11910 11110 gene locus_tag LOCUS_06880 11910 11110 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382904.1 protein_id gnl|my_center|LOCUS_06880 12077 12946 gene locus_tag LOCUS_06890 12077 12946 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 protein_id gnl|my_center|LOCUS_06890 13423 13010 gene locus_tag LOCUS_06900 13423 13010 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027906.1 protein_id gnl|my_center|LOCUS_06900 13721 14353 gene locus_tag LOCUS_06910 gene crp 13721 14353 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 protein_id gnl|my_center|LOCUS_06910 14419 15927 gene locus_tag LOCUS_06920 14419 15927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06920 16006 16494 gene locus_tag LOCUS_06930 16006 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06930 17754 16528 gene locus_tag LOCUS_06940 gene argD 17754 16528 CDS product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963789.1 protein_id gnl|my_center|LOCUS_06940 18418 17843 gene locus_tag LOCUS_06950 18418 17843 CDS product aminodeoxychorismate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174674.1 protein_id gnl|my_center|LOCUS_06950 19048 18476 gene locus_tag LOCUS_06960 gene ppiA 19048 18476 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920482.1 protein_id gnl|my_center|LOCUS_06960 19419 21965 gene locus_tag LOCUS_06970 gene nirB 19419 21965 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817340.1 protein_id gnl|my_center|LOCUS_06970 21962 22288 gene locus_tag LOCUS_06980 gene nirD 21962 22288 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099065.1 protein_id gnl|my_center|LOCUS_06980 22370 23734 gene locus_tag LOCUS_06990 gene cysG 22370 23734 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703652.1 protein_id gnl|my_center|LOCUS_06990 24778 23774 gene locus_tag LOCUS_07000 gene trpS 24778 23774 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099067.1 protein_id gnl|my_center|LOCUS_07000 25475 24798 gene locus_tag LOCUS_07010 25475 24798 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817344.1 protein_id gnl|my_center|LOCUS_07010 26145 25459 gene locus_tag LOCUS_07020 gene rpe 26145 25459 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369389.1 protein_id gnl|my_center|LOCUS_07020 27024 26209 gene locus_tag LOCUS_07030 gene dam 27024 26209 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174698.1 protein_id gnl|my_center|LOCUS_07030 28243 27176 gene locus_tag LOCUS_07040 28243 27176 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817345.1 protein_id gnl|my_center|LOCUS_07040 29464 28376 gene locus_tag LOCUS_07050 gene aroB 29464 28376 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420740.1 protein_id gnl|my_center|LOCUS_07050 30026 29505 gene locus_tag LOCUS_07060 gene aroK 30026 29505 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920267.1 protein_id gnl|my_center|LOCUS_07060 31675 30425 gene locus_tag LOCUS_07070 gene hofQ 31675 30425 CDS product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298773.1 protein_id gnl|my_center|LOCUS_07070 32003 31614 gene locus_tag LOCUS_07080 32003 31614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 32490 31993 gene locus_tag LOCUS_07090 32490 31993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 33028 32483 gene locus_tag LOCUS_07100 33028 32483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 33855 33028 gene locus_tag LOCUS_07110 gene pilM 33855 33028 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051840.1 protein_id gnl|my_center|LOCUS_07110 34050 36527 gene locus_tag LOCUS_07120 gene mrcA 34050 36527 CDS product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013215.1 protein_id gnl|my_center|LOCUS_07120 37166 36600 gene locus_tag LOCUS_07130 gene nudE 37166 36600 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099080.1 protein_id gnl|my_center|LOCUS_07130 37806 37627 gene locus_tag LOCUS_07140 37806 37627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 37766 39829 gene locus_tag LOCUS_07150 37766 39829 CDS product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817351.1 protein_id gnl|my_center|LOCUS_07150 39884 40555 gene locus_tag LOCUS_07160 gene yrfG 39884 40555 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703664.1 protein_id gnl|my_center|LOCUS_07160 40584 40991 gene locus_tag LOCUS_07170 gene hslR 40584 40991 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099083.1 protein_id gnl|my_center|LOCUS_07170 41012 41902 gene locus_tag LOCUS_07180 gene hslO 41012 41902 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099084.1 protein_id gnl|my_center|LOCUS_07180 42233 43852 gene locus_tag LOCUS_07190 gene pckA 42233 43852 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703667.1 protein_id gnl|my_center|LOCUS_07190 45266 43911 gene locus_tag LOCUS_07200 gene envZ 45266 43911 CDS product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174760.1 protein_id gnl|my_center|LOCUS_07200 45991 45272 gene locus_tag LOCUS_07210 gene ompR 45991 45272 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 protein_id gnl|my_center|LOCUS_07210 46699 46211 gene locus_tag LOCUS_07220 gene greB 46699 46211 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458979.1 protein_id gnl|my_center|LOCUS_07220 46908 49235 gene locus_tag LOCUS_07230 46908 49235 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980687.1 protein_id gnl|my_center|LOCUS_07230 50068 49292 gene locus_tag LOCUS_07240 gene bioH 50068 49292 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817359.1 protein_id gnl|my_center|LOCUS_07240 50435 50791 gene locus_tag LOCUS_07250 50435 50791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 50850 51425 gene locus_tag LOCUS_07260 gene nfuA 50850 51425 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099096.1 protein_id gnl|my_center|LOCUS_07260 53605 51524 gene locus_tag LOCUS_07270 gene malQ 53605 51524 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208925.1 protein_id gnl|my_center|LOCUS_07270 56023 53621 gene locus_tag LOCUS_07280 gene malP 56023 53621 CDS product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703683.1 protein_id gnl|my_center|LOCUS_07280 57018 56260 gene locus_tag LOCUS_07290 57018 56260 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157500.1 protein_id gnl|my_center|LOCUS_07290 57929 57096 gene locus_tag LOCUS_07300 gene glpG 57929 57096 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928734.1 protein_id gnl|my_center|LOCUS_07300 58377 58057 gene locus_tag LOCUS_07310 gene glpE 58377 58057 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704135.1 protein_id gnl|my_center|LOCUS_07310 58609 60117 gene locus_tag LOCUS_07320 gene glpD 58609 60117 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448178.1 protein_id gnl|my_center|LOCUS_07320 62634 60187 gene locus_tag LOCUS_07330 gene glgP 62634 60187 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993423.1 protein_id gnl|my_center|LOCUS_07330 64089 62656 gene locus_tag LOCUS_07340 gene glgA 64089 62656 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099109.1 protein_id gnl|my_center|LOCUS_07340 65450 64167 gene locus_tag LOCUS_07350 gene glgC 65450 64167 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099110.1 protein_id gnl|my_center|LOCUS_07350 67446 65443 gene locus_tag LOCUS_07360 gene glgX 67446 65443 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192552.1 protein_id gnl|my_center|LOCUS_07360 69629 67443 gene locus_tag LOCUS_07370 gene glgB 69629 67443 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098552.1 protein_id gnl|my_center|LOCUS_07370 71134 70025 gene locus_tag LOCUS_07380 gene asd 71134 70025 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038629675.1 protein_id gnl|my_center|LOCUS_07380 71361 71954 gene locus_tag LOCUS_07390 71361 71954 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209508.1 protein_id gnl|my_center|LOCUS_07390 72557 72018 gene locus_tag LOCUS_07400 gene gntK 72557 72018 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108342.1 protein_id gnl|my_center|LOCUS_07400 72726 72571 gene locus_tag LOCUS_07410 72726 72571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 73663 72689 gene locus_tag LOCUS_07420 gene gntR 73663 72689 CDS product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence010 193 999 gene locus_tag LOCUS_07430 gene xthA 193 999 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097033.1 protein_id gnl|my_center|LOCUS_07430 2922 1000 gene locus_tag LOCUS_07440 2922 1000 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211670.1 protein_id gnl|my_center|LOCUS_07440 3065 2922 gene locus_tag LOCUS_07450 3065 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 3771 3220 gene locus_tag LOCUS_07460 3771 3220 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211673.1 protein_id gnl|my_center|LOCUS_07460 3943 5799 gene locus_tag LOCUS_07470 gene sppA 3943 5799 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259874.1 protein_id gnl|my_center|LOCUS_07470 5887 6903 gene locus_tag LOCUS_07480 gene ansA 5887 6903 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366152.1 protein_id gnl|my_center|LOCUS_07480 7255 6974 gene locus_tag LOCUS_07490 7255 6974 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046791.1 protein_id gnl|my_center|LOCUS_07490 7669 7259 gene locus_tag LOCUS_07500 gene msrB 7669 7259 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097052.1 protein_id gnl|my_center|LOCUS_07500 8010 9008 gene locus_tag LOCUS_07510 gene gapA 8010 9008 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 protein_id gnl|my_center|LOCUS_07510 9085 9966 gene locus_tag LOCUS_07520 9085 9966 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211679.1 protein_id gnl|my_center|LOCUS_07520 10164 10367 gene locus_tag LOCUS_07530 10164 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 10896 12830 gene locus_tag LOCUS_07540 gene yeaG 10896 12830 CDS product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162916.1 protein_id gnl|my_center|LOCUS_07540 12930 14204 gene locus_tag LOCUS_07550 12930 14204 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097061.1 protein_id gnl|my_center|LOCUS_07550 14455 15003 gene locus_tag LOCUS_07560 14455 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 15009 16181 gene locus_tag LOCUS_07570 15009 16181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 16260 16493 gene locus_tag LOCUS_07580 16260 16493 CDS product DUF1480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164922.1 protein_id gnl|my_center|LOCUS_07580 16834 18300 gene locus_tag LOCUS_07590 16834 18300 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368710.1 protein_id gnl|my_center|LOCUS_07590 18602 19789 gene locus_tag LOCUS_07600 18602 19789 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816438.1 protein_id gnl|my_center|LOCUS_07600 20923 19853 gene locus_tag LOCUS_07610 gene dadX 20923 19853 CDS product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705840.1 protein_id gnl|my_center|LOCUS_07610 22247 20943 gene locus_tag LOCUS_07620 22247 20943 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705841.1 protein_id gnl|my_center|LOCUS_07620 22862 24397 gene locus_tag LOCUS_07630 22862 24397 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240763.1 protein_id gnl|my_center|LOCUS_07630 25181 24462 gene locus_tag LOCUS_07640 gene fadR 25181 24462 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366064.1 protein_id gnl|my_center|LOCUS_07640 25402 26934 gene locus_tag LOCUS_07650 gene nhaB 25402 26934 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406367.1 protein_id gnl|my_center|LOCUS_07650 27047 27577 gene locus_tag LOCUS_07660 gene dsbB 27047 27577 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943475.1 protein_id gnl|my_center|LOCUS_07660 28089 27640 gene locus_tag LOCUS_07670 28089 27640 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807626.1 protein_id gnl|my_center|LOCUS_07670 28807 28148 gene locus_tag LOCUS_07680 28807 28148 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284280.1 protein_id gnl|my_center|LOCUS_07680 29949 28861 gene locus_tag LOCUS_07690 29949 28861 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298239.1 protein_id gnl|my_center|LOCUS_07690 30320 30045 gene locus_tag LOCUS_07700 30320 30045 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295992.1 protein_id gnl|my_center|LOCUS_07700 30481 31182 gene locus_tag LOCUS_07710 gene minC 30481 31182 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169220.1 protein_id gnl|my_center|LOCUS_07710 31208 32020 gene locus_tag LOCUS_07720 gene minD 31208 32020 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366054.1 protein_id gnl|my_center|LOCUS_07720 32024 32293 gene locus_tag LOCUS_07730 gene minE 32024 32293 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211180.1 protein_id gnl|my_center|LOCUS_07730 33480 32353 gene locus_tag LOCUS_07740 gene rnd 33480 32353 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109156.1 protein_id gnl|my_center|LOCUS_07740 35288 33582 gene locus_tag LOCUS_07750 gene fadD 35288 33582 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954305.1 protein_id gnl|my_center|LOCUS_07750 36059 35472 gene locus_tag LOCUS_07760 36059 35472 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096141.1 protein_id gnl|my_center|LOCUS_07760 36815 36114 gene locus_tag LOCUS_07770 gene tsaB 36815 36114 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220976.1 protein_id gnl|my_center|LOCUS_07770 38785 36875 gene locus_tag LOCUS_07780 38785 36875 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128847.1 protein_id gnl|my_center|LOCUS_07780 39134 39478 gene locus_tag LOCUS_07790 39134 39478 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211186.1 protein_id gnl|my_center|LOCUS_07790 39690 39493 gene locus_tag LOCUS_07800 39690 39493 CDS product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500497.1 protein_id gnl|my_center|LOCUS_07800 39804 41177 gene locus_tag LOCUS_07810 gene pabB 39804 41177 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978456.1 protein_id gnl|my_center|LOCUS_07810 41167 41751 gene locus_tag LOCUS_07820 41167 41751 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705928.1 protein_id gnl|my_center|LOCUS_07820 41998 43362 gene locus_tag LOCUS_07830 gene sdaA 41998 43362 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 protein_id gnl|my_center|LOCUS_07830 43652 45214 gene locus_tag LOCUS_07840 43652 45214 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192512.1 protein_id gnl|my_center|LOCUS_07840 46874 45315 gene locus_tag LOCUS_07850 gene yoaE 46874 45315 CDS product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394983.1 protein_id gnl|my_center|LOCUS_07850 47411 48373 gene locus_tag LOCUS_07860 gene manX 47411 48373 CDS product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150543.1 protein_id gnl|my_center|LOCUS_07860 48453 49259 gene locus_tag LOCUS_07870 gene manY 48453 49259 CDS product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406926.1 protein_id gnl|my_center|LOCUS_07870 49275 50123 gene locus_tag LOCUS_07880 49275 50123 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175979.1 protein_id gnl|my_center|LOCUS_07880 50168 50617 gene locus_tag LOCUS_07890 50168 50617 CDS product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211066.1 protein_id gnl|my_center|LOCUS_07890 51406 50750 gene locus_tag LOCUS_07900 gene rlmA 51406 50750 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211061.1 protein_id gnl|my_center|LOCUS_07900 52131 51922 gene locus_tag LOCUS_07910 gene cspE 52131 51922 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 protein_id gnl|my_center|LOCUS_07910 53830 52826 gene locus_tag LOCUS_07920 53830 52826 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 protein_id gnl|my_center|LOCUS_07920 54135 53863 gene locus_tag LOCUS_07930 54135 53863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 54369 54608 gene locus_tag LOCUS_07940 54369 54608 CDS product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096123.1 protein_id gnl|my_center|LOCUS_07940 54872 56251 gene locus_tag LOCUS_07950 54872 56251 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705935.1 protein_id gnl|my_center|LOCUS_07950 57195 56314 gene locus_tag LOCUS_07960 gene htpX 57195 56314 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170215.1 protein_id gnl|my_center|LOCUS_07960 59475 57430 gene locus_tag LOCUS_07970 gene prc 59475 57430 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096119.1 protein_id gnl|my_center|LOCUS_07970 60196 59495 gene locus_tag LOCUS_07980 gene proQ 60196 59495 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170218.1 protein_id gnl|my_center|LOCUS_07980 60793 60293 gene locus_tag LOCUS_07990 gene msrC 60793 60293 CDS product L-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043882.1 protein_id gnl|my_center|LOCUS_07990 60978 60790 gene locus_tag LOCUS_08000 60978 60790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 60993 62255 gene locus_tag LOCUS_08010 gene yebS 60993 62255 CDS product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170219.1 protein_id gnl|my_center|LOCUS_08010 62206 64845 gene locus_tag LOCUS_08020 62206 64845 CDS product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816203.1 protein_id gnl|my_center|LOCUS_08020 65057 66496 gene locus_tag LOCUS_08030 gene rsmF 65057 66496 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057022.1 protein_id gnl|my_center|LOCUS_08030 67253 66603 gene locus_tag LOCUS_08040 gene pphA 67253 66603 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986169.1 protein_id gnl|my_center|LOCUS_08040 68872 68648 gene locus_tag LOCUS_08050 68872 68648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 <69654 68962 gene locus_tag LOCUS_08060 <69654 68962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096391.1:IS5-like element IS903B family transposase note possible pseudo, internal stop codon >Feature sequence011 <1 1221 gene locus_tag LOCUS_08070 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009966488.1:YfcC family protein 1649 4357 gene locus_tag LOCUS_08080 1649 4357 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989569.1 protein_id gnl|my_center|LOCUS_08080 4991 4428 gene locus_tag LOCUS_08090 gene hxlB 4991 4428 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_08090 6038 4992 gene locus_tag LOCUS_08100 6038 4992 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004058044.1 protein_id gnl|my_center|LOCUS_08100 6916 6080 gene locus_tag LOCUS_08110 6916 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7692 6949 gene locus_tag LOCUS_08120 7692 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 8224 7742 gene locus_tag LOCUS_08130 8224 7742 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476683.1 protein_id gnl|my_center|LOCUS_08130 8632 8243 gene locus_tag LOCUS_08140 8632 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08140 9371 9781 gene locus_tag LOCUS_08150 9371 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 11309 9939 gene locus_tag LOCUS_08160 11309 9939 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 protein_id gnl|my_center|LOCUS_08160 11623 11351 gene locus_tag LOCUS_08170 11623 11351 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699818.1 protein_id gnl|my_center|LOCUS_08170 12126 11662 gene locus_tag LOCUS_08180 12126 11662 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901818.1 protein_id gnl|my_center|LOCUS_08180 14167 12173 gene locus_tag LOCUS_08190 gene tkt 14167 12173 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088084.1 protein_id gnl|my_center|LOCUS_08190 14457 14275 gene locus_tag LOCUS_08200 14457 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 14677 15411 gene locus_tag LOCUS_08210 14677 15411 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363775.1 protein_id gnl|my_center|LOCUS_08210 16536 16021 gene locus_tag LOCUS_08220 16536 16021 CDS product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095367.1 protein_id gnl|my_center|LOCUS_08220 18090 16648 gene locus_tag LOCUS_08230 gene arcD 18090 16648 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267884.1 protein_id gnl|my_center|LOCUS_08230 19216 18212 gene locus_tag LOCUS_08240 gene argF 19216 18212 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237033.1 protein_id gnl|my_center|LOCUS_08240 20186 19269 gene locus_tag LOCUS_08250 gene arcC 20186 19269 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083065.1 protein_id gnl|my_center|LOCUS_08250 21432 20212 gene locus_tag LOCUS_08260 gene arcA 21432 20212 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314369.1 protein_id gnl|my_center|LOCUS_08260 22915 23058 gene locus_tag LOCUS_08270 22915 23058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 23143 24231 gene locus_tag LOCUS_08280 23143 24231 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202471.1 protein_id gnl|my_center|LOCUS_08280 24498 25781 gene locus_tag LOCUS_08290 24498 25781 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703236.1 protein_id gnl|my_center|LOCUS_08290 26017 27183 gene locus_tag LOCUS_08300 26017 27183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 27164 28390 gene locus_tag LOCUS_08310 27164 28390 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_08310 29041 29946 gene locus_tag LOCUS_08320 gene yagE 29041 29946 CDS product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136613.1 protein_id gnl|my_center|LOCUS_08320 30137 30964 gene locus_tag LOCUS_08330 30137 30964 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141977.1 protein_id gnl|my_center|LOCUS_08330 33366 31057 gene locus_tag LOCUS_08340 gene opgB 33366 31057 CDS product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292679.1 protein_id gnl|my_center|LOCUS_08340 33827 34864 gene locus_tag LOCUS_08350 33827 34864 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869097.1 protein_id gnl|my_center|LOCUS_08350 35329 36549 gene locus_tag LOCUS_08360 35329 36549 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288510.1 protein_id gnl|my_center|LOCUS_08360 37063 36563 gene locus_tag LOCUS_08370 37063 36563 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368396.1 protein_id gnl|my_center|LOCUS_08370 37230 37526 gene locus_tag LOCUS_08380 37230 37526 CDS product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215232.1 protein_id gnl|my_center|LOCUS_08380 37647 37561 gene locus_tag LOCUS_t00020 37647 37561 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 37764 37678 gene locus_tag LOCUS_t00030 37764 37678 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38964 37939 gene locus_tag LOCUS_08390 gene rsmC 38964 37939 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272345.1 protein_id gnl|my_center|LOCUS_08390 39138 39551 gene locus_tag LOCUS_08400 39138 39551 CDS product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368390.1 protein_id gnl|my_center|LOCUS_08400 39520 39963 gene locus_tag LOCUS_08410 gene rimI 39520 39963 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095481.1 protein_id gnl|my_center|LOCUS_08410 40049 40732 gene locus_tag LOCUS_08420 gene yjjG 40049 40732 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978805.1 protein_id gnl|my_center|LOCUS_08420 41655 42152 gene locus_tag LOCUS_08430 41655 42152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096174.1 protein_id gnl|my_center|LOCUS_08430 42176 42691 gene locus_tag LOCUS_08440 gene tssJ 42176 42691 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096175.1 protein_id gnl|my_center|LOCUS_08440 42716 44059 gene locus_tag LOCUS_08450 gene tssK 42716 44059 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096176.1 protein_id gnl|my_center|LOCUS_08450 44079 45320 gene locus_tag LOCUS_08460 44079 45320 CDS product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096177.1 protein_id gnl|my_center|LOCUS_08460 45324 48962 gene locus_tag LOCUS_08470 gene tssM 45324 48962 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096178.1 protein_id gnl|my_center|LOCUS_08470 48979 49680 gene locus_tag LOCUS_08480 gene tagF 48979 49680 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366557.1 protein_id gnl|my_center|LOCUS_08480 49705 50724 gene locus_tag LOCUS_08490 gene tssA 49705 50724 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705460.1 protein_id gnl|my_center|LOCUS_08490 50804 51331 gene locus_tag LOCUS_08500 gene tssB 50804 51331 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366559.1 protein_id gnl|my_center|LOCUS_08500 51335 52834 gene locus_tag LOCUS_08510 gene tssC 51335 52834 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096181.1 protein_id gnl|my_center|LOCUS_08510 53146 53628 gene locus_tag LOCUS_08520 53146 53628 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366565.1 protein_id gnl|my_center|LOCUS_08520 53841 54332 gene locus_tag LOCUS_08530 53841 54332 CDS product type VI secretion system amidase effector protein Tae4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096182.1 protein_id gnl|my_center|LOCUS_08530 54478 54705 gene locus_tag LOCUS_08540 54478 54705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08540 55098 56954 gene locus_tag LOCUS_08550 gene tagH 55098 56954 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096184.1 protein_id gnl|my_center|LOCUS_08550 56954 57748 gene locus_tag LOCUS_08560 56954 57748 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096185.1 protein_id gnl|my_center|LOCUS_08560 57774 58751 gene locus_tag LOCUS_08570 57774 58751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096186.1 protein_id gnl|my_center|LOCUS_08570 58803 59633 gene locus_tag LOCUS_08580 58803 59633 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705453.1 protein_id gnl|my_center|LOCUS_08580 59626 60207 gene locus_tag LOCUS_08590 gene tssE 59626 60207 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096188.1 protein_id gnl|my_center|LOCUS_08590 60210 62084 gene locus_tag LOCUS_08600 gene tssF 60210 62084 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420938.1 protein_id gnl|my_center|LOCUS_08600 62081 63142 gene locus_tag LOCUS_08610 gene tssG 62081 63142 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096190.1 protein_id gnl|my_center|LOCUS_08610 63269 65884 gene locus_tag LOCUS_08620 gene tssH 63269 65884 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096191.1 protein_id gnl|my_center|LOCUS_08620 65914 67371 gene locus_tag LOCUS_08630 65914 67371 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096192.1 protein_id gnl|my_center|LOCUS_08630 67468 68166 gene locus_tag LOCUS_08640 67468 68166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08640 >Feature sequence012 168 76 gene locus_tag LOCUS_t00040 168 76 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 641 456 gene locus_tag LOCUS_08650 gene csrA 641 456 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 protein_id gnl|my_center|LOCUS_08650 3691 1064 gene locus_tag LOCUS_08660 gene alaS 3691 1064 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098436.1 protein_id gnl|my_center|LOCUS_08660 4090 4626 gene locus_tag LOCUS_08670 gene hpt 4090 4626 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095614.1 protein_id gnl|my_center|LOCUS_08670 5367 4684 gene locus_tag LOCUS_08680 gene can 5367 4684 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651604.1 protein_id gnl|my_center|LOCUS_08680 5457 6383 gene locus_tag LOCUS_08690 5457 6383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368204.1 protein_id gnl|my_center|LOCUS_08690 6380 7150 gene locus_tag LOCUS_08700 6380 7150 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095617.1 protein_id gnl|my_center|LOCUS_08700 8662 7226 gene locus_tag LOCUS_08710 8662 7226 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706057.1 protein_id gnl|my_center|LOCUS_08710 10128 9241 gene locus_tag LOCUS_08720 10128 9241 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366502.1 protein_id gnl|my_center|LOCUS_08720 10436 10783 gene locus_tag LOCUS_08730 10436 10783 CDS product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704423.1 protein_id gnl|my_center|LOCUS_08730 10893 11762 gene locus_tag LOCUS_08740 gene speE 10893 11762 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167130.1 protein_id gnl|my_center|LOCUS_08740 11759 12595 gene locus_tag LOCUS_08750 gene speD 11759 12595 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368213.1 protein_id gnl|my_center|LOCUS_08750 13446 13162 gene locus_tag LOCUS_08760 13446 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08760 13686 13477 gene locus_tag LOCUS_08770 13686 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08770 14044 14229 gene locus_tag LOCUS_08780 14044 14229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 14408 14226 gene locus_tag LOCUS_08790 14408 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 14570 14442 gene locus_tag LOCUS_08800 14570 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 15018 14656 gene locus_tag LOCUS_08810 gene yacL 15018 14656 CDS product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384306.1 protein_id gnl|my_center|LOCUS_08810 17929 15332 gene locus_tag LOCUS_08820 gene acnB 17929 15332 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888954.1 protein_id gnl|my_center|LOCUS_08820 18552 18734 gene locus_tag LOCUS_08830 18552 18734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 18784 18921 gene locus_tag LOCUS_08840 18784 18921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08840 21075 19600 gene locus_tag LOCUS_08850 21075 19600 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245274.1 protein_id gnl|my_center|LOCUS_08850 21693 21394 gene locus_tag LOCUS_08860 21693 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 22255 22473 gene locus_tag LOCUS_08870 22255 22473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 23244 22873 gene locus_tag LOCUS_08880 23244 22873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 23763 23620 gene locus_tag LOCUS_08890 23763 23620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08890 24606 24313 gene locus_tag LOCUS_08900 gene cas2e 24606 24313 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 protein_id gnl|my_center|LOCUS_08900 24847 24611 gene locus_tag LOCUS_08910 24847 24611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 25352 24822 gene locus_tag LOCUS_08920 25352 24822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 26967 25540 gene locus_tag LOCUS_08930 gene lpdA 26967 25540 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102483.1 protein_id gnl|my_center|LOCUS_08930 28809 27184 gene locus_tag LOCUS_08940 gene aceF 28809 27184 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963533.1 protein_id gnl|my_center|LOCUS_08940 31487 28824 gene locus_tag LOCUS_08950 gene aceE 31487 28824 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368222.1 protein_id gnl|my_center|LOCUS_08950 32376 31612 gene locus_tag LOCUS_08960 gene pdhR 32376 31612 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389026.1 protein_id gnl|my_center|LOCUS_08960 32893 34245 gene locus_tag LOCUS_08970 32893 34245 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815579.1 protein_id gnl|my_center|LOCUS_08970 35156 34302 gene locus_tag LOCUS_08980 gene ampE 35156 34302 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172006.1 protein_id gnl|my_center|LOCUS_08980 35728 35153 gene locus_tag LOCUS_08990 gene ampD 35728 35153 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704411.1 protein_id gnl|my_center|LOCUS_08990 35952 36842 gene locus_tag LOCUS_09000 gene nadC 35952 36842 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095589.1 protein_id gnl|my_center|LOCUS_09000 37047 37490 gene locus_tag LOCUS_09010 gene ppdD 37047 37490 CDS product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360891.1 protein_id gnl|my_center|LOCUS_09010 37490 38890 gene locus_tag LOCUS_09020 gene gspE 37490 38890 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704408.1 protein_id gnl|my_center|LOCUS_09020 38895 40082 gene locus_tag LOCUS_09030 gene hofC 38895 40082 CDS product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167094.1 protein_id gnl|my_center|LOCUS_09030 41404 40364 gene locus_tag LOCUS_09040 41404 40364 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167093.1 protein_id gnl|my_center|LOCUS_09040 41647 42258 gene locus_tag LOCUS_09050 gene coaE 41647 42258 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209319.1 protein_id gnl|my_center|LOCUS_09050 42263 43006 gene locus_tag LOCUS_09060 gene zapD 42263 43006 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194736.1 protein_id gnl|my_center|LOCUS_09060 43022 43237 gene locus_tag LOCUS_09070 gene yacG 43022 43237 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368237.1 protein_id gnl|my_center|LOCUS_09070 43669 43283 gene locus_tag LOCUS_09080 gene mutT 43669 43283 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167088.1 protein_id gnl|my_center|LOCUS_09080 46526 43821 gene locus_tag LOCUS_09090 gene secA 46526 43821 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905780.1 protein_id gnl|my_center|LOCUS_09090 47148 46615 gene locus_tag LOCUS_09100 gene secM 47148 46615 CDS product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210427.1 protein_id gnl|my_center|LOCUS_09100 48384 47452 gene locus_tag LOCUS_09110 gene lpxC 48384 47452 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095578.1 protein_id gnl|my_center|LOCUS_09110 49622 48471 gene locus_tag LOCUS_09120 gene ftsZ 49622 48471 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389003.1 protein_id gnl|my_center|LOCUS_09120 50951 49695 gene locus_tag LOCUS_09130 gene ftsA 50951 49695 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210431.1 protein_id gnl|my_center|LOCUS_09130 51793 50948 gene locus_tag LOCUS_09140 gene ftsQ 51793 50948 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368242.1 protein_id gnl|my_center|LOCUS_09140 52715 51795 gene locus_tag LOCUS_09150 52715 51795 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815570.1 protein_id gnl|my_center|LOCUS_09150 54225 52708 gene locus_tag LOCUS_09160 gene murC 54225 52708 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095575.1 protein_id gnl|my_center|LOCUS_09160 55321 54263 gene locus_tag LOCUS_09170 gene murG 55321 54263 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016582.1 protein_id gnl|my_center|LOCUS_09170 56532 55318 gene locus_tag LOCUS_09180 gene ftsW 56532 55318 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156865.1 protein_id gnl|my_center|LOCUS_09180 57848 56532 gene locus_tag LOCUS_09190 gene murD 57848 56532 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704401.1 protein_id gnl|my_center|LOCUS_09190 58933 57851 gene locus_tag LOCUS_09200 gene mraY 58933 57851 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167069.1 protein_id gnl|my_center|LOCUS_09200 60288 58927 gene locus_tag LOCUS_09210 gene murF 60288 58927 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704400.1 protein_id gnl|my_center|LOCUS_09210 61772 60285 gene locus_tag LOCUS_09220 gene murE 61772 60285 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095570.1 protein_id gnl|my_center|LOCUS_09220 63525 61759 gene locus_tag LOCUS_09230 63525 61759 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156878.1 protein_id gnl|my_center|LOCUS_09230 63861 63541 gene locus_tag LOCUS_09240 gene ftsL 63861 63541 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029684613.1 protein_id gnl|my_center|LOCUS_09240 64799 63858 gene locus_tag LOCUS_09250 gene rsmH 64799 63858 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970440.1 protein_id gnl|my_center|LOCUS_09250 65260 64802 gene locus_tag LOCUS_09260 gene mraZ 65260 64802 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210443.1 protein_id gnl|my_center|LOCUS_09260 66794 65784 gene locus_tag LOCUS_09270 gene cra 66794 65784 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762406.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence013 695 357 gene locus_tag LOCUS_09280 695 357 CDS product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059386398.1 protein_id gnl|my_center|LOCUS_09280 1148 840 gene locus_tag LOCUS_09290 1148 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09290 1344 1219 gene locus_tag LOCUS_09300 1344 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1482 1682 gene locus_tag LOCUS_09310 1482 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1994 1641 gene locus_tag LOCUS_09320 1994 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2618 2139 gene locus_tag LOCUS_09330 2618 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 3023 2697 gene locus_tag LOCUS_09340 3023 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 3329 3120 gene locus_tag LOCUS_09350 3329 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4151 4372 gene locus_tag LOCUS_09360 4151 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 4369 5175 gene locus_tag LOCUS_09370 gene map 4369 5175 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114411.1 protein_id gnl|my_center|LOCUS_09370 5520 6116 gene locus_tag LOCUS_09380 5520 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09380 7742 6627 gene locus_tag LOCUS_09390 7742 6627 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978381.1 protein_id gnl|my_center|LOCUS_09390 7793 8260 gene locus_tag LOCUS_09400 7793 8260 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143849.1 protein_id gnl|my_center|LOCUS_09400 8917 8285 gene locus_tag LOCUS_09410 8917 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 9499 8954 gene locus_tag LOCUS_09420 9499 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 10347 10153 gene locus_tag LOCUS_09430 10347 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09430 10965 10498 gene locus_tag LOCUS_09440 10965 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 11871 13004 gene locus_tag LOCUS_09450 11871 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 16165 17892 gene locus_tag LOCUS_09460 16165 17892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 19052 18114 gene locus_tag LOCUS_09470 19052 18114 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_09470 20411 19641 gene locus_tag LOCUS_09480 gene ygbI 20411 19641 CDS product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168938.1 protein_id gnl|my_center|LOCUS_09480 20677 21591 gene locus_tag LOCUS_09490 20677 21591 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 protein_id gnl|my_center|LOCUS_09490 21591 22853 gene locus_tag LOCUS_09500 21591 22853 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298110.1 protein_id gnl|my_center|LOCUS_09500 22850 23473 gene locus_tag LOCUS_09510 22850 23473 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168943.1 protein_id gnl|my_center|LOCUS_09510 23473 24261 gene locus_tag LOCUS_09520 23473 24261 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136912.1 protein_id gnl|my_center|LOCUS_09520 24408 25769 gene locus_tag LOCUS_09530 24408 25769 CDS product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104441.1 protein_id gnl|my_center|LOCUS_09530 26159 27346 gene locus_tag LOCUS_09540 26159 27346 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815999.1 protein_id gnl|my_center|LOCUS_09540 27336 29810 gene locus_tag LOCUS_09550 gene torA 27336 29810 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815998.1 protein_id gnl|my_center|LOCUS_09550 31071 29962 gene locus_tag LOCUS_09560 gene apbC 31071 29962 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097927.1 protein_id gnl|my_center|LOCUS_09560 31265 33298 gene locus_tag LOCUS_09570 gene metG 31265 33298 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195338.1 protein_id gnl|my_center|LOCUS_09570 33486 33869 gene locus_tag LOCUS_09580 33486 33869 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295452.1 protein_id gnl|my_center|LOCUS_09580 33871 34563 gene locus_tag LOCUS_09590 33871 34563 CDS product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162334.1 protein_id gnl|my_center|LOCUS_09590 34657 35547 gene locus_tag LOCUS_09600 gene cdd 34657 35547 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211969.1 protein_id gnl|my_center|LOCUS_09600 35801 37498 gene locus_tag LOCUS_09610 35801 37498 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211968.1 protein_id gnl|my_center|LOCUS_09610 37647 38369 gene locus_tag LOCUS_09620 gene sanA 37647 38369 CDS product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097950.1 protein_id gnl|my_center|LOCUS_09620 39564 38401 gene locus_tag LOCUS_09630 gene yeiB 39564 38401 CDS product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001765111.1 protein_id gnl|my_center|LOCUS_09630 40284 39619 gene locus_tag LOCUS_09640 gene folE 40284 39619 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097957.1 protein_id gnl|my_center|LOCUS_09640 41546 40419 gene locus_tag LOCUS_09650 41546 40419 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211959.1 protein_id gnl|my_center|LOCUS_09650 41695 42606 gene locus_tag LOCUS_09660 41695 42606 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211958.1 protein_id gnl|my_center|LOCUS_09660 42707 43549 gene locus_tag LOCUS_09670 gene yeiG 42707 43549 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425460.1 protein_id gnl|my_center|LOCUS_09670 44501 43713 gene locus_tag LOCUS_09680 44501 43713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161751.1 protein_id gnl|my_center|LOCUS_09680 45583 44501 gene locus_tag LOCUS_09690 45583 44501 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215451.1 protein_id gnl|my_center|LOCUS_09690 47296 45830 gene locus_tag LOCUS_09700 gene lysP 47296 45830 CDS product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534384.1 protein_id gnl|my_center|LOCUS_09700 48351 47485 gene locus_tag LOCUS_09710 gene yieE 48351 47485 CDS product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097962.1 protein_id gnl|my_center|LOCUS_09710 48607 49662 gene locus_tag LOCUS_09720 48607 49662 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706115.1 protein_id gnl|my_center|LOCUS_09720 49722 50567 gene locus_tag LOCUS_09730 gene nfo 49722 50567 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873892.1 protein_id gnl|my_center|LOCUS_09730 52293 50602 gene locus_tag LOCUS_09740 gene fruA 52293 50602 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097965.1 protein_id gnl|my_center|LOCUS_09740 53248 52310 gene locus_tag LOCUS_09750 gene fruK 53248 52310 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091249.1 protein_id gnl|my_center|LOCUS_09750 54378 53245 gene locus_tag LOCUS_09760 gene fruB 54378 53245 CDS product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171391.1 protein_id gnl|my_center|LOCUS_09760 54781 55959 gene locus_tag LOCUS_09770 gene setB 54781 55959 CDS product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551969.1 protein_id gnl|my_center|LOCUS_09770 56398 56970 gene locus_tag LOCUS_09780 gene yeiP 56398 56970 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815996.1 protein_id gnl|my_center|LOCUS_09780 57022 58005 gene locus_tag LOCUS_09790 57022 58005 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706122.1 protein_id gnl|my_center|LOCUS_09790 58042 58755 gene locus_tag LOCUS_09800 58042 58755 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171423.1 protein_id gnl|my_center|LOCUS_09800 59366 59935 gene locus_tag LOCUS_09810 gene mepS 59366 59935 CDS product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208822.1 protein_id gnl|my_center|LOCUS_09810 60604 62022 gene locus_tag LOCUS_09820 60604 62022 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470593.1 protein_id gnl|my_center|LOCUS_09820 62058 62246 gene locus_tag LOCUS_09830 62058 62246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 62212 64020 gene locus_tag LOCUS_09840 62212 64020 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706125.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence014 <1 541 gene locus_tag LOCUS_09850 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001831126.1:HAD-IIB family hydrolase 1844 669 gene locus_tag LOCUS_09860 1844 669 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338817.1 protein_id gnl|my_center|LOCUS_09860 2991 1939 gene locus_tag LOCUS_09870 2991 1939 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972870.1 protein_id gnl|my_center|LOCUS_09870 3988 3062 gene locus_tag LOCUS_09880 3988 3062 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246965.1 protein_id gnl|my_center|LOCUS_09880 5123 4092 gene locus_tag LOCUS_09890 5123 4092 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380853.1 protein_id gnl|my_center|LOCUS_09890 6622 5138 gene locus_tag LOCUS_09900 6622 5138 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972980.1 protein_id gnl|my_center|LOCUS_09900 7917 6802 gene locus_tag LOCUS_09910 7917 6802 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_09910 8942 7947 gene locus_tag LOCUS_09920 gene iolG 8942 7947 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528364.1 protein_id gnl|my_center|LOCUS_09920 9975 8983 gene locus_tag LOCUS_09930 9975 8983 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207240953.1 protein_id gnl|my_center|LOCUS_09930 10798 9977 gene locus_tag LOCUS_09940 10798 9977 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_09940 12241 10808 gene locus_tag LOCUS_09950 gene gabD 12241 10808 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 protein_id gnl|my_center|LOCUS_09950 12762 13703 gene locus_tag LOCUS_09960 12762 13703 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_09960 13855 15702 gene locus_tag LOCUS_09970 gene iolD 13855 15702 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223774.1 protein_id gnl|my_center|LOCUS_09970 15720 16631 gene locus_tag LOCUS_09980 gene iolE 15720 16631 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 protein_id gnl|my_center|LOCUS_09980 17085 16801 gene locus_tag LOCUS_09990 17085 16801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09990 17404 17216 gene locus_tag LOCUS_10000 17404 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001683522.1 protein_id gnl|my_center|LOCUS_10000 18169 17441 gene locus_tag LOCUS_10010 gene phoU 18169 17441 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145007.1 protein_id gnl|my_center|LOCUS_10010 18960 18187 gene locus_tag LOCUS_10020 gene pstB 18960 18187 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500183.1 protein_id gnl|my_center|LOCUS_10020 19892 19005 gene locus_tag LOCUS_10030 gene pstA 19892 19005 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099412.1 protein_id gnl|my_center|LOCUS_10030 20851 19889 gene locus_tag LOCUS_10040 gene pstC 20851 19889 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099411.1 protein_id gnl|my_center|LOCUS_10040 21975 20935 gene locus_tag LOCUS_10050 gene pstS 21975 20935 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867129.1 protein_id gnl|my_center|LOCUS_10050 22980 22342 gene locus_tag LOCUS_10060 22980 22342 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 protein_id gnl|my_center|LOCUS_10060 23085 23975 gene locus_tag LOCUS_10070 23085 23975 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388220.1 protein_id gnl|my_center|LOCUS_10070 26000 24168 gene locus_tag LOCUS_10080 gene glmS 26000 24168 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215552.1 protein_id gnl|my_center|LOCUS_10080 27531 26155 gene locus_tag LOCUS_10090 gene glmU 27531 26155 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099408.1 protein_id gnl|my_center|LOCUS_10090 28111 30738 gene locus_tag LOCUS_10100 gene tssI 28111 30738 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705445.1 protein_id gnl|my_center|LOCUS_10100 31297 30878 gene locus_tag LOCUS_10110 31297 30878 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024912932.1 protein_id gnl|my_center|LOCUS_10110 32704 31322 gene locus_tag LOCUS_10120 gene atpD 32704 31322 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190499.1 protein_id gnl|my_center|LOCUS_10120 33726 32860 gene locus_tag LOCUS_10130 gene atpG 33726 32860 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862364.1 protein_id gnl|my_center|LOCUS_10130 35320 33779 gene locus_tag LOCUS_10140 gene atpA 35320 33779 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862367.1 protein_id gnl|my_center|LOCUS_10140 35868 35335 gene locus_tag LOCUS_10150 gene atpH 35868 35335 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288593.1 protein_id gnl|my_center|LOCUS_10150 36353 35883 gene locus_tag LOCUS_10160 gene atpF 36353 35883 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393038.1 protein_id gnl|my_center|LOCUS_10160 36690 36448 gene locus_tag LOCUS_10170 gene atpE 36690 36448 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 protein_id gnl|my_center|LOCUS_10170 37558 36740 gene locus_tag LOCUS_10180 gene atpB 37558 36740 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135618.1 protein_id gnl|my_center|LOCUS_10180 37947 37567 gene locus_tag LOCUS_10190 gene atpI 37947 37567 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116695.1 protein_id gnl|my_center|LOCUS_10190 39418 38759 gene locus_tag LOCUS_10200 gene rsmG 39418 38759 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161183.1 protein_id gnl|my_center|LOCUS_10200 40386 39442 gene locus_tag LOCUS_10210 40386 39442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10210 41330 40425 gene locus_tag LOCUS_10220 41330 40425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10220 42235 41795 gene locus_tag LOCUS_10230 gene mioC 42235 41795 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099402.1 protein_id gnl|my_center|LOCUS_10230 42856 42395 gene locus_tag LOCUS_10240 gene asnC 42856 42395 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 protein_id gnl|my_center|LOCUS_10240 44423 42963 gene locus_tag LOCUS_10250 gene viaA 44423 42963 CDS product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703920.1 protein_id gnl|my_center|LOCUS_10250 45913 44420 gene locus_tag LOCUS_10260 gene ravA 45913 44420 CDS product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099399.1 protein_id gnl|my_center|LOCUS_10260 46143 48011 gene locus_tag LOCUS_10270 gene kup 46143 48011 CDS product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099398.1 protein_id gnl|my_center|LOCUS_10270 49422 48028 gene locus_tag LOCUS_10280 gene qseC 49422 48028 CDS product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098726.1 protein_id gnl|my_center|LOCUS_10280 50081 49419 gene locus_tag LOCUS_10290 gene qseB 50081 49419 CDS product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098725.1 protein_id gnl|my_center|LOCUS_10290 50343 50741 gene locus_tag LOCUS_10300 50343 50741 CDS product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 protein_id gnl|my_center|LOCUS_10300 51412 52209 gene locus_tag LOCUS_10310 51412 52209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172561.1 protein_id gnl|my_center|LOCUS_10310 52206 52976 gene locus_tag LOCUS_10320 52206 52976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172560.1 protein_id gnl|my_center|LOCUS_10320 52999 54021 gene locus_tag LOCUS_10330 52999 54021 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530798.1 protein_id gnl|my_center|LOCUS_10330 54036 55334 gene locus_tag LOCUS_10340 54036 55334 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226151.1 protein_id gnl|my_center|LOCUS_10340 55538 55957 gene locus_tag LOCUS_10350 gene rbsD 55538 55957 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715936.1 protein_id gnl|my_center|LOCUS_10350 55965 57476 gene locus_tag LOCUS_10360 gene rbsA 55965 57476 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387762.1 protein_id gnl|my_center|LOCUS_10360 57473 58444 gene locus_tag LOCUS_10370 gene rbsC 57473 58444 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368991.1 protein_id gnl|my_center|LOCUS_10370 58471 59352 gene locus_tag LOCUS_10380 gene rbsB 58471 59352 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368990.1 protein_id gnl|my_center|LOCUS_10380 59411 60343 gene locus_tag LOCUS_10390 gene rbsK 59411 60343 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815255.1 protein_id gnl|my_center|LOCUS_10390 60350 61351 gene locus_tag LOCUS_10400 gene rbsR 60350 61351 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175187.1 protein_id gnl|my_center|LOCUS_10400 62751 61348 gene locus_tag LOCUS_10410 gene mdtD 62751 61348 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence015 99 365 gene locus_tag LOCUS_10420 99 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 441 752 gene locus_tag LOCUS_10430 441 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1197 718 gene locus_tag LOCUS_10440 gene tssD 1197 718 CDS product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094807.1 protein_id gnl|my_center|LOCUS_10440 2085 1411 gene locus_tag LOCUS_10450 2085 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165356698.1 protein_id gnl|my_center|LOCUS_10450 2258 2518 gene locus_tag LOCUS_10460 2258 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2920 2567 gene locus_tag LOCUS_10470 2920 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 3243 3168 gene locus_tag LOCUS_t00050 3243 3168 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3510 4037 gene locus_tag LOCUS_10480 gene mug 3510 4037 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703525.1 protein_id gnl|my_center|LOCUS_10480 5958 4114 gene locus_tag LOCUS_10490 gene rpoD 5958 4114 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369628.1 protein_id gnl|my_center|LOCUS_10490 7894 6152 gene locus_tag LOCUS_10500 gene dnaG 7894 6152 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210358.1 protein_id gnl|my_center|LOCUS_10500 8229 8014 gene locus_tag LOCUS_10510 gene rpsU 8229 8014 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_10510 8526 9539 gene locus_tag LOCUS_10520 gene tsaD 8526 9539 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264383.1 protein_id gnl|my_center|LOCUS_10520 10175 9570 gene locus_tag LOCUS_10530 gene plsY 10175 9570 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160822.1 protein_id gnl|my_center|LOCUS_10530 10282 10641 gene locus_tag LOCUS_10540 gene folB 10282 10641 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369633.1 protein_id gnl|my_center|LOCUS_10540 10783 11601 gene locus_tag LOCUS_10550 gene bacA 10783 11601 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833310.1 protein_id gnl|my_center|LOCUS_10550 12907 11672 gene locus_tag LOCUS_10560 gene cca 12907 11672 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708517.1 protein_id gnl|my_center|LOCUS_10560 13650 13027 gene locus_tag LOCUS_10570 13650 13027 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098761.1 protein_id gnl|my_center|LOCUS_10570 13856 15160 gene locus_tag LOCUS_10580 13856 15160 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817221.1 protein_id gnl|my_center|LOCUS_10580 15237 18083 gene locus_tag LOCUS_10590 gene glnE 15237 18083 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640211.1 protein_id gnl|my_center|LOCUS_10590 18171 19601 gene locus_tag LOCUS_10600 gene hldE 18171 19601 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817219.1 protein_id gnl|my_center|LOCUS_10600 19990 19697 gene locus_tag LOCUS_10610 gene ubiK 19990 19697 CDS product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297598.1 protein_id gnl|my_center|LOCUS_10610 20400 21056 gene locus_tag LOCUS_10620 gene ribB 20400 21056 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076997.1 protein_id gnl|my_center|LOCUS_10620 21303 22088 gene locus_tag LOCUS_10630 gene ygiD 21303 22088 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098747.1 protein_id gnl|my_center|LOCUS_10630 23335 22175 gene locus_tag LOCUS_10640 23335 22175 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160795.1 protein_id gnl|my_center|LOCUS_10640 24031 23345 gene locus_tag LOCUS_10650 24031 23345 CDS product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831528.1 protein_id gnl|my_center|LOCUS_10650 25779 24196 gene locus_tag LOCUS_10660 gene tolC 25779 24196 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 protein_id gnl|my_center|LOCUS_10660 25882 26517 gene locus_tag LOCUS_10670 gene nudF 25882 26517 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098743.1 protein_id gnl|my_center|LOCUS_10670 26514 26939 gene locus_tag LOCUS_10680 26514 26939 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862516.1 protein_id gnl|my_center|LOCUS_10680 26987 27814 gene locus_tag LOCUS_10690 gene cpdA 26987 27814 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217438.1 protein_id gnl|my_center|LOCUS_10690 27818 28399 gene locus_tag LOCUS_10700 gene yqiA 27818 28399 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 protein_id gnl|my_center|LOCUS_10700 28453 30348 gene locus_tag LOCUS_10710 gene parE 28453 30348 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212181.1 protein_id gnl|my_center|LOCUS_10710 30363 31280 gene locus_tag LOCUS_10720 30363 31280 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174098.1 protein_id gnl|my_center|LOCUS_10720 31933 31352 gene locus_tag LOCUS_10730 31933 31352 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817212.1 protein_id gnl|my_center|LOCUS_10730 32403 34676 gene locus_tag LOCUS_10740 gene parC 32403 34676 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212178.1 protein_id gnl|my_center|LOCUS_10740 34801 35538 gene locus_tag LOCUS_10750 gene plsC 34801 35538 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369660.1 protein_id gnl|my_center|LOCUS_10750 35706 37124 gene locus_tag LOCUS_10760 gene ftsP 35706 37124 CDS product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817210.1 protein_id gnl|my_center|LOCUS_10760 38033 37209 gene locus_tag LOCUS_10770 gene dkgA 38033 37209 CDS product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174084.1 protein_id gnl|my_center|LOCUS_10770 39244 38087 gene locus_tag LOCUS_10780 gene yqhD 39244 38087 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 protein_id gnl|my_center|LOCUS_10780 39421 40314 gene locus_tag LOCUS_10790 gene yqhC 39421 40314 CDS product DNA-binding transcriptional regulator YqhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350547.1 protein_id gnl|my_center|LOCUS_10790 41002 40343 gene locus_tag LOCUS_10800 gene yghB 41002 40343 CDS product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 protein_id gnl|my_center|LOCUS_10800 42457 41129 gene locus_tag LOCUS_10810 gene metC 42457 41129 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315867.1 protein_id gnl|my_center|LOCUS_10810 42702 43442 gene locus_tag LOCUS_10820 gene exbB 42702 43442 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098712.1 protein_id gnl|my_center|LOCUS_10820 43448 43870 gene locus_tag LOCUS_10830 gene exbD 43448 43870 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 protein_id gnl|my_center|LOCUS_10830 44056 45375 gene locus_tag LOCUS_10840 44056 45375 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188918.1 protein_id gnl|my_center|LOCUS_10840 45509 46957 gene locus_tag LOCUS_10850 45509 46957 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096471.1 protein_id gnl|my_center|LOCUS_10850 47443 46961 gene locus_tag LOCUS_10860 47443 46961 CDS product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214045.1 protein_id gnl|my_center|LOCUS_10860 47943 49379 gene locus_tag LOCUS_10870 47943 49379 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817265.1 protein_id gnl|my_center|LOCUS_10870 49373 50302 gene locus_tag LOCUS_10880 49373 50302 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174267.1 protein_id gnl|my_center|LOCUS_10880 50299 51099 gene locus_tag LOCUS_10890 50299 51099 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817266.1 protein_id gnl|my_center|LOCUS_10890 51120 51824 gene locus_tag LOCUS_10900 51120 51824 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_10900 51989 53257 gene locus_tag LOCUS_10910 51989 53257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 53859 53356 gene locus_tag LOCUS_10920 gene ftnA 53859 53356 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170444.1 protein_id gnl|my_center|LOCUS_10920 55853 54234 gene locus_tag LOCUS_10930 55853 54234 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530447.1 protein_id gnl|my_center|LOCUS_10930 57264 55882 gene locus_tag LOCUS_10940 57264 55882 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703479.1 protein_id gnl|my_center|LOCUS_10940 58840 57353 gene locus_tag LOCUS_10950 58840 57353 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112672.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence016 328 1479 gene locus_tag LOCUS_10960 328 1479 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097314.1 protein_id gnl|my_center|LOCUS_10960 2286 1546 gene locus_tag LOCUS_10970 gene pflA 2286 1546 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097312.1 protein_id gnl|my_center|LOCUS_10970 4743 2455 gene locus_tag LOCUS_10980 gene pflB 4743 2455 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292822.1 protein_id gnl|my_center|LOCUS_10980 5698 4838 gene locus_tag LOCUS_10990 gene focA 5698 4838 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166519.1 protein_id gnl|my_center|LOCUS_10990 7941 6184 gene locus_tag LOCUS_11000 gene ycaO 7941 6184 CDS product 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420898.1 protein_id gnl|my_center|LOCUS_11000 8253 9338 gene locus_tag LOCUS_11010 gene serC 8253 9338 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882989.1 protein_id gnl|my_center|LOCUS_11010 9426 10712 gene locus_tag LOCUS_11020 gene aroA 9426 10712 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704884.1 protein_id gnl|my_center|LOCUS_11020 10917 11606 gene locus_tag LOCUS_11030 gene cmk 10917 11606 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097305.1 protein_id gnl|my_center|LOCUS_11030 11723 13405 gene locus_tag LOCUS_11040 gene rpsA 11723 13405 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367470.1 protein_id gnl|my_center|LOCUS_11040 13479 13763 gene locus_tag LOCUS_11050 gene ihfB 13479 13763 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211322.1 protein_id gnl|my_center|LOCUS_11050 14204 16468 gene locus_tag LOCUS_11060 14204 16468 CDS product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705794.1 protein_id gnl|my_center|LOCUS_11060 16504 18252 gene locus_tag LOCUS_11070 gene msbA 16504 18252 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097303.1 protein_id gnl|my_center|LOCUS_11070 18249 19223 gene locus_tag LOCUS_11080 gene lpxK 18249 19223 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704887.1 protein_id gnl|my_center|LOCUS_11080 19282 20511 gene locus_tag LOCUS_11090 19282 20511 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704888.1 protein_id gnl|my_center|LOCUS_11090 20575 20757 gene locus_tag LOCUS_11100 gene ycaR 20575 20757 CDS product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097300.1 protein_id gnl|my_center|LOCUS_11100 20754 21503 gene locus_tag LOCUS_11110 gene kdsB 20754 21503 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211314.1 protein_id gnl|my_center|LOCUS_11110 21679 22572 gene locus_tag LOCUS_11120 21679 22572 CDS product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170979.1 protein_id gnl|my_center|LOCUS_11120 23337 22552 gene locus_tag LOCUS_11130 gene elyC 23337 22552 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899599.1 protein_id gnl|my_center|LOCUS_11130 23412 24248 gene locus_tag LOCUS_11140 gene cmoM 23412 24248 CDS product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301572.1 protein_id gnl|my_center|LOCUS_11140 24245 25567 gene locus_tag LOCUS_11150 gene mukF 24245 25567 CDS product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170970.1 protein_id gnl|my_center|LOCUS_11150 25548 26279 gene locus_tag LOCUS_11160 gene mukE 25548 26279 CDS product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097294.1 protein_id gnl|my_center|LOCUS_11160 26276 30724 gene locus_tag LOCUS_11170 gene mukB 26276 30724 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211308.1 protein_id gnl|my_center|LOCUS_11170 31100 32914 gene locus_tag LOCUS_11180 gene ldtD 31100 32914 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816041.1 protein_id gnl|my_center|LOCUS_11180 33102 33650 gene locus_tag LOCUS_11190 33102 33650 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357053.1 protein_id gnl|my_center|LOCUS_11190 33701 34330 gene locus_tag LOCUS_11200 gene gloC 33701 34330 CDS product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109455.1 protein_id gnl|my_center|LOCUS_11200 35580 34387 gene locus_tag LOCUS_11210 gene aspC 35580 34387 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462648.1 protein_id gnl|my_center|LOCUS_11210 36967 35891 gene locus_tag LOCUS_11220 gene ompF 36967 35891 CDS product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097287.1 protein_id gnl|my_center|LOCUS_11220 38666 37266 gene locus_tag LOCUS_11230 gene asnS 38666 37266 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159985.1 protein_id gnl|my_center|LOCUS_11230 40040 38835 gene locus_tag LOCUS_11240 gene pncB 40040 38835 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305916.1 protein_id gnl|my_center|LOCUS_11240 40299 42914 gene locus_tag LOCUS_11250 gene pepN 40299 42914 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704896.1 protein_id gnl|my_center|LOCUS_11250 43754 42966 gene locus_tag LOCUS_11260 gene ssuB 43754 42966 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090500.1 protein_id gnl|my_center|LOCUS_11260 44545 43751 gene locus_tag LOCUS_11270 gene ssuC 44545 43751 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235210.1 protein_id gnl|my_center|LOCUS_11270 45202 44651 gene locus_tag LOCUS_11280 gene ssuE 45202 44651 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097270.1 protein_id gnl|my_center|LOCUS_11280 45459 46469 gene locus_tag LOCUS_11290 gene pyrD 45459 46469 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305914.1 protein_id gnl|my_center|LOCUS_11290 46648 47193 gene locus_tag LOCUS_11300 gene zapC 46648 47193 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005020285.1 protein_id gnl|my_center|LOCUS_11300 47512 49629 gene locus_tag LOCUS_11310 gene rlmKL 47512 49629 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086472.1 protein_id gnl|my_center|LOCUS_11310 49636 51549 gene locus_tag LOCUS_11320 49636 51549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038019873.1 protein_id gnl|my_center|LOCUS_11320 51568 52836 gene locus_tag LOCUS_11330 gene pqiA 51568 52836 CDS product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333164.1 protein_id gnl|my_center|LOCUS_11330 52823 54466 gene locus_tag LOCUS_11340 gene pqiB 52823 54466 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029684982.1 protein_id gnl|my_center|LOCUS_11340 54463 55026 gene locus_tag LOCUS_11350 gene pqiC 54463 55026 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170914.1 protein_id gnl|my_center|LOCUS_11350 54975 55178 gene locus_tag LOCUS_11360 54975 55178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 55297 55464 gene locus_tag LOCUS_11370 gene rmf 55297 55464 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228015.1 protein_id gnl|my_center|LOCUS_11370 56263 55745 gene locus_tag LOCUS_11380 gene fabA 56263 55745 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220006.1 protein_id gnl|my_center|LOCUS_11380 58077 56332 gene locus_tag LOCUS_11390 58077 56332 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097259.1 protein_id gnl|my_center|LOCUS_11390 58384 58842 gene locus_tag LOCUS_11400 gene matP 58384 58842 CDS product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097258.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence017 1814 2542 gene locus_tag LOCUS_11410 1814 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704984.1 protein_id gnl|my_center|LOCUS_11410 2567 3052 gene locus_tag LOCUS_11420 2567 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3055 4029 gene locus_tag LOCUS_11430 3055 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 4041 4295 gene locus_tag LOCUS_11440 4041 4295 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001443095.1 protein_id gnl|my_center|LOCUS_11440 4295 5707 gene locus_tag LOCUS_11450 4295 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 5700 9065 gene locus_tag LOCUS_11460 5700 9065 CDS product type VI secretion system membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211936.1 protein_id gnl|my_center|LOCUS_11460 9052 9585 gene locus_tag LOCUS_11470 gene tssJ 9052 9585 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096443.1 protein_id gnl|my_center|LOCUS_11470 9585 11360 gene locus_tag LOCUS_11480 gene tssF 9585 11360 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155110255.1 protein_id gnl|my_center|LOCUS_11480 11360 12436 gene locus_tag LOCUS_11490 gene tssG 11360 12436 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211941.1 protein_id gnl|my_center|LOCUS_11490 13206 12532 gene locus_tag LOCUS_11500 gene yecA 13206 12532 CDS product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847882.1 protein_id gnl|my_center|LOCUS_11500 13463 13203 gene locus_tag LOCUS_11510 13463 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 14350 13490 gene locus_tag LOCUS_11520 14350 13490 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981091.1 protein_id gnl|my_center|LOCUS_11520 17083 14360 gene locus_tag LOCUS_11530 17083 14360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 18199 17207 gene locus_tag LOCUS_11540 18199 17207 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388639.1 protein_id gnl|my_center|LOCUS_11540 18778 18281 gene locus_tag LOCUS_11550 18778 18281 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 protein_id gnl|my_center|LOCUS_11550 19340 21037 gene locus_tag LOCUS_11560 gene aspT 19340 21037 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068377.1 protein_id gnl|my_center|LOCUS_11560 21124 22725 gene locus_tag LOCUS_11570 21124 22725 CDS product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073522.1 protein_id gnl|my_center|LOCUS_11570 22959 23213 gene locus_tag LOCUS_11580 22959 23213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 23750 23379 gene locus_tag LOCUS_11590 23750 23379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 24712 23942 gene locus_tag LOCUS_11600 gene fabG 24712 23942 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_11600 25810 24752 gene locus_tag LOCUS_11610 gene rhaT 25810 24752 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_11610 26732 25818 gene locus_tag LOCUS_11620 26732 25818 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092846703.1 protein_id gnl|my_center|LOCUS_11620 27082 26732 gene locus_tag LOCUS_11630 gene rhaM 27082 26732 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391995.1 protein_id gnl|my_center|LOCUS_11630 28259 27072 gene locus_tag LOCUS_11640 gene rhmD 28259 27072 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174589.1 protein_id gnl|my_center|LOCUS_11640 29613 28393 gene locus_tag LOCUS_11650 29613 28393 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113702.1 protein_id gnl|my_center|LOCUS_11650 30661 29738 gene locus_tag LOCUS_11660 30661 29738 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966109.1 protein_id gnl|my_center|LOCUS_11660 31590 31354 gene locus_tag LOCUS_11670 31590 31354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 32782 31601 gene locus_tag LOCUS_11680 32782 31601 CDS product Bcr/CflA family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957917.1 protein_id gnl|my_center|LOCUS_11680 33505 32786 gene locus_tag LOCUS_11690 33505 32786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532982.1 protein_id gnl|my_center|LOCUS_11690 34284 33499 gene locus_tag LOCUS_11700 34284 33499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727509.1 protein_id gnl|my_center|LOCUS_11700 35168 34281 gene locus_tag LOCUS_11710 35168 34281 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083876.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11710 36054 35161 gene locus_tag LOCUS_11720 36054 35161 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_11720 37215 36118 gene locus_tag LOCUS_11730 37215 36118 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314633.1 protein_id gnl|my_center|LOCUS_11730 37962 37246 gene locus_tag LOCUS_11740 37962 37246 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089549.1 protein_id gnl|my_center|LOCUS_11740 38735 37950 gene locus_tag LOCUS_11750 38735 37950 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531948.1 protein_id gnl|my_center|LOCUS_11750 39985 38732 gene locus_tag LOCUS_11760 39985 38732 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533606.1 protein_id gnl|my_center|LOCUS_11760 40319 40005 gene locus_tag LOCUS_11770 40319 40005 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070702.1 protein_id gnl|my_center|LOCUS_11770 41041 41116 gene locus_tag LOCUS_t00060 41041 41116 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 41118 41191 gene locus_tag LOCUS_t00070 41118 41191 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 42405 41488 gene locus_tag LOCUS_11780 42405 41488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 43510 42554 gene locus_tag LOCUS_11790 43510 42554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 44940 43708 gene locus_tag LOCUS_11800 44940 43708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 46274 44937 gene locus_tag LOCUS_11810 gene ectB 46274 44937 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148528493.1 protein_id gnl|my_center|LOCUS_11810 47632 46295 gene locus_tag LOCUS_11820 gene pvdA 47632 46295 CDS product L-ornithine N(5)-monooxygenase PvdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114509.1 protein_id gnl|my_center|LOCUS_11820 48026 47658 gene locus_tag LOCUS_11830 48026 47658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 48519 48121 gene locus_tag LOCUS_11840 48519 48121 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211247.1 protein_id gnl|my_center|LOCUS_11840 49417 48506 gene locus_tag LOCUS_11850 49417 48506 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211248.1 protein_id gnl|my_center|LOCUS_11850 50313 49414 gene locus_tag LOCUS_11860 50313 49414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 51383 50337 gene locus_tag LOCUS_11870 51383 50337 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188514.1 protein_id gnl|my_center|LOCUS_11870 52036 51383 gene locus_tag LOCUS_11880 52036 51383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 53661 52033 gene locus_tag LOCUS_11890 53661 52033 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533314.1 protein_id gnl|my_center|LOCUS_11890 54185 53721 gene locus_tag LOCUS_11900 54185 53721 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089251.1 protein_id gnl|my_center|LOCUS_11900 54640 54176 gene locus_tag LOCUS_11910 54640 54176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531514.1 protein_id gnl|my_center|LOCUS_11910 56087 54627 gene locus_tag LOCUS_11920 56087 54627 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463516.1 protein_id gnl|my_center|LOCUS_11920 57291 57019 gene locus_tag LOCUS_11930 57291 57019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 57584 57348 gene locus_tag LOCUS_11940 57584 57348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11940 57826 57644 gene locus_tag LOCUS_11950 57826 57644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 58061 57873 gene locus_tag LOCUS_11960 58061 57873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 58756 58064 gene locus_tag LOCUS_11970 58756 58064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165356698.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence018 <1 888 gene locus_tag LOCUS_11980 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063787.1:substrate-binding domain-containing protein 910 2481 gene locus_tag LOCUS_11990 910 2481 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063789.1 protein_id gnl|my_center|LOCUS_11990 2515 3498 gene locus_tag LOCUS_12000 2515 3498 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063788.1 protein_id gnl|my_center|LOCUS_12000 3684 4118 gene locus_tag LOCUS_12010 3684 4118 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811574.1 protein_id gnl|my_center|LOCUS_12010 4128 5012 gene locus_tag LOCUS_12020 4128 5012 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811576.1 protein_id gnl|my_center|LOCUS_12020 5202 6200 gene locus_tag LOCUS_12030 5202 6200 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814501.1 protein_id gnl|my_center|LOCUS_12030 6432 7598 gene locus_tag LOCUS_12040 6432 7598 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270078.1 protein_id gnl|my_center|LOCUS_12040 7689 8570 gene locus_tag LOCUS_12050 7689 8570 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 protein_id gnl|my_center|LOCUS_12050 9312 10469 gene locus_tag LOCUS_12060 9312 10469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811606.1 protein_id gnl|my_center|LOCUS_12060 10480 11505 gene locus_tag LOCUS_12070 10480 11505 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_12070 11498 12112 gene locus_tag LOCUS_12080 11498 12112 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113265.1 protein_id gnl|my_center|LOCUS_12080 12144 12593 gene locus_tag LOCUS_12090 gene aroQ 12144 12593 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_12090 12590 13528 gene locus_tag LOCUS_12100 12590 13528 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510794.1 protein_id gnl|my_center|LOCUS_12100 14554 13592 gene locus_tag LOCUS_12110 14554 13592 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040706.1 protein_id gnl|my_center|LOCUS_12110 15049 16077 gene locus_tag LOCUS_12120 15049 16077 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968140.1 protein_id gnl|my_center|LOCUS_12120 16176 17030 gene locus_tag LOCUS_12130 16176 17030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086028.1 protein_id gnl|my_center|LOCUS_12130 17032 17853 gene locus_tag LOCUS_12140 17032 17853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383453.1 protein_id gnl|my_center|LOCUS_12140 18030 19280 gene locus_tag LOCUS_12150 18030 19280 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114443.1 protein_id gnl|my_center|LOCUS_12150 21036 19345 gene locus_tag LOCUS_12160 21036 19345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498066.1 protein_id gnl|my_center|LOCUS_12160 21902 21033 gene locus_tag LOCUS_12170 21902 21033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729788.1 protein_id gnl|my_center|LOCUS_12170 22803 21904 gene locus_tag LOCUS_12180 22803 21904 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384277.1 protein_id gnl|my_center|LOCUS_12180 24445 22835 gene locus_tag LOCUS_12190 24445 22835 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 protein_id gnl|my_center|LOCUS_12190 26117 24621 gene locus_tag LOCUS_12200 26117 24621 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537832.1 protein_id gnl|my_center|LOCUS_12200 28175 26493 gene locus_tag LOCUS_12210 gene nopX 28175 26493 CDS product type II secretion system effector nodulation protein NopX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857555.1 protein_id gnl|my_center|LOCUS_12210 28554 29132 gene locus_tag LOCUS_12220 28554 29132 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_12220 29327 30241 gene locus_tag LOCUS_12230 29327 30241 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 protein_id gnl|my_center|LOCUS_12230 31215 30334 gene locus_tag LOCUS_12240 31215 30334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737007.1 protein_id gnl|my_center|LOCUS_12240 32042 31212 gene locus_tag LOCUS_12250 32042 31212 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266332.1 protein_id gnl|my_center|LOCUS_12250 33098 32076 gene locus_tag LOCUS_12260 33098 32076 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266334.1 protein_id gnl|my_center|LOCUS_12260 34599 33415 gene locus_tag LOCUS_12270 34599 33415 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535741.1 protein_id gnl|my_center|LOCUS_12270 35346 34918 gene locus_tag LOCUS_12280 35346 34918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12280 35743 35294 gene locus_tag LOCUS_12290 35743 35294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12290 36597 35740 gene locus_tag LOCUS_12300 gene sitC 36597 35740 CDS product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370015.1 protein_id gnl|my_center|LOCUS_12300 36938 36594 gene locus_tag LOCUS_12310 36938 36594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12310 37273 36899 gene locus_tag LOCUS_12320 37273 36899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12320 37688 37395 gene locus_tag LOCUS_12330 37688 37395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12330 38230 38769 gene locus_tag LOCUS_12340 38230 38769 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773772.1 protein_id gnl|my_center|LOCUS_12340 38957 39493 gene locus_tag LOCUS_12350 38957 39493 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041165625.1 protein_id gnl|my_center|LOCUS_12350 39603 42089 gene locus_tag LOCUS_12360 39603 42089 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704501.1 protein_id gnl|my_center|LOCUS_12360 42089 43144 gene locus_tag LOCUS_12370 42089 43144 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704500.1 protein_id gnl|my_center|LOCUS_12370 43293 43904 gene locus_tag LOCUS_12380 43293 43904 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704499.1 protein_id gnl|my_center|LOCUS_12380 44909 44211 gene locus_tag LOCUS_12390 44909 44211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 45790 45521 gene locus_tag LOCUS_12400 45790 45521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 46465 46001 gene locus_tag LOCUS_12410 46465 46001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 46911 47411 gene locus_tag LOCUS_12420 gene tssB 46911 47411 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096428.1 protein_id gnl|my_center|LOCUS_12420 47465 49015 gene locus_tag LOCUS_12430 gene tssC 47465 49015 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023324775.1 protein_id gnl|my_center|LOCUS_12430 49033 50373 gene locus_tag LOCUS_12440 gene tssK 49033 50373 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096430.1 protein_id gnl|my_center|LOCUS_12440 50370 51059 gene locus_tag LOCUS_12450 gene tssL 50370 51059 CDS product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096431.1 protein_id gnl|my_center|LOCUS_12450 51056 52753 gene locus_tag LOCUS_12460 51056 52753 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120158270.1 protein_id gnl|my_center|LOCUS_12460 52901 53392 gene locus_tag LOCUS_12470 gene hcp 52901 53392 CDS product type VI secretion system effector Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366299.1 protein_id gnl|my_center|LOCUS_12470 53772 54042 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccagacccgcgcgcacgcggaaatcct 54113 56491 gene locus_tag LOCUS_12480 54113 56491 CDS product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705822.1 protein_id gnl|my_center|LOCUS_12480 56491 57270 gene locus_tag LOCUS_12490 56491 57270 CDS product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878141.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence019 1056 325 gene locus_tag LOCUS_12500 1056 325 CDS product class II aldolase and adducin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_12500 1968 1126 gene locus_tag LOCUS_12510 1968 1126 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230916.1 protein_id gnl|my_center|LOCUS_12510 2918 2046 gene locus_tag LOCUS_12520 gene thpD 2918 2046 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976953.1 protein_id gnl|my_center|LOCUS_12520 4829 3309 gene locus_tag LOCUS_12530 4829 3309 CDS product amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315104.1 protein_id gnl|my_center|LOCUS_12530 5683 4853 gene locus_tag LOCUS_12540 5683 4853 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726714.1 protein_id gnl|my_center|LOCUS_12540 6321 5806 gene locus_tag LOCUS_12550 6321 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 6631 7056 gene locus_tag LOCUS_12560 6631 7056 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369686.1 protein_id gnl|my_center|LOCUS_12560 8290 7343 gene locus_tag LOCUS_12570 8290 7343 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703484.1 protein_id gnl|my_center|LOCUS_12570 8637 10391 gene locus_tag LOCUS_12580 8637 10391 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186447661.1 protein_id gnl|my_center|LOCUS_12580 10781 10476 gene locus_tag LOCUS_12590 10781 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 10965 10795 gene locus_tag LOCUS_12600 10965 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210867.1 protein_id gnl|my_center|LOCUS_12600 11477 11241 gene locus_tag LOCUS_12610 11477 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 12449 11793 gene locus_tag LOCUS_12620 12449 11793 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142908.1 protein_id gnl|my_center|LOCUS_12620 13126 13455 gene locus_tag LOCUS_12630 13126 13455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12630 13592 13936 gene locus_tag LOCUS_12640 13592 13936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 14201 14413 gene locus_tag LOCUS_12650 14201 14413 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707644.1 protein_id gnl|my_center|LOCUS_12650 14756 15973 gene locus_tag LOCUS_12660 14756 15973 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 protein_id gnl|my_center|LOCUS_12660 16260 16412 gene locus_tag LOCUS_12670 16260 16412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 16354 16515 gene locus_tag LOCUS_12680 16354 16515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 16856 17110 gene locus_tag LOCUS_12690 gene iraP 16856 17110 CDS product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518423.1 protein_id gnl|my_center|LOCUS_12690 17382 17681 gene locus_tag LOCUS_12700 17382 17681 CDS product PsiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704542.1 protein_id gnl|my_center|LOCUS_12700 18674 17859 gene locus_tag LOCUS_12710 gene proC 18674 17859 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412190.1 protein_id gnl|my_center|LOCUS_12710 18929 19372 gene locus_tag LOCUS_12720 18929 19372 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158137.1 protein_id gnl|my_center|LOCUS_12720 20041 19409 gene locus_tag LOCUS_12730 20041 19409 CDS product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114320.1 protein_id gnl|my_center|LOCUS_12730 20344 20868 gene locus_tag LOCUS_12740 gene aroL 20344 20868 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208693.1 protein_id gnl|my_center|LOCUS_12740 20990 21274 gene locus_tag LOCUS_12750 gene ppnP 20990 21274 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368017.1 protein_id gnl|my_center|LOCUS_12750 22370 21459 gene locus_tag LOCUS_12760 gene rdgC 22370 21459 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160563.1 protein_id gnl|my_center|LOCUS_12760 22516 23430 gene locus_tag LOCUS_12770 gene mak 22516 23430 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219315.1 protein_id gnl|my_center|LOCUS_12770 24934 23471 gene locus_tag LOCUS_12780 gene eat 24934 23471 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267271.1 protein_id gnl|my_center|LOCUS_12780 25104 26108 gene locus_tag LOCUS_12790 25104 26108 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206268.1 protein_id gnl|my_center|LOCUS_12790 26260 27330 gene locus_tag LOCUS_12800 26260 27330 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206266.1 protein_id gnl|my_center|LOCUS_12800 27722 27333 gene locus_tag LOCUS_12810 27722 27333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 31476 27793 gene locus_tag LOCUS_12820 31476 27793 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816917.1 protein_id gnl|my_center|LOCUS_12820 32714 31473 gene locus_tag LOCUS_12830 gene sbcD 32714 31473 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208687.1 protein_id gnl|my_center|LOCUS_12830 32917 33606 gene locus_tag LOCUS_12840 gene phoB 32917 33606 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113921.1 protein_id gnl|my_center|LOCUS_12840 33621 34952 gene locus_tag LOCUS_12850 gene phoR 33621 34952 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704551.1 protein_id gnl|my_center|LOCUS_12850 35153 36256 gene locus_tag LOCUS_12860 35153 36256 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 protein_id gnl|my_center|LOCUS_12860 36661 37980 gene locus_tag LOCUS_12870 gene brnQ 36661 37980 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167571.1 protein_id gnl|my_center|LOCUS_12870 38047 39402 gene locus_tag LOCUS_12880 gene proY 38047 39402 CDS product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295329.1 protein_id gnl|my_center|LOCUS_12880 40725 39478 gene locus_tag LOCUS_12890 40725 39478 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210192.1 protein_id gnl|my_center|LOCUS_12890 41719 41138 gene locus_tag LOCUS_12900 41719 41138 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167576.1 protein_id gnl|my_center|LOCUS_12900 41825 42895 gene locus_tag LOCUS_12910 gene queA 41825 42895 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208673.1 protein_id gnl|my_center|LOCUS_12910 43263 44387 gene locus_tag LOCUS_12920 gene tgt 43263 44387 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667304.1 protein_id gnl|my_center|LOCUS_12920 44412 44744 gene locus_tag LOCUS_12930 gene yajC 44412 44744 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166605.1 protein_id gnl|my_center|LOCUS_12930 44772 46619 gene locus_tag LOCUS_12940 gene secD 44772 46619 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208670.1 protein_id gnl|my_center|LOCUS_12940 46630 47598 gene locus_tag LOCUS_12950 gene secF 46630 47598 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167586.1 protein_id gnl|my_center|LOCUS_12950 48646 47855 gene locus_tag LOCUS_12960 gene hisN 48646 47855 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606663.1 protein_id gnl|my_center|LOCUS_12960 48746 49516 gene locus_tag LOCUS_12970 48746 49516 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095418.1 protein_id gnl|my_center|LOCUS_12970 50126 49770 gene locus_tag LOCUS_12980 50126 49770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367842.1 protein_id gnl|my_center|LOCUS_12980 51059 50544 gene locus_tag LOCUS_12990 51059 50544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 51468 52940 gene locus_tag LOCUS_13000 51468 52940 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167861.1 protein_id gnl|my_center|LOCUS_13000 53299 53649 gene locus_tag LOCUS_13010 53299 53649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 53840 56017 gene locus_tag LOCUS_13020 53840 56017 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_13020 56112 56438 gene locus_tag LOCUS_13030 56112 56438 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165309.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence020 4231 1004 gene locus_tag LOCUS_13040 gene carB 4231 1004 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095532.1 protein_id gnl|my_center|LOCUS_13040 5394 4234 gene locus_tag LOCUS_13050 gene carA 5394 4234 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298633.1 protein_id gnl|my_center|LOCUS_13050 6667 5852 gene locus_tag LOCUS_13060 gene dapB 6667 5852 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210504.1 protein_id gnl|my_center|LOCUS_13060 6999 8312 gene locus_tag LOCUS_13070 6999 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 9315 8362 gene locus_tag LOCUS_13080 gene ispH 9315 8362 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815541.1 protein_id gnl|my_center|LOCUS_13080 9766 9296 gene locus_tag LOCUS_13090 gene fkpB 9766 9296 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004655.1 protein_id gnl|my_center|LOCUS_13090 10275 9763 gene locus_tag LOCUS_13100 gene lspA 10275 9763 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157006.1 protein_id gnl|my_center|LOCUS_13100 13091 10275 gene locus_tag LOCUS_13110 gene ileS 13091 10275 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286823.1 protein_id gnl|my_center|LOCUS_13110 14006 13119 gene locus_tag LOCUS_13120 gene ribF 14006 13119 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210510.1 protein_id gnl|my_center|LOCUS_13120 14378 14641 gene locus_tag LOCUS_13130 gene rpsT 14378 14641 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 protein_id gnl|my_center|LOCUS_13130 16241 15108 gene locus_tag LOCUS_13140 gene dnaJ 16241 15108 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 protein_id gnl|my_center|LOCUS_13140 18264 16348 gene locus_tag LOCUS_13150 gene dnaK 18264 16348 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516126.1 protein_id gnl|my_center|LOCUS_13150 19750 18449 gene locus_tag LOCUS_13160 19750 18449 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209244.1 protein_id gnl|my_center|LOCUS_13160 20464 19886 gene locus_tag LOCUS_13170 gene mog 20464 19886 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209243.1 protein_id gnl|my_center|LOCUS_13170 21561 20608 gene locus_tag LOCUS_13180 gene tal 21561 20608 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130185.1 protein_id gnl|my_center|LOCUS_13180 21775 22551 gene locus_tag LOCUS_13190 gene yaaA 21775 22551 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704335.1 protein_id gnl|my_center|LOCUS_13190 22769 23821 gene locus_tag LOCUS_13200 22769 23821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 24254 23970 gene locus_tag LOCUS_13210 24254 23970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 24156 25367 gene locus_tag LOCUS_13220 24156 25367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 26712 25426 gene locus_tag LOCUS_13230 gene thrC 26712 25426 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209239.1 protein_id gnl|my_center|LOCUS_13230 27644 26715 gene locus_tag LOCUS_13240 gene thrB 27644 26715 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209238.1 protein_id gnl|my_center|LOCUS_13240 30109 27647 gene locus_tag LOCUS_13250 gene thrA 30109 27647 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704333.1 protein_id gnl|my_center|LOCUS_13250 31141 30440 gene locus_tag LOCUS_13260 31141 30440 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704332.1 protein_id gnl|my_center|LOCUS_13260 31774 32490 gene locus_tag LOCUS_13270 gene arcA 31774 32490 CDS product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 protein_id gnl|my_center|LOCUS_13270 33032 32559 gene locus_tag LOCUS_13280 gene creA 33032 32559 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095506.1 protein_id gnl|my_center|LOCUS_13280 33237 34118 gene locus_tag LOCUS_13290 gene robA 33237 34118 CDS product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371679.1 protein_id gnl|my_center|LOCUS_13290 34802 34155 gene locus_tag LOCUS_13300 gene gpmB 34802 34155 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704328.1 protein_id gnl|my_center|LOCUS_13300 34853 35371 gene locus_tag LOCUS_13310 gene yjjX 34853 35371 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815530.1 protein_id gnl|my_center|LOCUS_13310 35804 35472 gene locus_tag LOCUS_13320 gene trpR 35804 35472 CDS product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368371.1 protein_id gnl|my_center|LOCUS_13320 37922 35991 gene locus_tag LOCUS_13330 gene sltY 37922 35991 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815528.1 protein_id gnl|my_center|LOCUS_13330 38210 40012 gene locus_tag LOCUS_13340 gene atzF 38210 40012 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 protein_id gnl|my_center|LOCUS_13340 40005 43625 gene locus_tag LOCUS_13350 gene uca 40005 43625 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140960.1 protein_id gnl|my_center|LOCUS_13350 43636 44346 gene locus_tag LOCUS_13360 43636 44346 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267779.1 protein_id gnl|my_center|LOCUS_13360 44370 45641 gene locus_tag LOCUS_13370 gene urtA 44370 45641 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_13370 45821 47395 gene locus_tag LOCUS_13380 gene urtB 45821 47395 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210793.1 protein_id gnl|my_center|LOCUS_13380 47395 48471 gene locus_tag LOCUS_13390 gene urtC 47395 48471 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210794.1 protein_id gnl|my_center|LOCUS_13390 48464 49255 gene locus_tag LOCUS_13400 gene urtD 48464 49255 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096633.1 protein_id gnl|my_center|LOCUS_13400 49236 49955 gene locus_tag LOCUS_13410 gene urtE 49236 49955 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096632.1 protein_id gnl|my_center|LOCUS_13410 50035 50799 gene locus_tag LOCUS_13420 gene deoR 50035 50799 CDS product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450106.1 protein_id gnl|my_center|LOCUS_13420 51773 50826 gene locus_tag LOCUS_13430 51773 50826 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970705.1 protein_id gnl|my_center|LOCUS_13430 51978 53645 gene locus_tag LOCUS_13440 gene ettA 51978 53645 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095500.1 protein_id gnl|my_center|LOCUS_13440 53893 54102 gene locus_tag LOCUS_13450 53893 54102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13450 54932 54273 gene locus_tag LOCUS_13460 54932 54273 CDS product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228082.1 protein_id gnl|my_center|LOCUS_13460 55372 54923 gene locus_tag LOCUS_13470 55372 54923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 <56702 55399 gene locus_tag LOCUS_13480 <56702 55399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463563.1:DUF2235 domain-containing protein note possible pseudo, frameshifted >Feature sequence021 1277 6 gene locus_tag LOCUS_13490 1277 6 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547538.1 protein_id gnl|my_center|LOCUS_13490 2801 1293 gene locus_tag LOCUS_13500 gene dhaS 2801 1293 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 protein_id gnl|my_center|LOCUS_13500 3094 2798 gene locus_tag LOCUS_13510 3094 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3849 3118 gene locus_tag LOCUS_13520 gene urtE 3849 3118 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096632.1 protein_id gnl|my_center|LOCUS_13520 4552 3827 gene locus_tag LOCUS_13530 gene urtD 4552 3827 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084268.1 protein_id gnl|my_center|LOCUS_13530 5565 4549 gene locus_tag LOCUS_13540 5565 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6428 5562 gene locus_tag LOCUS_13550 gene urtB 6428 5562 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532993.1 protein_id gnl|my_center|LOCUS_13550 7506 6442 gene locus_tag LOCUS_13560 7506 6442 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_13560 8737 7508 gene locus_tag LOCUS_13570 8737 7508 CDS product substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083028.1 protein_id gnl|my_center|LOCUS_13570 10037 8868 gene locus_tag LOCUS_13580 10037 8868 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966651.1 protein_id gnl|my_center|LOCUS_13580 10199 10621 gene locus_tag LOCUS_13590 10199 10621 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 protein_id gnl|my_center|LOCUS_13590 11761 10766 gene locus_tag LOCUS_13600 11761 10766 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 protein_id gnl|my_center|LOCUS_13600 13313 11829 gene locus_tag LOCUS_13610 13313 11829 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209440.1 protein_id gnl|my_center|LOCUS_13610 14261 13317 gene locus_tag LOCUS_13620 14261 13317 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209439.1 protein_id gnl|my_center|LOCUS_13620 15084 14254 gene locus_tag LOCUS_13630 15084 14254 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209438.1 protein_id gnl|my_center|LOCUS_13630 16270 15170 gene locus_tag LOCUS_13640 16270 15170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209437.1 protein_id gnl|my_center|LOCUS_13640 17792 16272 gene locus_tag LOCUS_13650 17792 16272 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167401.1 protein_id gnl|my_center|LOCUS_13650 18403 17792 gene locus_tag LOCUS_13660 18403 17792 CDS product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167399.1 protein_id gnl|my_center|LOCUS_13660 19354 18416 gene locus_tag LOCUS_13670 19354 18416 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209434.1 protein_id gnl|my_center|LOCUS_13670 19560 20507 gene locus_tag LOCUS_13680 19560 20507 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209443.1 protein_id gnl|my_center|LOCUS_13680 21088 20945 gene locus_tag LOCUS_13690 21088 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 21206 21358 gene locus_tag LOCUS_13700 21206 21358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 22639 21428 gene locus_tag LOCUS_13710 22639 21428 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704462.1 protein_id gnl|my_center|LOCUS_13710 23347 22643 gene locus_tag LOCUS_13720 23347 22643 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973715.1 protein_id gnl|my_center|LOCUS_13720 23452 24408 gene locus_tag LOCUS_13730 23452 24408 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816771.1 protein_id gnl|my_center|LOCUS_13730 24844 24769 gene locus_tag LOCUS_t00080 24844 24769 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25553 25005 gene locus_tag LOCUS_13740 gene pgsA 25553 25005 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170287.1 protein_id gnl|my_center|LOCUS_13740 26311 25619 gene locus_tag LOCUS_13750 26311 25619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13750 27391 26336 gene locus_tag LOCUS_13760 27391 26336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13760 28199 27450 gene locus_tag LOCUS_13770 gene uvrY 28199 27450 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211176.1 protein_id gnl|my_center|LOCUS_13770 28874 29098 gene locus_tag LOCUS_13780 28874 29098 CDS product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160184.1 protein_id gnl|my_center|LOCUS_13780 30192 29584 gene locus_tag LOCUS_13790 gene rhlI 30192 29584 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113896.1 protein_id gnl|my_center|LOCUS_13790 31706 33103 gene locus_tag LOCUS_13800 gene cycA 31706 33103 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174531811.1 protein_id gnl|my_center|LOCUS_13800 33815 33180 gene locus_tag LOCUS_13810 gene rutR 33815 33180 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367241.1 protein_id gnl|my_center|LOCUS_13810 34124 35215 gene locus_tag LOCUS_13820 gene rutA 34124 35215 CDS product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704991.1 protein_id gnl|my_center|LOCUS_13820 35215 35949 gene locus_tag LOCUS_13830 gene rutB 35215 35949 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307708.1 protein_id gnl|my_center|LOCUS_13830 36093 36479 gene locus_tag LOCUS_13840 gene rutC 36093 36479 CDS product pyrimidine utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169991.1 protein_id gnl|my_center|LOCUS_13840 36489 37316 gene locus_tag LOCUS_13850 gene rutD 36489 37316 CDS product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169992.1 protein_id gnl|my_center|LOCUS_13850 37301 37891 gene locus_tag LOCUS_13860 37301 37891 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367246.1 protein_id gnl|my_center|LOCUS_13860 37901 38437 gene locus_tag LOCUS_13870 gene rutF 37901 38437 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816246.1 protein_id gnl|my_center|LOCUS_13870 38472 39803 gene locus_tag LOCUS_13880 gene rutG 38472 39803 CDS product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764407.1 protein_id gnl|my_center|LOCUS_13880 40120 40719 gene locus_tag LOCUS_13890 gene wrbA 40120 40719 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062894.1 protein_id gnl|my_center|LOCUS_13890 40740 40970 gene locus_tag LOCUS_13900 40740 40970 CDS product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499832.1 protein_id gnl|my_center|LOCUS_13900 42779 41268 gene locus_tag LOCUS_13910 gene agp 42779 41268 CDS product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044266.1 protein_id gnl|my_center|LOCUS_13910 43293 43206 gene locus_tag LOCUS_t00090 43293 43206 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 43512 44168 gene locus_tag LOCUS_13920 gene yccA 43512 44168 CDS product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374046.1 protein_id gnl|my_center|LOCUS_13920 44274 44600 gene locus_tag LOCUS_13930 gene tusE 44274 44600 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904446.1 protein_id gnl|my_center|LOCUS_13930 44895 44617 gene locus_tag LOCUS_13940 gene yccX 44895 44617 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704915.1 protein_id gnl|my_center|LOCUS_13940 44983 46173 gene locus_tag LOCUS_13950 gene rlmI 44983 46173 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116288.1 protein_id gnl|my_center|LOCUS_13950 46235 46552 gene locus_tag LOCUS_13960 gene hspQ 46235 46552 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367415.1 protein_id gnl|my_center|LOCUS_13960 47011 46595 gene locus_tag LOCUS_13970 47011 46595 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 protein_id gnl|my_center|LOCUS_13970 47349 47993 gene locus_tag LOCUS_13980 47349 47993 CDS product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097250.1 protein_id gnl|my_center|LOCUS_13980 48087 48545 gene locus_tag LOCUS_13990 gene mgsA 48087 48545 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367424.1 protein_id gnl|my_center|LOCUS_13990 50631 48577 gene locus_tag LOCUS_14000 gene helD 50631 48577 CDS product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816055.1 protein_id gnl|my_center|LOCUS_14000 50771 51217 gene locus_tag LOCUS_14010 50771 51217 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704910.1 protein_id gnl|my_center|LOCUS_14010 51232 53373 gene locus_tag LOCUS_14020 gene yccS 51232 53373 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097254.1 protein_id gnl|my_center|LOCUS_14020 54294 53674 gene locus_tag LOCUS_14030 54294 53674 CDS product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097255.1 protein_id gnl|my_center|LOCUS_14030 54507 55013 gene locus_tag LOCUS_14040 gene sulA 54507 55013 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367430.1 protein_id gnl|my_center|LOCUS_14040 55364 56431 gene locus_tag LOCUS_14050 gene ompA 55364 56431 CDS product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989142.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence022 <1 664 gene locus_tag LOCUS_14060 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968133.1:amino acid ABC transporter ATP-binding protein 712 1188 gene locus_tag LOCUS_14070 712 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1227 1652 gene locus_tag LOCUS_14080 1227 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2281 4293 gene locus_tag LOCUS_14090 2281 4293 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035647.1 protein_id gnl|my_center|LOCUS_14090 4294 5277 gene locus_tag LOCUS_14100 4294 5277 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729925.1 protein_id gnl|my_center|LOCUS_14100 5278 6033 gene locus_tag LOCUS_14110 5278 6033 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088221.1 protein_id gnl|my_center|LOCUS_14110 6037 7065 gene locus_tag LOCUS_14120 6037 7065 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510662.1 protein_id gnl|my_center|LOCUS_14120 7683 7450 gene locus_tag LOCUS_14130 7683 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 8107 8979 gene locus_tag LOCUS_14140 8107 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 10070 9021 gene locus_tag LOCUS_14150 gene dusA 10070 9021 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095060.1 protein_id gnl|my_center|LOCUS_14150 11229 10450 gene locus_tag LOCUS_14160 11229 10450 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 protein_id gnl|my_center|LOCUS_14160 11843 12040 gene locus_tag LOCUS_14170 11843 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 12042 12500 gene locus_tag LOCUS_14180 gene gatA 12042 12500 CDS product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080443.1 protein_id gnl|my_center|LOCUS_14180 12532 12819 gene locus_tag LOCUS_14190 gene gatB 12532 12819 CDS product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824293.1 protein_id gnl|my_center|LOCUS_14190 12822 14195 gene locus_tag LOCUS_14200 12822 14195 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490608.1 protein_id gnl|my_center|LOCUS_14200 14244 15302 gene locus_tag LOCUS_14210 gene gatD 14244 15302 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844177.1 protein_id gnl|my_center|LOCUS_14210 15880 15602 gene locus_tag LOCUS_14220 15880 15602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14220 17475 16489 gene locus_tag LOCUS_14230 gene lacD 17475 16489 CDS product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357245.1 protein_id gnl|my_center|LOCUS_14230 18468 17521 gene locus_tag LOCUS_14240 gene lacC 18468 17521 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775547.1 protein_id gnl|my_center|LOCUS_14240 19699 18872 gene locus_tag LOCUS_14250 19699 18872 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175238.1 protein_id gnl|my_center|LOCUS_14250 21123 19714 gene locus_tag LOCUS_14260 21123 19714 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719918.1 protein_id gnl|my_center|LOCUS_14260 22055 21135 gene locus_tag LOCUS_14270 gene pfkB 22055 21135 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763021.1 protein_id gnl|my_center|LOCUS_14270 22201 22052 gene locus_tag LOCUS_14280 22201 22052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 22530 23366 gene locus_tag LOCUS_14290 22530 23366 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118366.1 protein_id gnl|my_center|LOCUS_14290 23370 24335 gene locus_tag LOCUS_14300 23370 24335 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027808.1 protein_id gnl|my_center|LOCUS_14300 24492 24677 gene locus_tag LOCUS_14310 24492 24677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 24795 25307 gene locus_tag LOCUS_14320 gene zur 24795 25307 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416263.1 protein_id gnl|my_center|LOCUS_14320 26093 25485 gene locus_tag LOCUS_14330 gene lexA 26093 25485 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_14330 26565 26209 gene locus_tag LOCUS_14340 26565 26209 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368764.1 protein_id gnl|my_center|LOCUS_14340 26694 29117 gene locus_tag LOCUS_14350 gene plsB 26694 29117 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017354.1 protein_id gnl|my_center|LOCUS_14350 30167 29298 gene locus_tag LOCUS_14360 gene ubiA 30167 29298 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209088.1 protein_id gnl|my_center|LOCUS_14360 30696 30169 gene locus_tag LOCUS_14370 gene ubiC 30696 30169 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095049.1 protein_id gnl|my_center|LOCUS_14370 31672 31274 gene locus_tag LOCUS_14380 gene psiE 31672 31274 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202963.1 protein_id gnl|my_center|LOCUS_14380 33915 31825 gene locus_tag LOCUS_14390 33915 31825 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095037.1 protein_id gnl|my_center|LOCUS_14390 34658 33915 gene locus_tag LOCUS_14400 34658 33915 CDS product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095036.1 protein_id gnl|my_center|LOCUS_14400 35302 34655 gene locus_tag LOCUS_14410 gene gfcB 35302 34655 CDS product lipoprotein GfcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247610.1 protein_id gnl|my_center|LOCUS_14410 35628 35380 gene locus_tag LOCUS_14420 35628 35380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 37921 36275 gene locus_tag LOCUS_14430 gene pgi 37921 36275 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790033.1 protein_id gnl|my_center|LOCUS_14430 38592 39947 gene locus_tag LOCUS_14440 gene lysC 38592 39947 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136394.1 protein_id gnl|my_center|LOCUS_14440 40150 40842 gene locus_tag LOCUS_14450 gene aqpZ 40150 40842 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704870.1 protein_id gnl|my_center|LOCUS_14450 41029 41970 gene locus_tag LOCUS_14460 gene panS 41029 41970 CDS product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704027.1 protein_id gnl|my_center|LOCUS_14460 43633 42008 gene locus_tag LOCUS_14470 43633 42008 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956807.1 protein_id gnl|my_center|LOCUS_14470 47564 43881 gene locus_tag LOCUS_14480 gene metH 47564 43881 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096047.1 protein_id gnl|my_center|LOCUS_14480 47770 48603 gene locus_tag LOCUS_14490 gene iclR 47770 48603 CDS product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368798.1 protein_id gnl|my_center|LOCUS_14490 50386 48656 gene locus_tag LOCUS_14500 gene aceK 50386 48656 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137261.1 protein_id gnl|my_center|LOCUS_14500 51805 50501 gene locus_tag LOCUS_14510 gene aceA 51805 50501 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857886.1 protein_id gnl|my_center|LOCUS_14510 53421 51823 gene locus_tag LOCUS_14520 gene aceB 53421 51823 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138905.1 protein_id gnl|my_center|LOCUS_14520 54694 53765 gene locus_tag LOCUS_14530 gene metA 54694 53765 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122786.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence023 1471 35 gene locus_tag LOCUS_14540 1471 35 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048103.1 protein_id gnl|my_center|LOCUS_14540 2252 1443 gene locus_tag LOCUS_14550 2252 1443 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261025.1 protein_id gnl|my_center|LOCUS_14550 3223 2339 gene locus_tag LOCUS_14560 gene rfbA 3223 2339 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857536.1 protein_id gnl|my_center|LOCUS_14560 4397 3312 gene locus_tag LOCUS_14570 gene rfbB 4397 3312 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699404.1 protein_id gnl|my_center|LOCUS_14570 6120 5107 gene locus_tag LOCUS_14580 gene galE 6120 5107 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 protein_id gnl|my_center|LOCUS_14580 7070 6174 gene locus_tag LOCUS_14590 gene galF 7070 6174 CDS product GalU regulator GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981469.1 protein_id gnl|my_center|LOCUS_14590 8255 7236 gene locus_tag LOCUS_14600 8255 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 9522 8356 gene locus_tag LOCUS_14610 9522 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 11390 9900 gene locus_tag LOCUS_14620 11390 9900 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_14620 13676 11631 gene locus_tag LOCUS_14630 13676 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 13675 13893 gene locus_tag LOCUS_14640 13675 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 15229 14186 gene locus_tag LOCUS_14650 gene lsgC 15229 14186 CDS product lipooligosaccharide biosynthesis family 4 glycosyltransferase LsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694187.1 protein_id gnl|my_center|LOCUS_14650 16028 15276 gene locus_tag LOCUS_14660 16028 15276 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031644.1 protein_id gnl|my_center|LOCUS_14660 17158 16247 gene locus_tag LOCUS_14670 17158 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 19444 17264 gene locus_tag LOCUS_14680 gene wzc 19444 17264 CDS product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097881.1 protein_id gnl|my_center|LOCUS_14680 19891 19457 gene locus_tag LOCUS_14690 19891 19457 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 protein_id gnl|my_center|LOCUS_14690 21042 19909 gene locus_tag LOCUS_14700 21042 19909 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014170829.1 protein_id gnl|my_center|LOCUS_14700 22782 21349 gene locus_tag LOCUS_14710 22782 21349 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_14710 23728 25308 gene locus_tag LOCUS_14720 23728 25308 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097884.1 protein_id gnl|my_center|LOCUS_14720 27172 25355 gene locus_tag LOCUS_14730 gene asmA 27172 25355 CDS product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252292.1 protein_id gnl|my_center|LOCUS_14730 27774 27193 gene locus_tag LOCUS_14740 gene dcd 27774 27193 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234783.1 protein_id gnl|my_center|LOCUS_14740 28480 27905 gene locus_tag LOCUS_14750 gene udk 28480 27905 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295424.1 protein_id gnl|my_center|LOCUS_14750 28934 29554 gene locus_tag LOCUS_14760 28934 29554 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706058.1 protein_id gnl|my_center|LOCUS_14760 29697 31049 gene locus_tag LOCUS_14770 gene yegD 29697 31049 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469681.1 protein_id gnl|my_center|LOCUS_14770 31261 32487 gene locus_tag LOCUS_14780 gene mdtA 31261 32487 CDS product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678993.1 protein_id gnl|my_center|LOCUS_14780 32487 35609 gene locus_tag LOCUS_14790 32487 35609 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097900.1 protein_id gnl|my_center|LOCUS_14790 35606 38677 gene locus_tag LOCUS_14800 gene mdtC 35606 38677 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667528.1 protein_id gnl|my_center|LOCUS_14800 38720 40132 gene locus_tag LOCUS_14810 38720 40132 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706067.1 protein_id gnl|my_center|LOCUS_14810 40138 41511 gene locus_tag LOCUS_14820 gene baeS 40138 41511 CDS product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097903.1 protein_id gnl|my_center|LOCUS_14820 41524 42231 gene locus_tag LOCUS_14830 gene baeR 41524 42231 CDS product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365781.1 protein_id gnl|my_center|LOCUS_14830 42389 43762 gene locus_tag LOCUS_14840 gene yegQ 42389 43762 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001517981.1 protein_id gnl|my_center|LOCUS_14840 44041 44940 gene locus_tag LOCUS_14850 gene yegS 44041 44940 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273393.1 protein_id gnl|my_center|LOCUS_14850 45283 46497 gene locus_tag LOCUS_14860 gene rspA 45283 46497 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298659.1 protein_id gnl|my_center|LOCUS_14860 46508 47518 gene locus_tag LOCUS_14870 46508 47518 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836057.1 protein_id gnl|my_center|LOCUS_14870 47620 48903 gene locus_tag LOCUS_14880 47620 48903 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824230.1 protein_id gnl|my_center|LOCUS_14880 48952 50415 gene locus_tag LOCUS_14890 48952 50415 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096786.1 protein_id gnl|my_center|LOCUS_14890 50505 51191 gene locus_tag LOCUS_14900 50505 51191 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215563.1 protein_id gnl|my_center|LOCUS_14900 52267 51215 gene locus_tag LOCUS_14910 gene fbaB 52267 51215 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365768.1 protein_id gnl|my_center|LOCUS_14910 53225 52425 gene locus_tag LOCUS_14920 gene thiD 53225 52425 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822268.1 protein_id gnl|my_center|LOCUS_14920 54013 53222 gene locus_tag LOCUS_14930 gene thiM 54013 53222 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195605.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence024 3 2549 gene locus_tag LOCUS_14940 gene mdtC 3 2549 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667608.1 protein_id gnl|my_center|LOCUS_14940 2556 3974 gene locus_tag LOCUS_14950 gene opmB 2556 3974 CDS product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_14950 4880 3978 gene locus_tag LOCUS_14960 4880 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 7033 4901 gene locus_tag LOCUS_14970 7033 4901 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_14970 8068 7043 gene locus_tag LOCUS_14980 8068 7043 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088527.1 protein_id gnl|my_center|LOCUS_14980 9584 8091 gene locus_tag LOCUS_14990 9584 8091 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095096.1 protein_id gnl|my_center|LOCUS_14990 10570 9587 gene locus_tag LOCUS_15000 10570 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 11709 11281 gene locus_tag LOCUS_15010 11709 11281 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200865.1 protein_id gnl|my_center|LOCUS_15010 11785 12147 gene locus_tag LOCUS_15020 11785 12147 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385272.1 protein_id gnl|my_center|LOCUS_15020 12144 12599 gene locus_tag LOCUS_15030 12144 12599 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529580.1 protein_id gnl|my_center|LOCUS_15030 12864 15020 gene locus_tag LOCUS_15040 gene aas 12864 15020 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896085.1 protein_id gnl|my_center|LOCUS_15040 15017 16225 gene locus_tag LOCUS_15050 gene lplT 15017 16225 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816987.1 protein_id gnl|my_center|LOCUS_15050 17329 16289 gene locus_tag LOCUS_15060 17329 16289 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209839.1 protein_id gnl|my_center|LOCUS_15060 17637 17494 gene locus_tag LOCUS_15070 17637 17494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 17782 17651 gene locus_tag LOCUS_15080 17782 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 18538 17828 gene locus_tag LOCUS_15090 18538 17828 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895635.1 protein_id gnl|my_center|LOCUS_15090 19298 18612 gene locus_tag LOCUS_15100 gene mutH 19298 18612 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165371.1 protein_id gnl|my_center|LOCUS_15100 19831 19643 gene locus_tag LOCUS_15110 19831 19643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 19983 20510 gene locus_tag LOCUS_15120 gene rppH 19983 20510 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165374.1 protein_id gnl|my_center|LOCUS_15120 20523 22769 gene locus_tag LOCUS_15130 gene ptsP 20523 22769 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957883.1 protein_id gnl|my_center|LOCUS_15130 22971 23843 gene locus_tag LOCUS_15140 gene lgt 22971 23843 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816984.1 protein_id gnl|my_center|LOCUS_15140 23850 24644 gene locus_tag LOCUS_15150 gene thyA 23850 24644 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816983.1 protein_id gnl|my_center|LOCUS_15150 25304 24645 gene locus_tag LOCUS_15160 gene ddpX 25304 24645 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285824.1 protein_id gnl|my_center|LOCUS_15160 25635 26096 gene locus_tag LOCUS_15170 25635 26096 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 protein_id gnl|my_center|LOCUS_15170 26087 26641 gene locus_tag LOCUS_15180 26087 26641 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211630.1 protein_id gnl|my_center|LOCUS_15180 26638 27066 gene locus_tag LOCUS_15190 26638 27066 CDS product YgdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173304.1 protein_id gnl|my_center|LOCUS_15190 27056 27358 gene locus_tag LOCUS_15200 27056 27358 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019280.1 protein_id gnl|my_center|LOCUS_15200 27457 30840 gene locus_tag LOCUS_15210 gene recC 27457 30840 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816979.1 protein_id gnl|my_center|LOCUS_15210 30967 33861 gene locus_tag LOCUS_15220 gene ptrA 30967 33861 CDS product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816978.1 protein_id gnl|my_center|LOCUS_15220 33854 37402 gene locus_tag LOCUS_15230 gene recB 33854 37402 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816977.1 protein_id gnl|my_center|LOCUS_15230 37399 39237 gene locus_tag LOCUS_15240 gene recD 37399 39237 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816976.1 protein_id gnl|my_center|LOCUS_15240 39764 39414 gene locus_tag LOCUS_15250 39764 39414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15250 40247 39921 gene locus_tag LOCUS_15260 40247 39921 CDS product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886449.1 protein_id gnl|my_center|LOCUS_15260 40804 40241 gene locus_tag LOCUS_15270 40804 40241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133086100.1 protein_id gnl|my_center|LOCUS_15270 42422 41094 gene locus_tag LOCUS_15280 gene argA 42422 41094 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098542.1 protein_id gnl|my_center|LOCUS_15280 42309 42569 gene locus_tag LOCUS_15290 42309 42569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 42584 43900 gene locus_tag LOCUS_15300 gene amiC 42584 43900 CDS product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173271.1 protein_id gnl|my_center|LOCUS_15300 45007 43985 gene locus_tag LOCUS_15310 45007 43985 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705075.1 protein_id gnl|my_center|LOCUS_15310 45463 46224 gene locus_tag LOCUS_15320 45463 46224 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_15320 46266 46553 gene locus_tag LOCUS_15330 46266 46553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 46638 47036 gene locus_tag LOCUS_15340 46638 47036 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528197.1 protein_id gnl|my_center|LOCUS_15340 47184 47795 gene locus_tag LOCUS_15350 47184 47795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15350 47796 48233 gene locus_tag LOCUS_15360 47796 48233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15360 48882 48196 gene locus_tag LOCUS_15370 48882 48196 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168864.1 protein_id gnl|my_center|LOCUS_15370 49161 49820 gene locus_tag LOCUS_15380 gene gstA 49161 49820 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444385.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence025 2668 1997 gene locus_tag LOCUS_15390 2668 1997 CDS product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387039.1 protein_id gnl|my_center|LOCUS_15390 4524 2665 gene locus_tag LOCUS_15400 4524 2665 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084105269.1 protein_id gnl|my_center|LOCUS_15400 4879 4529 gene locus_tag LOCUS_15410 4879 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 5011 4889 gene locus_tag LOCUS_15420 5011 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 5658 5101 gene locus_tag LOCUS_15430 5658 5101 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235713.1 protein_id gnl|my_center|LOCUS_15430 5821 8826 gene locus_tag LOCUS_15440 5821 8826 CDS product Tn3-like element Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143760.1 protein_id gnl|my_center|LOCUS_15440 12587 8982 gene locus_tag LOCUS_15450 gene uca 12587 8982 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096802.1 protein_id gnl|my_center|LOCUS_15450 13304 12669 gene locus_tag LOCUS_15460 13304 12669 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_15460 14025 13315 gene locus_tag LOCUS_15470 14025 13315 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 protein_id gnl|my_center|LOCUS_15470 14795 14037 gene locus_tag LOCUS_15480 14795 14037 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090873437.1 protein_id gnl|my_center|LOCUS_15480 15620 14808 gene locus_tag LOCUS_15490 15620 14808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_15490 16751 15636 gene locus_tag LOCUS_15500 16751 15636 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 protein_id gnl|my_center|LOCUS_15500 17374 18090 gene locus_tag LOCUS_15510 17374 18090 CDS product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175086.1 protein_id gnl|my_center|LOCUS_15510 18549 20471 gene locus_tag LOCUS_15520 gene mtlA 18549 20471 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093271.1 protein_id gnl|my_center|LOCUS_15520 20582 21730 gene locus_tag LOCUS_15530 gene mtlD 20582 21730 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645420.1 protein_id gnl|my_center|LOCUS_15530 21730 22332 gene locus_tag LOCUS_15540 gene mtlR 21730 22332 CDS product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228271.1 protein_id gnl|my_center|LOCUS_15540 22395 22757 gene locus_tag LOCUS_15550 22395 22757 CDS product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209618.1 protein_id gnl|my_center|LOCUS_15550 23564 22830 gene locus_tag LOCUS_15560 23564 22830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 24561 23944 gene locus_tag LOCUS_15570 gene sodA 24561 23944 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122632.1 protein_id gnl|my_center|LOCUS_15570 26105 24762 gene locus_tag LOCUS_15580 26105 24762 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206265.1 protein_id gnl|my_center|LOCUS_15580 26326 27102 gene locus_tag LOCUS_15590 26326 27102 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727633.1 protein_id gnl|my_center|LOCUS_15590 28009 27206 gene locus_tag LOCUS_15600 gene fdhD 28009 27206 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753617.1 protein_id gnl|my_center|LOCUS_15600 28278 29204 gene locus_tag LOCUS_15610 gene fdhE 28278 29204 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027727.1 protein_id gnl|my_center|LOCUS_15610 29321 29932 gene locus_tag LOCUS_15620 29321 29932 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766681.1 protein_id gnl|my_center|LOCUS_15620 30007 30747 gene locus_tag LOCUS_15630 30007 30747 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097911.1 protein_id gnl|my_center|LOCUS_15630 31714 30734 gene locus_tag LOCUS_15640 31714 30734 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012008.1 protein_id gnl|my_center|LOCUS_15640 32726 31701 gene locus_tag LOCUS_15650 32726 31701 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846217.1 protein_id gnl|my_center|LOCUS_15650 34012 32747 gene locus_tag LOCUS_15660 34012 32747 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 protein_id gnl|my_center|LOCUS_15660 35120 34197 gene locus_tag LOCUS_15670 35120 34197 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118645.1 protein_id gnl|my_center|LOCUS_15670 36066 36800 gene locus_tag LOCUS_15680 36066 36800 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211859.1 protein_id gnl|my_center|LOCUS_15680 37431 36781 gene locus_tag LOCUS_15690 37431 36781 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211858.1 protein_id gnl|my_center|LOCUS_15690 38686 37877 gene locus_tag LOCUS_15700 gene yidA 38686 37877 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209641.1 protein_id gnl|my_center|LOCUS_15700 41335 38927 gene locus_tag LOCUS_15710 gene gyrB 41335 38927 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703899.1 protein_id gnl|my_center|LOCUS_15710 42438 41353 gene locus_tag LOCUS_15720 gene recF 42438 41353 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209643.1 protein_id gnl|my_center|LOCUS_15720 43699 42599 gene locus_tag LOCUS_15730 gene dnaN 43699 42599 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673462.1 protein_id gnl|my_center|LOCUS_15730 45038 43704 gene locus_tag LOCUS_15740 gene dnaA 45038 43704 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014068246.1 protein_id gnl|my_center|LOCUS_15740 46019 46345 gene locus_tag LOCUS_15750 gene rnpA 46019 46345 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239725.1 protein_id gnl|my_center|LOCUS_15750 46309 46566 gene locus_tag LOCUS_15760 gene yidD 46309 46566 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703903.1 protein_id gnl|my_center|LOCUS_15760 46569 48212 gene locus_tag LOCUS_15770 gene yidC 46569 48212 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378272.1 protein_id gnl|my_center|LOCUS_15770 48340 49704 gene locus_tag LOCUS_15780 gene mnmE 48340 49704 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703904.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence026 <1 926 gene locus_tag LOCUS_15790 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369971.1:7-carboxy-7-deazaguanine synthase QueE 2461 1073 gene locus_tag LOCUS_15800 2461 1073 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903720.1 protein_id gnl|my_center|LOCUS_15800 3163 3408 gene locus_tag LOCUS_15810 3163 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 3497 3940 gene locus_tag LOCUS_15820 3497 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3937 4737 gene locus_tag LOCUS_15830 3937 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 4754 6049 gene locus_tag LOCUS_15840 4754 6049 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817199.1 protein_id gnl|my_center|LOCUS_15840 6063 6509 gene locus_tag LOCUS_15850 6063 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 6534 7655 gene locus_tag LOCUS_15860 6534 7655 CDS product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213784.1 protein_id gnl|my_center|LOCUS_15860 7659 8933 gene locus_tag LOCUS_15870 7659 8933 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079097.1 protein_id gnl|my_center|LOCUS_15870 9242 9868 gene locus_tag LOCUS_15880 9242 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 9872 10723 gene locus_tag LOCUS_15890 9872 10723 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261284.1 protein_id gnl|my_center|LOCUS_15890 10716 11483 gene locus_tag LOCUS_15900 10716 11483 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212166.1 protein_id gnl|my_center|LOCUS_15900 11524 12072 gene locus_tag LOCUS_15910 11524 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 12050 12649 gene locus_tag LOCUS_15920 gene tadF 12050 12649 CDS product tight adherence pilus pseudopilin TadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817205.1 protein_id gnl|my_center|LOCUS_15920 12630 13064 gene locus_tag LOCUS_15930 12630 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 13055 14725 gene locus_tag LOCUS_15940 13055 14725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 15260 14898 gene locus_tag LOCUS_15950 gene queD 15260 14898 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001329795.1 protein_id gnl|my_center|LOCUS_15950 15560 17365 gene locus_tag LOCUS_15960 gene cysJ 15560 17365 CDS product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703301.1 protein_id gnl|my_center|LOCUS_15960 17365 19077 gene locus_tag LOCUS_15970 gene cysI 17365 19077 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369975.1 protein_id gnl|my_center|LOCUS_15970 19087 19824 gene locus_tag LOCUS_15980 19087 19824 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167272.1 protein_id gnl|my_center|LOCUS_15980 20135 19851 gene locus_tag LOCUS_15990 20135 19851 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211043.1 protein_id gnl|my_center|LOCUS_15990 21163 20138 gene locus_tag LOCUS_16000 21163 20138 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490486.1 protein_id gnl|my_center|LOCUS_16000 21420 22835 gene locus_tag LOCUS_16010 gene cysG 21420 22835 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815607.1 protein_id gnl|my_center|LOCUS_16010 22845 23753 gene locus_tag LOCUS_16020 gene cysD 22845 23753 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499613.1 protein_id gnl|my_center|LOCUS_16020 23765 25204 gene locus_tag LOCUS_16030 gene cysN 23765 25204 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090348.1 protein_id gnl|my_center|LOCUS_16030 25206 25814 gene locus_tag LOCUS_16040 gene cysC 25206 25814 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098503.1 protein_id gnl|my_center|LOCUS_16040 25873 26193 gene locus_tag LOCUS_16050 25873 26193 CDS product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209389.1 protein_id gnl|my_center|LOCUS_16050 26968 26246 gene locus_tag LOCUS_16060 26968 26246 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705159.1 protein_id gnl|my_center|LOCUS_16060 27719 26955 gene locus_tag LOCUS_16070 27719 26955 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 protein_id gnl|my_center|LOCUS_16070 28529 27768 gene locus_tag LOCUS_16080 28529 27768 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705157.1 protein_id gnl|my_center|LOCUS_16080 28557 29048 gene locus_tag LOCUS_16090 28557 29048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 29045 29743 gene locus_tag LOCUS_16100 gene ispD 29045 29743 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246155.1 protein_id gnl|my_center|LOCUS_16100 29762 30244 gene locus_tag LOCUS_16110 gene ispF 29762 30244 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 protein_id gnl|my_center|LOCUS_16110 30244 31293 gene locus_tag LOCUS_16120 gene truD 30244 31293 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815611.1 protein_id gnl|my_center|LOCUS_16120 31757 31305 gene locus_tag LOCUS_16130 31757 31305 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727266.1 protein_id gnl|my_center|LOCUS_16130 33226 31835 gene locus_tag LOCUS_16140 33226 31835 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 protein_id gnl|my_center|LOCUS_16140 34219 33371 gene locus_tag LOCUS_16150 34219 33371 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385588.1 protein_id gnl|my_center|LOCUS_16150 34451 34254 gene locus_tag LOCUS_16160 34451 34254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 35511 36086 gene locus_tag LOCUS_16170 35511 36086 CDS product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 protein_id gnl|my_center|LOCUS_16170 36464 36856 gene locus_tag LOCUS_16180 36464 36856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16180 36856 37503 gene locus_tag LOCUS_16190 36856 37503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16190 39256 38042 gene locus_tag LOCUS_16200 gene hmpA 39256 38042 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967628.1 protein_id gnl|my_center|LOCUS_16200 39508 39960 gene locus_tag LOCUS_16210 gene nsrR 39508 39960 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_16210 40916 41668 gene locus_tag LOCUS_16220 gene surE 40916 41668 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305779.1 protein_id gnl|my_center|LOCUS_16220 41662 42288 gene locus_tag LOCUS_16230 41662 42288 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369988.1 protein_id gnl|my_center|LOCUS_16230 42602 43528 gene locus_tag LOCUS_16240 42602 43528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 43579 44571 gene locus_tag LOCUS_16250 gene rpoS 43579 44571 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 protein_id gnl|my_center|LOCUS_16250 47267 44706 gene locus_tag LOCUS_16260 gene mutS 47267 44706 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005807.1 protein_id gnl|my_center|LOCUS_16260 47784 48206 gene locus_tag LOCUS_16270 47784 48206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence027 105 30 gene locus_tag LOCUS_t00100 105 30 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 686 1630 gene locus_tag LOCUS_16280 686 1630 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245931.1 protein_id gnl|my_center|LOCUS_16280 2538 1744 gene locus_tag LOCUS_16290 gene mtfA 2538 1744 CDS product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302302.1 protein_id gnl|my_center|LOCUS_16290 3065 2583 gene locus_tag LOCUS_16300 3065 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16300 3772 4485 gene locus_tag LOCUS_16310 3772 4485 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097750.1 protein_id gnl|my_center|LOCUS_16310 4789 5139 gene locus_tag LOCUS_16320 gene hinT 4789 5139 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097111.1 protein_id gnl|my_center|LOCUS_16320 5160 5528 gene locus_tag LOCUS_16330 5160 5528 CDS product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225269.1 protein_id gnl|my_center|LOCUS_16330 5539 6138 gene locus_tag LOCUS_16340 5539 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 6122 6949 gene locus_tag LOCUS_16350 gene thiK 6122 6949 CDS product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517652.1 protein_id gnl|my_center|LOCUS_16350 7021 8064 gene locus_tag LOCUS_16360 gene nagZ 7021 8064 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097107.1 protein_id gnl|my_center|LOCUS_16360 8104 8646 gene locus_tag LOCUS_16370 gene ycfP 8104 8646 CDS product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587943.1 protein_id gnl|my_center|LOCUS_16370 9123 10427 gene locus_tag LOCUS_16380 gene ndh 9123 10427 CDS product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211053.1 protein_id gnl|my_center|LOCUS_16380 10712 11254 gene locus_tag LOCUS_16390 10712 11254 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170666.1 protein_id gnl|my_center|LOCUS_16390 14745 11299 gene locus_tag LOCUS_16400 gene mfd 14745 11299 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097100.1 protein_id gnl|my_center|LOCUS_16400 15199 14990 gene locus_tag LOCUS_16410 15199 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 15460 16659 gene locus_tag LOCUS_16420 gene lolC 15460 16659 CDS product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272105.1 protein_id gnl|my_center|LOCUS_16420 16652 17356 gene locus_tag LOCUS_16430 gene lolD 16652 17356 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158007.1 protein_id gnl|my_center|LOCUS_16430 17356 18597 gene locus_tag LOCUS_16440 gene lolE 17356 18597 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705054.1 protein_id gnl|my_center|LOCUS_16440 18818 19651 gene locus_tag LOCUS_16450 gene cobB 18818 19651 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816137.1 protein_id gnl|my_center|LOCUS_16450 19791 21017 gene locus_tag LOCUS_16460 gene pepT 19791 21017 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816138.1 protein_id gnl|my_center|LOCUS_16460 22229 21105 gene locus_tag LOCUS_16470 22229 21105 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097085.1 protein_id gnl|my_center|LOCUS_16470 23749 22286 gene locus_tag LOCUS_16480 gene phoQ 23749 22286 CDS product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170639.1 protein_id gnl|my_center|LOCUS_16480 24421 23753 gene locus_tag LOCUS_16490 gene phoP 24421 23753 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158018.1 protein_id gnl|my_center|LOCUS_16490 26011 24641 gene locus_tag LOCUS_16500 gene purB 26011 24641 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816141.1 protein_id gnl|my_center|LOCUS_16500 26702 26061 gene locus_tag LOCUS_16510 gene hflD 26702 26061 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024131182.1 protein_id gnl|my_center|LOCUS_16510 27899 26742 gene locus_tag LOCUS_16520 gene mnmA 27899 26742 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097080.1 protein_id gnl|my_center|LOCUS_16520 28419 27985 gene locus_tag LOCUS_16530 28419 27985 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097079.1 protein_id gnl|my_center|LOCUS_16530 28673 29923 gene locus_tag LOCUS_16540 gene icd 28673 29923 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210910.1 protein_id gnl|my_center|LOCUS_16540 30237 30656 gene locus_tag LOCUS_16550 30237 30656 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394197.1 protein_id gnl|my_center|LOCUS_16550 30659 31921 gene locus_tag LOCUS_16560 gene umuC 30659 31921 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096856.1 protein_id gnl|my_center|LOCUS_16560 33958 32216 gene locus_tag LOCUS_16570 33958 32216 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031071.1 protein_id gnl|my_center|LOCUS_16570 35343 33964 gene locus_tag LOCUS_16580 35343 33964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031070.1 protein_id gnl|my_center|LOCUS_16580 36298 35510 gene locus_tag LOCUS_16590 36298 35510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16590 37188 36295 gene locus_tag LOCUS_16600 37188 36295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16600 37774 37442 gene locus_tag LOCUS_16610 37774 37442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 38049 38228 gene locus_tag LOCUS_16620 38049 38228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 38713 38351 gene locus_tag LOCUS_16630 38713 38351 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705325.1 protein_id gnl|my_center|LOCUS_16630 39758 38814 gene locus_tag LOCUS_16640 gene ldcA 39758 38814 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705839.1 protein_id gnl|my_center|LOCUS_16640 40058 40615 gene locus_tag LOCUS_16650 gene emtA 40058 40615 CDS product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103057843.1 protein_id gnl|my_center|LOCUS_16650 41085 43490 gene locus_tag LOCUS_16660 41085 43490 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703276.1 protein_id gnl|my_center|LOCUS_16660 43903 43610 gene locus_tag LOCUS_16670 43903 43610 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703275.1 protein_id gnl|my_center|LOCUS_16670 44215 44412 gene locus_tag LOCUS_16680 44215 44412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 44423 44671 gene locus_tag LOCUS_16690 44423 44671 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 protein_id gnl|my_center|LOCUS_16690 45766 44903 gene locus_tag LOCUS_16700 45766 44903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16700 46578 45691 gene locus_tag LOCUS_16710 46578 45691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16710 46974 47915 gene locus_tag LOCUS_16720 gene ghrA 46974 47915 CDS product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705016.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence028 3167 489 gene locus_tag LOCUS_16730 gene adhE 3167 489 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210657.1 protein_id gnl|my_center|LOCUS_16730 3657 4304 gene locus_tag LOCUS_16740 3657 4304 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164160.1 protein_id gnl|my_center|LOCUS_16740 4674 4351 gene locus_tag LOCUS_16750 4674 4351 CDS product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425070.1 protein_id gnl|my_center|LOCUS_16750 6179 4719 gene locus_tag LOCUS_16760 gene cls 6179 4719 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 protein_id gnl|my_center|LOCUS_16760 6847 6551 gene locus_tag LOCUS_16770 6847 6551 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367051.1 protein_id gnl|my_center|LOCUS_16770 7051 7779 gene locus_tag LOCUS_16780 7051 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 8250 7822 gene locus_tag LOCUS_16790 gene yciA 8250 7822 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210641.1 protein_id gnl|my_center|LOCUS_16790 8845 8309 gene locus_tag LOCUS_16800 8845 8309 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808682.1 protein_id gnl|my_center|LOCUS_16800 9637 8900 gene locus_tag LOCUS_16810 9637 8900 CDS product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366197.1 protein_id gnl|my_center|LOCUS_16810 10082 9648 gene locus_tag LOCUS_16820 10082 9648 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 protein_id gnl|my_center|LOCUS_16820 10335 10967 gene locus_tag LOCUS_16830 gene ompW 10335 10967 CDS product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705753.1 protein_id gnl|my_center|LOCUS_16830 11330 11016 gene locus_tag LOCUS_16840 11330 11016 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_16840 12283 11480 gene locus_tag LOCUS_16850 gene trpA 12283 11480 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443087.1 protein_id gnl|my_center|LOCUS_16850 13473 12283 gene locus_tag LOCUS_16860 gene trpB 13473 12283 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096356.1 protein_id gnl|my_center|LOCUS_16860 14882 13521 gene locus_tag LOCUS_16870 gene trpCF 14882 13521 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050075568.1 protein_id gnl|my_center|LOCUS_16870 15886 14885 gene locus_tag LOCUS_16880 15886 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16880 16477 15899 gene locus_tag LOCUS_16890 16477 15899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16890 18039 16477 gene locus_tag LOCUS_16900 18039 16477 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816407.1 protein_id gnl|my_center|LOCUS_16900 18349 19191 gene locus_tag LOCUS_16910 gene rnm 18349 19191 CDS product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705744.1 protein_id gnl|my_center|LOCUS_16910 19228 19848 gene locus_tag LOCUS_16920 19228 19848 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 protein_id gnl|my_center|LOCUS_16920 20216 21082 gene locus_tag LOCUS_16930 gene rluB 20216 21082 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291216.1 protein_id gnl|my_center|LOCUS_16930 21721 21128 gene locus_tag LOCUS_16940 gene cobO 21721 21128 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096364.1 protein_id gnl|my_center|LOCUS_16940 22482 21721 gene locus_tag LOCUS_16950 22482 21721 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118664067.1 protein_id gnl|my_center|LOCUS_16950 22700 23749 gene locus_tag LOCUS_16960 gene sohB 22700 23749 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816401.1 protein_id gnl|my_center|LOCUS_16960 24029 23757 gene locus_tag LOCUS_16970 24029 23757 CDS product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210623.1 protein_id gnl|my_center|LOCUS_16970 24425 27022 gene locus_tag LOCUS_16980 gene topA 24425 27022 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513593.1 protein_id gnl|my_center|LOCUS_16980 27344 28318 gene locus_tag LOCUS_16990 gene cysB 27344 28318 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175683.1 protein_id gnl|my_center|LOCUS_16990 28777 28950 gene locus_tag LOCUS_17000 28777 28950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 28954 29118 gene locus_tag LOCUS_17010 28954 29118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 29626 32304 gene locus_tag LOCUS_17020 gene acnA 29626 32304 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099547.1 protein_id gnl|my_center|LOCUS_17020 32994 32380 gene locus_tag LOCUS_17030 gene ribA 32994 32380 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176295.1 protein_id gnl|my_center|LOCUS_17030 33211 33975 gene locus_tag LOCUS_17040 gene pgpB 33211 33975 CDS product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420925.1 protein_id gnl|my_center|LOCUS_17040 34131 34439 gene locus_tag LOCUS_17050 34131 34439 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096374.1 protein_id gnl|my_center|LOCUS_17050 34446 35615 gene locus_tag LOCUS_17060 gene lapB 34446 35615 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096375.1 protein_id gnl|my_center|LOCUS_17060 35818 36540 gene locus_tag LOCUS_17070 gene pyrF 35818 36540 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763993.1 protein_id gnl|my_center|LOCUS_17070 36537 36860 gene locus_tag LOCUS_17080 gene yciH 36537 36860 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705734.1 protein_id gnl|my_center|LOCUS_17080 37162 36947 gene locus_tag LOCUS_17090 gene osmB 37162 36947 CDS product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498247.1 protein_id gnl|my_center|LOCUS_17090 39688 37622 gene locus_tag LOCUS_17100 39688 37622 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169907.1 protein_id gnl|my_center|LOCUS_17100 41811 39877 gene locus_tag LOCUS_17110 41811 39877 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096382.1 protein_id gnl|my_center|LOCUS_17110 44241 41935 gene locus_tag LOCUS_17120 44241 41935 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816272.1 protein_id gnl|my_center|LOCUS_17120 44562 45467 gene locus_tag LOCUS_17130 44562 45467 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816367.1 protein_id gnl|my_center|LOCUS_17130 46668 45502 gene locus_tag LOCUS_17140 46668 45502 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705732.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence029 1731 70 gene locus_tag LOCUS_17150 1731 70 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525720.1 protein_id gnl|my_center|LOCUS_17150 3284 2511 gene locus_tag LOCUS_17160 gene sseB 3284 2511 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298978.1 protein_id gnl|my_center|LOCUS_17160 4607 3321 gene locus_tag LOCUS_17170 gene pepB 4607 3321 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081828.1 protein_id gnl|my_center|LOCUS_17170 6243 5029 gene locus_tag LOCUS_17180 gene iscS 6243 5029 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 protein_id gnl|my_center|LOCUS_17180 6898 6404 gene locus_tag LOCUS_17190 gene iscR 6898 6404 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707916.1 protein_id gnl|my_center|LOCUS_17190 7780 7052 gene locus_tag LOCUS_17200 gene trmJ 7780 7052 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940018.1 protein_id gnl|my_center|LOCUS_17200 7901 8704 gene locus_tag LOCUS_17210 gene suhB 7901 8704 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553451.1 protein_id gnl|my_center|LOCUS_17210 9747 8743 gene locus_tag LOCUS_17220 9747 8743 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081833.1 protein_id gnl|my_center|LOCUS_17220 10397 9738 gene locus_tag LOCUS_17230 10397 9738 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098298.1 protein_id gnl|my_center|LOCUS_17230 10581 11807 gene locus_tag LOCUS_17240 gene csiE 10581 11807 CDS product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703176.1 protein_id gnl|my_center|LOCUS_17240 13128 11875 gene locus_tag LOCUS_17250 13128 11875 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919178.1 protein_id gnl|my_center|LOCUS_17250 13798 13460 gene locus_tag LOCUS_17260 gene glnB 13798 13460 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231018.1 protein_id gnl|my_center|LOCUS_17260 15387 14050 gene locus_tag LOCUS_17270 gene glrR 15387 14050 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 protein_id gnl|my_center|LOCUS_17270 16148 15384 gene locus_tag LOCUS_17280 gene qseG 16148 15384 CDS product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446608.1 protein_id gnl|my_center|LOCUS_17280 17579 16152 gene locus_tag LOCUS_17290 17579 16152 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049561091.1 protein_id gnl|my_center|LOCUS_17290 22076 18186 gene locus_tag LOCUS_17300 gene purL 22076 18186 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970087.1 protein_id gnl|my_center|LOCUS_17300 22344 23801 gene locus_tag LOCUS_17310 gene mltF 22344 23801 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172712.1 protein_id gnl|my_center|LOCUS_17310 24306 23809 gene locus_tag LOCUS_17320 gene tadA 24306 23809 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 protein_id gnl|my_center|LOCUS_17320 25025 24390 gene locus_tag LOCUS_17330 gene yfhb 25025 24390 CDS product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098310.1 protein_id gnl|my_center|LOCUS_17330 26961 26683 gene locus_tag LOCUS_17340 26961 26683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 27930 26971 gene locus_tag LOCUS_17350 27930 26971 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974240.1 protein_id gnl|my_center|LOCUS_17350 28511 28080 gene locus_tag LOCUS_17360 28511 28080 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097827.1 protein_id gnl|my_center|LOCUS_17360 28611 29531 gene locus_tag LOCUS_17370 28611 29531 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097828.1 protein_id gnl|my_center|LOCUS_17370 29870 31249 gene locus_tag LOCUS_17380 29870 31249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 31581 31330 gene locus_tag LOCUS_17390 31581 31330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 31854 32108 gene locus_tag LOCUS_17400 gene yfhL 31854 32108 CDS product 4Fe-4S dicluster ferredoxin YfhL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196297.1 protein_id gnl|my_center|LOCUS_17400 32491 32111 gene locus_tag LOCUS_17410 gene acpS 32491 32111 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986043.1 protein_id gnl|my_center|LOCUS_17410 33222 32491 gene locus_tag LOCUS_17420 gene pdxJ 33222 32491 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815755.1 protein_id gnl|my_center|LOCUS_17420 34037 33300 gene locus_tag LOCUS_17430 gene recO 34037 33300 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209680.1 protein_id gnl|my_center|LOCUS_17430 34953 34045 gene locus_tag LOCUS_17440 gene era 34953 34045 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159414.1 protein_id gnl|my_center|LOCUS_17440 35630 34950 gene locus_tag LOCUS_17450 gene rnc 35630 34950 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068343.1 protein_id gnl|my_center|LOCUS_17450 36741 35767 gene locus_tag LOCUS_17460 gene lepB 36741 35767 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002559.1 protein_id gnl|my_center|LOCUS_17460 38550 36751 gene locus_tag LOCUS_17470 gene lepA 38550 36751 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172749.1 protein_id gnl|my_center|LOCUS_17470 39148 38792 gene locus_tag LOCUS_17480 39148 38792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 40221 39259 gene locus_tag LOCUS_17490 gene rseB 40221 39259 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812041.1 protein_id gnl|my_center|LOCUS_17490 40871 40221 gene locus_tag LOCUS_17500 gene rseA 40871 40221 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168379.1 protein_id gnl|my_center|LOCUS_17500 41476 40901 gene locus_tag LOCUS_17510 gene rpoE 41476 40901 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176728.1 protein_id gnl|my_center|LOCUS_17510 41944 43563 gene locus_tag LOCUS_17520 gene nadB 41944 43563 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094491.1 protein_id gnl|my_center|LOCUS_17520 44285 43545 gene locus_tag LOCUS_17530 44285 43545 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098325.1 protein_id gnl|my_center|LOCUS_17530 44418 45743 gene locus_tag LOCUS_17540 gene srmB 44418 45743 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370281.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence030 670 1248 gene locus_tag LOCUS_17550 670 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1541 2341 gene locus_tag LOCUS_17560 1541 2341 CDS product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097597.1 protein_id gnl|my_center|LOCUS_17560 2552 2755 gene locus_tag LOCUS_17570 gene tatE 2552 2755 CDS product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859519.1 protein_id gnl|my_center|LOCUS_17570 3877 2912 gene locus_tag LOCUS_17580 gene lipA 3877 2912 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004712243.1 protein_id gnl|my_center|LOCUS_17580 4744 4052 gene locus_tag LOCUS_17590 gene lipB 4744 4052 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218201.1 protein_id gnl|my_center|LOCUS_17590 5059 4796 gene locus_tag LOCUS_17600 gene ybeD 5059 4796 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210322.1 protein_id gnl|my_center|LOCUS_17600 6468 5257 gene locus_tag LOCUS_17610 gene dacA 6468 5257 CDS product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167886.1 protein_id gnl|my_center|LOCUS_17610 7917 6817 gene locus_tag LOCUS_17620 gene rlpA 7917 6817 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167887.1 protein_id gnl|my_center|LOCUS_17620 9052 7928 gene locus_tag LOCUS_17630 gene mrdB 9052 7928 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 protein_id gnl|my_center|LOCUS_17630 10953 9049 gene locus_tag LOCUS_17640 gene mrdA 10953 9049 CDS product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097589.1 protein_id gnl|my_center|LOCUS_17640 11455 10985 gene locus_tag LOCUS_17650 gene rlmH 11455 10985 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210328.1 protein_id gnl|my_center|LOCUS_17650 11776 11459 gene locus_tag LOCUS_17660 gene rsfS 11776 11459 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 protein_id gnl|my_center|LOCUS_17660 12035 11805 gene locus_tag LOCUS_17670 12035 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 12744 12091 gene locus_tag LOCUS_17680 gene nadD 12744 12091 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210330.1 protein_id gnl|my_center|LOCUS_17680 13768 12737 gene locus_tag LOCUS_17690 gene holA 13768 12737 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210331.1 protein_id gnl|my_center|LOCUS_17690 14361 13765 gene locus_tag LOCUS_17700 gene lptE 14361 13765 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816836.1 protein_id gnl|my_center|LOCUS_17700 16958 14376 gene locus_tag LOCUS_17710 gene leuS 16958 14376 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210333.1 protein_id gnl|my_center|LOCUS_17710 17196 17678 gene locus_tag LOCUS_17720 17196 17678 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831082.1 protein_id gnl|my_center|LOCUS_17720 17830 18141 gene locus_tag LOCUS_17730 17830 18141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 18407 20074 gene locus_tag LOCUS_17740 gene menD 18407 20074 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210247.1 protein_id gnl|my_center|LOCUS_17740 20071 20841 gene locus_tag LOCUS_17750 gene menH 20071 20841 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210246.1 protein_id gnl|my_center|LOCUS_17750 20868 21725 gene locus_tag LOCUS_17760 gene menB 20868 21725 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640013.1 protein_id gnl|my_center|LOCUS_17760 21725 22693 gene locus_tag LOCUS_17770 gene menC 21725 22693 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210244.1 protein_id gnl|my_center|LOCUS_17770 22681 24057 gene locus_tag LOCUS_17780 gene menE 22681 24057 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298357.1 protein_id gnl|my_center|LOCUS_17780 25542 24106 gene locus_tag LOCUS_17790 gene katA 25542 24106 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175627974.1 protein_id gnl|my_center|LOCUS_17790 25904 27100 gene locus_tag LOCUS_17800 25904 27100 CDS product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171600.1 protein_id gnl|my_center|LOCUS_17800 27927 27199 gene locus_tag LOCUS_17810 gene ubiG 27927 27199 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365620.1 protein_id gnl|my_center|LOCUS_17810 28105 30741 gene locus_tag LOCUS_17820 gene gyrA 28105 30741 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098009.1 protein_id gnl|my_center|LOCUS_17820 31503 30886 gene locus_tag LOCUS_17830 31503 30886 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742279.1 protein_id gnl|my_center|LOCUS_17830 31941 34733 gene locus_tag LOCUS_17840 gene rcsC 31941 34733 CDS product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098008.1 protein_id gnl|my_center|LOCUS_17840 35463 34813 gene locus_tag LOCUS_17850 gene rcsB 35463 34813 CDS product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210824.1 protein_id gnl|my_center|LOCUS_17850 38125 35456 gene locus_tag LOCUS_17860 gene rcsD 38125 35456 CDS product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619743.1 protein_id gnl|my_center|LOCUS_17860 36250 36178 gene locus_tag LOCUS_t00110 36250 36178 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 39325 38150 gene locus_tag LOCUS_17870 39325 38150 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210825.1 protein_id gnl|my_center|LOCUS_17870 40050 41168 gene locus_tag LOCUS_17880 40050 41168 CDS product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171545.1 protein_id gnl|my_center|LOCUS_17880 41616 42539 gene locus_tag LOCUS_17890 gene apbE 41616 42539 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784304.1 protein_id gnl|my_center|LOCUS_17890 42642 43274 gene locus_tag LOCUS_17900 gene alkB 42642 43274 CDS product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365631.1 protein_id gnl|my_center|LOCUS_17900 44075 43341 gene locus_tag LOCUS_17910 44075 43341 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213120.1 protein_id gnl|my_center|LOCUS_17910 44388 44167 gene locus_tag LOCUS_17920 44388 44167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095877.1 protein_id gnl|my_center|LOCUS_17920 44630 45496 gene locus_tag LOCUS_17930 44630 45496 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208318.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence031 2028 370 gene locus_tag LOCUS_17940 gene actP 2028 370 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095079.1 protein_id gnl|my_center|LOCUS_17940 2336 2028 gene locus_tag LOCUS_17950 2336 2028 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999620.1 protein_id gnl|my_center|LOCUS_17950 4467 2512 gene locus_tag LOCUS_17960 gene acs 4467 2512 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078206.1 protein_id gnl|my_center|LOCUS_17960 5185 6486 gene locus_tag LOCUS_17970 gene gltP 5185 6486 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209033.1 protein_id gnl|my_center|LOCUS_17970 6452 7459 gene locus_tag LOCUS_17980 gene murQ 6452 7459 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817228.1 protein_id gnl|my_center|LOCUS_17980 8704 7481 gene locus_tag LOCUS_17990 gene sbmA 8704 7481 CDS product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301663.1 protein_id gnl|my_center|LOCUS_17990 10313 8910 gene locus_tag LOCUS_18000 10313 8910 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366510.1 protein_id gnl|my_center|LOCUS_18000 10492 10902 gene locus_tag LOCUS_18010 gene emrE 10492 10902 CDS product SMR family multidrug efflux protein EmrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070440.1 protein_id gnl|my_center|LOCUS_18010 11434 12693 gene locus_tag LOCUS_18020 11434 12693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206429.1 protein_id gnl|my_center|LOCUS_18020 12703 14613 gene locus_tag LOCUS_18030 12703 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533061.1 protein_id gnl|my_center|LOCUS_18030 14727 15464 gene locus_tag LOCUS_18040 14727 15464 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817006.1 protein_id gnl|my_center|LOCUS_18040 16679 15702 gene locus_tag LOCUS_18050 gene hemB 16679 15702 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095798.1 protein_id gnl|my_center|LOCUS_18050 18364 16859 gene locus_tag LOCUS_18060 gene proP 18364 16859 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296882.1 protein_id gnl|my_center|LOCUS_18060 19615 18650 gene locus_tag LOCUS_18070 19615 18650 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028521.1 protein_id gnl|my_center|LOCUS_18070 20094 19861 gene locus_tag LOCUS_18080 20094 19861 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882582.1 protein_id gnl|my_center|LOCUS_18080 20675 20139 gene locus_tag LOCUS_18090 20675 20139 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069273.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18090 21070 22281 gene locus_tag LOCUS_18100 21070 22281 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703713.1 protein_id gnl|my_center|LOCUS_18100 23168 22458 gene locus_tag LOCUS_18110 23168 22458 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157438.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18110 25300 23378 gene locus_tag LOCUS_18120 gene iolC 25300 23378 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050164505.1 protein_id gnl|my_center|LOCUS_18120 26740 25634 gene locus_tag LOCUS_18130 26740 25634 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168094.1 protein_id gnl|my_center|LOCUS_18130 27876 26749 gene locus_tag LOCUS_18140 27876 26749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070131.1 protein_id gnl|my_center|LOCUS_18140 29609 27873 gene locus_tag LOCUS_18150 29609 27873 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 protein_id gnl|my_center|LOCUS_18150 30594 29602 gene locus_tag LOCUS_18160 gene hlyD 30594 29602 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704812.1 protein_id gnl|my_center|LOCUS_18160 31433 30873 gene locus_tag LOCUS_18170 31433 30873 CDS product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245277.1 protein_id gnl|my_center|LOCUS_18170 32227 31559 gene locus_tag LOCUS_18180 32227 31559 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815353.1 protein_id gnl|my_center|LOCUS_18180 32465 32713 gene locus_tag LOCUS_18190 gene tusA 32465 32713 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215973.1 protein_id gnl|my_center|LOCUS_18190 33412 32783 gene locus_tag LOCUS_18200 33412 32783 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964735.1 protein_id gnl|my_center|LOCUS_18200 33601 33969 gene locus_tag LOCUS_18210 33601 33969 CDS product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815355.1 protein_id gnl|my_center|LOCUS_18210 34374 34099 gene locus_tag LOCUS_18220 34374 34099 CDS product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163952.1 protein_id gnl|my_center|LOCUS_18220 34966 34364 gene locus_tag LOCUS_18230 gene rsmD 34966 34364 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703709.1 protein_id gnl|my_center|LOCUS_18230 35155 36468 gene locus_tag LOCUS_18240 gene ftsY 35155 36468 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099141.1 protein_id gnl|my_center|LOCUS_18240 36465 37133 gene locus_tag LOCUS_18250 gene ftsE 36465 37133 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211504.1 protein_id gnl|my_center|LOCUS_18250 37123 38106 gene locus_tag LOCUS_18260 gene ftsX 37123 38106 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084329.1 protein_id gnl|my_center|LOCUS_18260 38379 39236 gene locus_tag LOCUS_18270 gene rpoH 38379 39236 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500093.1 protein_id gnl|my_center|LOCUS_18270 39715 39320 gene locus_tag LOCUS_18280 gene panM 39715 39320 CDS product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703707.1 protein_id gnl|my_center|LOCUS_18280 40166 41281 gene locus_tag LOCUS_18290 40166 41281 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163937.1 protein_id gnl|my_center|LOCUS_18290 41479 42405 gene locus_tag LOCUS_18300 gene livH 41479 42405 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211509.1 protein_id gnl|my_center|LOCUS_18300 42402 43676 gene locus_tag LOCUS_18310 gene livM 42402 43676 CDS product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369324.1 protein_id gnl|my_center|LOCUS_18310 43673 44440 gene locus_tag LOCUS_18320 gene livG 43673 44440 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082101.1 protein_id gnl|my_center|LOCUS_18320 44442 45155 gene locus_tag LOCUS_18330 gene livF 44442 45155 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099128.1 protein_id gnl|my_center|LOCUS_18330 <45999 45194 gene locus_tag LOCUS_18340 <45999 45194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044973.1:formylglycine-generating enzyme family protein >Feature sequence032 552 1466 gene locus_tag LOCUS_18350 gene accD 552 1466 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365554.1 protein_id gnl|my_center|LOCUS_18350 1538 2806 gene locus_tag LOCUS_18360 gene folC 1538 2806 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706173.1 protein_id gnl|my_center|LOCUS_18360 2796 3692 gene locus_tag LOCUS_18370 gene dedD 2796 3692 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171804.1 protein_id gnl|my_center|LOCUS_18370 3930 4433 gene locus_tag LOCUS_18380 gene cvpA 3930 4433 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 protein_id gnl|my_center|LOCUS_18380 4470 5987 gene locus_tag LOCUS_18390 gene purF 4470 5987 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098134.1 protein_id gnl|my_center|LOCUS_18390 6202 6771 gene locus_tag LOCUS_18400 gene ubiX 6202 6771 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825691.1 protein_id gnl|my_center|LOCUS_18400 7047 7829 gene locus_tag LOCUS_18410 gene hisJ 7047 7829 CDS product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365563.1 protein_id gnl|my_center|LOCUS_18410 7906 8592 gene locus_tag LOCUS_18420 7906 8592 CDS product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365564.1 protein_id gnl|my_center|LOCUS_18420 8589 9305 gene locus_tag LOCUS_18430 8589 9305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502590.1 protein_id gnl|my_center|LOCUS_18430 9314 10087 gene locus_tag LOCUS_18440 gene hisP 9314 10087 CDS product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171791.1 protein_id gnl|my_center|LOCUS_18440 11046 10153 gene locus_tag LOCUS_18450 11046 10153 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166265.1 protein_id gnl|my_center|LOCUS_18450 11786 11160 gene locus_tag LOCUS_18460 gene yfcG 11786 11160 CDS product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706166.1 protein_id gnl|my_center|LOCUS_18460 11975 12616 gene locus_tag LOCUS_18470 gene yfcF 11975 12616 CDS product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042440.1 protein_id gnl|my_center|LOCUS_18470 12900 13445 gene locus_tag LOCUS_18480 gene yfcD 12900 13445 CDS product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230215.1 protein_id gnl|my_center|LOCUS_18480 15725 13584 gene locus_tag LOCUS_18490 gene pta 15725 13584 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082007.1 protein_id gnl|my_center|LOCUS_18490 16996 15794 gene locus_tag LOCUS_18500 gene ackA 16996 15794 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095707.1 protein_id gnl|my_center|LOCUS_18500 17333 17785 gene locus_tag LOCUS_18510 gene yfbV 17333 17785 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171754.1 protein_id gnl|my_center|LOCUS_18510 17936 18430 gene locus_tag LOCUS_18520 17936 18430 CDS product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159196.1 protein_id gnl|my_center|LOCUS_18520 18444 19103 gene locus_tag LOCUS_18530 gene hxpA 18444 19103 CDS product hexitol phosphatase HxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203403.1 protein_id gnl|my_center|LOCUS_18530 19182 20999 gene locus_tag LOCUS_18540 19182 20999 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082012.1 protein_id gnl|my_center|LOCUS_18540 21672 21073 gene locus_tag LOCUS_18550 gene yfbR 21672 21073 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098110.1 protein_id gnl|my_center|LOCUS_18550 23207 21936 gene locus_tag LOCUS_18560 gene alaA 23207 21936 CDS product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098109.1 protein_id gnl|my_center|LOCUS_18560 24152 25078 gene locus_tag LOCUS_18570 gene lrhA 24152 25078 CDS product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881734.1 protein_id gnl|my_center|LOCUS_18570 25744 26181 gene locus_tag LOCUS_18580 gene nuoA 25744 26181 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913181.1 protein_id gnl|my_center|LOCUS_18580 26197 26871 gene locus_tag LOCUS_18590 gene nuoB 26197 26871 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913178.1 protein_id gnl|my_center|LOCUS_18590 26993 28792 gene locus_tag LOCUS_18600 gene nuoC 26993 28792 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247855.1 protein_id gnl|my_center|LOCUS_18600 28795 29310 gene locus_tag LOCUS_18610 gene nuoE 28795 29310 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545038.1 protein_id gnl|my_center|LOCUS_18610 29307 30653 gene locus_tag LOCUS_18620 gene nuoF 29307 30653 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861487.1 protein_id gnl|my_center|LOCUS_18620 30795 33518 gene locus_tag LOCUS_18630 gene nuoG 30795 33518 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706161.1 protein_id gnl|my_center|LOCUS_18630 33515 34492 gene locus_tag LOCUS_18640 gene nuoH 33515 34492 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365589.1 protein_id gnl|my_center|LOCUS_18640 34505 35047 gene locus_tag LOCUS_18650 gene nuoI 34505 35047 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172747.1 protein_id gnl|my_center|LOCUS_18650 35058 35612 gene locus_tag LOCUS_18660 gene nuoJ 35058 35612 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393511.1 protein_id gnl|my_center|LOCUS_18660 35609 35911 gene locus_tag LOCUS_18670 gene nuoK 35609 35911 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159229.1 protein_id gnl|my_center|LOCUS_18670 35908 37743 gene locus_tag LOCUS_18680 gene nuoL 35908 37743 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832758.1 protein_id gnl|my_center|LOCUS_18680 37872 39392 gene locus_tag LOCUS_18690 gene nuoM 37872 39392 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926441.1 protein_id gnl|my_center|LOCUS_18690 39399 40856 gene locus_tag LOCUS_18700 gene nuoN 39399 40856 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815945.1 protein_id gnl|my_center|LOCUS_18700 41037 41486 gene locus_tag LOCUS_18710 41037 41486 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365596.1 protein_id gnl|my_center|LOCUS_18710 43297 41693 gene locus_tag LOCUS_18720 43297 41693 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081955.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence033 79 3 gene locus_tag LOCUS_t00120 79 3 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 160 84 gene locus_tag LOCUS_t00130 160 84 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1663 290 gene locus_tag LOCUS_18730 gene mdtK 1663 290 CDS product MdtK family multidrug efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096934.1 protein_id gnl|my_center|LOCUS_18730 1885 2532 gene locus_tag LOCUS_18740 1885 2532 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096933.1 protein_id gnl|my_center|LOCUS_18740 3766 2618 gene locus_tag LOCUS_18750 gene cfa 3766 2618 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098902.1 protein_id gnl|my_center|LOCUS_18750 5223 4198 gene locus_tag LOCUS_18760 gene purR 5223 4198 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210943.1 protein_id gnl|my_center|LOCUS_18760 5391 5591 gene locus_tag LOCUS_18770 5391 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 6596 5709 gene locus_tag LOCUS_18780 6596 5709 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169450.1 protein_id gnl|my_center|LOCUS_18780 7073 7405 gene locus_tag LOCUS_18790 gene grxD 7073 7405 CDS product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108176.1 protein_id gnl|my_center|LOCUS_18790 8307 7627 gene locus_tag LOCUS_18800 gene rnt 8307 7627 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096924.1 protein_id gnl|my_center|LOCUS_18800 8817 8410 gene locus_tag LOCUS_18810 gene gloA 8817 8410 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165939.1 protein_id gnl|my_center|LOCUS_18810 10104 9004 gene locus_tag LOCUS_18820 10104 9004 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816376.1 protein_id gnl|my_center|LOCUS_18820 10745 10146 gene locus_tag LOCUS_18830 gene nemR 10745 10146 CDS product DNA-binding transcriptional regulator NemR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032947.1 protein_id gnl|my_center|LOCUS_18830 11560 10916 gene locus_tag LOCUS_18840 11560 10916 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705819.1 protein_id gnl|my_center|LOCUS_18840 11667 12596 gene locus_tag LOCUS_18850 11667 12596 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705820.1 protein_id gnl|my_center|LOCUS_18850 14697 12676 gene locus_tag LOCUS_18860 14697 12676 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169471.1 protein_id gnl|my_center|LOCUS_18860 15562 14705 gene locus_tag LOCUS_18870 15562 14705 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096915.1 protein_id gnl|my_center|LOCUS_18870 15959 16396 gene locus_tag LOCUS_18880 gene slyA 15959 16396 CDS product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078997.1 protein_id gnl|my_center|LOCUS_18880 16911 16444 gene locus_tag LOCUS_18890 gene slyB 16911 16444 CDS product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597179.1 protein_id gnl|my_center|LOCUS_18890 17196 18314 gene locus_tag LOCUS_18900 gene anmK 17196 18314 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096911.1 protein_id gnl|my_center|LOCUS_18900 18380 18694 gene locus_tag LOCUS_18910 18380 18694 CDS product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218323.1 protein_id gnl|my_center|LOCUS_18910 18761 19417 gene locus_tag LOCUS_18920 gene pdxH 18761 19417 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282319.1 protein_id gnl|my_center|LOCUS_18920 19550 20824 gene locus_tag LOCUS_18930 gene tyrS 19550 20824 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295400.1 protein_id gnl|my_center|LOCUS_18930 20891 21751 gene locus_tag LOCUS_18940 gene pdxY 20891 21751 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165910.1 protein_id gnl|my_center|LOCUS_18940 22439 21834 gene locus_tag LOCUS_18950 gene gstA 22439 21834 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816371.1 protein_id gnl|my_center|LOCUS_18950 22891 24312 gene locus_tag LOCUS_18960 22891 24312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18960 24263 24454 gene locus_tag LOCUS_18970 24263 24454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18970 25308 24673 gene locus_tag LOCUS_18980 gene nth 25308 24673 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 protein_id gnl|my_center|LOCUS_18980 26003 25305 gene locus_tag LOCUS_18990 26003 25305 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169892.1 protein_id gnl|my_center|LOCUS_18990 26628 25996 gene locus_tag LOCUS_19000 gene rsxG 26628 25996 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210600.1 protein_id gnl|my_center|LOCUS_19000 27691 26633 gene locus_tag LOCUS_19010 gene rsxD 27691 26633 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705232.1 protein_id gnl|my_center|LOCUS_19010 29830 27692 gene locus_tag LOCUS_19020 gene rsxC 29830 27692 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124232787.1 protein_id gnl|my_center|LOCUS_19020 30401 29823 gene locus_tag LOCUS_19030 gene rsxB 30401 29823 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096899.1 protein_id gnl|my_center|LOCUS_19030 30982 30401 gene locus_tag LOCUS_19040 gene rsxA 30982 30401 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133193.1 protein_id gnl|my_center|LOCUS_19040 31549 31106 gene locus_tag LOCUS_19050 31549 31106 CDS product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816280.1 protein_id gnl|my_center|LOCUS_19050 31869 31654 gene locus_tag LOCUS_19060 gene ydgT 31869 31654 CDS product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217950.1 protein_id gnl|my_center|LOCUS_19060 32757 32128 gene locus_tag LOCUS_19070 32757 32128 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812213.1 protein_id gnl|my_center|LOCUS_19070 33049 33900 gene locus_tag LOCUS_19080 33049 33900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 protein_id gnl|my_center|LOCUS_19080 33910 35022 gene locus_tag LOCUS_19090 33910 35022 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 protein_id gnl|my_center|LOCUS_19090 35038 36591 gene locus_tag LOCUS_19100 35038 36591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 protein_id gnl|my_center|LOCUS_19100 36605 37549 gene locus_tag LOCUS_19110 36605 37549 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066663.1 protein_id gnl|my_center|LOCUS_19110 37558 38364 gene locus_tag LOCUS_19120 37558 38364 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066662.1 protein_id gnl|my_center|LOCUS_19120 38364 40007 gene locus_tag LOCUS_19130 38364 40007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970010.1 protein_id gnl|my_center|LOCUS_19130 40112 41152 gene locus_tag LOCUS_19140 40112 41152 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096894.1 protein_id gnl|my_center|LOCUS_19140 42364 41564 gene locus_tag LOCUS_19150 42364 41564 CDS product IS110-like element IS1618 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211760.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19150 43138 42743 gene locus_tag LOCUS_19160 43138 42743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 44319 43141 gene locus_tag LOCUS_19170 44319 43141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence034 375 1397 gene locus_tag LOCUS_19180 gene mltG 375 1397 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816078.1 protein_id gnl|my_center|LOCUS_19180 1387 2019 gene locus_tag LOCUS_19190 gene tmk 1387 2019 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213082.1 protein_id gnl|my_center|LOCUS_19190 2220 3002 gene locus_tag LOCUS_19200 gene holB 2220 3002 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830395.1 protein_id gnl|my_center|LOCUS_19200 3030 3824 gene locus_tag LOCUS_19210 3030 3824 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097114.1 protein_id gnl|my_center|LOCUS_19210 3952 5388 gene locus_tag LOCUS_19220 gene ptsG 3952 5388 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157966.1 protein_id gnl|my_center|LOCUS_19220 6129 5473 gene locus_tag LOCUS_19230 6129 5473 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703367.1 protein_id gnl|my_center|LOCUS_19230 6487 6978 gene locus_tag LOCUS_19240 gene vsr 6487 6978 CDS product VSPR family DNA mismatch endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785988.1 protein_id gnl|my_center|LOCUS_19240 7281 7135 gene locus_tag LOCUS_19250 7281 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 7348 7623 gene locus_tag LOCUS_19260 7348 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 7638 8549 gene locus_tag LOCUS_19270 7638 8549 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922685.1 protein_id gnl|my_center|LOCUS_19270 8858 8634 gene locus_tag LOCUS_19280 8858 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 10216 9125 gene locus_tag LOCUS_19290 10216 9125 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704680.1 protein_id gnl|my_center|LOCUS_19290 10881 19457 gene locus_tag LOCUS_19300 10881 19457 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705673.1 protein_id gnl|my_center|LOCUS_19300 19784 19545 gene locus_tag LOCUS_19310 19784 19545 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369996.1 protein_id gnl|my_center|LOCUS_19310 21232 19808 gene locus_tag LOCUS_19320 21232 19808 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863165.1 protein_id gnl|my_center|LOCUS_19320 21634 22044 gene locus_tag LOCUS_19330 21634 22044 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703289.1 protein_id gnl|my_center|LOCUS_19330 22267 22617 gene locus_tag LOCUS_19340 22267 22617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 22784 23092 gene locus_tag LOCUS_19350 22784 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 24827 23184 gene locus_tag LOCUS_19360 24827 23184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972717.1 protein_id gnl|my_center|LOCUS_19360 25260 25739 gene locus_tag LOCUS_19370 25260 25739 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972716.1 protein_id gnl|my_center|LOCUS_19370 25981 27312 gene locus_tag LOCUS_19380 25981 27312 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972714.1 protein_id gnl|my_center|LOCUS_19380 27385 29055 gene locus_tag LOCUS_19390 27385 29055 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972713.1 protein_id gnl|my_center|LOCUS_19390 29176 30123 gene locus_tag LOCUS_19400 29176 30123 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972712.1 protein_id gnl|my_center|LOCUS_19400 30134 31015 gene locus_tag LOCUS_19410 30134 31015 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972711.1 protein_id gnl|my_center|LOCUS_19410 31079 31783 gene locus_tag LOCUS_19420 31079 31783 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972715.1 protein_id gnl|my_center|LOCUS_19420 32556 31831 gene locus_tag LOCUS_19430 32556 31831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091922.1 protein_id gnl|my_center|LOCUS_19430 33396 32563 gene locus_tag LOCUS_19440 33396 32563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104191.1 protein_id gnl|my_center|LOCUS_19440 34375 33398 gene locus_tag LOCUS_19450 34375 33398 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114494.1 protein_id gnl|my_center|LOCUS_19450 34936 35874 gene locus_tag LOCUS_19460 34936 35874 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202597.1 protein_id gnl|my_center|LOCUS_19460 35864 37417 gene locus_tag LOCUS_19470 35864 37417 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268053.1 protein_id gnl|my_center|LOCUS_19470 37414 38421 gene locus_tag LOCUS_19480 37414 38421 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205509.1 protein_id gnl|my_center|LOCUS_19480 38414 39400 gene locus_tag LOCUS_19490 38414 39400 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205508.1 protein_id gnl|my_center|LOCUS_19490 40484 39546 gene locus_tag LOCUS_19500 40484 39546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705475.1 protein_id gnl|my_center|LOCUS_19500 41280 40510 gene locus_tag LOCUS_19510 41280 40510 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705474.1 protein_id gnl|my_center|LOCUS_19510 42047 41277 gene locus_tag LOCUS_19520 42047 41277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705473.1 protein_id gnl|my_center|LOCUS_19520 42748 42047 gene locus_tag LOCUS_19530 gene tenA 42748 42047 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705472.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence035 <1 996 gene locus_tag LOCUS_19540 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704428.1:ATP-dependent helicase HrpB 1106 3571 gene locus_tag LOCUS_19550 gene mrcB 1106 3571 CDS product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918132.1 protein_id gnl|my_center|LOCUS_19550 4924 3644 gene locus_tag LOCUS_19560 gene hemL 4924 3644 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167221.1 protein_id gnl|my_center|LOCUS_19560 5274 5621 gene locus_tag LOCUS_19570 gene erpA 5274 5621 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 protein_id gnl|my_center|LOCUS_19570 6493 5693 gene locus_tag LOCUS_19580 gene btuF 6493 5693 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704438.1 protein_id gnl|my_center|LOCUS_19580 7184 6486 gene locus_tag LOCUS_19590 gene mtnN 7184 6486 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167232.1 protein_id gnl|my_center|LOCUS_19590 7283 8773 gene locus_tag LOCUS_19600 gene dgt 7283 8773 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057067.1 protein_id gnl|my_center|LOCUS_19600 8926 10365 gene locus_tag LOCUS_19610 gene degP 8926 10365 CDS product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753942.1 protein_id gnl|my_center|LOCUS_19610 10968 10576 gene locus_tag LOCUS_19620 10968 10576 CDS product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164058.1 protein_id gnl|my_center|LOCUS_19620 12141 11317 gene locus_tag LOCUS_19630 gene dapD 12141 11317 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_19630 14909 12261 gene locus_tag LOCUS_19640 gene glnD 14909 12261 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095651.1 protein_id gnl|my_center|LOCUS_19640 15843 15052 gene locus_tag LOCUS_19650 gene map 15843 15052 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266399.1 protein_id gnl|my_center|LOCUS_19650 16177 16902 gene locus_tag LOCUS_19660 gene rpsB 16177 16902 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246882.1 protein_id gnl|my_center|LOCUS_19660 17109 17960 gene locus_tag LOCUS_19670 gene tsf 17109 17960 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173227.1 protein_id gnl|my_center|LOCUS_19670 18104 18835 gene locus_tag LOCUS_19680 gene pyrH 18104 18835 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164053.1 protein_id gnl|my_center|LOCUS_19680 18974 19531 gene locus_tag LOCUS_19690 gene frr 18974 19531 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368165.1 protein_id gnl|my_center|LOCUS_19690 19667 20869 gene locus_tag LOCUS_19700 gene ispC 19667 20869 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811923.1 protein_id gnl|my_center|LOCUS_19700 21055 21807 gene locus_tag LOCUS_19710 gene ispU 21055 21807 CDS product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028110.1 protein_id gnl|my_center|LOCUS_19710 21826 22683 gene locus_tag LOCUS_19720 gene cdsA 21826 22683 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095657.1 protein_id gnl|my_center|LOCUS_19720 22697 24052 gene locus_tag LOCUS_19730 gene rseP 22697 24052 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 protein_id gnl|my_center|LOCUS_19730 24103 26508 gene locus_tag LOCUS_19740 gene bamA 24103 26508 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 protein_id gnl|my_center|LOCUS_19740 26574 27131 gene locus_tag LOCUS_19750 gene skp 26574 27131 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816966.1 protein_id gnl|my_center|LOCUS_19750 27134 28159 gene locus_tag LOCUS_19760 gene lpxD 27134 28159 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368156.1 protein_id gnl|my_center|LOCUS_19760 28317 28772 gene locus_tag LOCUS_19770 gene fabZ 28317 28772 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210739.1 protein_id gnl|my_center|LOCUS_19770 28776 29564 gene locus_tag LOCUS_19780 gene lpxA 28776 29564 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173176.1 protein_id gnl|my_center|LOCUS_19780 29569 30717 gene locus_tag LOCUS_19790 gene lpxB 29569 30717 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139667.1 protein_id gnl|my_center|LOCUS_19790 30710 31309 gene locus_tag LOCUS_19800 gene rnhB 30710 31309 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569412.1 protein_id gnl|my_center|LOCUS_19800 31373 34855 gene locus_tag LOCUS_19810 gene dnaE 31373 34855 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294791.1 protein_id gnl|my_center|LOCUS_19810 34868 35827 gene locus_tag LOCUS_19820 gene accA 34868 35827 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391685.1 protein_id gnl|my_center|LOCUS_19820 36169 36558 gene locus_tag LOCUS_19830 36169 36558 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095668.1 protein_id gnl|my_center|LOCUS_19830 36618 37922 gene locus_tag LOCUS_19840 gene tilS 36618 37922 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176578.1 protein_id gnl|my_center|LOCUS_19840 38264 38001 gene locus_tag LOCUS_19850 gene rof 38264 38001 CDS product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368146.1 protein_id gnl|my_center|LOCUS_19850 38451 38251 gene locus_tag LOCUS_19860 38451 38251 CDS product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212152.1 protein_id gnl|my_center|LOCUS_19860 38587 39141 gene locus_tag LOCUS_19870 38587 39141 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173162.1 protein_id gnl|my_center|LOCUS_19870 39114 39548 gene locus_tag LOCUS_19880 gene arfB 39114 39548 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635537.1 protein_id gnl|my_center|LOCUS_19880 40659 39676 gene locus_tag LOCUS_19890 40659 39676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 40643 40867 gene locus_tag LOCUS_19900 40643 40867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence036 645 271 gene locus_tag LOCUS_19910 645 271 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351248.1 protein_id gnl|my_center|LOCUS_19910 866 642 gene locus_tag LOCUS_19920 866 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1437 994 gene locus_tag LOCUS_19930 1437 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2432 1776 gene locus_tag LOCUS_19940 2432 1776 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365553.1 protein_id gnl|my_center|LOCUS_19940 3273 2470 gene locus_tag LOCUS_19950 gene truA 3273 2470 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192683.1 protein_id gnl|my_center|LOCUS_19950 4283 3273 gene locus_tag LOCUS_19960 4283 3273 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209726.1 protein_id gnl|my_center|LOCUS_19960 5545 4409 gene locus_tag LOCUS_19970 gene pdxB 5545 4409 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120453040.1 protein_id gnl|my_center|LOCUS_19970 5837 6850 gene locus_tag LOCUS_19980 gene flk 5837 6850 CDS product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209721.1 protein_id gnl|my_center|LOCUS_19980 8166 6973 gene locus_tag LOCUS_19990 8166 6973 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706177.1 protein_id gnl|my_center|LOCUS_19990 8795 9781 gene locus_tag LOCUS_20000 8795 9781 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210043.1 protein_id gnl|my_center|LOCUS_20000 9882 11381 gene locus_tag LOCUS_20010 9882 11381 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210044.1 protein_id gnl|my_center|LOCUS_20010 11374 12360 gene locus_tag LOCUS_20020 11374 12360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210045.1 protein_id gnl|my_center|LOCUS_20020 12362 13315 gene locus_tag LOCUS_20030 12362 13315 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210046.1 protein_id gnl|my_center|LOCUS_20030 13334 14971 gene locus_tag LOCUS_20040 13334 14971 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 protein_id gnl|my_center|LOCUS_20040 16275 15058 gene locus_tag LOCUS_20050 gene fabB 16275 15058 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706178.1 protein_id gnl|my_center|LOCUS_20050 16433 18445 gene locus_tag LOCUS_20060 gene mnmC 16433 18445 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683769.1 protein_id gnl|my_center|LOCUS_20060 18813 18493 gene locus_tag LOCUS_20070 18813 18493 CDS product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098147.1 protein_id gnl|my_center|LOCUS_20070 19355 18807 gene locus_tag LOCUS_20080 gene epmC 19355 18807 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089220.1 protein_id gnl|my_center|LOCUS_20080 20352 19549 gene locus_tag LOCUS_20090 20352 19549 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209713.1 protein_id gnl|my_center|LOCUS_20090 21186 20362 gene locus_tag LOCUS_20100 gene mepA 21186 20362 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750429.1 protein_id gnl|my_center|LOCUS_20100 22276 21191 gene locus_tag LOCUS_20110 gene aroC 22276 21191 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918470.1 protein_id gnl|my_center|LOCUS_20110 23232 22300 gene locus_tag LOCUS_20120 gene prmB 23232 22300 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098152.1 protein_id gnl|my_center|LOCUS_20120 23444 23992 gene locus_tag LOCUS_20130 gene smrB 23444 23992 CDS product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098153.1 protein_id gnl|my_center|LOCUS_20130 24547 24065 gene locus_tag LOCUS_20140 gene sixA 24547 24065 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365538.1 protein_id gnl|my_center|LOCUS_20140 26875 24719 gene locus_tag LOCUS_20150 gene fadJ 26875 24719 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425046.1 protein_id gnl|my_center|LOCUS_20150 28189 26879 gene locus_tag LOCUS_20160 gene fadI 28189 26879 CDS product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531990.1 protein_id gnl|my_center|LOCUS_20160 28660 28364 gene locus_tag LOCUS_20170 28660 28364 CDS product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227845.1 protein_id gnl|my_center|LOCUS_20170 29061 30344 gene locus_tag LOCUS_20180 gene fadL 29061 30344 CDS product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420287.1 protein_id gnl|my_center|LOCUS_20180 31184 30423 gene locus_tag LOCUS_20190 gene mlaA 31184 30423 CDS product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209701.1 protein_id gnl|my_center|LOCUS_20190 32434 31220 gene locus_tag LOCUS_20200 gene ccmI 32434 31220 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815901.1 protein_id gnl|my_center|LOCUS_20200 32895 32431 gene locus_tag LOCUS_20210 32895 32431 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703210.1 protein_id gnl|my_center|LOCUS_20210 33449 32895 gene locus_tag LOCUS_20220 gene dsbE 33449 32895 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824454.1 protein_id gnl|my_center|LOCUS_20220 35401 33446 gene locus_tag LOCUS_20230 35401 33446 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158627.1 protein_id gnl|my_center|LOCUS_20230 35880 35398 gene locus_tag LOCUS_20240 gene ccmE 35880 35398 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158631.1 protein_id gnl|my_center|LOCUS_20240 36109 35873 gene locus_tag LOCUS_20250 gene ccmD 36109 35873 CDS product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815899.1 protein_id gnl|my_center|LOCUS_20250 36849 36106 gene locus_tag LOCUS_20260 36849 36106 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815898.1 protein_id gnl|my_center|LOCUS_20260 37568 36909 gene locus_tag LOCUS_20270 gene ccmB 37568 36909 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815897.1 protein_id gnl|my_center|LOCUS_20270 38191 37553 gene locus_tag LOCUS_20280 gene ccmA 38191 37553 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209693.1 protein_id gnl|my_center|LOCUS_20280 38586 38660 gene locus_tag LOCUS_t00140 38586 38660 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39443 39054 gene locus_tag LOCUS_20290 39443 39054 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence037 55 378 gene locus_tag LOCUS_20300 55 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 379 576 gene locus_tag LOCUS_20310 379 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 959 1792 gene locus_tag LOCUS_20320 959 1792 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182015315.1 protein_id gnl|my_center|LOCUS_20320 1807 2634 gene locus_tag LOCUS_20330 1807 2634 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704527.1 protein_id gnl|my_center|LOCUS_20330 2618 3424 gene locus_tag LOCUS_20340 2618 3424 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704526.1 protein_id gnl|my_center|LOCUS_20340 3414 4097 gene locus_tag LOCUS_20350 3414 4097 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704525.1 protein_id gnl|my_center|LOCUS_20350 4578 5591 gene locus_tag LOCUS_20360 4578 5591 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807522.1 protein_id gnl|my_center|LOCUS_20360 5588 6034 gene locus_tag LOCUS_20370 5588 6034 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809022.1 protein_id gnl|my_center|LOCUS_20370 6037 7680 gene locus_tag LOCUS_20380 6037 7680 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529488.1 protein_id gnl|my_center|LOCUS_20380 7684 8649 gene locus_tag LOCUS_20390 7684 8649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389766.1 protein_id gnl|my_center|LOCUS_20390 8650 9534 gene locus_tag LOCUS_20400 8650 9534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968090.1 protein_id gnl|my_center|LOCUS_20400 9654 11195 gene locus_tag LOCUS_20410 9654 11195 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064659.1 protein_id gnl|my_center|LOCUS_20410 12399 11332 gene locus_tag LOCUS_20420 12399 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 13670 12399 gene locus_tag LOCUS_20430 13670 12399 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973043.1 protein_id gnl|my_center|LOCUS_20430 15691 13667 gene locus_tag LOCUS_20440 gene fhuB 15691 13667 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061689.1 protein_id gnl|my_center|LOCUS_20440 16629 15688 gene locus_tag LOCUS_20450 16629 15688 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821935.1 protein_id gnl|my_center|LOCUS_20450 17453 16626 gene locus_tag LOCUS_20460 17453 16626 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948410.1 protein_id gnl|my_center|LOCUS_20460 19951 17504 gene locus_tag LOCUS_20470 19951 17504 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974567.1 protein_id gnl|my_center|LOCUS_20470 21195 20173 gene locus_tag LOCUS_20480 21195 20173 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836262.1 protein_id gnl|my_center|LOCUS_20480 21805 21296 gene locus_tag LOCUS_20490 21805 21296 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836263.1 protein_id gnl|my_center|LOCUS_20490 23280 22234 gene locus_tag LOCUS_20500 23280 22234 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853200.1 protein_id gnl|my_center|LOCUS_20500 24604 23291 gene locus_tag LOCUS_20510 24604 23291 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 protein_id gnl|my_center|LOCUS_20510 25974 24703 gene locus_tag LOCUS_20520 25974 24703 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 protein_id gnl|my_center|LOCUS_20520 27380 26433 gene locus_tag LOCUS_20530 27380 26433 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814047.1 protein_id gnl|my_center|LOCUS_20530 28316 27432 gene locus_tag LOCUS_20540 28316 27432 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126955.1 protein_id gnl|my_center|LOCUS_20540 29483 28335 gene locus_tag LOCUS_20550 29483 28335 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096618.1 protein_id gnl|my_center|LOCUS_20550 29720 30991 gene locus_tag LOCUS_20560 29720 30991 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410744.1 protein_id gnl|my_center|LOCUS_20560 30984 31964 gene locus_tag LOCUS_20570 30984 31964 CDS product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096616.1 protein_id gnl|my_center|LOCUS_20570 31971 32732 gene locus_tag LOCUS_20580 31971 32732 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366720.1 protein_id gnl|my_center|LOCUS_20580 33197 33805 gene locus_tag LOCUS_20590 33197 33805 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479655.1 protein_id gnl|my_center|LOCUS_20590 33982 34749 gene locus_tag LOCUS_20600 33982 34749 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198602.1 protein_id gnl|my_center|LOCUS_20600 34755 35444 gene locus_tag LOCUS_20610 34755 35444 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740602.1 protein_id gnl|my_center|LOCUS_20610 35441 36133 gene locus_tag LOCUS_20620 35441 36133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103715.1 protein_id gnl|my_center|LOCUS_20620 36157 37041 gene locus_tag LOCUS_20630 36157 37041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 37303 37115 gene locus_tag LOCUS_20640 37303 37115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 37645 37352 gene locus_tag LOCUS_20650 37645 37352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence038 2414 207 gene locus_tag LOCUS_20660 gene fhuE 2414 207 CDS product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953444.1 protein_id gnl|my_center|LOCUS_20660 3165 2680 gene locus_tag LOCUS_20670 3165 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20670 3339 3566 gene locus_tag LOCUS_20680 3339 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 4280 3741 gene locus_tag LOCUS_20690 gene ssb1 4280 3741 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 protein_id gnl|my_center|LOCUS_20690 4510 4313 gene locus_tag LOCUS_20700 4510 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 4509 7337 gene locus_tag LOCUS_20710 gene uvrA 4509 7337 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368747.1 protein_id gnl|my_center|LOCUS_20710 7673 8737 gene locus_tag LOCUS_20720 7673 8737 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198300.1 protein_id gnl|my_center|LOCUS_20720 9156 8812 gene locus_tag LOCUS_20730 9156 8812 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155657.1 protein_id gnl|my_center|LOCUS_20730 10518 9325 gene locus_tag LOCUS_20740 gene tyrB 10518 9325 CDS product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368753.1 protein_id gnl|my_center|LOCUS_20740 12075 10669 gene locus_tag LOCUS_20750 gene dnaB 12075 10669 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067434228.1 protein_id gnl|my_center|LOCUS_20750 12180 13163 gene locus_tag LOCUS_20760 12180 13163 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209094.1 protein_id gnl|my_center|LOCUS_20760 14163 13384 gene locus_tag LOCUS_20770 14163 13384 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098381.1 protein_id gnl|my_center|LOCUS_20770 15118 16122 gene locus_tag LOCUS_20780 gene iolG 15118 16122 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 protein_id gnl|my_center|LOCUS_20780 16124 17083 gene locus_tag LOCUS_20790 16124 17083 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153439942.1 protein_id gnl|my_center|LOCUS_20790 17950 17171 gene locus_tag LOCUS_20800 17950 17171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_20800 18711 17947 gene locus_tag LOCUS_20810 18711 17947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974810.1 protein_id gnl|my_center|LOCUS_20810 19738 18722 gene locus_tag LOCUS_20820 19738 18722 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315613.1 protein_id gnl|my_center|LOCUS_20820 20419 21447 gene locus_tag LOCUS_20830 20419 21447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 21444 22832 gene locus_tag LOCUS_20840 21444 22832 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099324.1 protein_id gnl|my_center|LOCUS_20840 23122 23826 gene locus_tag LOCUS_20850 23122 23826 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185826.1 protein_id gnl|my_center|LOCUS_20850 23829 24722 gene locus_tag LOCUS_20860 23829 24722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 25377 24946 gene locus_tag LOCUS_20870 25377 24946 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705656.1 protein_id gnl|my_center|LOCUS_20870 26347 25424 gene locus_tag LOCUS_20880 26347 25424 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_20880 27144 26344 gene locus_tag LOCUS_20890 27144 26344 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_20890 28422 27157 gene locus_tag LOCUS_20900 28422 27157 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222248.1 protein_id gnl|my_center|LOCUS_20900 28721 28434 gene locus_tag LOCUS_20910 28721 28434 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 protein_id gnl|my_center|LOCUS_20910 28835 29674 gene locus_tag LOCUS_20920 28835 29674 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_20920 29839 30423 gene locus_tag LOCUS_20930 29839 30423 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206572.1 protein_id gnl|my_center|LOCUS_20930 31546 30515 gene locus_tag LOCUS_20940 31546 30515 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_20940 31870 32766 gene locus_tag LOCUS_20950 31870 32766 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366436.1 protein_id gnl|my_center|LOCUS_20950 32763 33689 gene locus_tag LOCUS_20960 32763 33689 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726715.1 protein_id gnl|my_center|LOCUS_20960 33682 34305 gene locus_tag LOCUS_20970 33682 34305 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20970 34472 36772 gene locus_tag LOCUS_20980 34472 36772 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064227.1 protein_id gnl|my_center|LOCUS_20980 <37579 36847 gene locus_tag LOCUS_20990 <37579 36847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039574.1:Ldh family oxidoreductase >Feature sequence039 924 490 gene locus_tag LOCUS_21000 924 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21000 1287 925 gene locus_tag LOCUS_21010 1287 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21010 1767 1345 gene locus_tag LOCUS_21020 gene rraB 1767 1345 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002940.1 protein_id gnl|my_center|LOCUS_21020 1930 2940 gene locus_tag LOCUS_21030 gene argF 1930 2940 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368551.1 protein_id gnl|my_center|LOCUS_21030 3195 4130 gene locus_tag LOCUS_21040 gene pyrB 3195 4130 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095365.1 protein_id gnl|my_center|LOCUS_21040 4147 4608 gene locus_tag LOCUS_21050 gene pyrI 4147 4608 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148583.1 protein_id gnl|my_center|LOCUS_21050 4647 5033 gene locus_tag LOCUS_21060 gene ridA 4647 5033 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162498.1 protein_id gnl|my_center|LOCUS_21060 5366 6226 gene locus_tag LOCUS_21070 5366 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21070 6296 7024 gene locus_tag LOCUS_21080 6296 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21080 7208 9349 gene locus_tag LOCUS_21090 gene nrdD 7208 9349 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187798.1 protein_id gnl|my_center|LOCUS_21090 9346 9840 gene locus_tag LOCUS_21100 gene nrdG 9346 9840 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095356.1 protein_id gnl|my_center|LOCUS_21100 10043 10960 gene locus_tag LOCUS_21110 10043 10960 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312133.1 protein_id gnl|my_center|LOCUS_21110 11100 12614 gene locus_tag LOCUS_21120 11100 12614 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385764.1 protein_id gnl|my_center|LOCUS_21120 12651 14243 gene locus_tag LOCUS_21130 12651 14243 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538185.1 protein_id gnl|my_center|LOCUS_21130 14206 15318 gene locus_tag LOCUS_21140 14206 15318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385765.1 protein_id gnl|my_center|LOCUS_21140 15315 16250 gene locus_tag LOCUS_21150 15315 16250 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385766.1 protein_id gnl|my_center|LOCUS_21150 16243 17109 gene locus_tag LOCUS_21160 16243 17109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008282.1 protein_id gnl|my_center|LOCUS_21160 17106 17864 gene locus_tag LOCUS_21170 17106 17864 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385768.1 protein_id gnl|my_center|LOCUS_21170 17875 18792 gene locus_tag LOCUS_21180 17875 18792 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 protein_id gnl|my_center|LOCUS_21180 18792 20099 gene locus_tag LOCUS_21190 18792 20099 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538186.1 protein_id gnl|my_center|LOCUS_21190 20532 20107 gene locus_tag LOCUS_21200 20532 20107 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080672.1 protein_id gnl|my_center|LOCUS_21200 20631 20930 gene locus_tag LOCUS_21210 20631 20930 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156248.1 protein_id gnl|my_center|LOCUS_21210 21420 20914 gene locus_tag LOCUS_21220 21420 20914 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098905.1 protein_id gnl|my_center|LOCUS_21220 21938 21414 gene locus_tag LOCUS_21230 21938 21414 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815454.1 protein_id gnl|my_center|LOCUS_21230 22142 23137 gene locus_tag LOCUS_21240 22142 23137 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098907.1 protein_id gnl|my_center|LOCUS_21240 23146 24033 gene locus_tag LOCUS_21250 23146 24033 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309784.1 protein_id gnl|my_center|LOCUS_21250 24162 25169 gene locus_tag LOCUS_21260 24162 25169 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130415.1 protein_id gnl|my_center|LOCUS_21260 27252 25351 gene locus_tag LOCUS_21270 gene deaD 27252 25351 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305131.1 protein_id gnl|my_center|LOCUS_21270 28336 27419 gene locus_tag LOCUS_21280 gene nlpI 28336 27419 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098912.1 protein_id gnl|my_center|LOCUS_21280 30557 28431 gene locus_tag LOCUS_21290 gene pnp 30557 28431 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369529.1 protein_id gnl|my_center|LOCUS_21290 31138 30869 gene locus_tag LOCUS_21300 gene rpsO 31138 30869 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 protein_id gnl|my_center|LOCUS_21300 32190 31246 gene locus_tag LOCUS_21310 gene truB 32190 31246 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098915.1 protein_id gnl|my_center|LOCUS_21310 32621 32190 gene locus_tag LOCUS_21320 gene rbfA 32621 32190 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 protein_id gnl|my_center|LOCUS_21320 35346 32659 gene locus_tag LOCUS_21330 gene infB 35346 32659 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703597.1 protein_id gnl|my_center|LOCUS_21330 36851 35364 gene locus_tag LOCUS_21340 gene nusA 36851 35364 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369524.1 protein_id gnl|my_center|LOCUS_21340 37329 36877 gene locus_tag LOCUS_21350 gene rimP 37329 36877 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833432.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence040 988 476 gene locus_tag LOCUS_21360 gene cpxP 988 476 CDS product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233466.1 protein_id gnl|my_center|LOCUS_21360 1141 1839 gene locus_tag LOCUS_21370 gene cpxR 1141 1839 CDS product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033719.1 protein_id gnl|my_center|LOCUS_21370 1836 3209 gene locus_tag LOCUS_21380 gene cpxA 1836 3209 CDS product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368938.1 protein_id gnl|my_center|LOCUS_21380 3248 3724 gene locus_tag LOCUS_21390 gene trmL 3248 3724 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094923.1 protein_id gnl|my_center|LOCUS_21390 4613 3792 gene locus_tag LOCUS_21400 gene cysE 4613 3792 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 protein_id gnl|my_center|LOCUS_21400 5705 4686 gene locus_tag LOCUS_21410 gene gpsA 5705 4686 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 protein_id gnl|my_center|LOCUS_21410 6166 5705 gene locus_tag LOCUS_21420 gene secB 6166 5705 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003370.1 protein_id gnl|my_center|LOCUS_21420 6465 6214 gene locus_tag LOCUS_21430 gene grxC 6465 6214 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273795.1 protein_id gnl|my_center|LOCUS_21430 6916 6485 gene locus_tag LOCUS_21440 6916 6485 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094920.1 protein_id gnl|my_center|LOCUS_21440 7566 8756 gene locus_tag LOCUS_21450 gene envC 7566 8756 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216228.1 protein_id gnl|my_center|LOCUS_21450 8760 9665 gene locus_tag LOCUS_21460 8760 9665 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135520.1 protein_id gnl|my_center|LOCUS_21460 9880 11112 gene locus_tag LOCUS_21470 9880 11112 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023331731.1 protein_id gnl|my_center|LOCUS_21470 11105 12016 gene locus_tag LOCUS_21480 11105 12016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111964309.1 protein_id gnl|my_center|LOCUS_21480 12199 13131 gene locus_tag LOCUS_21490 gene rfaD 12199 13131 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815275.1 protein_id gnl|my_center|LOCUS_21490 13149 14210 gene locus_tag LOCUS_21500 gene rfaF 13149 14210 CDS product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094907.1 protein_id gnl|my_center|LOCUS_21500 14198 15175 gene locus_tag LOCUS_21510 gene rfaC 14198 15175 CDS product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815273.1 protein_id gnl|my_center|LOCUS_21510 15183 16094 gene locus_tag LOCUS_21520 15183 16094 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094904.1 protein_id gnl|my_center|LOCUS_21520 16404 16126 gene locus_tag LOCUS_21530 16404 16126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21530 17549 16575 gene locus_tag LOCUS_21540 17549 16575 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094902.1 protein_id gnl|my_center|LOCUS_21540 17880 17695 gene locus_tag LOCUS_21550 17880 17695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 18067 19155 gene locus_tag LOCUS_21560 18067 19155 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703805.1 protein_id gnl|my_center|LOCUS_21560 19237 20313 gene locus_tag LOCUS_21570 19237 20313 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094905.1 protein_id gnl|my_center|LOCUS_21570 20329 21336 gene locus_tag LOCUS_21580 gene waaH 20329 21336 CDS product UDP-glucuronate:LPS(HepIII) glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982122.1 protein_id gnl|my_center|LOCUS_21580 21409 22485 gene locus_tag LOCUS_21590 gene rfaQ 21409 22485 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094901.1 protein_id gnl|my_center|LOCUS_21590 22478 23614 gene locus_tag LOCUS_21600 22478 23614 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 protein_id gnl|my_center|LOCUS_21600 23704 24978 gene locus_tag LOCUS_21610 gene waaA 23704 24978 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094897.1 protein_id gnl|my_center|LOCUS_21610 24979 25758 gene locus_tag LOCUS_21620 24979 25758 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208987.1 protein_id gnl|my_center|LOCUS_21620 25755 26231 gene locus_tag LOCUS_21630 gene coaD 25755 26231 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703808.1 protein_id gnl|my_center|LOCUS_21630 27079 26270 gene locus_tag LOCUS_21640 gene mutM 27079 26270 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208989.1 protein_id gnl|my_center|LOCUS_21640 27322 27155 gene locus_tag LOCUS_21650 gene rpmG 27322 27155 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208990.1 protein_id gnl|my_center|LOCUS_21650 27570 27334 gene locus_tag LOCUS_21660 gene rpmB 27570 27334 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164747.1 protein_id gnl|my_center|LOCUS_21660 28522 27860 gene locus_tag LOCUS_21670 gene radC 28522 27860 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175951.1 protein_id gnl|my_center|LOCUS_21670 28714 29925 gene locus_tag LOCUS_21680 gene coaBC 28714 29925 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050149.1 protein_id gnl|my_center|LOCUS_21680 29903 30361 gene locus_tag LOCUS_21690 gene dut 29903 30361 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976070.1 protein_id gnl|my_center|LOCUS_21690 30723 31274 gene locus_tag LOCUS_21700 gene slmA 30723 31274 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094890.1 protein_id gnl|my_center|LOCUS_21700 31759 31280 gene locus_tag LOCUS_21710 31759 31280 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209757.1 protein_id gnl|my_center|LOCUS_21710 33803 31752 gene locus_tag LOCUS_21720 33803 31752 CDS product DUF4401 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209756.1 protein_id gnl|my_center|LOCUS_21720 34478 33837 gene locus_tag LOCUS_21730 gene pyrE 34478 33837 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094889.1 protein_id gnl|my_center|LOCUS_21730 35300 34569 gene locus_tag LOCUS_21740 gene rph 35300 34569 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247078.1 protein_id gnl|my_center|LOCUS_21740 35631 36494 gene locus_tag LOCUS_21750 35631 36494 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094887.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence041 2062 377 gene locus_tag LOCUS_21760 2062 377 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174873167.1 protein_id gnl|my_center|LOCUS_21760 3633 2077 gene locus_tag LOCUS_21770 gene hutH 3633 2077 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704356.1 protein_id gnl|my_center|LOCUS_21770 3942 4697 gene locus_tag LOCUS_21780 gene hutC 3942 4697 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211280.1 protein_id gnl|my_center|LOCUS_21780 5253 5594 gene locus_tag LOCUS_21790 5253 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 5663 5884 gene locus_tag LOCUS_21800 5663 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 6680 6138 gene locus_tag LOCUS_21810 gene ves 6680 6138 CDS product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097026.1 protein_id gnl|my_center|LOCUS_21810 8032 6677 gene locus_tag LOCUS_21820 8032 6677 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816556.1 protein_id gnl|my_center|LOCUS_21820 8120 9337 gene locus_tag LOCUS_21830 gene hutI 8120 9337 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211281.1 protein_id gnl|my_center|LOCUS_21830 9334 10125 gene locus_tag LOCUS_21840 gene hutG 9334 10125 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169047.1 protein_id gnl|my_center|LOCUS_21840 10549 10292 gene locus_tag LOCUS_21850 10549 10292 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210240.1 protein_id gnl|my_center|LOCUS_21850 11349 10717 gene locus_tag LOCUS_21860 11349 10717 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704818.1 protein_id gnl|my_center|LOCUS_21860 11477 12406 gene locus_tag LOCUS_21870 gene rlmF 11477 12406 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704819.1 protein_id gnl|my_center|LOCUS_21870 12688 12425 gene locus_tag LOCUS_21880 12688 12425 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097470.1 protein_id gnl|my_center|LOCUS_21880 13270 12767 gene locus_tag LOCUS_21890 gene dps 13270 12767 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704821.1 protein_id gnl|my_center|LOCUS_21890 14560 13742 gene locus_tag LOCUS_21900 gene rhtA 14560 13742 CDS product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097462.1 protein_id gnl|my_center|LOCUS_21900 15005 15520 gene locus_tag LOCUS_21910 gene ompX 15005 15520 CDS product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097460.1 protein_id gnl|my_center|LOCUS_21910 16353 16814 gene locus_tag LOCUS_21920 gene mntR 16353 16814 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091019.1 protein_id gnl|my_center|LOCUS_21920 17171 18748 gene locus_tag LOCUS_21930 17171 18748 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367567.1 protein_id gnl|my_center|LOCUS_21930 20351 18810 gene locus_tag LOCUS_21940 20351 18810 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038812.1 protein_id gnl|my_center|LOCUS_21940 21381 20602 gene locus_tag LOCUS_21950 gene moeB 21381 20602 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829250.1 protein_id gnl|my_center|LOCUS_21950 22618 21383 gene locus_tag LOCUS_21960 gene moeA 22618 21383 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397340.1 protein_id gnl|my_center|LOCUS_21960 22852 23817 gene locus_tag LOCUS_21970 gene iaaA 22852 23817 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704837.1 protein_id gnl|my_center|LOCUS_21970 23827 25704 gene locus_tag LOCUS_21980 23827 25704 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065127.1 protein_id gnl|my_center|LOCUS_21980 25756 27294 gene locus_tag LOCUS_21990 gene gsiB 25756 27294 CDS product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097435.1 protein_id gnl|my_center|LOCUS_21990 27347 28267 gene locus_tag LOCUS_22000 gene gsiC 27347 28267 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936066.1 protein_id gnl|my_center|LOCUS_22000 28277 29182 gene locus_tag LOCUS_22010 gene gsiD 28277 29182 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097433.1 protein_id gnl|my_center|LOCUS_22010 29509 29913 gene locus_tag LOCUS_22020 gene ybgC 29509 29913 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859689.1 protein_id gnl|my_center|LOCUS_22020 29910 30596 gene locus_tag LOCUS_22030 gene tolQ 29910 30596 CDS product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097532.1 protein_id gnl|my_center|LOCUS_22030 30610 31038 gene locus_tag LOCUS_22040 gene tolR 30610 31038 CDS product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393306.1 protein_id gnl|my_center|LOCUS_22040 31067 32326 gene locus_tag LOCUS_22050 31067 32326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 32459 33751 gene locus_tag LOCUS_22060 gene tolB 32459 33751 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165502.1 protein_id gnl|my_center|LOCUS_22060 33755 34315 gene locus_tag LOCUS_22070 gene pal 33755 34315 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859700.1 protein_id gnl|my_center|LOCUS_22070 34325 35131 gene locus_tag LOCUS_22080 gene cpoB 34325 35131 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165506.1 protein_id gnl|my_center|LOCUS_22080 35295 35370 gene locus_tag LOCUS_t00150 35295 35370 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 35447 35522 gene locus_tag LOCUS_t00160 35447 35522 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 35714 35944 gene locus_tag LOCUS_22090 35714 35944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence042 1205 1366 gene locus_tag LOCUS_22100 1205 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2302 1535 gene locus_tag LOCUS_22110 2302 1535 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 protein_id gnl|my_center|LOCUS_22110 2971 3648 gene locus_tag LOCUS_22120 2971 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22120 3933 5543 gene locus_tag LOCUS_22130 3933 5543 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115437.1 protein_id gnl|my_center|LOCUS_22130 5568 6482 gene locus_tag LOCUS_22140 gene ppk2 5568 6482 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524222.1 protein_id gnl|my_center|LOCUS_22140 8715 6664 gene locus_tag LOCUS_22150 gene dcp 8715 6664 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306080.1 protein_id gnl|my_center|LOCUS_22150 10195 8849 gene locus_tag LOCUS_22160 gene guaD 10195 8849 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097233.1 protein_id gnl|my_center|LOCUS_22160 10385 11149 gene locus_tag LOCUS_22170 gene ydfG 10385 11149 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366753.1 protein_id gnl|my_center|LOCUS_22170 11550 11221 gene locus_tag LOCUS_22180 11550 11221 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921383.1 protein_id gnl|my_center|LOCUS_22180 11809 12096 gene locus_tag LOCUS_22190 11809 12096 CDS product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066440.1 protein_id gnl|my_center|LOCUS_22190 12148 12444 gene locus_tag LOCUS_22200 12148 12444 CDS product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165762.1 protein_id gnl|my_center|LOCUS_22200 13198 12536 gene locus_tag LOCUS_22210 gene bioD 13198 12536 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366772.1 protein_id gnl|my_center|LOCUS_22210 14545 13325 gene locus_tag LOCUS_22220 gene mlc 14545 13325 CDS product ROK family transcriptional regulator Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169799.1 protein_id gnl|my_center|LOCUS_22220 15591 14692 gene locus_tag LOCUS_22230 15591 14692 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705289.1 protein_id gnl|my_center|LOCUS_22230 15689 16945 gene locus_tag LOCUS_22240 15689 16945 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091829.1 protein_id gnl|my_center|LOCUS_22240 18394 16997 gene locus_tag LOCUS_22250 gene fumC 18394 16997 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096878.1 protein_id gnl|my_center|LOCUS_22250 18597 19772 gene locus_tag LOCUS_22260 gene manA 18597 19772 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096880.1 protein_id gnl|my_center|LOCUS_22260 19913 21415 gene locus_tag LOCUS_22270 19913 21415 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705246.1 protein_id gnl|my_center|LOCUS_22270 22464 21433 gene locus_tag LOCUS_22280 gene malI 22464 21433 CDS product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169835.1 protein_id gnl|my_center|LOCUS_22280 22661 24247 gene locus_tag LOCUS_22290 gene malX 22661 24247 CDS product maltose/glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816293.1 protein_id gnl|my_center|LOCUS_22290 24301 25473 gene locus_tag LOCUS_22300 24301 25473 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046052024.1 protein_id gnl|my_center|LOCUS_22300 25605 26603 gene locus_tag LOCUS_22310 gene add 25605 26603 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565566.1 protein_id gnl|my_center|LOCUS_22310 27575 26622 gene locus_tag LOCUS_22320 27575 26622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 28150 27785 gene locus_tag LOCUS_22330 28150 27785 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311244.1 protein_id gnl|my_center|LOCUS_22330 28422 28150 gene locus_tag LOCUS_22340 28422 28150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069541.1 protein_id gnl|my_center|LOCUS_22340 29352 28654 gene locus_tag LOCUS_22350 gene hutG 29352 28654 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524693.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22350 30811 29432 gene locus_tag LOCUS_22360 30811 29432 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527395.1 protein_id gnl|my_center|LOCUS_22360 31649 30870 gene locus_tag LOCUS_22370 31649 30870 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811719.1 protein_id gnl|my_center|LOCUS_22370 32335 31649 gene locus_tag LOCUS_22380 32335 31649 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811721.1 protein_id gnl|my_center|LOCUS_22380 33134 32379 gene locus_tag LOCUS_22390 33134 32379 CDS product glutamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930601.1 protein_id gnl|my_center|LOCUS_22390 33874 33179 gene locus_tag LOCUS_22400 33874 33179 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926578.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence043 517 164 gene locus_tag LOCUS_22410 517 164 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878158.1 protein_id gnl|my_center|LOCUS_22410 1440 652 gene locus_tag LOCUS_22420 1440 652 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269155.1 protein_id gnl|my_center|LOCUS_22420 1862 1937 gene locus_tag LOCUS_t00170 1862 1937 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1981 2056 gene locus_tag LOCUS_t00180 1981 2056 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3730 2123 gene locus_tag LOCUS_22430 3730 2123 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113365.1 protein_id gnl|my_center|LOCUS_22430 4313 3723 gene locus_tag LOCUS_22440 4313 3723 CDS product 3-mercaptopropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113364.1 protein_id gnl|my_center|LOCUS_22440 5284 4313 gene locus_tag LOCUS_22450 5284 4313 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113358.1 protein_id gnl|my_center|LOCUS_22450 6366 5284 gene locus_tag LOCUS_22460 6366 5284 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138358771.1 protein_id gnl|my_center|LOCUS_22460 7381 6473 gene locus_tag LOCUS_22470 7381 6473 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767686.1 protein_id gnl|my_center|LOCUS_22470 7528 8448 gene locus_tag LOCUS_22480 7528 8448 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974800.1 protein_id gnl|my_center|LOCUS_22480 8450 9757 gene locus_tag LOCUS_22490 8450 9757 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974868.1 protein_id gnl|my_center|LOCUS_22490 11003 9816 gene locus_tag LOCUS_22500 11003 9816 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098187.1 protein_id gnl|my_center|LOCUS_22500 11367 12605 gene locus_tag LOCUS_22510 11367 12605 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131734.1 protein_id gnl|my_center|LOCUS_22510 12876 12625 gene locus_tag LOCUS_22520 12876 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 13305 14270 gene locus_tag LOCUS_22530 gene glk 13305 14270 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170346.1 protein_id gnl|my_center|LOCUS_22530 14725 15252 gene locus_tag LOCUS_22540 14725 15252 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391901.1 protein_id gnl|my_center|LOCUS_22540 15372 16607 gene locus_tag LOCUS_22550 gene alaC 15372 16607 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098178.1 protein_id gnl|my_center|LOCUS_22550 17930 16902 gene locus_tag LOCUS_22560 17930 16902 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114760.1 protein_id gnl|my_center|LOCUS_22560 19531 17933 gene locus_tag LOCUS_22570 19531 17933 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114761.1 protein_id gnl|my_center|LOCUS_22570 19753 20532 gene locus_tag LOCUS_22580 19753 20532 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020594.1 protein_id gnl|my_center|LOCUS_22580 20551 21003 gene locus_tag LOCUS_22590 20551 21003 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114763.1 protein_id gnl|my_center|LOCUS_22590 21104 21856 gene locus_tag LOCUS_22600 21104 21856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 22080 22361 gene locus_tag LOCUS_22610 22080 22361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 22957 22589 gene locus_tag LOCUS_22620 22957 22589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22620 23286 23011 gene locus_tag LOCUS_22630 23286 23011 CDS product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228052.1 protein_id gnl|my_center|LOCUS_22630 23722 23528 gene locus_tag LOCUS_22640 23722 23528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 24679 23942 gene locus_tag LOCUS_22650 gene lpxH 24679 23942 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212239.1 protein_id gnl|my_center|LOCUS_22650 25173 24679 gene locus_tag LOCUS_22660 gene ppiB 25173 24679 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095923.1 protein_id gnl|my_center|LOCUS_22660 25415 26800 gene locus_tag LOCUS_22670 gene cysS 25415 26800 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222677.1 protein_id gnl|my_center|LOCUS_22670 28040 27015 gene locus_tag LOCUS_22680 28040 27015 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224898.1 protein_id gnl|my_center|LOCUS_22680 28312 28563 gene locus_tag LOCUS_22690 28312 28563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 28964 28788 gene locus_tag LOCUS_22700 28964 28788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 30806 29553 gene locus_tag LOCUS_22710 30806 29553 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817956.1 protein_id gnl|my_center|LOCUS_22710 31794 30871 gene locus_tag LOCUS_22720 gene dapA 31794 30871 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_22720 32702 31926 gene locus_tag LOCUS_22730 32702 31926 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339325.1 protein_id gnl|my_center|LOCUS_22730 32828 33877 gene locus_tag LOCUS_22740 32828 33877 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099539.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence044 511 1296 gene locus_tag LOCUS_22750 gene otsB 511 1296 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840119.1 protein_id gnl|my_center|LOCUS_22750 1301 2737 gene locus_tag LOCUS_22760 gene otsA 1301 2737 CDS product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089042.1 protein_id gnl|my_center|LOCUS_22760 3240 2821 gene locus_tag LOCUS_22770 gene uspC 3240 2821 CDS product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705964.1 protein_id gnl|my_center|LOCUS_22770 5096 3366 gene locus_tag LOCUS_22780 gene argS 5096 3366 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025331.1 protein_id gnl|my_center|LOCUS_22780 5730 6290 gene locus_tag LOCUS_22790 5730 6290 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096073.1 protein_id gnl|my_center|LOCUS_22790 6651 7403 gene locus_tag LOCUS_22800 gene cutC 6651 7403 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211209.1 protein_id gnl|my_center|LOCUS_22800 8179 7613 gene locus_tag LOCUS_22810 gene speG 8179 7613 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366764.1 protein_id gnl|my_center|LOCUS_22810 8552 9415 gene locus_tag LOCUS_22820 8552 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 10519 9551 gene locus_tag LOCUS_22830 gene cmoB 10519 9551 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816529.1 protein_id gnl|my_center|LOCUS_22830 11319 10516 gene locus_tag LOCUS_22840 gene cmoA 11319 10516 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096076.1 protein_id gnl|my_center|LOCUS_22840 12243 11419 gene locus_tag LOCUS_22850 12243 11419 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705960.1 protein_id gnl|my_center|LOCUS_22850 12851 12282 gene locus_tag LOCUS_22860 12851 12282 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705959.1 protein_id gnl|my_center|LOCUS_22860 13168 14946 gene locus_tag LOCUS_22870 gene aspS 13168 14946 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705958.1 protein_id gnl|my_center|LOCUS_22870 14948 15382 gene locus_tag LOCUS_22880 gene nudB 14948 15382 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653696.1 protein_id gnl|my_center|LOCUS_22880 15510 16253 gene locus_tag LOCUS_22890 15510 16253 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211202.1 protein_id gnl|my_center|LOCUS_22890 16297 16821 gene locus_tag LOCUS_22900 gene ruvC 16297 16821 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974712.1 protein_id gnl|my_center|LOCUS_22900 16895 17509 gene locus_tag LOCUS_22910 gene ruvA 16895 17509 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580325.1 protein_id gnl|my_center|LOCUS_22910 17518 18525 gene locus_tag LOCUS_22920 gene ruvB 17518 18525 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163065.1 protein_id gnl|my_center|LOCUS_22920 19382 18597 gene locus_tag LOCUS_22930 gene znuB 19382 18597 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571518.1 protein_id gnl|my_center|LOCUS_22930 20134 19379 gene locus_tag LOCUS_22940 gene znuC 20134 19379 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832401.1 protein_id gnl|my_center|LOCUS_22940 20212 21159 gene locus_tag LOCUS_22950 gene znuA 20212 21159 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096089.1 protein_id gnl|my_center|LOCUS_22950 21333 22511 gene locus_tag LOCUS_22960 gene mepM 21333 22511 CDS product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096090.1 protein_id gnl|my_center|LOCUS_22960 22736 23707 gene locus_tag LOCUS_22970 gene lpxM 22736 23707 CDS product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032705956.1 protein_id gnl|my_center|LOCUS_22970 25296 23854 gene locus_tag LOCUS_22980 gene pyk 25296 23854 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096092.1 protein_id gnl|my_center|LOCUS_22980 26319 25450 gene locus_tag LOCUS_22990 26319 25450 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056719.1 protein_id gnl|my_center|LOCUS_22990 26685 28160 gene locus_tag LOCUS_23000 gene zwf 26685 28160 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301727.1 protein_id gnl|my_center|LOCUS_23000 28422 29060 gene locus_tag LOCUS_23010 gene kdgA 28422 29060 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800493.1 protein_id gnl|my_center|LOCUS_23010 30290 29112 gene locus_tag LOCUS_23020 gene purT 30290 29112 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419918.1 protein_id gnl|my_center|LOCUS_23020 31194 30529 gene locus_tag LOCUS_23030 gene exoX 31194 30529 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944282.1 protein_id gnl|my_center|LOCUS_23030 31468 31238 gene locus_tag LOCUS_23040 31468 31238 CDS product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366007.1 protein_id gnl|my_center|LOCUS_23040 31775 32653 gene locus_tag LOCUS_23050 gene copD 31775 32653 CDS product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705947.1 protein_id gnl|my_center|LOCUS_23050 32714 33055 gene locus_tag LOCUS_23060 32714 33055 CDS product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096105.1 protein_id gnl|my_center|LOCUS_23060 33687 34031 gene locus_tag LOCUS_23070 33687 34031 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422760.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence045 139 489 gene locus_tag LOCUS_23080 139 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 594 857 gene locus_tag LOCUS_23090 594 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2272 776 gene locus_tag LOCUS_23100 2272 776 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097232.1 protein_id gnl|my_center|LOCUS_23100 2416 3147 gene locus_tag LOCUS_23110 2416 3147 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097231.1 protein_id gnl|my_center|LOCUS_23110 3135 3872 gene locus_tag LOCUS_23120 gene hpxA 3135 3872 CDS product allantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097230.1 protein_id gnl|my_center|LOCUS_23120 3955 4914 gene locus_tag LOCUS_23130 gene puuE 3955 4914 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097229.1 protein_id gnl|my_center|LOCUS_23130 5337 4954 gene locus_tag LOCUS_23140 gene hpxZ 5337 4954 CDS product oxalurate catabolism protein HpxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705418.1 protein_id gnl|my_center|LOCUS_23140 6736 5342 gene locus_tag LOCUS_23150 6736 5342 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208739.1 protein_id gnl|my_center|LOCUS_23150 6918 6733 gene locus_tag LOCUS_23160 gene hpxX 6918 6733 CDS product oxalurate catabolism protein HpxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097226.1 protein_id gnl|my_center|LOCUS_23160 8517 6931 gene locus_tag LOCUS_23170 gene hpxW 8517 6931 CDS product oxamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705415.1 protein_id gnl|my_center|LOCUS_23170 8685 9524 gene locus_tag LOCUS_23180 gene hpxU 8685 9524 CDS product MurR/RpiR family transcriptional regulator HpxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097225.1 protein_id gnl|my_center|LOCUS_23180 9721 10494 gene locus_tag LOCUS_23190 9721 10494 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446864.1 protein_id gnl|my_center|LOCUS_23190 10504 11169 gene locus_tag LOCUS_23200 10504 11169 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705412.1 protein_id gnl|my_center|LOCUS_23200 11166 11825 gene locus_tag LOCUS_23210 11166 11825 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689664.1 protein_id gnl|my_center|LOCUS_23210 11806 12543 gene locus_tag LOCUS_23220 11806 12543 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097221.1 protein_id gnl|my_center|LOCUS_23220 12589 13827 gene locus_tag LOCUS_23230 12589 13827 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419062.1 protein_id gnl|my_center|LOCUS_23230 13827 15095 gene locus_tag LOCUS_23240 gene hpxK 13827 15095 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097219.1 protein_id gnl|my_center|LOCUS_23240 15981 15214 gene locus_tag LOCUS_23250 15981 15214 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704468.1 protein_id gnl|my_center|LOCUS_23250 17129 15969 gene locus_tag LOCUS_23260 17129 15969 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097611.1 protein_id gnl|my_center|LOCUS_23260 17828 18904 gene locus_tag LOCUS_23270 17828 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 21456 19006 gene locus_tag LOCUS_23280 gene fadE 21456 19006 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973055.1 protein_id gnl|my_center|LOCUS_23280 21682 22260 gene locus_tag LOCUS_23290 gene lpcA 21682 22260 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004099149.1 protein_id gnl|my_center|LOCUS_23290 22355 23122 gene locus_tag LOCUS_23300 22355 23122 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208719.1 protein_id gnl|my_center|LOCUS_23300 23833 23093 gene locus_tag LOCUS_23310 gene dpaA 23833 23093 CDS product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225658.1 protein_id gnl|my_center|LOCUS_23310 24093 25148 gene locus_tag LOCUS_23320 gene dinB 24093 25148 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704475.1 protein_id gnl|my_center|LOCUS_23320 26739 25282 gene locus_tag LOCUS_23330 gene pepD 26739 25282 CDS product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292984.1 protein_id gnl|my_center|LOCUS_23330 27073 27531 gene locus_tag LOCUS_23340 gene gpt 27073 27531 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889733.1 protein_id gnl|my_center|LOCUS_23340 27640 28887 gene locus_tag LOCUS_23350 gene frsA 27640 28887 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095741.1 protein_id gnl|my_center|LOCUS_23350 28945 29346 gene locus_tag LOCUS_23360 gene crl 28945 29346 CDS product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174696.1 protein_id gnl|my_center|LOCUS_23360 29695 30798 gene locus_tag LOCUS_23370 gene proB 29695 30798 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167536.1 protein_id gnl|my_center|LOCUS_23370 30808 32061 gene locus_tag LOCUS_23380 gene proA 30808 32061 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704510.1 protein_id gnl|my_center|LOCUS_23380 32161 32236 gene locus_tag LOCUS_t00190 32161 32236 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 32412 33626 gene locus_tag LOCUS_23390 32412 33626 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772650.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence046 1500 466 gene locus_tag LOCUS_23400 1500 466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970338.1 protein_id gnl|my_center|LOCUS_23400 3275 1512 gene locus_tag LOCUS_23410 3275 1512 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121537498.1 protein_id gnl|my_center|LOCUS_23410 4410 3325 gene locus_tag LOCUS_23420 4410 3325 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970337.1 protein_id gnl|my_center|LOCUS_23420 6898 4523 gene locus_tag LOCUS_23430 6898 4523 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705740.1 protein_id gnl|my_center|LOCUS_23430 7643 8563 gene locus_tag LOCUS_23440 7643 8563 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920469.1 protein_id gnl|my_center|LOCUS_23440 9052 9243 gene locus_tag LOCUS_23450 9052 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 9392 10105 gene locus_tag LOCUS_23460 9392 10105 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816375.1 protein_id gnl|my_center|LOCUS_23460 10105 11868 gene locus_tag LOCUS_23470 10105 11868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 11858 12655 gene locus_tag LOCUS_23480 11858 12655 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171842.1 protein_id gnl|my_center|LOCUS_23480 12987 14252 gene locus_tag LOCUS_23490 12987 14252 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107493.1 protein_id gnl|my_center|LOCUS_23490 14441 15349 gene locus_tag LOCUS_23500 14441 15349 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236427.1 protein_id gnl|my_center|LOCUS_23500 15524 17074 gene locus_tag LOCUS_23510 15524 17074 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536654.1 protein_id gnl|my_center|LOCUS_23510 17088 18077 gene locus_tag LOCUS_23520 17088 18077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969807.1 protein_id gnl|my_center|LOCUS_23520 18121 18939 gene locus_tag LOCUS_23530 18121 18939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528250.1 protein_id gnl|my_center|LOCUS_23530 18932 20572 gene locus_tag LOCUS_23540 18932 20572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536648.1 protein_id gnl|my_center|LOCUS_23540 21326 20598 gene locus_tag LOCUS_23550 21326 20598 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379556.1 protein_id gnl|my_center|LOCUS_23550 22147 21383 gene locus_tag LOCUS_23560 22147 21383 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104269.1 protein_id gnl|my_center|LOCUS_23560 22847 22152 gene locus_tag LOCUS_23570 22847 22152 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104270.1 protein_id gnl|my_center|LOCUS_23570 23632 22880 gene locus_tag LOCUS_23580 23632 22880 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104271.1 protein_id gnl|my_center|LOCUS_23580 23838 23632 gene locus_tag LOCUS_23590 23838 23632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 24251 23814 gene locus_tag LOCUS_23600 24251 23814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 25562 24639 gene locus_tag LOCUS_23610 gene nac 25562 24639 CDS product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101817188.1 protein_id gnl|my_center|LOCUS_23610 26041 27267 gene locus_tag LOCUS_23620 26041 27267 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395882.1 protein_id gnl|my_center|LOCUS_23620 28179 27409 gene locus_tag LOCUS_23630 28179 27409 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395884.1 protein_id gnl|my_center|LOCUS_23630 29195 28209 gene locus_tag LOCUS_23640 29195 28209 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395886.1 protein_id gnl|my_center|LOCUS_23640 29902 29192 gene locus_tag LOCUS_23650 gene pxpB 29902 29192 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395888.1 protein_id gnl|my_center|LOCUS_23650 30745 29906 gene locus_tag LOCUS_23660 30745 29906 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379555.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence047 1402 623 gene locus_tag LOCUS_23670 1402 623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530487.1 protein_id gnl|my_center|LOCUS_23670 2565 1579 gene locus_tag LOCUS_23680 2565 1579 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173753.1 protein_id gnl|my_center|LOCUS_23680 2857 4023 gene locus_tag LOCUS_23690 2857 4023 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366979.1 protein_id gnl|my_center|LOCUS_23690 4036 5028 gene locus_tag LOCUS_23700 4036 5028 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815950.1 protein_id gnl|my_center|LOCUS_23700 6020 5055 gene locus_tag LOCUS_23710 gene ybiB 6020 5055 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386538.1 protein_id gnl|my_center|LOCUS_23710 8202 6022 gene locus_tag LOCUS_23720 gene dinG 8202 6022 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704815.1 protein_id gnl|my_center|LOCUS_23720 8933 8295 gene locus_tag LOCUS_23730 gene leuE 8933 8295 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704095.1 protein_id gnl|my_center|LOCUS_23730 9835 9305 gene locus_tag LOCUS_23740 gene idi 9835 9305 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890634.1 protein_id gnl|my_center|LOCUS_23740 11131 10022 gene locus_tag LOCUS_23750 11131 10022 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210785.1 protein_id gnl|my_center|LOCUS_23750 12091 11219 gene locus_tag LOCUS_23760 12091 11219 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266655.1 protein_id gnl|my_center|LOCUS_23760 14489 12192 gene locus_tag LOCUS_23770 gene bglX 14489 12192 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706093.1 protein_id gnl|my_center|LOCUS_23770 14665 16410 gene locus_tag LOCUS_23780 gene dld 14665 16410 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097938.1 protein_id gnl|my_center|LOCUS_23780 19014 16534 gene locus_tag LOCUS_23790 19014 16534 CDS product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298473.1 protein_id gnl|my_center|LOCUS_23790 20255 19305 gene locus_tag LOCUS_23800 gene pbpG 20255 19305 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097940.1 protein_id gnl|my_center|LOCUS_23800 21023 20436 gene locus_tag LOCUS_23810 21023 20436 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017057.1 protein_id gnl|my_center|LOCUS_23810 21230 21805 gene locus_tag LOCUS_23820 21230 21805 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955285.1 protein_id gnl|my_center|LOCUS_23820 22218 23414 gene locus_tag LOCUS_23830 gene ldtB 22218 23414 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689864.1 protein_id gnl|my_center|LOCUS_23830 24271 25533 gene locus_tag LOCUS_23840 24271 25533 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 protein_id gnl|my_center|LOCUS_23840 25535 27655 gene locus_tag LOCUS_23850 25535 27655 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105688.1 protein_id gnl|my_center|LOCUS_23850 28618 27686 gene locus_tag LOCUS_23860 gene dusC 28618 27686 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706102.1 protein_id gnl|my_center|LOCUS_23860 30089 28755 gene locus_tag LOCUS_23870 gene rhlE 30089 28755 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007092.1 protein_id gnl|my_center|LOCUS_23870 30725 30333 gene locus_tag LOCUS_23880 30725 30333 CDS product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704808.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence048 1606 311 gene locus_tag LOCUS_23890 1606 311 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095114.1 protein_id gnl|my_center|LOCUS_23890 3058 2213 gene locus_tag LOCUS_23900 3058 2213 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227679.1 protein_id gnl|my_center|LOCUS_23900 5218 3239 gene locus_tag LOCUS_23910 5218 3239 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930025.1 protein_id gnl|my_center|LOCUS_23910 7268 5208 gene locus_tag LOCUS_23920 7268 5208 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038771.1 protein_id gnl|my_center|LOCUS_23920 7733 7284 gene locus_tag LOCUS_23930 7733 7284 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 protein_id gnl|my_center|LOCUS_23930 8406 7900 gene locus_tag LOCUS_23940 8406 7900 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555947.1 protein_id gnl|my_center|LOCUS_23940 9865 8549 gene locus_tag LOCUS_23950 gene gabT 9865 8549 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103055.1 protein_id gnl|my_center|LOCUS_23950 11118 9994 gene locus_tag LOCUS_23960 11118 9994 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820761.1 protein_id gnl|my_center|LOCUS_23960 12046 11120 gene locus_tag LOCUS_23970 12046 11120 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_23970 12897 12046 gene locus_tag LOCUS_23980 12897 12046 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446937.1 protein_id gnl|my_center|LOCUS_23980 14238 12907 gene locus_tag LOCUS_23990 14238 12907 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973451.1 protein_id gnl|my_center|LOCUS_23990 16047 14386 gene locus_tag LOCUS_24000 16047 14386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103050.1 protein_id gnl|my_center|LOCUS_24000 16895 16044 gene locus_tag LOCUS_24010 16895 16044 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153436039.1 protein_id gnl|my_center|LOCUS_24010 17848 16895 gene locus_tag LOCUS_24020 17848 16895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771075.1 protein_id gnl|my_center|LOCUS_24020 19470 17866 gene locus_tag LOCUS_24030 19470 17866 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401719.1 protein_id gnl|my_center|LOCUS_24030 20780 19503 gene locus_tag LOCUS_24040 20780 19503 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103048.1 protein_id gnl|my_center|LOCUS_24040 21471 20800 gene locus_tag LOCUS_24050 21471 20800 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612858.1 protein_id gnl|my_center|LOCUS_24050 22989 21517 gene locus_tag LOCUS_24060 22989 21517 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973008.1 protein_id gnl|my_center|LOCUS_24060 25094 23637 gene locus_tag LOCUS_24070 25094 23637 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103053.1 protein_id gnl|my_center|LOCUS_24070 26242 25286 gene locus_tag LOCUS_24080 gene cbl 26242 25286 CDS product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705998.1 protein_id gnl|my_center|LOCUS_24080 27415 26498 gene locus_tag LOCUS_24090 gene nac 27415 26498 CDS product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432103.1 protein_id gnl|my_center|LOCUS_24090 28741 27707 gene locus_tag LOCUS_24100 28741 27707 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380853.1 protein_id gnl|my_center|LOCUS_24100 30241 28757 gene locus_tag LOCUS_24110 30241 28757 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392224.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence049 1787 63 gene locus_tag LOCUS_24120 gene ilvI 1787 63 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425651.1 protein_id gnl|my_center|LOCUS_24120 2734 4302 gene locus_tag LOCUS_24130 gene leuA 2734 4302 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095562.1 protein_id gnl|my_center|LOCUS_24130 4299 5396 gene locus_tag LOCUS_24140 gene leuB 4299 5396 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042324.1 protein_id gnl|my_center|LOCUS_24140 5399 6799 gene locus_tag LOCUS_24150 gene leuC 5399 6799 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167044.1 protein_id gnl|my_center|LOCUS_24150 6809 7414 gene locus_tag LOCUS_24160 gene leuD 6809 7414 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025800380.1 protein_id gnl|my_center|LOCUS_24160 7604 9265 gene locus_tag LOCUS_24170 gene sgrR 7604 9265 CDS product DNA-binding transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640096.1 protein_id gnl|my_center|LOCUS_24170 9501 10487 gene locus_tag LOCUS_24180 gene thiB 9501 10487 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640095.1 protein_id gnl|my_center|LOCUS_24180 10463 12073 gene locus_tag LOCUS_24190 gene thiP 10463 12073 CDS product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235671.1 protein_id gnl|my_center|LOCUS_24190 12057 12758 gene locus_tag LOCUS_24200 gene thiQ 12057 12758 CDS product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704381.1 protein_id gnl|my_center|LOCUS_24200 13537 12773 gene locus_tag LOCUS_24210 13537 12773 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148377.1 protein_id gnl|my_center|LOCUS_24210 14023 13631 gene locus_tag LOCUS_24220 14023 13631 CDS product DUF4150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366584.1 protein_id gnl|my_center|LOCUS_24220 14645 14034 gene locus_tag LOCUS_24230 14645 14034 CDS product DUF3540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705433.1 protein_id gnl|my_center|LOCUS_24230 15728 14658 gene locus_tag LOCUS_24240 15728 14658 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705434.1 protein_id gnl|my_center|LOCUS_24240 18265 15725 gene locus_tag LOCUS_24250 18265 15725 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705435.1 protein_id gnl|my_center|LOCUS_24250 18802 18446 gene locus_tag LOCUS_24260 18802 18446 CDS product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705439.1 protein_id gnl|my_center|LOCUS_24260 21258 18811 gene locus_tag LOCUS_24270 gene tssI 21258 18811 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705445.1 protein_id gnl|my_center|LOCUS_24270 21870 24236 gene locus_tag LOCUS_24280 gene polB 21870 24236 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035641.1 protein_id gnl|my_center|LOCUS_24280 24367 27273 gene locus_tag LOCUS_24290 gene rapA 24367 27273 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117038.1 protein_id gnl|my_center|LOCUS_24290 27273 27992 gene locus_tag LOCUS_24300 gene rluA 27273 27992 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525176.1 protein_id gnl|my_center|LOCUS_24300 28871 28044 gene locus_tag LOCUS_24310 gene djlA 28871 28044 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167009.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence050 1 267 gene locus_tag LOCUS_24320 1 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 904 311 gene locus_tag LOCUS_24330 904 311 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098628.1 protein_id gnl|my_center|LOCUS_24330 1593 1264 gene locus_tag LOCUS_24340 gene zapA 1593 1264 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004706812.1 protein_id gnl|my_center|LOCUS_24340 1834 2346 gene locus_tag LOCUS_24350 gene ygfB 1834 2346 CDS product UPF0149 family protein YgfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640201.1 protein_id gnl|my_center|LOCUS_24350 2434 3756 gene locus_tag LOCUS_24360 gene pepP 2434 3756 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209952.1 protein_id gnl|my_center|LOCUS_24360 3753 4931 gene locus_tag LOCUS_24370 gene ubiH 3753 4931 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052899460.1 protein_id gnl|my_center|LOCUS_24370 4945 6147 gene locus_tag LOCUS_24380 gene ubiI 4945 6147 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192216.1 protein_id gnl|my_center|LOCUS_24380 6626 7720 gene locus_tag LOCUS_24390 gene gcvT 6626 7720 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068693.1 protein_id gnl|my_center|LOCUS_24390 7746 8132 gene locus_tag LOCUS_24400 gene gcvH 7746 8132 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173499.1 protein_id gnl|my_center|LOCUS_24400 8189 11092 gene locus_tag LOCUS_24410 gene gcvP 8189 11092 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209947.1 protein_id gnl|my_center|LOCUS_24410 11322 11975 gene locus_tag LOCUS_24420 11322 11975 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863433.1 protein_id gnl|my_center|LOCUS_24420 13000 12017 gene locus_tag LOCUS_24430 gene ygfZ 13000 12017 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703421.1 protein_id gnl|my_center|LOCUS_24430 13207 13485 gene locus_tag LOCUS_24440 gene sdhE 13207 13485 CDS product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098615.1 protein_id gnl|my_center|LOCUS_24440 13466 13861 gene locus_tag LOCUS_24450 13466 13861 CDS product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244781.1 protein_id gnl|my_center|LOCUS_24450 14426 13908 gene locus_tag LOCUS_24460 gene fldB 14426 13908 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055874.1 protein_id gnl|my_center|LOCUS_24460 14535 15428 gene locus_tag LOCUS_24470 gene xerD 14535 15428 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173453.1 protein_id gnl|my_center|LOCUS_24470 15454 16158 gene locus_tag LOCUS_24480 gene dsbC 15454 16158 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817020.1 protein_id gnl|my_center|LOCUS_24480 16165 16326 gene locus_tag LOCUS_24490 16165 16326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 16353 17894 gene locus_tag LOCUS_24500 gene recJ 16353 17894 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173449.1 protein_id gnl|my_center|LOCUS_24500 18218 19099 gene locus_tag LOCUS_24510 gene prfB 18218 19099 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989230.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24510 19109 20629 gene locus_tag LOCUS_24520 gene lysS 19109 20629 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369798.1 protein_id gnl|my_center|LOCUS_24520 21063 22094 gene locus_tag LOCUS_24530 21063 22094 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168576.1 protein_id gnl|my_center|LOCUS_24530 22161 24236 gene locus_tag LOCUS_24540 22161 24236 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168575.1 protein_id gnl|my_center|LOCUS_24540 24247 25320 gene locus_tag LOCUS_24550 gene fbpC 24247 25320 CDS product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816658.1 protein_id gnl|my_center|LOCUS_24550 26013 25390 gene locus_tag LOCUS_24560 26013 25390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 26541 27704 gene locus_tag LOCUS_24570 26541 27704 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209848.1 protein_id gnl|my_center|LOCUS_24570 28621 27680 gene locus_tag LOCUS_24580 28621 27680 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703333.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence051 <1 602 gene locus_tag LOCUS_24590 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000487668.1:lysophospholipase L2 676 1476 gene locus_tag LOCUS_24600 gene yigL 676 1476 CDS product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038628922.1 protein_id gnl|my_center|LOCUS_24600 2595 1540 gene locus_tag LOCUS_24610 gene glpQ 2595 1540 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098017.1 protein_id gnl|my_center|LOCUS_24610 3954 2608 gene locus_tag LOCUS_24620 gene glpT 3954 2608 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365615.1 protein_id gnl|my_center|LOCUS_24620 4356 5219 gene locus_tag LOCUS_24630 4356 5219 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703990.1 protein_id gnl|my_center|LOCUS_24630 5705 5226 gene locus_tag LOCUS_24640 5705 5226 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409371.1 protein_id gnl|my_center|LOCUS_24640 6743 5805 gene locus_tag LOCUS_24650 gene metR 6743 5805 CDS product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211525.1 protein_id gnl|my_center|LOCUS_24650 6900 9176 gene locus_tag LOCUS_24660 gene metE 6900 9176 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176312.1 protein_id gnl|my_center|LOCUS_24660 10063 9227 gene locus_tag LOCUS_24670 10063 9227 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099243.1 protein_id gnl|my_center|LOCUS_24670 10419 11180 gene locus_tag LOCUS_24680 gene udp 10419 11180 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181652.1 protein_id gnl|my_center|LOCUS_24680 11361 12890 gene locus_tag LOCUS_24690 gene rmuC 11361 12890 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211532.1 protein_id gnl|my_center|LOCUS_24690 12965 13720 gene locus_tag LOCUS_24700 gene ubiE 12965 13720 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224024.1 protein_id gnl|my_center|LOCUS_24700 13733 14338 gene locus_tag LOCUS_24710 gene ubiJ 13733 14338 CDS product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099240.1 protein_id gnl|my_center|LOCUS_24710 14335 15972 gene locus_tag LOCUS_24720 gene ubiB 14335 15972 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099239.1 protein_id gnl|my_center|LOCUS_24720 16093 16341 gene locus_tag LOCUS_24730 gene tatA 16093 16341 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099238.1 protein_id gnl|my_center|LOCUS_24730 16350 16883 gene locus_tag LOCUS_24740 gene tatB 16350 16883 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459611.1 protein_id gnl|my_center|LOCUS_24740 16886 17650 gene locus_tag LOCUS_24750 gene tatC 16886 17650 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368842.1 protein_id gnl|my_center|LOCUS_24750 17741 18523 gene locus_tag LOCUS_24760 gene tatD 17741 18523 CDS product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815374.1 protein_id gnl|my_center|LOCUS_24760 19080 18592 gene locus_tag LOCUS_24770 gene rfaH 19080 18592 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192400.1 protein_id gnl|my_center|LOCUS_24770 19351 20835 gene locus_tag LOCUS_24780 gene ubiD 19351 20835 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368839.1 protein_id gnl|my_center|LOCUS_24780 20879 21580 gene locus_tag LOCUS_24790 gene fre 20879 21580 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807928.1 protein_id gnl|my_center|LOCUS_24790 22823 21660 gene locus_tag LOCUS_24800 gene fadA 22823 21660 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099231.1 protein_id gnl|my_center|LOCUS_24800 25020 22834 gene locus_tag LOCUS_24810 gene fadB 25020 22834 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703999.1 protein_id gnl|my_center|LOCUS_24810 25206 26537 gene locus_tag LOCUS_24820 gene pepQ 25206 26537 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444545.1 protein_id gnl|my_center|LOCUS_24820 26537 27154 gene locus_tag LOCUS_24830 26537 27154 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378910.1 protein_id gnl|my_center|LOCUS_24830 27185 28636 gene locus_tag LOCUS_24840 gene trkH 27185 28636 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545661.1 protein_id gnl|my_center|LOCUS_24840 28659 29195 gene locus_tag LOCUS_24850 gene hemG 28659 29195 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368833.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence052 225 428 gene locus_tag LOCUS_24860 225 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24860 761 1231 gene locus_tag LOCUS_24870 gene argR 761 1231 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210173.1 protein_id gnl|my_center|LOCUS_24870 1849 2112 gene locus_tag LOCUS_24880 gene yhcN 1849 2112 CDS product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210172.1 protein_id gnl|my_center|LOCUS_24880 2205 2474 gene locus_tag LOCUS_24890 gene yhcN 2205 2474 CDS product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175416.1 protein_id gnl|my_center|LOCUS_24890 4664 2700 gene locus_tag LOCUS_24900 gene aaeB 4664 2700 CDS product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369470.1 protein_id gnl|my_center|LOCUS_24900 5609 4677 gene locus_tag LOCUS_24910 gene aaeA 5609 4677 CDS product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098978.1 protein_id gnl|my_center|LOCUS_24910 5821 5618 gene locus_tag LOCUS_24920 5821 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 6104 7021 gene locus_tag LOCUS_24930 gene aaeR 6104 7021 CDS product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098979.1 protein_id gnl|my_center|LOCUS_24930 8522 7077 gene locus_tag LOCUS_24940 gene tldD 8522 7077 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174328.1 protein_id gnl|my_center|LOCUS_24940 12357 8587 gene locus_tag LOCUS_24950 gene yhdP 12357 8587 CDS product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253536.1 protein_id gnl|my_center|LOCUS_24950 14219 12750 gene locus_tag LOCUS_24960 gene rng 14219 12750 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123197.1 protein_id gnl|my_center|LOCUS_24960 14802 14209 gene locus_tag LOCUS_24970 14802 14209 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 protein_id gnl|my_center|LOCUS_24970 15299 14811 gene locus_tag LOCUS_24980 gene mreD 15299 14811 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210077.1 protein_id gnl|my_center|LOCUS_24980 16432 15296 gene locus_tag LOCUS_24990 gene mreC 16432 15296 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802540.1 protein_id gnl|my_center|LOCUS_24990 17447 16404 gene locus_tag LOCUS_25000 gene mreB 17447 16404 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 protein_id gnl|my_center|LOCUS_25000 19696 17762 gene locus_tag LOCUS_25010 gene csrD 19696 17762 CDS product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241469.1 protein_id gnl|my_center|LOCUS_25010 19863 20840 gene locus_tag LOCUS_25020 19863 20840 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210074.1 protein_id gnl|my_center|LOCUS_25020 21109 21555 gene locus_tag LOCUS_25030 gene aroQ 21109 21555 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174343.1 protein_id gnl|my_center|LOCUS_25030 21583 22044 gene locus_tag LOCUS_25040 gene accB 21583 22044 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 protein_id gnl|my_center|LOCUS_25040 22056 23261 gene locus_tag LOCUS_25050 gene accC 22056 23261 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817284.1 protein_id gnl|my_center|LOCUS_25050 23258 23404 gene locus_tag LOCUS_25060 23258 23404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25060 23481 23723 gene locus_tag LOCUS_25070 23481 23723 CDS product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340020.1 protein_id gnl|my_center|LOCUS_25070 23713 25167 gene locus_tag LOCUS_25080 gene panF 23713 25167 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175744.1 protein_id gnl|my_center|LOCUS_25080 25179 26060 gene locus_tag LOCUS_25090 gene prmA 25179 26060 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145827.1 protein_id gnl|my_center|LOCUS_25090 26495 27367 gene locus_tag LOCUS_25100 gene dusB 26495 27367 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174350.1 protein_id gnl|my_center|LOCUS_25100 27392 27688 gene locus_tag LOCUS_25110 gene fis 27392 27688 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210061.1 protein_id gnl|my_center|LOCUS_25110 28639 28199 gene locus_tag LOCUS_25120 28639 28199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence053 2748 118 gene locus_tag LOCUS_25130 gene tssH 2748 118 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211927.1 protein_id gnl|my_center|LOCUS_25130 3421 2930 gene locus_tag LOCUS_25140 3421 2930 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210014.1 protein_id gnl|my_center|LOCUS_25140 5175 3517 gene locus_tag LOCUS_25150 5175 3517 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243153.1 protein_id gnl|my_center|LOCUS_25150 5834 5190 gene locus_tag LOCUS_25160 gene tssL 5834 5190 CDS product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710992.1 protein_id gnl|my_center|LOCUS_25160 7168 5831 gene locus_tag LOCUS_25170 gene tssK 7168 5831 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686687.1 protein_id gnl|my_center|LOCUS_25170 8853 7315 gene locus_tag LOCUS_25180 gene tssC 8853 7315 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214707.1 protein_id gnl|my_center|LOCUS_25180 9384 8887 gene locus_tag LOCUS_25190 gene tssB 9384 8887 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213014.1 protein_id gnl|my_center|LOCUS_25190 9383 9577 gene locus_tag LOCUS_25200 9383 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 11437 10286 gene locus_tag LOCUS_25210 11437 10286 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 protein_id gnl|my_center|LOCUS_25210 11725 12405 gene locus_tag LOCUS_25220 11725 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 12795 13571 gene locus_tag LOCUS_25230 12795 13571 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_25230 14367 13720 gene locus_tag LOCUS_25240 gene fucA 14367 13720 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440828.1 protein_id gnl|my_center|LOCUS_25240 14937 16247 gene locus_tag LOCUS_25250 gene fucP 14937 16247 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528619.1 protein_id gnl|my_center|LOCUS_25250 16279 18054 gene locus_tag LOCUS_25260 gene fucI 16279 18054 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724126.1 protein_id gnl|my_center|LOCUS_25260 18109 19527 gene locus_tag LOCUS_25270 gene fucK 18109 19527 CDS product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763972.1 protein_id gnl|my_center|LOCUS_25270 19529 19951 gene locus_tag LOCUS_25280 gene fucU 19529 19951 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920840.1 protein_id gnl|my_center|LOCUS_25280 19992 20747 gene locus_tag LOCUS_25290 gene fucR 19992 20747 CDS product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642344.1 protein_id gnl|my_center|LOCUS_25290 20835 21563 gene locus_tag LOCUS_25300 20835 21563 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 protein_id gnl|my_center|LOCUS_25300 21663 22328 gene locus_tag LOCUS_25310 gene yieH 21663 22328 CDS product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175148.1 protein_id gnl|my_center|LOCUS_25310 22460 23788 gene locus_tag LOCUS_25320 22460 23788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25320 23855 24511 gene locus_tag LOCUS_25330 23855 24511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 24953 25369 gene locus_tag LOCUS_25340 24953 25369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 25366 26823 gene locus_tag LOCUS_25350 25366 26823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25350 26814 27446 gene locus_tag LOCUS_25360 26814 27446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25360 >Feature sequence054 704 1807 gene locus_tag LOCUS_25370 704 1807 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974269.1 protein_id gnl|my_center|LOCUS_25370 1833 2612 gene locus_tag LOCUS_25380 1833 2612 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197330.1 protein_id gnl|my_center|LOCUS_25380 2844 2659 gene locus_tag LOCUS_25390 2844 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2927 4111 gene locus_tag LOCUS_25400 2927 4111 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528042.1 protein_id gnl|my_center|LOCUS_25400 5218 4256 gene locus_tag LOCUS_25410 5218 4256 CDS product Ni(II)/Co(II) efflux transporter permease subunit NcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196366.1 protein_id gnl|my_center|LOCUS_25410 5463 5768 gene locus_tag LOCUS_25420 gene rcnR 5463 5768 CDS product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019953.1 protein_id gnl|my_center|LOCUS_25420 6692 5907 gene locus_tag LOCUS_25430 6692 5907 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064849.1 protein_id gnl|my_center|LOCUS_25430 7640 6744 gene locus_tag LOCUS_25440 7640 6744 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047183.1 protein_id gnl|my_center|LOCUS_25440 7831 8643 gene locus_tag LOCUS_25450 7831 8643 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974708.1 protein_id gnl|my_center|LOCUS_25450 8673 9398 gene locus_tag LOCUS_25460 8673 9398 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313622.1 protein_id gnl|my_center|LOCUS_25460 9395 10141 gene locus_tag LOCUS_25470 9395 10141 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313623.1 protein_id gnl|my_center|LOCUS_25470 10155 11330 gene locus_tag LOCUS_25480 10155 11330 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_25480 11327 12430 gene locus_tag LOCUS_25490 11327 12430 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974706.1 protein_id gnl|my_center|LOCUS_25490 12414 13583 gene locus_tag LOCUS_25500 12414 13583 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974705.1 protein_id gnl|my_center|LOCUS_25500 13593 14516 gene locus_tag LOCUS_25510 gene dapA 13593 14516 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642619.1 protein_id gnl|my_center|LOCUS_25510 15600 14500 gene locus_tag LOCUS_25520 15600 14500 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974704.1 protein_id gnl|my_center|LOCUS_25520 15669 16883 gene locus_tag LOCUS_25530 15669 16883 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817956.1 protein_id gnl|my_center|LOCUS_25530 18753 17485 gene locus_tag LOCUS_25540 18753 17485 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032715566.1 protein_id gnl|my_center|LOCUS_25540 19634 19050 gene locus_tag LOCUS_25550 19634 19050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 20294 21436 gene locus_tag LOCUS_25560 20294 21436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 21452 22738 gene locus_tag LOCUS_25570 21452 22738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 22787 23518 gene locus_tag LOCUS_25580 22787 23518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207465.1 protein_id gnl|my_center|LOCUS_25580 24481 25410 gene locus_tag LOCUS_25590 gene thiO 24481 25410 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972408.1 protein_id gnl|my_center|LOCUS_25590 25410 25541 gene locus_tag LOCUS_25600 25410 25541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 25609 26373 gene locus_tag LOCUS_25610 25609 26373 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529413.1 protein_id gnl|my_center|LOCUS_25610 26370 27347 gene locus_tag LOCUS_25620 26370 27347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence055 <1 873 gene locus_tag LOCUS_25630 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098937.1:arabinose-5-phosphate isomerase KdsD 888 1454 gene locus_tag LOCUS_25640 gene kdsC 888 1454 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_25640 1451 2026 gene locus_tag LOCUS_25650 gene lptC 1451 2026 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369495.1 protein_id gnl|my_center|LOCUS_25650 2010 2549 gene locus_tag LOCUS_25660 gene lptA 2010 2549 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669770.1 protein_id gnl|my_center|LOCUS_25660 2555 3280 gene locus_tag LOCUS_25670 gene lptB 2555 3280 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 protein_id gnl|my_center|LOCUS_25670 3314 4765 gene locus_tag LOCUS_25680 gene rpoN 3314 4765 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703606.1 protein_id gnl|my_center|LOCUS_25680 4790 5077 gene locus_tag LOCUS_25690 gene hpf 4790 5077 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098943.1 protein_id gnl|my_center|LOCUS_25690 5296 5781 gene locus_tag LOCUS_25700 gene ptsN 5296 5781 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609332.1 protein_id gnl|my_center|LOCUS_25700 5852 6706 gene locus_tag LOCUS_25710 gene rapZ 5852 6706 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369491.1 protein_id gnl|my_center|LOCUS_25710 6703 6975 gene locus_tag LOCUS_25720 gene npr 6703 6975 CDS product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162489.1 protein_id gnl|my_center|LOCUS_25720 7694 6972 gene locus_tag LOCUS_25730 gene mtgA 7694 6972 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210144.1 protein_id gnl|my_center|LOCUS_25730 7873 7691 gene locus_tag LOCUS_25740 7873 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 10513 8567 gene locus_tag LOCUS_25750 gene arcB 10513 8567 CDS product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817254.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25750 10909 10526 gene locus_tag LOCUS_25760 10909 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25760 11908 17439 gene locus_tag LOCUS_25770 11908 17439 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651396.1 protein_id gnl|my_center|LOCUS_25770 17463 19265 gene locus_tag LOCUS_25780 17463 19265 CDS product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970681.1 protein_id gnl|my_center|LOCUS_25780 19872 19390 gene locus_tag LOCUS_25790 gene sspB 19872 19390 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366129.1 protein_id gnl|my_center|LOCUS_25790 20019 19879 gene locus_tag LOCUS_25800 20019 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25800 20520 20029 gene locus_tag LOCUS_25810 gene sspA 20520 20029 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210135.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25810 21248 20856 gene locus_tag LOCUS_25820 gene rpsI 21248 20856 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 protein_id gnl|my_center|LOCUS_25820 21692 21264 gene locus_tag LOCUS_25830 gene rplM 21692 21264 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 protein_id gnl|my_center|LOCUS_25830 23065 21938 gene locus_tag LOCUS_25840 gene zapE 23065 21938 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191224.1 protein_id gnl|my_center|LOCUS_25840 23231 23635 gene locus_tag LOCUS_25850 gene zapG 23231 23635 CDS product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295270.1 protein_id gnl|my_center|LOCUS_25850 23760 25127 gene locus_tag LOCUS_25860 gene degQ 23760 25127 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817258.1 protein_id gnl|my_center|LOCUS_25860 25222 26283 gene locus_tag LOCUS_25870 gene degS 25222 26283 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098970.1 protein_id gnl|my_center|LOCUS_25870 27298 26363 gene locus_tag LOCUS_25880 gene mdh 27298 26363 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861588.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence056 1241 504 gene locus_tag LOCUS_25890 gene blcR 1241 504 CDS product IclR family transcriptional regulator BlcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974399.1 protein_id gnl|my_center|LOCUS_25890 1417 2871 gene locus_tag LOCUS_25900 1417 2871 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974400.1 protein_id gnl|my_center|LOCUS_25900 2905 4071 gene locus_tag LOCUS_25910 2905 4071 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974401.1 protein_id gnl|my_center|LOCUS_25910 4113 4904 gene locus_tag LOCUS_25920 4113 4904 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019565706.1 protein_id gnl|my_center|LOCUS_25920 5145 6566 gene locus_tag LOCUS_25930 5145 6566 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112617.1 protein_id gnl|my_center|LOCUS_25930 7795 6590 gene locus_tag LOCUS_25940 7795 6590 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388890.1 protein_id gnl|my_center|LOCUS_25940 9162 7855 gene locus_tag LOCUS_25950 9162 7855 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972973.1 protein_id gnl|my_center|LOCUS_25950 10183 9179 gene locus_tag LOCUS_25960 gene hcxA 10183 9179 CDS product hydroxycarboxylate dehydrogenase HcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120415.1 protein_id gnl|my_center|LOCUS_25960 10686 11483 gene locus_tag LOCUS_25970 10686 11483 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 protein_id gnl|my_center|LOCUS_25970 11652 13034 gene locus_tag LOCUS_25980 gene purB 11652 13034 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345327.1 protein_id gnl|my_center|LOCUS_25980 13031 13564 gene locus_tag LOCUS_25990 gene snaB 13031 13564 CDS product sulfur-containing aminoacid acetyltransferase SnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242734.1 protein_id gnl|my_center|LOCUS_25990 13584 14372 gene locus_tag LOCUS_26000 13584 14372 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 protein_id gnl|my_center|LOCUS_26000 14438 15109 gene locus_tag LOCUS_26010 14438 15109 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243465.1 protein_id gnl|my_center|LOCUS_26010 15119 15880 gene locus_tag LOCUS_26020 15119 15880 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243284.1 protein_id gnl|my_center|LOCUS_26020 15958 17112 gene locus_tag LOCUS_26030 15958 17112 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157892.1 protein_id gnl|my_center|LOCUS_26030 19253 17187 gene locus_tag LOCUS_26040 19253 17187 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208882.1 protein_id gnl|my_center|LOCUS_26040 20000 19515 gene locus_tag LOCUS_26050 20000 19515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 20486 21397 gene locus_tag LOCUS_26060 20486 21397 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198844.1 protein_id gnl|my_center|LOCUS_26060 21612 22658 gene locus_tag LOCUS_26070 21612 22658 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 protein_id gnl|my_center|LOCUS_26070 22663 23346 gene locus_tag LOCUS_26080 22663 23346 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081171.1 protein_id gnl|my_center|LOCUS_26080 24411 23635 gene locus_tag LOCUS_26090 gene surE 24411 23635 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171844.1 protein_id gnl|my_center|LOCUS_26090 24737 25078 gene locus_tag LOCUS_26100 24737 25078 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209688.1 protein_id gnl|my_center|LOCUS_26100 25235 25744 gene locus_tag LOCUS_26110 gene pncC 25235 25744 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_26110 25825 26898 gene locus_tag LOCUS_26120 gene recA 25825 26898 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209446.1 protein_id gnl|my_center|LOCUS_26120 27204 26986 gene locus_tag LOCUS_26130 27204 26986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26130 >Feature sequence057 1035 184 gene locus_tag LOCUS_26140 gene murI 1035 184 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420807.1 protein_id gnl|my_center|LOCUS_26140 2854 980 gene locus_tag LOCUS_26150 gene btuB 2854 980 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703958.1 protein_id gnl|my_center|LOCUS_26150 3231 4334 gene locus_tag LOCUS_26160 gene trmA 3231 4334 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368905.1 protein_id gnl|my_center|LOCUS_26160 4733 4386 gene locus_tag LOCUS_26170 4733 4386 CDS product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501783.1 protein_id gnl|my_center|LOCUS_26170 5395 4754 gene locus_tag LOCUS_26180 gene fabR 5395 4754 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163800.1 protein_id gnl|my_center|LOCUS_26180 5573 6988 gene locus_tag LOCUS_26190 gene sthA 5573 6988 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120810.1 protein_id gnl|my_center|LOCUS_26190 7888 6971 gene locus_tag LOCUS_26200 gene oxyR 7888 6971 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025919.1 protein_id gnl|my_center|LOCUS_26200 9678 8302 gene locus_tag LOCUS_26210 gene argH 9678 8302 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230038.1 protein_id gnl|my_center|LOCUS_26210 11010 9796 gene locus_tag LOCUS_26220 11010 9796 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874007.1 protein_id gnl|my_center|LOCUS_26220 11812 11036 gene locus_tag LOCUS_26230 gene argB 11812 11036 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686923.1 protein_id gnl|my_center|LOCUS_26230 12837 11833 gene locus_tag LOCUS_26240 gene argC 12837 11833 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815301.1 protein_id gnl|my_center|LOCUS_26240 13017 14168 gene locus_tag LOCUS_26250 gene argE 13017 14168 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309894.1 protein_id gnl|my_center|LOCUS_26250 14414 17065 gene locus_tag LOCUS_26260 gene ppc 14414 17065 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368915.1 protein_id gnl|my_center|LOCUS_26260 18020 17121 gene locus_tag LOCUS_26270 gene metF 18020 17121 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007509.1 protein_id gnl|my_center|LOCUS_26270 20730 18295 gene locus_tag LOCUS_26280 20730 18295 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208934.1 protein_id gnl|my_center|LOCUS_26280 21893 20733 gene locus_tag LOCUS_26290 gene metB 21893 20733 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368924.1 protein_id gnl|my_center|LOCUS_26290 22159 22476 gene locus_tag LOCUS_26300 gene metJ 22159 22476 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852811.1 protein_id gnl|my_center|LOCUS_26300 22757 22545 gene locus_tag LOCUS_26310 gene rpmE 22757 22545 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715284.1 protein_id gnl|my_center|LOCUS_26310 22970 25165 gene locus_tag LOCUS_26320 gene priA 22970 25165 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815293.1 protein_id gnl|my_center|LOCUS_26320 25376 26422 gene locus_tag LOCUS_26330 gene cytR 25376 26422 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368928.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence058 3051 1078 gene locus_tag LOCUS_26340 gene hmsP 3051 1078 CDS product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209560.1 protein_id gnl|my_center|LOCUS_26340 4325 3318 gene locus_tag LOCUS_26350 4325 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 4775 4329 gene locus_tag LOCUS_26360 4775 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 8719 4778 gene locus_tag LOCUS_26370 8719 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 11164 8729 gene locus_tag LOCUS_26380 gene bcsB 11164 8729 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602570.1 protein_id gnl|my_center|LOCUS_26380 13263 11161 gene locus_tag LOCUS_26390 gene bcsA 13263 11161 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770918.1 protein_id gnl|my_center|LOCUS_26390 14202 13441 gene locus_tag LOCUS_26400 14202 13441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 14789 14229 gene locus_tag LOCUS_26410 14789 14229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 16230 15238 gene locus_tag LOCUS_26420 gene dppF 16230 15238 CDS product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103574.1 protein_id gnl|my_center|LOCUS_26420 17212 16220 gene locus_tag LOCUS_26430 gene dppD 17212 16220 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703765.1 protein_id gnl|my_center|LOCUS_26430 18121 17219 gene locus_tag LOCUS_26440 gene dppC 18121 17219 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209563.1 protein_id gnl|my_center|LOCUS_26440 19154 18135 gene locus_tag LOCUS_26450 gene dppB 19154 18135 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174906.1 protein_id gnl|my_center|LOCUS_26450 20979 19366 gene locus_tag LOCUS_26460 20979 19366 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418419.1 protein_id gnl|my_center|LOCUS_26460 21825 21749 gene locus_tag LOCUS_t00200 21825 21749 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23636 21957 gene locus_tag LOCUS_26470 gene eptB 23636 21957 CDS product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817403.1 protein_id gnl|my_center|LOCUS_26470 24526 23909 gene locus_tag LOCUS_26480 24526 23909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095513.1 protein_id gnl|my_center|LOCUS_26480 25021 24683 gene locus_tag LOCUS_26490 25021 24683 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 protein_id gnl|my_center|LOCUS_26490 26103 25450 gene locus_tag LOCUS_26500 26103 25450 CDS product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228082.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence059 701 153 gene locus_tag LOCUS_26510 701 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 1226 762 gene locus_tag LOCUS_26520 1226 762 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466823.1 protein_id gnl|my_center|LOCUS_26520 2124 1255 gene locus_tag LOCUS_26530 2124 1255 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015241121.1 protein_id gnl|my_center|LOCUS_26530 3279 2149 gene locus_tag LOCUS_26540 3279 2149 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413981.1 protein_id gnl|my_center|LOCUS_26540 4048 3296 gene locus_tag LOCUS_26550 4048 3296 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525108.1 protein_id gnl|my_center|LOCUS_26550 5664 4048 gene locus_tag LOCUS_26560 5664 4048 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_26560 9023 5661 gene locus_tag LOCUS_26570 9023 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 9615 11057 gene locus_tag LOCUS_26580 9615 11057 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228258.1 protein_id gnl|my_center|LOCUS_26580 11746 11105 gene locus_tag LOCUS_26590 11746 11105 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 protein_id gnl|my_center|LOCUS_26590 11925 12419 gene locus_tag LOCUS_26600 11925 12419 CDS product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525781.1 protein_id gnl|my_center|LOCUS_26600 12616 12452 gene locus_tag LOCUS_26610 12616 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 13036 14538 gene locus_tag LOCUS_26620 13036 14538 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120833.1 protein_id gnl|my_center|LOCUS_26620 14532 16136 gene locus_tag LOCUS_26630 14532 16136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 16209 17231 gene locus_tag LOCUS_26640 16209 17231 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449622.1 protein_id gnl|my_center|LOCUS_26640 18333 17566 gene locus_tag LOCUS_26650 18333 17566 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 protein_id gnl|my_center|LOCUS_26650 19454 18414 gene locus_tag LOCUS_26660 gene idnD 19454 18414 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197408.1 protein_id gnl|my_center|LOCUS_26660 20800 19487 gene locus_tag LOCUS_26670 20800 19487 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496901.1 protein_id gnl|my_center|LOCUS_26670 22001 20853 gene locus_tag LOCUS_26680 gene dgoD 22001 20853 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703894.1 protein_id gnl|my_center|LOCUS_26680 22615 21998 gene locus_tag LOCUS_26690 22615 21998 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094785.1 protein_id gnl|my_center|LOCUS_26690 23483 22599 gene locus_tag LOCUS_26700 23483 22599 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094784.1 protein_id gnl|my_center|LOCUS_26700 24178 23480 gene locus_tag LOCUS_26710 gene dgoR 24178 23480 CDS product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861109.1 protein_id gnl|my_center|LOCUS_26710 25283 24657 gene locus_tag LOCUS_26720 25283 24657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 >Feature sequence060 157 81 gene locus_tag LOCUS_t00210 157 81 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 364 1515 gene locus_tag LOCUS_26730 gene mltA 364 1515 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678621.1 protein_id gnl|my_center|LOCUS_26730 1574 2386 gene locus_tag LOCUS_26740 gene tcdA 1574 2386 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703318.1 protein_id gnl|my_center|LOCUS_26740 2859 2419 gene locus_tag LOCUS_26750 gene csdE 2859 2419 CDS product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184261.1 protein_id gnl|my_center|LOCUS_26750 4067 2856 gene locus_tag LOCUS_26760 gene csdA 4067 2856 CDS product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703316.1 protein_id gnl|my_center|LOCUS_26760 4423 4647 gene locus_tag LOCUS_26770 4423 4647 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166349.1 protein_id gnl|my_center|LOCUS_26770 4943 5902 gene locus_tag LOCUS_26780 gene gcvA 4943 5902 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 protein_id gnl|my_center|LOCUS_26780 5902 6351 gene locus_tag LOCUS_26790 5902 6351 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369946.1 protein_id gnl|my_center|LOCUS_26790 6344 7444 gene locus_tag LOCUS_26800 gene rlmM 6344 7444 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212119.1 protein_id gnl|my_center|LOCUS_26800 7845 7540 gene locus_tag LOCUS_26810 7845 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26810 9748 8384 gene locus_tag LOCUS_26820 gene ppnN 9748 8384 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 protein_id gnl|my_center|LOCUS_26820 10780 9935 gene locus_tag LOCUS_26830 gene queF 10780 9935 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100435.1 protein_id gnl|my_center|LOCUS_26830 10896 11441 gene locus_tag LOCUS_26840 gene syd 10896 11441 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369954.1 protein_id gnl|my_center|LOCUS_26840 11899 12147 gene locus_tag LOCUS_26850 11899 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 12144 12353 gene locus_tag LOCUS_26860 12144 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26860 12468 12914 gene locus_tag LOCUS_26870 12468 12914 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807735.1 protein_id gnl|my_center|LOCUS_26870 13038 14177 gene locus_tag LOCUS_26880 13038 14177 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098521.1 protein_id gnl|my_center|LOCUS_26880 17010 14278 gene locus_tag LOCUS_26890 gene barA 17010 14278 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 protein_id gnl|my_center|LOCUS_26890 17173 18489 gene locus_tag LOCUS_26900 gene rlmD 17173 18489 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098519.1 protein_id gnl|my_center|LOCUS_26900 18523 20760 gene locus_tag LOCUS_26910 gene relA 18523 20760 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167242.1 protein_id gnl|my_center|LOCUS_26910 20908 21690 gene locus_tag LOCUS_26920 gene mazG 20908 21690 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703306.1 protein_id gnl|my_center|LOCUS_26920 21663 21869 gene locus_tag LOCUS_26930 21663 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 21957 23594 gene locus_tag LOCUS_26940 gene pyrG 21957 23594 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167247.1 protein_id gnl|my_center|LOCUS_26940 23673 24968 gene locus_tag LOCUS_26950 gene eno 23673 24968 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036723.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence061 3 239 gene locus_tag LOCUS_26960 3 239 CDS product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908860.1 protein_id gnl|my_center|LOCUS_26960 1388 447 gene locus_tag LOCUS_26970 1388 447 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165628.1 protein_id gnl|my_center|LOCUS_26970 1877 1461 gene locus_tag LOCUS_26980 gene sufE 1877 1461 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096952.1 protein_id gnl|my_center|LOCUS_26980 3134 1911 gene locus_tag LOCUS_26990 gene sufS 3134 1911 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143859.1 protein_id gnl|my_center|LOCUS_26990 4411 3131 gene locus_tag LOCUS_27000 gene sufD 4411 3131 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096954.1 protein_id gnl|my_center|LOCUS_27000 5165 4386 gene locus_tag LOCUS_27010 gene sufC 5165 4386 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096955.1 protein_id gnl|my_center|LOCUS_27010 6679 5183 gene locus_tag LOCUS_27020 gene sufB 6679 5183 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705129.1 protein_id gnl|my_center|LOCUS_27020 7062 6688 gene locus_tag LOCUS_27030 gene sufA 7062 6688 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165616.1 protein_id gnl|my_center|LOCUS_27030 7454 7858 gene locus_tag LOCUS_27040 7454 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 8317 7892 gene locus_tag LOCUS_27050 8317 7892 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169420.1 protein_id gnl|my_center|LOCUS_27050 11370 8317 gene locus_tag LOCUS_27060 11370 8317 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419180.1 protein_id gnl|my_center|LOCUS_27060 11641 12774 gene locus_tag LOCUS_27070 gene ydiK 11641 12774 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096976.1 protein_id gnl|my_center|LOCUS_27070 15605 13221 gene locus_tag LOCUS_27080 gene ppsA 15605 13221 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069375.1 protein_id gnl|my_center|LOCUS_27080 16129 16962 gene locus_tag LOCUS_27090 gene ppsR 16129 16962 CDS product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620693.1 protein_id gnl|my_center|LOCUS_27090 17355 17621 gene locus_tag LOCUS_27100 17355 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27100 17666 18013 gene locus_tag LOCUS_27110 17666 18013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27110 18023 18220 gene locus_tag LOCUS_27120 18023 18220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27120 18696 19742 gene locus_tag LOCUS_27130 gene aroH 18696 19742 CDS product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419178.1 protein_id gnl|my_center|LOCUS_27130 21263 19860 gene locus_tag LOCUS_27140 21263 19860 CDS product multidrug efflux MFS transporter NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722177.1 protein_id gnl|my_center|LOCUS_27140 22521 21349 gene locus_tag LOCUS_27150 22521 21349 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366269.1 protein_id gnl|my_center|LOCUS_27150 22841 25162 gene locus_tag LOCUS_27160 22841 25162 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705665.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence062 823 2250 gene locus_tag LOCUS_27170 gene sbcB 823 2250 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816708.1 protein_id gnl|my_center|LOCUS_27170 2413 3024 gene locus_tag LOCUS_27180 2413 3024 CDS product YkoF family thiamine/hydroxymethylpyrimidine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368488.1 protein_id gnl|my_center|LOCUS_27180 4369 3299 gene locus_tag LOCUS_27190 4369 3299 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309930.1 protein_id gnl|my_center|LOCUS_27190 4435 4803 gene locus_tag LOCUS_27200 gene tnpA 4435 4803 CDS product IS200/IS605-like element IS609 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604943.1 protein_id gnl|my_center|LOCUS_27200 5796 4912 gene locus_tag LOCUS_27210 5796 4912 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208318.1 protein_id gnl|my_center|LOCUS_27210 7241 5793 gene locus_tag LOCUS_27220 7241 5793 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393205.1 protein_id gnl|my_center|LOCUS_27220 7592 9082 gene locus_tag LOCUS_27230 7592 9082 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196023.1 protein_id gnl|my_center|LOCUS_27230 9294 9479 gene locus_tag LOCUS_27240 9294 9479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 11051 9426 gene locus_tag LOCUS_27250 11051 9426 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_27250 11411 12214 gene locus_tag LOCUS_27260 11411 12214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806976.1 protein_id gnl|my_center|LOCUS_27260 12211 12987 gene locus_tag LOCUS_27270 12211 12987 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394299.1 protein_id gnl|my_center|LOCUS_27270 13010 13993 gene locus_tag LOCUS_27280 13010 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 14002 15669 gene locus_tag LOCUS_27290 14002 15669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 16206 17201 gene locus_tag LOCUS_27300 16206 17201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 17198 17998 gene locus_tag LOCUS_27310 17198 17998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393480.1 protein_id gnl|my_center|LOCUS_27310 17998 18753 gene locus_tag LOCUS_27320 17998 18753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810701.1 protein_id gnl|my_center|LOCUS_27320 18763 19443 gene locus_tag LOCUS_27330 gene nthB 18763 19443 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400923.1 protein_id gnl|my_center|LOCUS_27330 19455 20072 gene locus_tag LOCUS_27340 gene nthA 19455 20072 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879389.1 protein_id gnl|my_center|LOCUS_27340 20069 20455 gene locus_tag LOCUS_27350 20069 20455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 20452 21168 gene locus_tag LOCUS_27360 20452 21168 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081171.1 protein_id gnl|my_center|LOCUS_27360 21165 22214 gene locus_tag LOCUS_27370 21165 22214 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266608.1 protein_id gnl|my_center|LOCUS_27370 22274 23188 gene locus_tag LOCUS_27380 22274 23188 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245546.1 protein_id gnl|my_center|LOCUS_27380 23707 23123 gene locus_tag LOCUS_27390 23707 23123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 24732 23824 gene locus_tag LOCUS_27400 24732 23824 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113788.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence063 1058 207 gene locus_tag LOCUS_27410 gene sseA 1058 207 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098288.1 protein_id gnl|my_center|LOCUS_27410 1309 4980 gene locus_tag LOCUS_27420 1309 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27420 5014 6279 gene locus_tag LOCUS_27430 5014 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27430 6313 8637 gene locus_tag LOCUS_27440 gene pbpC 6313 8637 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703167.1 protein_id gnl|my_center|LOCUS_27440 8820 9251 gene locus_tag LOCUS_27450 gene ndk 8820 9251 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963841.1 protein_id gnl|my_center|LOCUS_27450 9441 10610 gene locus_tag LOCUS_27460 9441 10610 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003206.1 protein_id gnl|my_center|LOCUS_27460 10707 11444 gene locus_tag LOCUS_27470 gene pilW 10707 11444 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172603.1 protein_id gnl|my_center|LOCUS_27470 11434 12444 gene locus_tag LOCUS_27480 gene rodZ 11434 12444 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098278.1 protein_id gnl|my_center|LOCUS_27480 12485 13606 gene locus_tag LOCUS_27490 gene ispG 12485 13606 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551818.1 protein_id gnl|my_center|LOCUS_27490 13683 14993 gene locus_tag LOCUS_27500 gene hisS 13683 14993 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159557.1 protein_id gnl|my_center|LOCUS_27500 15033 15650 gene locus_tag LOCUS_27510 gene yfgM 15033 15650 CDS product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409203.1 protein_id gnl|my_center|LOCUS_27510 15670 16851 gene locus_tag LOCUS_27520 gene bamB 15670 16851 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177033.1 protein_id gnl|my_center|LOCUS_27520 17015 18508 gene locus_tag LOCUS_27530 gene der 17015 18508 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249413.1 protein_id gnl|my_center|LOCUS_27530 20321 18960 gene locus_tag LOCUS_27540 gene xseA 20321 18960 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815788.1 protein_id gnl|my_center|LOCUS_27540 20491 21957 gene locus_tag LOCUS_27550 gene guaB 20491 21957 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944174.1 protein_id gnl|my_center|LOCUS_27550 22029 23609 gene locus_tag LOCUS_27560 gene guaA 22029 23609 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098264.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence064 709 380 gene locus_tag LOCUS_27570 709 380 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204123.1 protein_id gnl|my_center|LOCUS_27570 1136 726 gene locus_tag LOCUS_27580 1136 726 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095890.1 protein_id gnl|my_center|LOCUS_27580 1843 1169 gene locus_tag LOCUS_27590 1843 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705237.1 protein_id gnl|my_center|LOCUS_27590 2476 1856 gene locus_tag LOCUS_27600 2476 1856 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704257.1 protein_id gnl|my_center|LOCUS_27600 2931 2473 gene locus_tag LOCUS_27610 2931 2473 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368475.1 protein_id gnl|my_center|LOCUS_27610 3891 2944 gene locus_tag LOCUS_27620 gene cutD 3891 2944 CDS product choline TMA-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704258.1 protein_id gnl|my_center|LOCUS_27620 7342 3947 gene locus_tag LOCUS_27630 gene cutC 7342 3947 CDS product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819602.1 protein_id gnl|my_center|LOCUS_27630 8533 7373 gene locus_tag LOCUS_27640 8533 7373 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704260.1 protein_id gnl|my_center|LOCUS_27640 8806 8549 gene locus_tag LOCUS_27650 8806 8549 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599365.1 protein_id gnl|my_center|LOCUS_27650 10446 8833 gene locus_tag LOCUS_27660 10446 8833 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704261.1 protein_id gnl|my_center|LOCUS_27660 10773 10495 gene locus_tag LOCUS_27670 10773 10495 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002442217.1 protein_id gnl|my_center|LOCUS_27670 11084 10770 gene locus_tag LOCUS_27680 11084 10770 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002442227.1 protein_id gnl|my_center|LOCUS_27680 11379 11101 gene locus_tag LOCUS_27690 11379 11101 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012542984.1 protein_id gnl|my_center|LOCUS_27690 12363 11845 gene locus_tag LOCUS_27700 12363 11845 CDS product FidL-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217010.1 protein_id gnl|my_center|LOCUS_27700 13160 12360 gene locus_tag LOCUS_27710 13160 12360 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704262.1 protein_id gnl|my_center|LOCUS_27710 13692 14234 gene locus_tag LOCUS_27720 13692 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 14236 15168 gene locus_tag LOCUS_27730 14236 15168 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094967.1 protein_id gnl|my_center|LOCUS_27730 16148 15153 gene locus_tag LOCUS_27740 16148 15153 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094968.1 protein_id gnl|my_center|LOCUS_27740 16397 16164 gene locus_tag LOCUS_27750 16397 16164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 16435 17346 gene locus_tag LOCUS_27760 gene glyQ 16435 17346 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 protein_id gnl|my_center|LOCUS_27760 17356 19425 gene locus_tag LOCUS_27770 gene glyS 17356 19425 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703776.1 protein_id gnl|my_center|LOCUS_27770 19978 20937 gene locus_tag LOCUS_27780 gene mhpF 19978 20937 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044314.1 protein_id gnl|my_center|LOCUS_27780 20934 21956 gene locus_tag LOCUS_27790 gene dmpG 20934 21956 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013510.1 protein_id gnl|my_center|LOCUS_27790 22136 23533 gene locus_tag LOCUS_27800 22136 23533 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190513.1 protein_id gnl|my_center|LOCUS_27800 24346 23570 gene locus_tag LOCUS_27810 24346 23570 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103889.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence065 1145 1381 gene locus_tag LOCUS_27820 1145 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 1503 2222 gene locus_tag LOCUS_27830 1503 2222 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 protein_id gnl|my_center|LOCUS_27830 3343 2267 gene locus_tag LOCUS_27840 3343 2267 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392002.1 protein_id gnl|my_center|LOCUS_27840 3653 5080 gene locus_tag LOCUS_27850 3653 5080 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705730.1 protein_id gnl|my_center|LOCUS_27850 5217 5465 gene locus_tag LOCUS_27860 5217 5465 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063447014.1 protein_id gnl|my_center|LOCUS_27860 6675 5728 gene locus_tag LOCUS_27870 gene choX 6675 5728 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530058.1 protein_id gnl|my_center|LOCUS_27870 8219 6678 gene locus_tag LOCUS_27880 gene betC 8219 6678 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_27880 8325 9257 gene locus_tag LOCUS_27890 8325 9257 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011857652.1 protein_id gnl|my_center|LOCUS_27890 9371 10210 gene locus_tag LOCUS_27900 9371 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 10231 11067 gene locus_tag LOCUS_27910 gene choW 10231 11067 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200833.1 protein_id gnl|my_center|LOCUS_27910 11266 12177 gene locus_tag LOCUS_27920 11266 12177 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 protein_id gnl|my_center|LOCUS_27920 12245 13072 gene locus_tag LOCUS_27930 12245 13072 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532488.1 protein_id gnl|my_center|LOCUS_27930 13192 13596 gene locus_tag LOCUS_27940 13192 13596 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025999094.1 protein_id gnl|my_center|LOCUS_27940 14332 13673 gene locus_tag LOCUS_27950 14332 13673 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087077.1 protein_id gnl|my_center|LOCUS_27950 14463 15380 gene locus_tag LOCUS_27960 14463 15380 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727037.1 protein_id gnl|my_center|LOCUS_27960 15373 16155 gene locus_tag LOCUS_27970 15373 16155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495282.1 protein_id gnl|my_center|LOCUS_27970 16172 17014 gene locus_tag LOCUS_27980 16172 17014 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726986.1 protein_id gnl|my_center|LOCUS_27980 17017 18027 gene locus_tag LOCUS_27990 17017 18027 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726985.1 protein_id gnl|my_center|LOCUS_27990 18037 18252 gene locus_tag LOCUS_28000 18037 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 18252 19625 gene locus_tag LOCUS_28010 18252 19625 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_28010 19622 20503 gene locus_tag LOCUS_28020 gene eamA 19622 20503 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987753.1 protein_id gnl|my_center|LOCUS_28020 21496 20588 gene locus_tag LOCUS_28030 21496 20588 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387792.1 protein_id gnl|my_center|LOCUS_28030 21856 22698 gene locus_tag LOCUS_28040 21856 22698 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387789.1 protein_id gnl|my_center|LOCUS_28040 22961 23365 gene locus_tag LOCUS_28050 22961 23365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 23431 24012 gene locus_tag LOCUS_28060 23431 24012 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 protein_id gnl|my_center|LOCUS_28060 24117 24377 gene locus_tag LOCUS_28070 24117 24377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence066 649 1272 gene locus_tag LOCUS_28080 gene rhtB 649 1272 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176125.1 protein_id gnl|my_center|LOCUS_28080 1958 1335 gene locus_tag LOCUS_28090 gene rhtC 1958 1335 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176129.1 protein_id gnl|my_center|LOCUS_28090 3869 2043 gene locus_tag LOCUS_28100 gene recQ 3869 2043 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420793.1 protein_id gnl|my_center|LOCUS_28100 4281 4751 gene locus_tag LOCUS_28110 gene yigI 4281 4751 CDS product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004097567.1 protein_id gnl|my_center|LOCUS_28110 5003 9001 gene locus_tag LOCUS_28120 5003 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 10064 9111 gene locus_tag LOCUS_28130 gene corA 10064 9111 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166238.1 protein_id gnl|my_center|LOCUS_28130 12518 10356 gene locus_tag LOCUS_28140 gene uvrD 12518 10356 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383407.1 protein_id gnl|my_center|LOCUS_28140 13292 12576 gene locus_tag LOCUS_28150 gene yigB 13292 12576 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211474.1 protein_id gnl|my_center|LOCUS_28150 14200 13292 gene locus_tag LOCUS_28160 gene xerC 14200 13292 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211473.1 protein_id gnl|my_center|LOCUS_28160 14901 14197 gene locus_tag LOCUS_28170 14901 14197 CDS product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176169.1 protein_id gnl|my_center|LOCUS_28170 15746 14898 gene locus_tag LOCUS_28180 gene dapF 15746 14898 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176172.1 protein_id gnl|my_center|LOCUS_28180 15943 15749 gene locus_tag LOCUS_28190 15943 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 18704 16146 gene locus_tag LOCUS_28200 gene cyaA 18704 16146 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 protein_id gnl|my_center|LOCUS_28200 18718 18966 gene locus_tag LOCUS_28210 18718 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 18995 19936 gene locus_tag LOCUS_28220 gene hemC 18995 19936 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001338644.1 protein_id gnl|my_center|LOCUS_28220 19933 20673 gene locus_tag LOCUS_28230 gene hemD 19933 20673 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883127.1 protein_id gnl|my_center|LOCUS_28230 20697 21833 gene locus_tag LOCUS_28240 gene hemX 20697 21833 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211463.1 protein_id gnl|my_center|LOCUS_28240 21836 23026 gene locus_tag LOCUS_28250 gene hemY 21836 23026 CDS product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 protein_id gnl|my_center|LOCUS_28250 23696 24094 gene locus_tag LOCUS_28260 23696 24094 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173442.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence067 681 199 gene locus_tag LOCUS_28270 681 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2039 681 gene locus_tag LOCUS_28280 gene pssA 2039 681 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949265.1 protein_id gnl|my_center|LOCUS_28280 4806 2149 gene locus_tag LOCUS_28290 gene pat 4806 2149 CDS product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082943.1 protein_id gnl|my_center|LOCUS_28290 5735 4992 gene locus_tag LOCUS_28300 gene tapT 5735 4992 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183640.1 protein_id gnl|my_center|LOCUS_28300 6226 5807 gene locus_tag LOCUS_28310 gene trxC 6226 5807 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098330.1 protein_id gnl|my_center|LOCUS_28310 6433 7470 gene locus_tag LOCUS_28320 6433 7470 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098329.1 protein_id gnl|my_center|LOCUS_28320 9138 7603 gene locus_tag LOCUS_28330 gene emrB 9138 7603 CDS product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295176.1 protein_id gnl|my_center|LOCUS_28330 10328 9153 gene locus_tag LOCUS_28340 gene emrA 10328 9153 CDS product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098428.1 protein_id gnl|my_center|LOCUS_28340 11010 10477 gene locus_tag LOCUS_28350 gene emrR 11010 10477 CDS product multidrug efflux transporter EmrAB transcriptional repressor EmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378442.1 protein_id gnl|my_center|LOCUS_28350 11441 11100 gene locus_tag LOCUS_28360 gene ygaH 11441 11100 CDS product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119759.1 protein_id gnl|my_center|LOCUS_28360 12178 11438 gene locus_tag LOCUS_28370 gene ygaZ 12178 11438 CDS product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445658.1 protein_id gnl|my_center|LOCUS_28370 13497 12313 gene locus_tag LOCUS_28380 13497 12313 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165770.1 protein_id gnl|my_center|LOCUS_28380 14642 13647 gene locus_tag LOCUS_28390 gene proX 14642 13647 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370071.1 protein_id gnl|my_center|LOCUS_28390 15874 14711 gene locus_tag LOCUS_28400 gene proW 15874 14711 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815703.1 protein_id gnl|my_center|LOCUS_28400 17066 15867 gene locus_tag LOCUS_28410 gene proV 17066 15867 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985490.1 protein_id gnl|my_center|LOCUS_28410 18332 17367 gene locus_tag LOCUS_28420 gene nrdF 18332 17367 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815704.1 protein_id gnl|my_center|LOCUS_28420 20627 18477 gene locus_tag LOCUS_28430 gene nrdE 20627 18477 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212212.1 protein_id gnl|my_center|LOCUS_28430 21010 20600 gene locus_tag LOCUS_28440 gene nrdI 21010 20600 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215935.1 protein_id gnl|my_center|LOCUS_28440 21257 21015 gene locus_tag LOCUS_28450 21257 21015 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815707.1 protein_id gnl|my_center|LOCUS_28450 21929 22276 gene locus_tag LOCUS_28460 21929 22276 CDS product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098417.1 protein_id gnl|my_center|LOCUS_28460 22678 23265 gene locus_tag LOCUS_28470 22678 23265 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366891.1 protein_id gnl|my_center|LOCUS_28470 23255 23668 gene locus_tag LOCUS_28480 23255 23668 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087887.1 protein_id gnl|my_center|LOCUS_28480 >Feature sequence068 1428 370 gene locus_tag LOCUS_28490 1428 370 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144640.1 protein_id gnl|my_center|LOCUS_28490 1636 2730 gene locus_tag LOCUS_28500 1636 2730 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705363.1 protein_id gnl|my_center|LOCUS_28500 2900 3820 gene locus_tag LOCUS_28510 2900 3820 CDS product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816068.1 protein_id gnl|my_center|LOCUS_28510 3838 5073 gene locus_tag LOCUS_28520 gene mdtG 3838 5073 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074159.1 protein_id gnl|my_center|LOCUS_28520 5334 5732 gene locus_tag LOCUS_28530 5334 5732 CDS product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097161.1 protein_id gnl|my_center|LOCUS_28530 5952 5734 gene locus_tag LOCUS_28540 5952 5734 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237185.1 protein_id gnl|my_center|LOCUS_28540 8630 6054 gene locus_tag LOCUS_28550 gene mdoH 8630 6054 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602389.1 protein_id gnl|my_center|LOCUS_28550 10188 8623 gene locus_tag LOCUS_28560 gene mdoG 10188 8623 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 protein_id gnl|my_center|LOCUS_28560 10571 11743 gene locus_tag LOCUS_28570 gene mdoC 10571 11743 CDS product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097165.1 protein_id gnl|my_center|LOCUS_28570 12008 13198 gene locus_tag LOCUS_28580 12008 13198 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461355.1 protein_id gnl|my_center|LOCUS_28580 13386 15770 gene locus_tag LOCUS_28590 13386 15770 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_28590 16580 15939 gene locus_tag LOCUS_28600 16580 15939 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313420.1 protein_id gnl|my_center|LOCUS_28600 17098 16916 gene locus_tag LOCUS_28610 17098 16916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 17856 19892 gene locus_tag LOCUS_28620 17856 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 20368 20538 gene locus_tag LOCUS_28630 20368 20538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 20740 21777 gene locus_tag LOCUS_28640 gene waaO 20740 21777 CDS product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088491.1 protein_id gnl|my_center|LOCUS_28640 22532 23068 gene locus_tag LOCUS_28650 22532 23068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 23455 23369 gene locus_tag LOCUS_t00220 23455 23369 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23539 23466 gene locus_tag LOCUS_t00230 23539 23466 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence069 324 1343 gene locus_tag LOCUS_28660 324 1343 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742148.1 protein_id gnl|my_center|LOCUS_28660 1343 1879 gene locus_tag LOCUS_28670 1343 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 1885 2976 gene locus_tag LOCUS_28680 1885 2976 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113360.1 protein_id gnl|my_center|LOCUS_28680 3101 3847 gene locus_tag LOCUS_28690 3101 3847 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 protein_id gnl|my_center|LOCUS_28690 4897 3962 gene locus_tag LOCUS_28700 4897 3962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529870.1 protein_id gnl|my_center|LOCUS_28700 6000 4894 gene locus_tag LOCUS_28710 6000 4894 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529869.1 protein_id gnl|my_center|LOCUS_28710 7553 5997 gene locus_tag LOCUS_28720 7553 5997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529868.1 protein_id gnl|my_center|LOCUS_28720 8740 7718 gene locus_tag LOCUS_28730 8740 7718 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529867.1 protein_id gnl|my_center|LOCUS_28730 8836 9282 gene locus_tag LOCUS_28740 8836 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529866.1 protein_id gnl|my_center|LOCUS_28740 9925 11394 gene locus_tag LOCUS_28750 gene hpaB 9925 11394 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 protein_id gnl|my_center|LOCUS_28750 11468 11857 gene locus_tag LOCUS_28760 11468 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 11862 13328 gene locus_tag LOCUS_28770 11862 13328 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105036.1 protein_id gnl|my_center|LOCUS_28770 13325 14623 gene locus_tag LOCUS_28780 13325 14623 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_28780 14826 15773 gene locus_tag LOCUS_28790 14826 15773 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331260.1 protein_id gnl|my_center|LOCUS_28790 15773 16306 gene locus_tag LOCUS_28800 gene rutF 15773 16306 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103444.1 protein_id gnl|my_center|LOCUS_28800 16358 17401 gene locus_tag LOCUS_28810 16358 17401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929892.1 protein_id gnl|my_center|LOCUS_28810 18598 17420 gene locus_tag LOCUS_28820 18598 17420 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529872.1 protein_id gnl|my_center|LOCUS_28820 18925 19740 gene locus_tag LOCUS_28830 18925 19740 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529856.1 protein_id gnl|my_center|LOCUS_28830 19786 20460 gene locus_tag LOCUS_28840 19786 20460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28840 20578 21321 gene locus_tag LOCUS_28850 20578 21321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28850 21494 22429 gene locus_tag LOCUS_28860 gene cbpA 21494 22429 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817008.1 protein_id gnl|my_center|LOCUS_28860 22432 22740 gene locus_tag LOCUS_28870 gene cbpM 22432 22740 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173425.1 protein_id gnl|my_center|LOCUS_28870 <23452 22805 gene locus_tag LOCUS_28880 <23452 22805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385500.1:DMT family transporter >Feature sequence070 1769 999 gene locus_tag LOCUS_28890 gene lldR 1769 999 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001553608.1 protein_id gnl|my_center|LOCUS_28890 3424 1769 gene locus_tag LOCUS_28900 gene lldP 3424 1769 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295233.1 protein_id gnl|my_center|LOCUS_28900 6641 3858 gene locus_tag LOCUS_28910 6641 3858 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815400.1 protein_id gnl|my_center|LOCUS_28910 8217 6631 gene locus_tag LOCUS_28920 8217 6631 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161803513.1 protein_id gnl|my_center|LOCUS_28920 11046 8419 gene locus_tag LOCUS_28930 11046 8419 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084281.1 protein_id gnl|my_center|LOCUS_28930 12254 11268 gene locus_tag LOCUS_28940 12254 11268 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084282.1 protein_id gnl|my_center|LOCUS_28940 12796 12251 gene locus_tag LOCUS_28950 12796 12251 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156585.1 protein_id gnl|my_center|LOCUS_28950 13109 13888 gene locus_tag LOCUS_28960 13109 13888 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046052102.1 protein_id gnl|my_center|LOCUS_28960 14864 13923 gene locus_tag LOCUS_28970 14864 13923 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206478.1 protein_id gnl|my_center|LOCUS_28970 14997 15734 gene locus_tag LOCUS_28980 14997 15734 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206477.1 protein_id gnl|my_center|LOCUS_28980 15904 16548 gene locus_tag LOCUS_28990 15904 16548 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028480.1 protein_id gnl|my_center|LOCUS_28990 18875 16677 gene locus_tag LOCUS_29000 18875 16677 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704681.1 protein_id gnl|my_center|LOCUS_29000 19616 19194 gene locus_tag LOCUS_29010 19616 19194 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704866.1 protein_id gnl|my_center|LOCUS_29010 20760 19804 gene locus_tag LOCUS_29020 20760 19804 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383348.1 protein_id gnl|my_center|LOCUS_29020 22408 20951 gene locus_tag LOCUS_29030 22408 20951 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815285.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence071 384 187 gene locus_tag LOCUS_29040 384 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 736 1422 gene locus_tag LOCUS_29050 736 1422 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 protein_id gnl|my_center|LOCUS_29050 1910 2443 gene locus_tag LOCUS_29060 1910 2443 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259181.1 protein_id gnl|my_center|LOCUS_29060 3843 2509 gene locus_tag LOCUS_29070 3843 2509 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228605.1 protein_id gnl|my_center|LOCUS_29070 4645 3887 gene locus_tag LOCUS_29080 4645 3887 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086017.1 protein_id gnl|my_center|LOCUS_29080 5439 4642 gene locus_tag LOCUS_29090 5439 4642 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970050.1 protein_id gnl|my_center|LOCUS_29090 6326 5439 gene locus_tag LOCUS_29100 6326 5439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339156.1 protein_id gnl|my_center|LOCUS_29100 7279 6323 gene locus_tag LOCUS_29110 7279 6323 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268897.1 protein_id gnl|my_center|LOCUS_29110 8785 7280 gene locus_tag LOCUS_29120 8785 7280 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_29120 10822 9686 gene locus_tag LOCUS_29130 10822 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 11120 12793 gene locus_tag LOCUS_29140 11120 12793 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255514.1 protein_id gnl|my_center|LOCUS_29140 12796 14280 gene locus_tag LOCUS_29150 12796 14280 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973394.1 protein_id gnl|my_center|LOCUS_29150 14307 15323 gene locus_tag LOCUS_29160 14307 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 15345 16298 gene locus_tag LOCUS_29170 15345 16298 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033042345.1 protein_id gnl|my_center|LOCUS_29170 16867 16694 gene locus_tag LOCUS_29180 16867 16694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 16946 19321 gene locus_tag LOCUS_29190 16946 19321 CDS product membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211139558.1 protein_id gnl|my_center|LOCUS_29190 19783 20229 gene locus_tag LOCUS_29200 19783 20229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence072 22 98 gene locus_tag LOCUS_t00240 22 98 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 176 252 gene locus_tag LOCUS_t00250 176 252 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 499 1065 gene locus_tag LOCUS_29210 gene yqaB 499 1065 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167426.1 protein_id gnl|my_center|LOCUS_29210 1347 2909 gene locus_tag LOCUS_29220 gene gshA 1347 2909 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848972.1 protein_id gnl|my_center|LOCUS_29220 3062 3577 gene locus_tag LOCUS_29230 gene luxS 3062 3577 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209453.1 protein_id gnl|my_center|LOCUS_29230 4953 3667 gene locus_tag LOCUS_29240 4953 3667 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028086.1 protein_id gnl|my_center|LOCUS_29240 5768 4977 gene locus_tag LOCUS_29250 5768 4977 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537507.1 protein_id gnl|my_center|LOCUS_29250 5934 7295 gene locus_tag LOCUS_29260 gene ffh 5934 7295 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 protein_id gnl|my_center|LOCUS_29260 7521 7769 gene locus_tag LOCUS_29270 gene rpsP 7521 7769 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209458.1 protein_id gnl|my_center|LOCUS_29270 7776 8336 gene locus_tag LOCUS_29280 gene rimM 7776 8336 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703198.1 protein_id gnl|my_center|LOCUS_29280 8372 9136 gene locus_tag LOCUS_29290 gene trmD 8372 9136 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 protein_id gnl|my_center|LOCUS_29290 9179 9526 gene locus_tag LOCUS_29300 gene rplS 9179 9526 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 protein_id gnl|my_center|LOCUS_29300 9716 10243 gene locus_tag LOCUS_29310 gene tnpA 9716 10243 CDS product IS200/IS605-like element ISSod23 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072537.1 protein_id gnl|my_center|LOCUS_29310 11338 10223 gene locus_tag LOCUS_29320 gene solA 11338 10223 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170765.1 protein_id gnl|my_center|LOCUS_29320 11805 11551 gene locus_tag LOCUS_29330 gene bssS 11805 11551 CDS product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500827.1 protein_id gnl|my_center|LOCUS_29330 12473 12195 gene locus_tag LOCUS_29340 12473 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 13054 12809 gene locus_tag LOCUS_29350 gene dinI 13054 12809 CDS product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097151.1 protein_id gnl|my_center|LOCUS_29350 14182 13136 gene locus_tag LOCUS_29360 gene pyrC 14182 13136 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097150.1 protein_id gnl|my_center|LOCUS_29360 14980 14417 gene locus_tag LOCUS_29370 14980 14417 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097149.1 protein_id gnl|my_center|LOCUS_29370 16345 15143 gene locus_tag LOCUS_29380 gene mdtH 16345 15143 CDS product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097148.1 protein_id gnl|my_center|LOCUS_29380 16768 17358 gene locus_tag LOCUS_29390 gene rimJ 16768 17358 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367203.1 protein_id gnl|my_center|LOCUS_29390 17485 18129 gene locus_tag LOCUS_29400 17485 18129 CDS product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877111.1 protein_id gnl|my_center|LOCUS_29400 18389 19927 gene locus_tag LOCUS_29410 gene murJ 18389 19927 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367200.1 protein_id gnl|my_center|LOCUS_29410 20719 20108 gene locus_tag LOCUS_29420 20719 20108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence073 115 1590 gene locus_tag LOCUS_29430 gene ilvC 115 1590 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099283.1 protein_id gnl|my_center|LOCUS_29430 1954 1673 gene locus_tag LOCUS_29440 gene ppiC 1954 1673 CDS product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096806.1 protein_id gnl|my_center|LOCUS_29440 2073 4097 gene locus_tag LOCUS_29450 gene rep 2073 4097 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099281.1 protein_id gnl|my_center|LOCUS_29450 5654 4170 gene locus_tag LOCUS_29460 gene ppx 5654 4170 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032900842.1 protein_id gnl|my_center|LOCUS_29460 6954 5662 gene locus_tag LOCUS_29470 gene rhlB 6954 5662 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047525.1 protein_id gnl|my_center|LOCUS_29470 7072 7404 gene locus_tag LOCUS_29480 gene trxA 7072 7404 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883224.1 protein_id gnl|my_center|LOCUS_29480 7742 9001 gene locus_tag LOCUS_29490 gene rho 7742 9001 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883293.1 protein_id gnl|my_center|LOCUS_29490 9282 10379 gene locus_tag LOCUS_29500 gene wecA 9282 10379 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 protein_id gnl|my_center|LOCUS_29500 10415 11446 gene locus_tag LOCUS_29510 gene wzzE 10415 11446 CDS product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299252.1 protein_id gnl|my_center|LOCUS_29510 11494 12630 gene locus_tag LOCUS_29520 gene wecB 11494 12630 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176215.1 protein_id gnl|my_center|LOCUS_29520 12627 13889 gene locus_tag LOCUS_29530 gene wecC 12627 13889 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703971.1 protein_id gnl|my_center|LOCUS_29530 13962 14654 gene locus_tag LOCUS_29540 gene rffC 13962 14654 CDS product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211982.1 protein_id gnl|my_center|LOCUS_29540 14659 15789 gene locus_tag LOCUS_29550 gene rffA 14659 15789 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 protein_id gnl|my_center|LOCUS_29550 15791 17041 gene locus_tag LOCUS_29560 gene wzxE 15791 17041 CDS product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050302.1 protein_id gnl|my_center|LOCUS_29560 17038 18111 gene locus_tag LOCUS_29570 17038 18111 CDS product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211979.1 protein_id gnl|my_center|LOCUS_29570 18108 19454 gene locus_tag LOCUS_29580 gene wzyE 18108 19454 CDS product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815334.1 protein_id gnl|my_center|LOCUS_29580 19494 20234 gene locus_tag LOCUS_29590 gene wecG 19494 20234 CDS product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183613.1 protein_id gnl|my_center|LOCUS_29590 20415 20491 gene locus_tag LOCUS_t00260 20415 20491 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 427 981 gene locus_tag LOCUS_29600 427 981 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099006.1 protein_id gnl|my_center|LOCUS_29600 1208 957 gene locus_tag LOCUS_29610 1208 957 CDS product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420723.1 protein_id gnl|my_center|LOCUS_29610 2023 1205 gene locus_tag LOCUS_29620 gene aroE 2023 1205 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451217.1 protein_id gnl|my_center|LOCUS_29620 2602 2030 gene locus_tag LOCUS_29630 gene tsaC 2602 2030 CDS product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420961.1 protein_id gnl|my_center|LOCUS_29630 3149 2595 gene locus_tag LOCUS_29640 3149 2595 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099010.1 protein_id gnl|my_center|LOCUS_29640 3648 3175 gene locus_tag LOCUS_29650 gene smg 3648 3175 CDS product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369440.1 protein_id gnl|my_center|LOCUS_29650 4744 3620 gene locus_tag LOCUS_29660 gene dprA 4744 3620 CDS product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228567.1 protein_id gnl|my_center|LOCUS_29660 4874 5383 gene locus_tag LOCUS_29670 gene def 4874 5383 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209021.1 protein_id gnl|my_center|LOCUS_29670 5405 6352 gene locus_tag LOCUS_29680 gene fmt 5405 6352 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099014.1 protein_id gnl|my_center|LOCUS_29680 6410 7699 gene locus_tag LOCUS_29690 gene rsmB 6410 7699 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215705.1 protein_id gnl|my_center|LOCUS_29690 7751 9127 gene locus_tag LOCUS_29700 gene trkA 7751 9127 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691382.1 protein_id gnl|my_center|LOCUS_29700 9260 9667 gene locus_tag LOCUS_29710 gene mscL 9260 9667 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099017.1 protein_id gnl|my_center|LOCUS_29710 10982 10005 gene locus_tag LOCUS_29720 10982 10005 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211003.1 protein_id gnl|my_center|LOCUS_29720 11186 12577 gene locus_tag LOCUS_29730 11186 12577 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211002.1 protein_id gnl|my_center|LOCUS_29730 12587 14086 gene locus_tag LOCUS_29740 gene xylB 12587 14086 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706072.1 protein_id gnl|my_center|LOCUS_29740 14240 15199 gene locus_tag LOCUS_29750 14240 15199 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210001.1 protein_id gnl|my_center|LOCUS_29750 15218 16747 gene locus_tag LOCUS_29760 15218 16747 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210000.1 protein_id gnl|my_center|LOCUS_29760 16764 17744 gene locus_tag LOCUS_29770 16764 17744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209999.1 protein_id gnl|my_center|LOCUS_29770 18138 19589 gene locus_tag LOCUS_29780 18138 19589 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089363.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence075 6312 1318 gene locus_tag LOCUS_29790 6312 1318 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103907.1 protein_id gnl|my_center|LOCUS_29790 7645 6455 gene locus_tag LOCUS_29800 7645 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 9436 8096 gene locus_tag LOCUS_29810 gene dcuB 9436 8096 CDS product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368823.1 protein_id gnl|my_center|LOCUS_29810 10263 11378 gene locus_tag LOCUS_29820 10263 11378 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366474.1 protein_id gnl|my_center|LOCUS_29820 11496 12410 gene locus_tag LOCUS_29830 11496 12410 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705514.1 protein_id gnl|my_center|LOCUS_29830 12420 13712 gene locus_tag LOCUS_29840 gene livM 12420 13712 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705513.1 protein_id gnl|my_center|LOCUS_29840 13705 14583 gene locus_tag LOCUS_29850 13705 14583 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366477.1 protein_id gnl|my_center|LOCUS_29850 14576 15292 gene locus_tag LOCUS_29860 14576 15292 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366478.1 protein_id gnl|my_center|LOCUS_29860 15418 16845 gene locus_tag LOCUS_29870 gene emmdR 15418 16845 CDS product multidrug efflux MATE transporter EmmdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120727113.1 protein_id gnl|my_center|LOCUS_29870 17132 17311 gene locus_tag LOCUS_29880 17132 17311 CDS product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009307.1 protein_id gnl|my_center|LOCUS_29880 18670 17450 gene locus_tag LOCUS_29890 18670 17450 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_29890 19515 18712 gene locus_tag LOCUS_29900 19515 18712 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 protein_id gnl|my_center|LOCUS_29900 >Feature sequence076 1310 693 gene locus_tag LOCUS_29910 1310 693 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038852.1 protein_id gnl|my_center|LOCUS_29910 1645 1436 gene locus_tag LOCUS_29920 1645 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 2345 1581 gene locus_tag LOCUS_29930 2345 1581 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210870.1 protein_id gnl|my_center|LOCUS_29930 2850 3881 gene locus_tag LOCUS_29940 gene chuS 2850 3881 CDS product hematinate-forming heme oxygenase ChuS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017190.1 protein_id gnl|my_center|LOCUS_29940 3878 4696 gene locus_tag LOCUS_29950 3878 4696 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156544.1 protein_id gnl|my_center|LOCUS_29950 4693 5694 gene locus_tag LOCUS_29960 4693 5694 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096986.1 protein_id gnl|my_center|LOCUS_29960 5687 6466 gene locus_tag LOCUS_29970 5687 6466 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815405.1 protein_id gnl|my_center|LOCUS_29970 7902 6463 gene locus_tag LOCUS_29980 7902 6463 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816391.1 protein_id gnl|my_center|LOCUS_29980 8588 8130 gene locus_tag LOCUS_29990 8588 8130 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169395.1 protein_id gnl|my_center|LOCUS_29990 8817 9590 gene locus_tag LOCUS_30000 8817 9590 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193030.1 protein_id gnl|my_center|LOCUS_30000 9681 10655 gene locus_tag LOCUS_30010 9681 10655 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064105.1 protein_id gnl|my_center|LOCUS_30010 11380 10613 gene locus_tag LOCUS_30020 gene btuD 11380 10613 CDS product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096997.1 protein_id gnl|my_center|LOCUS_30020 11926 11381 gene locus_tag LOCUS_30030 11926 11381 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096998.1 protein_id gnl|my_center|LOCUS_30030 12956 11973 gene locus_tag LOCUS_30040 gene btuC 12956 11973 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956518.1 protein_id gnl|my_center|LOCUS_30040 12969 13172 gene locus_tag LOCUS_30050 12969 13172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 13389 13090 gene locus_tag LOCUS_30060 gene ihfA 13389 13090 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229266.1 protein_id gnl|my_center|LOCUS_30060 15781 13394 gene locus_tag LOCUS_30070 gene pheT 15781 13394 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672340.1 protein_id gnl|my_center|LOCUS_30070 16780 15797 gene locus_tag LOCUS_30080 gene pheS 16780 15797 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097003.1 protein_id gnl|my_center|LOCUS_30080 17452 17096 gene locus_tag LOCUS_30090 gene rplT 17452 17096 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 protein_id gnl|my_center|LOCUS_30090 17693 17496 gene locus_tag LOCUS_30100 gene rpmI 17693 17496 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 protein_id gnl|my_center|LOCUS_30100 18262 17789 gene locus_tag LOCUS_30110 gene infC 18262 17789 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189469.1 protein_id gnl|my_center|LOCUS_30110 20131 18335 gene locus_tag LOCUS_30120 gene thrS 20131 18335 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144226.1 protein_id gnl|my_center|LOCUS_30120 >Feature sequence077 862 344 gene locus_tag LOCUS_30130 862 344 CDS product 4-hydroxyphenylacetate 3-monooxygenase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887467.1 protein_id gnl|my_center|LOCUS_30130 2437 875 gene locus_tag LOCUS_30140 gene hpaB 2437 875 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887473.1 protein_id gnl|my_center|LOCUS_30140 3563 2673 gene locus_tag LOCUS_30150 gene hpaA 3563 2673 CDS product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093495.1 protein_id gnl|my_center|LOCUS_30150 4872 3574 gene locus_tag LOCUS_30160 gene hpaX 4872 3574 CDS product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887477.1 protein_id gnl|my_center|LOCUS_30160 5751 4954 gene locus_tag LOCUS_30170 gene hpaI 5751 4954 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704294.1 protein_id gnl|my_center|LOCUS_30170 6565 5762 gene locus_tag LOCUS_30180 gene hpaH 6565 5762 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095451.1 protein_id gnl|my_center|LOCUS_30180 7019 6639 gene locus_tag LOCUS_30190 7019 6639 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119872.1 protein_id gnl|my_center|LOCUS_30190 8166 7090 gene locus_tag LOCUS_30200 gene hpaD 8166 7090 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528545.1 protein_id gnl|my_center|LOCUS_30200 9758 8304 gene locus_tag LOCUS_30210 gene hpaE 9758 8304 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095454.1 protein_id gnl|my_center|LOCUS_30210 11017 9755 gene locus_tag LOCUS_30220 gene hpaG 11017 9755 CDS product 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679210.1 protein_id gnl|my_center|LOCUS_30220 11351 11821 gene locus_tag LOCUS_30230 gene hpaR 11351 11821 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095456.1 protein_id gnl|my_center|LOCUS_30230 12644 12027 gene locus_tag LOCUS_30240 12644 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30240 13575 12913 gene locus_tag LOCUS_30250 13575 12913 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667095.1 protein_id gnl|my_center|LOCUS_30250 13750 15220 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttctaagctgcctgtgcggcagtgaac 15588 16064 gene locus_tag LOCUS_30260 15588 16064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 16054 16239 gene locus_tag LOCUS_30270 16054 16239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 16453 16244 gene locus_tag LOCUS_30280 16453 16244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30280 16949 16689 gene locus_tag LOCUS_30290 16949 16689 CDS product Insertion element iso-IS1N protein insA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179084.1 protein_id gnl|my_center|LOCUS_30290 17246 16989 gene locus_tag LOCUS_30300 17246 16989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30300 18127 17330 gene locus_tag LOCUS_30310 18127 17330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30310 18883 18410 gene locus_tag LOCUS_30320 18883 18410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059234286.1 protein_id gnl|my_center|LOCUS_30320 19608 18886 gene locus_tag LOCUS_30330 19608 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 >Feature sequence078 934 671 gene locus_tag LOCUS_30340 gene sctS 934 671 CDS product type III secretion system export apparatus subunit SctS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375712.1 protein_id gnl|my_center|LOCUS_30340 1607 942 gene locus_tag LOCUS_30350 gene sctR 1607 942 CDS product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406534.1 protein_id gnl|my_center|LOCUS_30350 2686 1604 gene locus_tag LOCUS_30360 2686 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3396 2683 gene locus_tag LOCUS_30370 3396 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3860 3393 gene locus_tag LOCUS_30380 3860 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 5184 3844 gene locus_tag LOCUS_30390 gene hrcN 5184 3844 CDS product type III secretion system ATPase HrcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266891.1 protein_id gnl|my_center|LOCUS_30390 6161 5205 gene locus_tag LOCUS_30400 gene sctD 6161 5205 CDS product type III secretion system inner membrane ring subunit SctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763855.1 protein_id gnl|my_center|LOCUS_30400 8272 6173 gene locus_tag LOCUS_30410 gene sctV 8272 6173 CDS product type III secretion system export apparatus subunit SctV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266893.1 protein_id gnl|my_center|LOCUS_30410 9450 8269 gene locus_tag LOCUS_30420 9450 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 9726 10283 gene locus_tag LOCUS_30430 gene hrpL 9726 10283 CDS product RNA polymerase sigma factor HrpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103538.1 protein_id gnl|my_center|LOCUS_30430 11089 10457 gene locus_tag LOCUS_30440 11089 10457 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768051.1 protein_id gnl|my_center|LOCUS_30440 11781 11242 gene locus_tag LOCUS_30450 11781 11242 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096732.1 protein_id gnl|my_center|LOCUS_30450 13010 11964 gene locus_tag LOCUS_30460 13010 11964 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705181.1 protein_id gnl|my_center|LOCUS_30460 13996 14574 gene locus_tag LOCUS_30470 gene pagP 13996 14574 CDS product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170942738.1 protein_id gnl|my_center|LOCUS_30470 14724 14933 gene locus_tag LOCUS_30480 gene cspE 14724 14933 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439184.1 protein_id gnl|my_center|LOCUS_30480 15724 16353 gene locus_tag LOCUS_30490 15724 16353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 16424 17842 gene locus_tag LOCUS_30500 16424 17842 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728113.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence079 923 87 gene locus_tag LOCUS_30510 gene sseA 923 87 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966391.1 protein_id gnl|my_center|LOCUS_30510 1948 980 gene locus_tag LOCUS_30520 1948 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 2745 1945 gene locus_tag LOCUS_30530 2745 1945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230261.1 protein_id gnl|my_center|LOCUS_30530 3493 2720 gene locus_tag LOCUS_30540 3493 2720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965193.1 protein_id gnl|my_center|LOCUS_30540 4302 3490 gene locus_tag LOCUS_30550 4302 3490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_30550 5704 4295 gene locus_tag LOCUS_30560 5704 4295 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973043.1 protein_id gnl|my_center|LOCUS_30560 6816 5701 gene locus_tag LOCUS_30570 6816 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 8350 6881 gene locus_tag LOCUS_30580 8350 6881 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920255.1 protein_id gnl|my_center|LOCUS_30580 10097 8361 gene locus_tag LOCUS_30590 10097 8361 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726806.1 protein_id gnl|my_center|LOCUS_30590 12332 10497 gene locus_tag LOCUS_30600 12332 10497 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113000.1 protein_id gnl|my_center|LOCUS_30600 12849 15065 gene locus_tag LOCUS_30610 12849 15065 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207286.1 protein_id gnl|my_center|LOCUS_30610 15117 16139 gene locus_tag LOCUS_30620 15117 16139 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965288.1 protein_id gnl|my_center|LOCUS_30620 16220 16831 gene locus_tag LOCUS_30630 16220 16831 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097992.1 protein_id gnl|my_center|LOCUS_30630 16980 18194 gene locus_tag LOCUS_30640 16980 18194 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047157.1 protein_id gnl|my_center|LOCUS_30640 18359 18434 gene locus_tag LOCUS_t00270 18359 18434 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18661 18780 gene locus_tag LOCUS_30650 18661 18780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 >Feature sequence080 1062 637 gene locus_tag LOCUS_30660 1062 637 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095077.1 protein_id gnl|my_center|LOCUS_30660 1167 2069 gene locus_tag LOCUS_30670 1167 2069 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174372.1 protein_id gnl|my_center|LOCUS_30670 3749 2103 gene locus_tag LOCUS_30680 3749 2103 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095075.1 protein_id gnl|my_center|LOCUS_30680 5378 4029 gene locus_tag LOCUS_30690 5378 4029 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080104.1 protein_id gnl|my_center|LOCUS_30690 6166 5693 gene locus_tag LOCUS_30700 gene soxR 6166 5693 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368733.1 protein_id gnl|my_center|LOCUS_30700 6255 6668 gene locus_tag LOCUS_30710 gene soxS 6255 6668 CDS product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368734.1 protein_id gnl|my_center|LOCUS_30710 7240 7515 gene locus_tag LOCUS_30720 7240 7515 CDS product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503385.1 protein_id gnl|my_center|LOCUS_30720 8573 7623 gene locus_tag LOCUS_30730 8573 7623 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_30730 9838 8567 gene locus_tag LOCUS_30740 9838 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 10355 10750 gene locus_tag LOCUS_30750 10355 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 11443 11646 gene locus_tag LOCUS_30760 11443 11646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 12453 11929 gene locus_tag LOCUS_30770 12453 11929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30770 12677 12483 gene locus_tag LOCUS_30780 12677 12483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 15020 12726 gene locus_tag LOCUS_30790 15020 12726 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032466356.1 protein_id gnl|my_center|LOCUS_30790 15373 15041 gene locus_tag LOCUS_30800 15373 15041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 15923 15384 gene locus_tag LOCUS_30810 15923 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 16665 16129 gene locus_tag LOCUS_30820 16665 16129 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213971.1 protein_id gnl|my_center|LOCUS_30820 >Feature sequence081 68 397 gene locus_tag LOCUS_30830 68 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30830 2430 607 gene locus_tag LOCUS_30840 gene typA 2430 607 CDS product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368970.1 protein_id gnl|my_center|LOCUS_30840 2871 4280 gene locus_tag LOCUS_30850 gene glnA 2871 4280 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213150.1 protein_id gnl|my_center|LOCUS_30850 4422 5471 gene locus_tag LOCUS_30860 gene glnL 4422 5471 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501857.1 protein_id gnl|my_center|LOCUS_30860 5479 6888 gene locus_tag LOCUS_30870 gene glnG 5479 6888 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334023.1 protein_id gnl|my_center|LOCUS_30870 8698 7325 gene locus_tag LOCUS_30880 gene hemN 8698 7325 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099379.1 protein_id gnl|my_center|LOCUS_30880 9454 8945 gene locus_tag LOCUS_30890 gene yihI 9454 8945 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099380.1 protein_id gnl|my_center|LOCUS_30890 10065 10688 gene locus_tag LOCUS_30900 gene yihA 10065 10688 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183327.1 protein_id gnl|my_center|LOCUS_30900 13918 11135 gene locus_tag LOCUS_30910 gene polA 13918 11135 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 protein_id gnl|my_center|LOCUS_30910 13961 14122 gene locus_tag LOCUS_30920 13961 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 15122 14493 gene locus_tag LOCUS_30930 gene dsbA 15122 14493 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725344.1 protein_id gnl|my_center|LOCUS_30930 16134 15148 gene locus_tag LOCUS_30940 16134 15148 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213169.1 protein_id gnl|my_center|LOCUS_30940 16483 16214 gene locus_tag LOCUS_30950 16483 16214 CDS product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 protein_id gnl|my_center|LOCUS_30950 16561 17148 gene locus_tag LOCUS_30960 gene mobA 16561 17148 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703924.1 protein_id gnl|my_center|LOCUS_30960 17149 17658 gene locus_tag LOCUS_30970 gene mobB 17149 17658 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989262.1 protein_id gnl|my_center|LOCUS_30970 >Feature sequence082 936 2639 gene locus_tag LOCUS_30980 936 2639 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811710.1 protein_id gnl|my_center|LOCUS_30980 2636 3256 gene locus_tag LOCUS_30990 2636 3256 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 protein_id gnl|my_center|LOCUS_30990 3310 4644 gene locus_tag LOCUS_31000 3310 4644 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083711.1 protein_id gnl|my_center|LOCUS_31000 4746 5135 gene locus_tag LOCUS_31010 4746 5135 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815583.1 protein_id gnl|my_center|LOCUS_31010 6087 5164 gene locus_tag LOCUS_31020 6087 5164 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941352.1 protein_id gnl|my_center|LOCUS_31020 7579 6071 gene locus_tag LOCUS_31030 7579 6071 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 protein_id gnl|my_center|LOCUS_31030 7727 9001 gene locus_tag LOCUS_31040 7727 9001 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099137.1 protein_id gnl|my_center|LOCUS_31040 10780 9392 gene locus_tag LOCUS_31050 10780 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 12340 10805 gene locus_tag LOCUS_31060 12340 10805 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112370.1 protein_id gnl|my_center|LOCUS_31060 13711 12539 gene locus_tag LOCUS_31070 13711 12539 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384188.1 protein_id gnl|my_center|LOCUS_31070 15855 13711 gene locus_tag LOCUS_31080 15855 13711 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103467.1 protein_id gnl|my_center|LOCUS_31080 16131 17255 gene locus_tag LOCUS_31090 16131 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 >Feature sequence083 8107 7526 gene locus_tag LOCUS_31100 8107 7526 CDS product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 protein_id gnl|my_center|LOCUS_31100 8686 8159 gene locus_tag LOCUS_31110 8686 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 10356 8686 gene locus_tag LOCUS_31120 10356 8686 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704284.1 protein_id gnl|my_center|LOCUS_31120 10634 10558 gene locus_tag LOCUS_t00280 10634 10558 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 11497 10766 gene locus_tag LOCUS_31130 gene dnaQ 11497 10766 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368125.1 protein_id gnl|my_center|LOCUS_31130 11550 12017 gene locus_tag LOCUS_31140 gene rnhA 11550 12017 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368126.1 protein_id gnl|my_center|LOCUS_31140 12736 12002 gene locus_tag LOCUS_31150 12736 12002 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298887.1 protein_id gnl|my_center|LOCUS_31150 12779 13534 gene locus_tag LOCUS_31160 gene gloB 12779 13534 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704465.1 protein_id gnl|my_center|LOCUS_31160 13608 14981 gene locus_tag LOCUS_31170 gene mltD 13608 14981 CDS product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228041.1 protein_id gnl|my_center|LOCUS_31170 15850 15077 gene locus_tag LOCUS_31180 15850 15077 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368130.1 protein_id gnl|my_center|LOCUS_31180 16626 15934 gene locus_tag LOCUS_31190 16626 15934 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 protein_id gnl|my_center|LOCUS_31190 17176 17100 gene locus_tag LOCUS_t00290 17176 17100 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence084 405 596 gene locus_tag LOCUS_31200 gene dsrB 405 596 CDS product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097741.1 protein_id gnl|my_center|LOCUS_31200 1402 767 gene locus_tag LOCUS_31210 gene rcsA 1402 767 CDS product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097740.1 protein_id gnl|my_center|LOCUS_31210 2933 2610 gene locus_tag LOCUS_31220 2933 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 3149 3628 gene locus_tag LOCUS_31230 gene yedD 3149 3628 CDS product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754694.1 protein_id gnl|my_center|LOCUS_31230 5170 3692 gene locus_tag LOCUS_31240 gene amyA 5170 3692 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245699.1 protein_id gnl|my_center|LOCUS_31240 5384 6391 gene locus_tag LOCUS_31250 gene dcyD 5384 6391 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069418.1 protein_id gnl|my_center|LOCUS_31250 6688 7488 gene locus_tag LOCUS_31260 gene tcyJ 6688 7488 CDS product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096020.1 protein_id gnl|my_center|LOCUS_31260 7488 8156 gene locus_tag LOCUS_31270 gene tcyL 7488 8156 CDS product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096022.1 protein_id gnl|my_center|LOCUS_31270 8153 8905 gene locus_tag LOCUS_31280 gene yecC 8153 8905 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273005.1 protein_id gnl|my_center|LOCUS_31280 9502 9068 gene locus_tag LOCUS_31290 9502 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31290 9898 9608 gene locus_tag LOCUS_31300 9898 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31300 9997 10155 gene locus_tag LOCUS_31310 9997 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31310 10201 10728 gene locus_tag LOCUS_31320 10201 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31320 14950 11009 gene locus_tag LOCUS_31330 gene putA 14950 11009 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305899.1 protein_id gnl|my_center|LOCUS_31330 14996 15175 gene locus_tag LOCUS_31340 14996 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 15694 16482 gene locus_tag LOCUS_31350 gene phoH 15694 16482 CDS product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001617488.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence085 <1 2626 gene locus_tag LOCUS_31360 <1 2626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_155030720.1:Ig-like domain-containing protein 2729 4891 gene locus_tag LOCUS_31370 2729 4891 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095715.1 protein_id gnl|my_center|LOCUS_31370 4925 6241 gene locus_tag LOCUS_31380 4925 6241 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095714.1 protein_id gnl|my_center|LOCUS_31380 6253 7794 gene locus_tag LOCUS_31390 6253 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 8919 7852 gene locus_tag LOCUS_31400 gene purK 8919 7852 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816855.1 protein_id gnl|my_center|LOCUS_31400 9425 8916 gene locus_tag LOCUS_31410 gene purE 9425 8916 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167785.1 protein_id gnl|my_center|LOCUS_31410 10425 11075 gene locus_tag LOCUS_31420 10425 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31420 11179 11361 gene locus_tag LOCUS_31430 11179 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31430 11959 11528 gene locus_tag LOCUS_31440 11959 11528 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168621.1 protein_id gnl|my_center|LOCUS_31440 13412 12015 gene locus_tag LOCUS_31450 13412 12015 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816648.1 protein_id gnl|my_center|LOCUS_31450 14769 13648 gene locus_tag LOCUS_31460 14769 13648 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 protein_id gnl|my_center|LOCUS_31460 15788 14892 gene locus_tag LOCUS_31470 gene iolE 15788 14892 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817366.1 protein_id gnl|my_center|LOCUS_31470 >Feature sequence086 1110 322 gene locus_tag LOCUS_31480 gene fabI 1110 322 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366239.1 protein_id gnl|my_center|LOCUS_31480 2071 1265 gene locus_tag LOCUS_31490 gene sapF 2071 1265 CDS product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096393.1 protein_id gnl|my_center|LOCUS_31490 3063 2071 gene locus_tag LOCUS_31500 gene sapD 3063 2071 CDS product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210970.1 protein_id gnl|my_center|LOCUS_31500 3953 3063 gene locus_tag LOCUS_31510 gene sapC 3953 3063 CDS product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366244.1 protein_id gnl|my_center|LOCUS_31510 5215 4250 gene locus_tag LOCUS_31520 gene sapB 5215 4250 CDS product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366265.1 protein_id gnl|my_center|LOCUS_31520 6801 5212 gene locus_tag LOCUS_31530 gene sapA 6801 5212 CDS product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816365.1 protein_id gnl|my_center|LOCUS_31530 8169 7174 gene locus_tag LOCUS_31540 gene pspF 8169 7174 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816362.1 protein_id gnl|my_center|LOCUS_31540 8335 9000 gene locus_tag LOCUS_31550 gene pspA 8335 9000 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511000.1 protein_id gnl|my_center|LOCUS_31550 9071 9292 gene locus_tag LOCUS_31560 gene pspB 9071 9292 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161022.1 protein_id gnl|my_center|LOCUS_31560 9295 9657 gene locus_tag LOCUS_31570 gene pspC 9295 9657 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096405.1 protein_id gnl|my_center|LOCUS_31570 9707 9955 gene locus_tag LOCUS_31580 gene pspD 9707 9955 CDS product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096406.1 protein_id gnl|my_center|LOCUS_31580 9936 11333 gene locus_tag LOCUS_31590 9936 11333 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096419.1 protein_id gnl|my_center|LOCUS_31590 11330 12394 gene locus_tag LOCUS_31600 11330 12394 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169550.1 protein_id gnl|my_center|LOCUS_31600 12605 14170 gene locus_tag LOCUS_31610 gene tyrR 12605 14170 CDS product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210983.1 protein_id gnl|my_center|LOCUS_31610 14762 14259 gene locus_tag LOCUS_31620 gene tpx 14762 14259 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210984.1 protein_id gnl|my_center|LOCUS_31620 14774 14956 gene locus_tag LOCUS_31630 14774 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 15637 16026 gene locus_tag LOCUS_31640 15637 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence087 1474 485 gene locus_tag LOCUS_31650 1474 485 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530761.1 protein_id gnl|my_center|LOCUS_31650 1580 2512 gene locus_tag LOCUS_31660 1580 2512 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368401.1 protein_id gnl|my_center|LOCUS_31660 3381 2566 gene locus_tag LOCUS_31670 3381 2566 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726998.1 protein_id gnl|my_center|LOCUS_31670 4253 3381 gene locus_tag LOCUS_31680 4253 3381 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776866.1 protein_id gnl|my_center|LOCUS_31680 5653 4313 gene locus_tag LOCUS_31690 5653 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 6180 6782 gene locus_tag LOCUS_31700 6180 6782 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971767.1 protein_id gnl|my_center|LOCUS_31700 6795 7886 gene locus_tag LOCUS_31710 gene ugpC 6795 7886 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252937.1 protein_id gnl|my_center|LOCUS_31710 9027 7903 gene locus_tag LOCUS_31720 9027 7903 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705629.1 protein_id gnl|my_center|LOCUS_31720 9939 9076 gene locus_tag LOCUS_31730 9939 9076 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110418.1 protein_id gnl|my_center|LOCUS_31730 10223 11383 gene locus_tag LOCUS_31740 10223 11383 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310749.1 protein_id gnl|my_center|LOCUS_31740 12347 11478 gene locus_tag LOCUS_31750 12347 11478 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704700.1 protein_id gnl|my_center|LOCUS_31750 12452 13816 gene locus_tag LOCUS_31760 12452 13816 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729040.1 protein_id gnl|my_center|LOCUS_31760 14515 14171 gene locus_tag LOCUS_31770 14515 14171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 15463 14972 gene locus_tag LOCUS_31780 gene hcp 15463 14972 CDS product type VI secretion system effector Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366299.1 protein_id gnl|my_center|LOCUS_31780 15853 15467 gene locus_tag LOCUS_31790 15853 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence088 1547 1729 gene locus_tag LOCUS_31800 1547 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1726 3405 gene locus_tag LOCUS_31810 1726 3405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974807.1 protein_id gnl|my_center|LOCUS_31810 3634 4485 gene locus_tag LOCUS_31820 3634 4485 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211044.1 protein_id gnl|my_center|LOCUS_31820 5914 4649 gene locus_tag LOCUS_31830 gene efeB 5914 4649 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730522.1 protein_id gnl|my_center|LOCUS_31830 7153 5918 gene locus_tag LOCUS_31840 7153 5918 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_31840 8673 7198 gene locus_tag LOCUS_31850 8673 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 10373 9372 gene locus_tag LOCUS_31860 10373 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103344.1 protein_id gnl|my_center|LOCUS_31860 11037 10669 gene locus_tag LOCUS_31870 11037 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 11221 12042 gene locus_tag LOCUS_31880 11221 12042 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104230.1 protein_id gnl|my_center|LOCUS_31880 12312 12506 gene locus_tag LOCUS_31890 12312 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 12513 13004 gene locus_tag LOCUS_31900 12513 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 13089 14474 gene locus_tag LOCUS_31910 13089 14474 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098348.1 protein_id gnl|my_center|LOCUS_31910 14655 15029 gene locus_tag LOCUS_31920 gene yobA 14655 15029 CDS product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042893410.1 protein_id gnl|my_center|LOCUS_31920 15282 15533 gene locus_tag LOCUS_31930 15282 15533 CDS product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366132.1 protein_id gnl|my_center|LOCUS_31930 15877 16029 gene locus_tag LOCUS_31940 15877 16029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 >Feature sequence089 557 294 gene locus_tag LOCUS_31950 557 294 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209637.1 protein_id gnl|my_center|LOCUS_31950 946 1362 gene locus_tag LOCUS_31960 gene ibpA 946 1362 CDS product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 protein_id gnl|my_center|LOCUS_31960 2389 1475 gene locus_tag LOCUS_31970 gene eamA 2389 1475 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987753.1 protein_id gnl|my_center|LOCUS_31970 2910 2413 gene locus_tag LOCUS_31980 2910 2413 CDS product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705788.1 protein_id gnl|my_center|LOCUS_31980 3742 2942 gene locus_tag LOCUS_31990 3742 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 4447 3746 gene locus_tag LOCUS_32000 4447 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 5730 4435 gene locus_tag LOCUS_32010 5730 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 7199 5730 gene locus_tag LOCUS_32020 7199 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764454.1 protein_id gnl|my_center|LOCUS_32020 7512 8951 gene locus_tag LOCUS_32030 7512 8951 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_32030 10284 9031 gene locus_tag LOCUS_32040 gene avtA 10284 9031 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144354.1 protein_id gnl|my_center|LOCUS_32040 10626 11834 gene locus_tag LOCUS_32050 10626 11834 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096422.1 protein_id gnl|my_center|LOCUS_32050 12854 11880 gene locus_tag LOCUS_32060 gene ghrB 12854 11880 CDS product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817452.1 protein_id gnl|my_center|LOCUS_32060 13568 12993 gene locus_tag LOCUS_32070 gene tag 13568 12993 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094984.1 protein_id gnl|my_center|LOCUS_32070 13908 14234 gene locus_tag LOCUS_32080 13908 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32080 14155 14460 gene locus_tag LOCUS_32090 14155 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32090 14647 15192 gene locus_tag LOCUS_32100 gene dnaT 14647 15192 CDS product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098821.1 protein_id gnl|my_center|LOCUS_32100 15231 15932 gene locus_tag LOCUS_32110 gene dnaC 15231 15932 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873982.1 protein_id gnl|my_center|LOCUS_32110 >Feature sequence090 325 1152 gene locus_tag LOCUS_32120 gene tauC 325 1152 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114601.1 protein_id gnl|my_center|LOCUS_32120 1149 1997 gene locus_tag LOCUS_32130 gene tauD 1149 1997 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004027.1 protein_id gnl|my_center|LOCUS_32130 3945 2044 gene locus_tag LOCUS_32140 3945 2044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634840.1 protein_id gnl|my_center|LOCUS_32140 4062 4613 gene locus_tag LOCUS_32150 gene kefG 4062 4613 CDS product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081510.1 protein_id gnl|my_center|LOCUS_32150 4614 6422 gene locus_tag LOCUS_32160 gene kefB 4614 6422 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399099.1 protein_id gnl|my_center|LOCUS_32160 6426 6662 gene locus_tag LOCUS_32170 6426 6662 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099038.1 protein_id gnl|my_center|LOCUS_32170 6814 7362 gene locus_tag LOCUS_32180 gene slyD 6814 7362 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861345.1 protein_id gnl|my_center|LOCUS_32180 7745 7527 gene locus_tag LOCUS_32190 7745 7527 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861693.1 protein_id gnl|my_center|LOCUS_32190 8034 8864 gene locus_tag LOCUS_32200 gene fkpA 8034 8864 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085068497.1 protein_id gnl|my_center|LOCUS_32200 8839 9033 gene locus_tag LOCUS_32210 8839 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 9047 9769 gene locus_tag LOCUS_32220 9047 9769 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091472.1 protein_id gnl|my_center|LOCUS_32220 9769 10155 gene locus_tag LOCUS_32230 gene tusD 9769 10155 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268013.1 protein_id gnl|my_center|LOCUS_32230 10155 10514 gene locus_tag LOCUS_32240 gene tusC 10155 10514 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212321.1 protein_id gnl|my_center|LOCUS_32240 10526 10813 gene locus_tag LOCUS_32250 gene tusB 10526 10813 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903373.1 protein_id gnl|my_center|LOCUS_32250 10938 11312 gene locus_tag LOCUS_32260 gene rpsL 10938 11312 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 protein_id gnl|my_center|LOCUS_32260 11409 11879 gene locus_tag LOCUS_32270 gene rpsG 11409 11879 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 protein_id gnl|my_center|LOCUS_32270 11974 14082 gene locus_tag LOCUS_32280 gene fusA 11974 14082 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212325.1 protein_id gnl|my_center|LOCUS_32280 14153 15337 gene locus_tag LOCUS_32290 gene tuf 14153 15337 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620081.1 protein_id gnl|my_center|LOCUS_32290 >Feature sequence091 556 281 gene locus_tag LOCUS_32300 556 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32300 954 1550 gene locus_tag LOCUS_32310 gene yihX 954 1550 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965695.1 protein_id gnl|my_center|LOCUS_32310 1640 2398 gene locus_tag LOCUS_32320 1640 2398 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 protein_id gnl|my_center|LOCUS_32320 2422 2859 gene locus_tag LOCUS_32330 gene dtd 2422 2859 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175741.1 protein_id gnl|my_center|LOCUS_32330 2919 3860 gene locus_tag LOCUS_32340 gene fabY 2919 3860 CDS product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099362.1 protein_id gnl|my_center|LOCUS_32340 4520 4056 gene locus_tag LOCUS_32350 4520 4056 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143849.1 protein_id gnl|my_center|LOCUS_32350 4601 5179 gene locus_tag LOCUS_32360 4601 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 6939 5260 gene locus_tag LOCUS_32370 6939 5260 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094876.1 protein_id gnl|my_center|LOCUS_32370 8455 7079 gene locus_tag LOCUS_32380 8455 7079 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094877.1 protein_id gnl|my_center|LOCUS_32380 9422 11173 gene locus_tag LOCUS_32390 9422 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 13590 11509 gene locus_tag LOCUS_32400 gene recG 13590 11509 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016758.1 protein_id gnl|my_center|LOCUS_32400 14285 13587 gene locus_tag LOCUS_32410 gene trmH 14285 13587 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369142.1 protein_id gnl|my_center|LOCUS_32410 <15436 14289 gene locus_tag LOCUS_32420 <15436 14289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369143.1:bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase >Feature sequence092 813 208 gene locus_tag LOCUS_32430 813 208 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941119.1 protein_id gnl|my_center|LOCUS_32430 1541 876 gene locus_tag LOCUS_32440 gene nfi 1541 876 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095016.1 protein_id gnl|my_center|LOCUS_32440 2610 1543 gene locus_tag LOCUS_32450 gene hemE 2610 1543 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175675.1 protein_id gnl|my_center|LOCUS_32450 3422 2649 gene locus_tag LOCUS_32460 gene nudC 3422 2649 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166081.1 protein_id gnl|my_center|LOCUS_32460 3518 4033 gene locus_tag LOCUS_32470 gene rsd 3518 4033 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934302.1 protein_id gnl|my_center|LOCUS_32470 4444 5109 gene locus_tag LOCUS_32480 gene thiE 4444 5109 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284576.1 protein_id gnl|my_center|LOCUS_32480 5119 5463 gene locus_tag LOCUS_32490 5119 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 6097 5867 gene locus_tag LOCUS_32500 6097 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32500 10087 6107 gene locus_tag LOCUS_32510 gene rpoC 10087 6107 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 protein_id gnl|my_center|LOCUS_32510 14197 10169 gene locus_tag LOCUS_32520 gene rpoB 14197 10169 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263103.1 protein_id gnl|my_center|LOCUS_32520 14890 14522 gene locus_tag LOCUS_32530 gene rplL 14890 14522 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095002.1 protein_id gnl|my_center|LOCUS_32530 >Feature sequence093 733 1278 gene locus_tag LOCUS_32540 733 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32540 1260 1445 gene locus_tag LOCUS_32550 1260 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32550 1635 1871 gene locus_tag LOCUS_32560 1635 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 1951 3075 gene locus_tag LOCUS_32570 1951 3075 CDS product ISAs1-like element ISSod22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 protein_id gnl|my_center|LOCUS_32570 5357 3327 gene locus_tag LOCUS_32580 gene fyuA 5357 3327 CDS product siderophore yersiniabactin receptor FyuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784550.1 protein_id gnl|my_center|LOCUS_32580 5479 6375 gene locus_tag LOCUS_32590 5479 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 6499 6365 gene locus_tag LOCUS_32600 6499 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 7100 8701 gene locus_tag LOCUS_32610 7100 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 8709 9110 gene locus_tag LOCUS_32620 8709 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 9128 10897 gene locus_tag LOCUS_32630 9128 10897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388619.1 protein_id gnl|my_center|LOCUS_32630 10884 12611 gene locus_tag LOCUS_32640 10884 12611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626054.1 protein_id gnl|my_center|LOCUS_32640 12595 13647 gene locus_tag LOCUS_32650 12595 13647 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097455.1 protein_id gnl|my_center|LOCUS_32650 13650 15146 gene locus_tag LOCUS_32660 13650 15146 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827567.1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence094 1 76 gene locus_tag LOCUS_t00300 1 76 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 131 206 gene locus_tag LOCUS_t00310 131 206 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 211 286 gene locus_tag LOCUS_t00320 211 286 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 904 581 gene locus_tag LOCUS_32670 904 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 909 1130 gene locus_tag LOCUS_32680 909 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32680 1283 1116 gene locus_tag LOCUS_32690 1283 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 2027 1401 gene locus_tag LOCUS_32700 2027 1401 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406576.1 protein_id gnl|my_center|LOCUS_32700 2722 2336 gene locus_tag LOCUS_32710 2722 2336 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787381.1 protein_id gnl|my_center|LOCUS_32710 3106 2750 gene locus_tag LOCUS_32720 3106 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 3269 3742 gene locus_tag LOCUS_32730 3269 3742 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 protein_id gnl|my_center|LOCUS_32730 4831 3911 gene locus_tag LOCUS_32740 4831 3911 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098193.1 protein_id gnl|my_center|LOCUS_32740 4927 5949 gene locus_tag LOCUS_32750 4927 5949 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878163.1 protein_id gnl|my_center|LOCUS_32750 6170 5952 gene locus_tag LOCUS_32760 6170 5952 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114688.1 protein_id gnl|my_center|LOCUS_32760 8190 6148 gene locus_tag LOCUS_32770 gene ligA 8190 6148 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443697.1 protein_id gnl|my_center|LOCUS_32770 9226 8261 gene locus_tag LOCUS_32780 gene zipA 9226 8261 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227089.1 protein_id gnl|my_center|LOCUS_32780 9443 10201 gene locus_tag LOCUS_32790 gene cysZ 9443 10201 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213487.1 protein_id gnl|my_center|LOCUS_32790 10359 11330 gene locus_tag LOCUS_32800 gene cysK 10359 11330 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036904.1 protein_id gnl|my_center|LOCUS_32800 11849 12106 gene locus_tag LOCUS_32810 gene ptsH 11849 12106 CDS product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 protein_id gnl|my_center|LOCUS_32810 12268 13995 gene locus_tag LOCUS_32820 gene ptsI 12268 13995 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208490.1 protein_id gnl|my_center|LOCUS_32820 14039 14542 gene locus_tag LOCUS_32830 gene crr 14039 14542 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392561.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence095 143 1042 gene locus_tag LOCUS_32840 gene hisG 143 1042 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388789.1 protein_id gnl|my_center|LOCUS_32840 1047 2354 gene locus_tag LOCUS_32850 gene hisD 1047 2354 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386882.1 protein_id gnl|my_center|LOCUS_32850 2351 3442 gene locus_tag LOCUS_32860 gene hisC 2351 3442 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168372.1 protein_id gnl|my_center|LOCUS_32860 3439 4506 gene locus_tag LOCUS_32870 gene hisB 3439 4506 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097845.1 protein_id gnl|my_center|LOCUS_32870 4506 5096 gene locus_tag LOCUS_32880 gene hisH 4506 5096 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168362.1 protein_id gnl|my_center|LOCUS_32880 5102 5839 gene locus_tag LOCUS_32890 gene hisA 5102 5839 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816714.1 protein_id gnl|my_center|LOCUS_32890 5821 6597 gene locus_tag LOCUS_32900 gene hisF 5821 6597 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706032.1 protein_id gnl|my_center|LOCUS_32900 6591 7202 gene locus_tag LOCUS_32910 gene hisIE 6591 7202 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954830.1 protein_id gnl|my_center|LOCUS_32910 8203 7271 gene locus_tag LOCUS_32920 gene wzzB 8203 7271 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215243.1 protein_id gnl|my_center|LOCUS_32920 9880 8474 gene locus_tag LOCUS_32930 gene gndA 9880 8474 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211888.1 protein_id gnl|my_center|LOCUS_32930 10523 9975 gene locus_tag LOCUS_32940 gene rfbC 10523 9975 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261024.1 protein_id gnl|my_center|LOCUS_32940 11099 10545 gene locus_tag LOCUS_32950 11099 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 12387 11089 gene locus_tag LOCUS_32960 12387 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 13389 12391 gene locus_tag LOCUS_32970 13389 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674024.1 protein_id gnl|my_center|LOCUS_32970 13814 13389 gene locus_tag LOCUS_32980 13814 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence096 749 318 gene locus_tag LOCUS_32990 749 318 CDS product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098815.1 protein_id gnl|my_center|LOCUS_32990 1963 980 gene locus_tag LOCUS_33000 gene epmB 1963 980 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940510.1 protein_id gnl|my_center|LOCUS_33000 2050 2616 gene locus_tag LOCUS_33010 gene efp 2050 2616 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257282.1 protein_id gnl|my_center|LOCUS_33010 2628 2807 gene locus_tag LOCUS_33020 2628 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 2921 3055 gene locus_tag LOCUS_33030 gene ecnB 2921 3055 CDS product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368653.1 protein_id gnl|my_center|LOCUS_33030 3478 3122 gene locus_tag LOCUS_33040 gene frdD 3478 3122 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299198.1 protein_id gnl|my_center|LOCUS_33040 3884 3489 gene locus_tag LOCUS_33050 gene frdC 3884 3489 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208749.1 protein_id gnl|my_center|LOCUS_33050 4629 3895 gene locus_tag LOCUS_33060 4629 3895 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175554.1 protein_id gnl|my_center|LOCUS_33060 6415 4622 gene locus_tag LOCUS_33070 gene frdA 6415 4622 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815417.1 protein_id gnl|my_center|LOCUS_33070 6737 7714 gene locus_tag LOCUS_33080 gene epmA 6737 7714 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 protein_id gnl|my_center|LOCUS_33080 11086 7760 gene locus_tag LOCUS_33090 gene mscM 11086 7760 CDS product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236760.1 protein_id gnl|my_center|LOCUS_33090 11999 11112 gene locus_tag LOCUS_33100 gene asd 11999 11112 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095278.1 protein_id gnl|my_center|LOCUS_33100 13160 12105 gene locus_tag LOCUS_33110 gene rsgA 13160 12105 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 protein_id gnl|my_center|LOCUS_33110 13213 13803 gene locus_tag LOCUS_33120 gene orn 13213 13803 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 protein_id gnl|my_center|LOCUS_33120 13967 14042 gene locus_tag LOCUS_t00330 13967 14042 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence097 3849 688 gene locus_tag LOCUS_33130 gene muxB 3849 688 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_33130 4910 3846 gene locus_tag LOCUS_33140 4910 3846 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931666.1 protein_id gnl|my_center|LOCUS_33140 6684 5275 gene locus_tag LOCUS_33150 6684 5275 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268044.1 protein_id gnl|my_center|LOCUS_33150 9805 6674 gene locus_tag LOCUS_33160 9805 6674 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268787.1 protein_id gnl|my_center|LOCUS_33160 10762 9815 gene locus_tag LOCUS_33170 10762 9815 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406318.1 protein_id gnl|my_center|LOCUS_33170 11337 11149 gene locus_tag LOCUS_33180 11337 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 13266 11551 gene locus_tag LOCUS_33190 gene ftsI 13266 11551 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642212.1 protein_id gnl|my_center|LOCUS_33190 14132 13671 gene locus_tag LOCUS_33200 14132 13671 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098560.1 protein_id gnl|my_center|LOCUS_33200 14421 14173 gene locus_tag LOCUS_33210 14421 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence098 976 251 gene locus_tag LOCUS_33220 976 251 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640685.1 protein_id gnl|my_center|LOCUS_33220 1418 969 gene locus_tag LOCUS_33230 1418 969 CDS product GlcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853257.1 protein_id gnl|my_center|LOCUS_33230 1738 2286 gene locus_tag LOCUS_33240 gene nfeR 1738 2286 CDS product DNA-binding transcriptional regulator NfeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018003.1 protein_id gnl|my_center|LOCUS_33240 3085 2498 gene locus_tag LOCUS_33250 3085 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 3426 3241 gene locus_tag LOCUS_33260 3426 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 4325 3540 gene locus_tag LOCUS_33270 4325 3540 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742177.1 protein_id gnl|my_center|LOCUS_33270 5140 4322 gene locus_tag LOCUS_33280 gene mhpD 5140 4322 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160723.1 protein_id gnl|my_center|LOCUS_33280 5349 5164 gene locus_tag LOCUS_33290 5349 5164 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831035.1 protein_id gnl|my_center|LOCUS_33290 5968 6858 gene locus_tag LOCUS_33300 5968 6858 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 protein_id gnl|my_center|LOCUS_33300 6923 7468 gene locus_tag LOCUS_33310 6923 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 7854 8930 gene locus_tag LOCUS_33320 7854 8930 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550689.1 protein_id gnl|my_center|LOCUS_33320 9108 11309 gene locus_tag LOCUS_33330 9108 11309 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705755.1 protein_id gnl|my_center|LOCUS_33330 13075 11381 gene locus_tag LOCUS_33340 gene dauA 13075 11381 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816539.1 protein_id gnl|my_center|LOCUS_33340 >Feature sequence099 53 844 gene locus_tag LOCUS_33350 53 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 855 2471 gene locus_tag LOCUS_33360 gene entE 855 2471 CDS product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097633.1 protein_id gnl|my_center|LOCUS_33360 2491 3345 gene locus_tag LOCUS_33370 gene entB 2491 3345 CDS product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367768.1 protein_id gnl|my_center|LOCUS_33370 3348 4100 gene locus_tag LOCUS_33380 gene entA 3348 4100 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367767.1 protein_id gnl|my_center|LOCUS_33380 4143 4556 gene locus_tag LOCUS_33390 gene entH 4143 4556 CDS product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097630.1 protein_id gnl|my_center|LOCUS_33390 6261 4684 gene locus_tag LOCUS_33400 gene ahpF 6261 4684 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979839.1 protein_id gnl|my_center|LOCUS_33400 6897 6334 gene locus_tag LOCUS_33410 gene ahpC 6897 6334 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859485.1 protein_id gnl|my_center|LOCUS_33410 8138 7425 gene locus_tag LOCUS_33420 8138 7425 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 protein_id gnl|my_center|LOCUS_33420 8757 8152 gene locus_tag LOCUS_33430 8757 8152 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020996754.1 protein_id gnl|my_center|LOCUS_33430 10263 8767 gene locus_tag LOCUS_33440 10263 8767 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704601.1 protein_id gnl|my_center|LOCUS_33440 10659 11597 gene locus_tag LOCUS_33450 gene bsdA 10659 11597 CDS product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 protein_id gnl|my_center|LOCUS_33450 12411 11623 gene locus_tag LOCUS_33460 gene map 12411 11623 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817158.1 protein_id gnl|my_center|LOCUS_33460 12659 12408 gene locus_tag LOCUS_33470 12659 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 <13721 12948 gene locus_tag LOCUS_33480 <13721 12948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000213683.1:siderophore-interacting protein >Feature sequence100 264 1082 gene locus_tag LOCUS_33490 264 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 1799 2068 gene locus_tag LOCUS_33500 1799 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 3645 2119 gene locus_tag LOCUS_33510 3645 2119 CDS product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817067.1 protein_id gnl|my_center|LOCUS_33510 4009 3656 gene locus_tag LOCUS_33520 4009 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095183.1 protein_id gnl|my_center|LOCUS_33520 5418 4009 gene locus_tag LOCUS_33530 5418 4009 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162366969.1 protein_id gnl|my_center|LOCUS_33530 6404 5430 gene locus_tag LOCUS_33540 6404 5430 CDS product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817069.1 protein_id gnl|my_center|LOCUS_33540 6805 6401 gene locus_tag LOCUS_33550 6805 6401 CDS product TIGR03757 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025381164.1 protein_id gnl|my_center|LOCUS_33550 7275 8258 gene locus_tag LOCUS_33560 7275 8258 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867479.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33560 9763 8672 gene locus_tag LOCUS_33570 9763 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123253.1 protein_id gnl|my_center|LOCUS_33570 11553 9763 gene locus_tag LOCUS_33580 11553 9763 CDS product restriction system-associated AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123252.1 protein_id gnl|my_center|LOCUS_33580 13103 11550 gene locus_tag LOCUS_33590 13103 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence101 685 855 gene locus_tag LOCUS_33600 685 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 1571 957 gene locus_tag LOCUS_33610 1571 957 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764720.1 protein_id gnl|my_center|LOCUS_33610 1988 1912 gene locus_tag LOCUS_t00340 1988 1912 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3819 2062 gene locus_tag LOCUS_33620 gene yejM 3819 2062 CDS product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256152.1 protein_id gnl|my_center|LOCUS_33620 4069 3842 gene locus_tag LOCUS_33630 4069 3842 CDS product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208836.1 protein_id gnl|my_center|LOCUS_33630 4228 5232 gene locus_tag LOCUS_33640 gene yejK 4228 5232 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365669.1 protein_id gnl|my_center|LOCUS_33640 5589 5305 gene locus_tag LOCUS_33650 gene rplY 5589 5305 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494186.1 protein_id gnl|my_center|LOCUS_33650 7506 5752 gene locus_tag LOCUS_33660 7506 5752 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706128.1 protein_id gnl|my_center|LOCUS_33660 7799 8503 gene locus_tag LOCUS_33670 gene rsuA 7799 8503 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097990.1 protein_id gnl|my_center|LOCUS_33670 8684 9880 gene locus_tag LOCUS_33680 8684 9880 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213351.1 protein_id gnl|my_center|LOCUS_33680 10197 10568 gene locus_tag LOCUS_33690 10197 10568 CDS product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 protein_id gnl|my_center|LOCUS_33690 12185 10590 gene locus_tag LOCUS_33700 gene yejF 12185 10590 CDS product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815989.1 protein_id gnl|my_center|LOCUS_33700 13212 12187 gene locus_tag LOCUS_33710 13212 12187 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088798.1 protein_id gnl|my_center|LOCUS_33710 >Feature sequence102 2460 202 gene locus_tag LOCUS_33720 2460 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 2767 4086 gene locus_tag LOCUS_33730 gene ugpB 2767 4086 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 protein_id gnl|my_center|LOCUS_33730 4142 5029 gene locus_tag LOCUS_33740 gene ugpA 4142 5029 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369328.1 protein_id gnl|my_center|LOCUS_33740 5026 5871 gene locus_tag LOCUS_33750 gene ugpE 5026 5871 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176328.1 protein_id gnl|my_center|LOCUS_33750 5875 6948 gene locus_tag LOCUS_33760 5875 6948 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099124.1 protein_id gnl|my_center|LOCUS_33760 6945 7688 gene locus_tag LOCUS_33770 gene ugpQ 6945 7688 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703700.1 protein_id gnl|my_center|LOCUS_33770 8208 7930 gene locus_tag LOCUS_33780 8208 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 8463 10160 gene locus_tag LOCUS_33790 gene ggt 8463 10160 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_33790 11126 10263 gene locus_tag LOCUS_33800 11126 10263 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975713.1 protein_id gnl|my_center|LOCUS_33800 11249 12262 gene locus_tag LOCUS_33810 11249 12262 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729983.1 protein_id gnl|my_center|LOCUS_33810 >Feature sequence103 317 823 gene locus_tag LOCUS_33820 317 823 CDS product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175227.1 protein_id gnl|my_center|LOCUS_33820 1067 2569 gene locus_tag LOCUS_33830 1067 2569 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098956.1 protein_id gnl|my_center|LOCUS_33830 2579 3850 gene locus_tag LOCUS_33840 2579 3850 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602676.1 protein_id gnl|my_center|LOCUS_33840 4953 3877 gene locus_tag LOCUS_33850 gene lptG 4953 3877 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295681.1 protein_id gnl|my_center|LOCUS_33850 6053 4953 gene locus_tag LOCUS_33860 gene lptF 6053 4953 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584114.1 protein_id gnl|my_center|LOCUS_33860 6322 7830 gene locus_tag LOCUS_33870 gene pepA 6322 7830 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175279.1 protein_id gnl|my_center|LOCUS_33870 7903 8361 gene locus_tag LOCUS_33880 7903 8361 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209309.1 protein_id gnl|my_center|LOCUS_33880 8368 11223 gene locus_tag LOCUS_33890 8368 11223 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368547.1 protein_id gnl|my_center|LOCUS_33890 11297 11800 gene locus_tag LOCUS_33900 11297 11800 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815474.1 protein_id gnl|my_center|LOCUS_33900 >Feature sequence104 3763 3548 gene locus_tag LOCUS_33910 3763 3548 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097641.1 protein_id gnl|my_center|LOCUS_33910 4963 3797 gene locus_tag LOCUS_33920 gene fes 4963 3797 CDS product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656592.1 protein_id gnl|my_center|LOCUS_33920 5280 7559 gene locus_tag LOCUS_33930 gene fepA 5280 7559 CDS product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704704.1 protein_id gnl|my_center|LOCUS_33930 7888 9063 gene locus_tag LOCUS_33940 7888 9063 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008806844.1 protein_id gnl|my_center|LOCUS_33940 9860 9084 gene locus_tag LOCUS_33950 gene ydcF 9860 9084 CDS product DUF218 domain-containing protein YdcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027930.1 protein_id gnl|my_center|LOCUS_33950 10536 10201 gene locus_tag LOCUS_33960 10536 10201 CDS product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880582.1 protein_id gnl|my_center|LOCUS_33960 11740 10682 gene locus_tag LOCUS_33970 11740 10682 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200856.1 protein_id gnl|my_center|LOCUS_33970 >Feature sequence105 1716 373 gene locus_tag LOCUS_33980 1716 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 2670 1870 gene locus_tag LOCUS_33990 2670 1870 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702976.1 protein_id gnl|my_center|LOCUS_33990 3238 2681 gene locus_tag LOCUS_34000 gene hxlB 3238 2681 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_34000 3970 3263 gene locus_tag LOCUS_34010 gene rpe 3970 3263 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 protein_id gnl|my_center|LOCUS_34010 5230 4280 gene locus_tag LOCUS_34020 5230 4280 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529341.1 protein_id gnl|my_center|LOCUS_34020 6194 5283 gene locus_tag LOCUS_34030 6194 5283 CDS product inner-membrane translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529340.1 protein_id gnl|my_center|LOCUS_34030 7850 6303 gene locus_tag LOCUS_34040 7850 6303 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529339.1 protein_id gnl|my_center|LOCUS_34040 8661 7888 gene locus_tag LOCUS_34050 8661 7888 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086009.1 protein_id gnl|my_center|LOCUS_34050 9613 9185 gene locus_tag LOCUS_34060 9613 9185 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246714.1 protein_id gnl|my_center|LOCUS_34060 10213 10992 gene locus_tag LOCUS_34070 10213 10992 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281586.1 protein_id gnl|my_center|LOCUS_34070 11336 11249 gene locus_tag LOCUS_t00350 11336 11249 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12116 11583 gene locus_tag LOCUS_34080 gene msrA 12116 11583 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 protein_id gnl|my_center|LOCUS_34080 >Feature sequence106 1112 204 gene locus_tag LOCUS_34090 1112 204 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084035.1 protein_id gnl|my_center|LOCUS_34090 2218 1550 gene locus_tag LOCUS_34100 2218 1550 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391478.1 protein_id gnl|my_center|LOCUS_34100 2355 3053 gene locus_tag LOCUS_34110 2355 3053 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811063.1 protein_id gnl|my_center|LOCUS_34110 3086 4462 gene locus_tag LOCUS_34120 3086 4462 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063875.1 protein_id gnl|my_center|LOCUS_34120 4515 5168 gene locus_tag LOCUS_34130 4515 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665896.1 protein_id gnl|my_center|LOCUS_34130 5165 6493 gene locus_tag LOCUS_34140 5165 6493 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227747.1 protein_id gnl|my_center|LOCUS_34140 7276 6917 gene locus_tag LOCUS_34150 7276 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 7367 8353 gene locus_tag LOCUS_34160 7367 8353 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 protein_id gnl|my_center|LOCUS_34160 8442 8822 gene locus_tag LOCUS_34170 8442 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 9343 9017 gene locus_tag LOCUS_34180 9343 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 9770 10252 gene locus_tag LOCUS_34190 gene tssD 9770 10252 CDS product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138096472.1 protein_id gnl|my_center|LOCUS_34190 10264 10713 gene locus_tag LOCUS_34200 10264 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135321903.1 protein_id gnl|my_center|LOCUS_34200 10713 11045 gene locus_tag LOCUS_34210 10713 11045 CDS product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023898555.1 protein_id gnl|my_center|LOCUS_34210 11490 11356 gene locus_tag LOCUS_34220 11490 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 11750 12097 gene locus_tag LOCUS_34230 11750 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence107 485 1525 gene locus_tag LOCUS_34240 485 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 1522 4902 gene locus_tag LOCUS_34250 1522 4902 CDS product ImcF-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832729.1 protein_id gnl|my_center|LOCUS_34250 4899 6482 gene locus_tag LOCUS_34260 gene tssA 4899 6482 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211937.1 protein_id gnl|my_center|LOCUS_34260 6592 8355 gene locus_tag LOCUS_34270 gene tssF 6592 8355 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155110255.1 protein_id gnl|my_center|LOCUS_34270 8310 9413 gene locus_tag LOCUS_34280 gene tssG 8310 9413 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373315.1 protein_id gnl|my_center|LOCUS_34280 9394 9933 gene locus_tag LOCUS_34290 gene tssJ 9394 9933 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074160625.1 protein_id gnl|my_center|LOCUS_34290 9937 10374 gene locus_tag LOCUS_34300 gene tssE 9937 10374 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211943.1 protein_id gnl|my_center|LOCUS_34300 10387 11769 gene locus_tag LOCUS_34310 10387 11769 CDS product type VI secretion system ImpA and VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211944.1 protein_id gnl|my_center|LOCUS_34310 >Feature sequence108 429 1121 gene locus_tag LOCUS_34320 429 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165356698.1 protein_id gnl|my_center|LOCUS_34320 1420 1698 gene locus_tag LOCUS_34330 1420 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 3095 1701 gene locus_tag LOCUS_34340 3095 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 3418 3173 gene locus_tag LOCUS_34350 3418 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 3924 3589 gene locus_tag LOCUS_34360 3924 3589 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242740.1 protein_id gnl|my_center|LOCUS_34360 4560 3982 gene locus_tag LOCUS_34370 4560 3982 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314627.1 protein_id gnl|my_center|LOCUS_34370 5410 4640 gene locus_tag LOCUS_34380 5410 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34380 5835 6107 gene locus_tag LOCUS_34390 5835 6107 CDS product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179111.1 protein_id gnl|my_center|LOCUS_34390 6207 6644 gene locus_tag LOCUS_34400 6207 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34400 7744 6650 gene locus_tag LOCUS_34410 7744 6650 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704680.1 protein_id gnl|my_center|LOCUS_34410 8187 10388 gene locus_tag LOCUS_34420 gene fhuE 8187 10388 CDS product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097112.1 protein_id gnl|my_center|LOCUS_34420 10736 11035 gene locus_tag LOCUS_34430 10736 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 11155 11322 gene locus_tag LOCUS_34440 11155 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 >Feature sequence109 224 706 gene locus_tag LOCUS_34450 224 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34450 1830 922 gene locus_tag LOCUS_34460 1830 922 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388594.1 protein_id gnl|my_center|LOCUS_34460 2903 5659 gene locus_tag LOCUS_34470 2903 5659 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969653.1 protein_id gnl|my_center|LOCUS_34470 5738 6529 gene locus_tag LOCUS_34480 5738 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 6755 8563 gene locus_tag LOCUS_34490 6755 8563 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_34490 8560 9909 gene locus_tag LOCUS_34500 8560 9909 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_34500 9910 11319 gene locus_tag LOCUS_34510 9910 11319 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767364.1 protein_id gnl|my_center|LOCUS_34510 >Feature sequence110 64 140 gene locus_tag LOCUS_t00360 64 140 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 149 224 gene locus_tag LOCUS_t00370 149 224 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1139 297 gene locus_tag LOCUS_34520 gene hdfR 1139 297 CDS product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176097.1 protein_id gnl|my_center|LOCUS_34520 1261 1599 gene locus_tag LOCUS_34530 1261 1599 CDS product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099290.1 protein_id gnl|my_center|LOCUS_34530 3145 1625 gene locus_tag LOCUS_34540 3145 1625 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058957.1 protein_id gnl|my_center|LOCUS_34540 3720 5366 gene locus_tag LOCUS_34550 gene ilvG 3720 5366 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815319.1 protein_id gnl|my_center|LOCUS_34550 5363 5620 gene locus_tag LOCUS_34560 gene ilvM 5363 5620 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176090.1 protein_id gnl|my_center|LOCUS_34560 5639 6568 gene locus_tag LOCUS_34570 gene ilvE 5639 6568 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099287.1 protein_id gnl|my_center|LOCUS_34570 6634 8484 gene locus_tag LOCUS_34580 gene ilvD 6634 8484 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127411.1 protein_id gnl|my_center|LOCUS_34580 8490 10037 gene locus_tag LOCUS_34590 gene ilvA 8490 10037 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176085.1 protein_id gnl|my_center|LOCUS_34590 10919 10038 gene locus_tag LOCUS_34600 gene ilvY 10919 10038 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176081.1 protein_id gnl|my_center|LOCUS_34600 >Feature sequence111 565 125 gene locus_tag LOCUS_34610 565 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34610 886 566 gene locus_tag LOCUS_34620 886 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 1677 1030 gene locus_tag LOCUS_34630 1677 1030 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530097.1 protein_id gnl|my_center|LOCUS_34630 1831 2499 gene locus_tag LOCUS_34640 1831 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 4001 2631 gene locus_tag LOCUS_34650 4001 2631 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094825.1 protein_id gnl|my_center|LOCUS_34650 7124 4005 gene locus_tag LOCUS_34660 gene eefB 7124 4005 CDS product multidrug efflux RND transporter permease subunit EefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703857.1 protein_id gnl|my_center|LOCUS_34660 8257 7124 gene locus_tag LOCUS_34670 8257 7124 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873803.1 protein_id gnl|my_center|LOCUS_34670 9702 8368 gene locus_tag LOCUS_34680 9702 8368 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211654.1 protein_id gnl|my_center|LOCUS_34680 >Feature sequence112 1505 831 gene locus_tag LOCUS_34690 1505 831 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703481.1 protein_id gnl|my_center|LOCUS_34690 1942 1502 gene locus_tag LOCUS_34700 1942 1502 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096732.1 protein_id gnl|my_center|LOCUS_34700 3615 2197 gene locus_tag LOCUS_34710 3615 2197 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703476.1 protein_id gnl|my_center|LOCUS_34710 5329 4052 gene locus_tag LOCUS_34720 5329 4052 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703482.1 protein_id gnl|my_center|LOCUS_34720 5813 6886 gene locus_tag LOCUS_34730 gene aroF 5813 6886 CDS product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 protein_id gnl|my_center|LOCUS_34730 6895 8019 gene locus_tag LOCUS_34740 gene tyrA 6895 8019 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098342.1 protein_id gnl|my_center|LOCUS_34740 9242 8082 gene locus_tag LOCUS_34750 gene pheA 9242 8082 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098340.1 protein_id gnl|my_center|LOCUS_34750 9825 9490 gene locus_tag LOCUS_34760 gene raiA 9825 9490 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178456.1 protein_id gnl|my_center|LOCUS_34760 10032 10256 gene locus_tag LOCUS_34770 10032 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167337863.1 protein_id gnl|my_center|LOCUS_34770 >Feature sequence113 885 810 gene locus_tag LOCUS_t00380 885 810 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1574 996 gene locus_tag LOCUS_34780 1574 996 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704143.1 protein_id gnl|my_center|LOCUS_34780 3359 1650 gene locus_tag LOCUS_34790 3359 1650 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068881.1 protein_id gnl|my_center|LOCUS_34790 3658 3335 gene locus_tag LOCUS_34800 gene cutA 3658 3335 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704145.1 protein_id gnl|my_center|LOCUS_34800 5092 3791 gene locus_tag LOCUS_34810 5092 3791 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 protein_id gnl|my_center|LOCUS_34810 6647 5211 gene locus_tag LOCUS_34820 gene aspA 6647 5211 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368668.1 protein_id gnl|my_center|LOCUS_34820 7030 7494 gene locus_tag LOCUS_34830 gene fxsA 7030 7494 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368667.1 protein_id gnl|my_center|LOCUS_34830 7719 8012 gene locus_tag LOCUS_34840 7719 8012 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209127.1 protein_id gnl|my_center|LOCUS_34840 8059 9714 gene locus_tag LOCUS_34850 gene groL 8059 9714 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729117.1 protein_id gnl|my_center|LOCUS_34850 9892 10251 gene locus_tag LOCUS_34860 9892 10251 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209129.1 protein_id gnl|my_center|LOCUS_34860 >Feature sequence114 487 963 gene locus_tag LOCUS_34870 487 963 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097504.1 protein_id gnl|my_center|LOCUS_34870 2040 1027 gene locus_tag LOCUS_34880 gene pgl 2040 1027 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097511.1 protein_id gnl|my_center|LOCUS_34880 2197 3015 gene locus_tag LOCUS_34890 2197 3015 CDS product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816800.1 protein_id gnl|my_center|LOCUS_34890 4075 3017 gene locus_tag LOCUS_34900 gene modC 4075 3017 CDS product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891683.1 protein_id gnl|my_center|LOCUS_34900 4769 4080 gene locus_tag LOCUS_34910 gene modB 4769 4080 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367643.1 protein_id gnl|my_center|LOCUS_34910 5539 4766 gene locus_tag LOCUS_34920 gene modA 5539 4766 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210756.1 protein_id gnl|my_center|LOCUS_34920 5820 5665 gene locus_tag LOCUS_34930 5820 5665 CDS product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045380498.1 protein_id gnl|my_center|LOCUS_34930 6094 6876 gene locus_tag LOCUS_34940 gene modE 6094 6876 CDS product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168058.1 protein_id gnl|my_center|LOCUS_34940 6951 8423 gene locus_tag LOCUS_34950 gene modF 6951 8423 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096859.1 protein_id gnl|my_center|LOCUS_34950 8551 9126 gene locus_tag LOCUS_34960 8551 9126 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190894.1 protein_id gnl|my_center|LOCUS_34960 9253 9462 gene locus_tag LOCUS_34970 9253 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 9453 10205 gene locus_tag LOCUS_34980 gene gpmA 9453 10205 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367652.1 protein_id gnl|my_center|LOCUS_34980 >Feature sequence115 1098 382 gene locus_tag LOCUS_34990 1098 382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158946.1 protein_id gnl|my_center|LOCUS_34990 2021 4042 gene locus_tag LOCUS_35000 gene uvrB 2021 4042 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704798.1 protein_id gnl|my_center|LOCUS_35000 4979 4074 gene locus_tag LOCUS_35010 gene yvcK 4979 4074 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097495.1 protein_id gnl|my_center|LOCUS_35010 5313 6371 gene locus_tag LOCUS_35020 gene moaA 5313 6371 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704804.1 protein_id gnl|my_center|LOCUS_35020 6389 6904 gene locus_tag LOCUS_35030 gene moaB 6389 6904 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097493.1 protein_id gnl|my_center|LOCUS_35030 6906 7391 gene locus_tag LOCUS_35040 gene moaC 6906 7391 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080901.1 protein_id gnl|my_center|LOCUS_35040 7384 7629 gene locus_tag LOCUS_35050 gene moaD 7384 7629 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598624.1 protein_id gnl|my_center|LOCUS_35050 7631 8110 gene locus_tag LOCUS_35060 gene moaE 7631 8110 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210774.1 protein_id gnl|my_center|LOCUS_35060 8176 9270 gene locus_tag LOCUS_35070 8176 9270 CDS product DUF1615 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166493634.1 protein_id gnl|my_center|LOCUS_35070 9412 10122 gene locus_tag LOCUS_35080 9412 10122 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 protein_id gnl|my_center|LOCUS_35080 >Feature sequence116 3026 813 gene locus_tag LOCUS_35090 gene katG 3026 813 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209433.1 protein_id gnl|my_center|LOCUS_35090 3623 3387 gene locus_tag LOCUS_35100 3623 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 4805 4410 gene locus_tag LOCUS_35110 4805 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 5491 6201 gene locus_tag LOCUS_35120 5491 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 6194 6847 gene locus_tag LOCUS_35130 6194 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 8563 7115 gene locus_tag LOCUS_35140 8563 7115 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388869.1 protein_id gnl|my_center|LOCUS_35140 8662 9453 gene locus_tag LOCUS_35150 8662 9453 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388870.1 protein_id gnl|my_center|LOCUS_35150 >Feature sequence117 809 84 gene locus_tag LOCUS_35160 809 84 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097581.1 protein_id gnl|my_center|LOCUS_35160 1490 810 gene locus_tag LOCUS_35170 gene gltK 1490 810 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272809.1 protein_id gnl|my_center|LOCUS_35170 2227 1487 gene locus_tag LOCUS_35180 2227 1487 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097579.1 protein_id gnl|my_center|LOCUS_35180 3446 2550 gene locus_tag LOCUS_35190 3446 2550 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367719.1 protein_id gnl|my_center|LOCUS_35190 5433 3865 gene locus_tag LOCUS_35200 gene lnt 5433 3865 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853033.1 protein_id gnl|my_center|LOCUS_35200 6304 5426 gene locus_tag LOCUS_35210 gene corC 6304 5426 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158416.1 protein_id gnl|my_center|LOCUS_35210 6859 6383 gene locus_tag LOCUS_35220 gene ybeY 6859 6383 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084477.1 protein_id gnl|my_center|LOCUS_35220 7914 6856 gene locus_tag LOCUS_35230 7914 6856 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367714.1 protein_id gnl|my_center|LOCUS_35230 <9655 8201 gene locus_tag LOCUS_35240 <9655 8201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001519200.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence118 419 1123 gene locus_tag LOCUS_35250 gene sfsA 419 1123 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228221.1 protein_id gnl|my_center|LOCUS_35250 1348 1803 gene locus_tag LOCUS_35260 gene dksA 1348 1803 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095632.1 protein_id gnl|my_center|LOCUS_35260 1876 2784 gene locus_tag LOCUS_35270 gene gluQRS 1876 2784 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937419.1 protein_id gnl|my_center|LOCUS_35270 2930 4264 gene locus_tag LOCUS_35280 gene pcnB 2930 4264 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026612395.1 protein_id gnl|my_center|LOCUS_35280 4261 4740 gene locus_tag LOCUS_35290 gene folK 4261 4740 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215130.1 protein_id gnl|my_center|LOCUS_35290 4839 5633 gene locus_tag LOCUS_35300 gene panB 4839 5633 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368198.1 protein_id gnl|my_center|LOCUS_35300 5649 6503 gene locus_tag LOCUS_35310 gene panC 5649 6503 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368199.1 protein_id gnl|my_center|LOCUS_35310 6572 6952 gene locus_tag LOCUS_35320 gene panD 6572 6952 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156780.1 protein_id gnl|my_center|LOCUS_35320 8765 7020 gene locus_tag LOCUS_35330 8765 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 >Feature sequence119 1205 186 gene locus_tag LOCUS_35340 gene csy3 1205 186 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_35340 2164 1223 gene locus_tag LOCUS_35350 gene csy2 2164 1223 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_35350 3486 2161 gene locus_tag LOCUS_35360 gene csy1 3486 2161 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222491.1 protein_id gnl|my_center|LOCUS_35360 7208 3927 gene locus_tag LOCUS_35370 gene cas3f 7208 3927 CDS product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_35370 8185 7205 gene locus_tag LOCUS_35380 gene cas1f 8185 7205 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_35380 8663 >8978 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgcacaggcagcttagaag >Feature sequence120 181 513 gene locus_tag LOCUS_35390 181 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35390 540 1100 gene locus_tag LOCUS_35400 540 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35400 2466 1171 gene locus_tag LOCUS_35410 gene shiA 2466 1171 CDS product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706015.1 protein_id gnl|my_center|LOCUS_35410 3161 3355 gene locus_tag LOCUS_35420 3161 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 3753 3571 gene locus_tag LOCUS_35430 3753 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 4074 3841 gene locus_tag LOCUS_35440 4074 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004132711.1 protein_id gnl|my_center|LOCUS_35440 4396 4632 gene locus_tag LOCUS_35450 4396 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 5268 4789 gene locus_tag LOCUS_35460 5268 4789 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050863361.1 protein_id gnl|my_center|LOCUS_35460 6111 6572 gene locus_tag LOCUS_35470 6111 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 7518 8489 gene locus_tag LOCUS_35480 gene hrpS 7518 8489 CDS product transcriptional regulator HrpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763906.1 protein_id gnl|my_center|LOCUS_35480 8588 8884 gene locus_tag LOCUS_35490 8588 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence121 122 46 gene locus_tag LOCUS_t00390 122 46 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 266 180 gene locus_tag LOCUS_t00400 266 180 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 662 324 gene locus_tag LOCUS_35500 gene secG 662 324 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 protein_id gnl|my_center|LOCUS_35500 2384 1050 gene locus_tag LOCUS_35510 gene glmM 2384 1050 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210189.1 protein_id gnl|my_center|LOCUS_35510 3225 2392 gene locus_tag LOCUS_35520 gene folP 3225 2392 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764731.1 protein_id gnl|my_center|LOCUS_35520 5261 3321 gene locus_tag LOCUS_35530 gene ftsH 5261 3321 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098921.1 protein_id gnl|my_center|LOCUS_35530 5938 5309 gene locus_tag LOCUS_35540 gene rlmE 5938 5309 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145971.1 protein_id gnl|my_center|LOCUS_35540 6064 6357 gene locus_tag LOCUS_35550 gene yhbY 6064 6357 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 protein_id gnl|my_center|LOCUS_35550 6943 6467 gene locus_tag LOCUS_35560 gene greA 6943 6467 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128178593.1 protein_id gnl|my_center|LOCUS_35560 7122 8627 gene locus_tag LOCUS_35570 gene dacB 7122 8627 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217314.1 protein_id gnl|my_center|LOCUS_35570 8814 8635 gene locus_tag LOCUS_35580 8814 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 >Feature sequence122 277 567 gene locus_tag LOCUS_35590 277 567 CDS product DUF1364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002252.1 protein_id gnl|my_center|LOCUS_35590 564 926 gene locus_tag LOCUS_35600 564 926 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008115.1 protein_id gnl|my_center|LOCUS_35600 923 1690 gene locus_tag LOCUS_35610 923 1690 CDS product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705710.1 protein_id gnl|my_center|LOCUS_35610 2475 2155 gene locus_tag LOCUS_35620 2475 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208841.1 protein_id gnl|my_center|LOCUS_35620 3131 2502 gene locus_tag LOCUS_35630 3131 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 4671 3106 gene locus_tag LOCUS_35640 4671 3106 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109154434.1 protein_id gnl|my_center|LOCUS_35640 5177 4668 gene locus_tag LOCUS_35650 5177 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 5949 5371 gene locus_tag LOCUS_35660 5949 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 6072 6284 gene locus_tag LOCUS_35670 gene essD 6072 6284 CDS product phage lysis protein EssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359727.1 protein_id gnl|my_center|LOCUS_35670 6284 6769 gene locus_tag LOCUS_35680 gene rrrD 6284 6769 CDS product lysozyme RrrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075162.1 protein_id gnl|my_center|LOCUS_35680 6766 7248 gene locus_tag LOCUS_35690 6766 7248 CDS product lysis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098056.1 protein_id gnl|my_center|LOCUS_35690 7245 7514 gene locus_tag LOCUS_35700 7245 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 8017 8352 gene locus_tag LOCUS_35710 8017 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 >Feature sequence123 1131 160 gene locus_tag LOCUS_35720 1131 160 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170737.1 protein_id gnl|my_center|LOCUS_35720 2172 1138 gene locus_tag LOCUS_35730 gene plsX 2172 1138 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197594.1 protein_id gnl|my_center|LOCUS_35730 2369 2199 gene locus_tag LOCUS_35740 gene rpmF 2369 2199 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210931.1 protein_id gnl|my_center|LOCUS_35740 2909 2388 gene locus_tag LOCUS_35750 gene yceD 2909 2388 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174492.1 protein_id gnl|my_center|LOCUS_35750 3186 3773 gene locus_tag LOCUS_35760 3186 3773 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367195.1 protein_id gnl|my_center|LOCUS_35760 4794 3808 gene locus_tag LOCUS_35770 gene rluC 4794 3808 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846343.1 protein_id gnl|my_center|LOCUS_35770 5340 8294 gene locus_tag LOCUS_35780 gene rne 5340 8294 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705034.1 protein_id gnl|my_center|LOCUS_35780 >Feature sequence124 5692 4367 gene locus_tag LOCUS_35790 5692 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 7346 5697 gene locus_tag LOCUS_35800 7346 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence125 1127 525 gene locus_tag LOCUS_35810 gene tdk 1127 525 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705104.1 protein_id gnl|my_center|LOCUS_35810 1471 1878 gene locus_tag LOCUS_35820 gene hns 1471 1878 CDS product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169306.1 protein_id gnl|my_center|LOCUS_35820 3076 2063 gene locus_tag LOCUS_35830 3076 2063 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 protein_id gnl|my_center|LOCUS_35830 4431 3091 gene locus_tag LOCUS_35840 4431 3091 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210664.1 protein_id gnl|my_center|LOCUS_35840 5363 4455 gene locus_tag LOCUS_35850 gene galU 5363 4455 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 protein_id gnl|my_center|LOCUS_35850 6566 5553 gene locus_tag LOCUS_35860 gene rssB 6566 5553 CDS product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193447.1 protein_id gnl|my_center|LOCUS_35860 <7171 6667 gene locus_tag LOCUS_35870 <7171 6667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015367078.1:patatin-like phospholipase RssA >Feature sequence126 651 169 gene locus_tag LOCUS_35880 gene smpB 651 169 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 protein_id gnl|my_center|LOCUS_35880 811 1245 gene locus_tag LOCUS_35890 811 1245 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 protein_id gnl|my_center|LOCUS_35890 1238 1525 gene locus_tag LOCUS_35900 1238 1525 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848491.1 protein_id gnl|my_center|LOCUS_35900 1910 1563 gene locus_tag LOCUS_35910 gene bamE 1910 1563 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203437.1 protein_id gnl|my_center|LOCUS_35910 3763 2102 gene locus_tag LOCUS_35920 gene recN 3763 2102 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880931.1 protein_id gnl|my_center|LOCUS_35920 4728 3850 gene locus_tag LOCUS_35930 gene nadK 4728 3850 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059145.1 protein_id gnl|my_center|LOCUS_35930 4851 5432 gene locus_tag LOCUS_35940 gene grpE 4851 5432 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172778.1 protein_id gnl|my_center|LOCUS_35940 6035 5529 gene locus_tag LOCUS_35950 6035 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35950 6481 6864 gene locus_tag LOCUS_35960 gene grcA 6481 6864 CDS product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166327.1 protein_id gnl|my_center|LOCUS_35960 >Feature sequence127 <1 1263 gene locus_tag LOCUS_35970 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704374.1:LPS assembly protein LptD 1318 2613 gene locus_tag LOCUS_35980 gene surA 1318 2613 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800482.1 protein_id gnl|my_center|LOCUS_35980 2597 3595 gene locus_tag LOCUS_35990 gene pdxA 2597 3595 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241224.1 protein_id gnl|my_center|LOCUS_35990 3588 4412 gene locus_tag LOCUS_36000 gene rsmA 3588 4412 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065364.1 protein_id gnl|my_center|LOCUS_36000 4416 4793 gene locus_tag LOCUS_36010 gene apaG 4416 4793 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610901.1 protein_id gnl|my_center|LOCUS_36010 4861 5679 gene locus_tag LOCUS_36020 gene apaH 4861 5679 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257195.1 protein_id gnl|my_center|LOCUS_36020 6187 5717 gene locus_tag LOCUS_36030 gene folA 6187 5717 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005020907.1 protein_id gnl|my_center|LOCUS_36030 >Feature sequence128 1751 339 gene locus_tag LOCUS_36040 gene pykF 1751 339 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816382.1 protein_id gnl|my_center|LOCUS_36040 3474 2260 gene locus_tag LOCUS_36050 3474 2260 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651240.1 protein_id gnl|my_center|LOCUS_36050 3808 4809 gene locus_tag LOCUS_36060 3808 4809 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103771.1 protein_id gnl|my_center|LOCUS_36060 5013 5465 gene locus_tag LOCUS_36070 5013 5465 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090697.1 protein_id gnl|my_center|LOCUS_36070 5465 6160 gene locus_tag LOCUS_36080 5465 6160 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140539.1 protein_id gnl|my_center|LOCUS_36080 >Feature sequence129 1483 224 gene locus_tag LOCUS_36090 gene murA 1483 224 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369505.1 protein_id gnl|my_center|LOCUS_36090 1812 1558 gene locus_tag LOCUS_36100 gene ibaG 1812 1558 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900133.1 protein_id gnl|my_center|LOCUS_36100 2233 1931 gene locus_tag LOCUS_36110 gene mlaB 2233 1931 CDS product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210125.1 protein_id gnl|my_center|LOCUS_36110 2865 2233 gene locus_tag LOCUS_36120 gene mlaC 2865 2233 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369502.1 protein_id gnl|my_center|LOCUS_36120 3425 2877 gene locus_tag LOCUS_36130 gene mlaD 3425 2877 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817261.1 protein_id gnl|my_center|LOCUS_36130 4212 3430 gene locus_tag LOCUS_36140 gene mlaE 4212 3430 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436044.1 protein_id gnl|my_center|LOCUS_36140 5035 4217 gene locus_tag LOCUS_36150 gene mlaF 5035 4217 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032898349.1 protein_id gnl|my_center|LOCUS_36150 5265 6242 gene locus_tag LOCUS_36160 5265 6242 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162457.1 protein_id gnl|my_center|LOCUS_36160 >Feature sequence130 944 1498 gene locus_tag LOCUS_36170 944 1498 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045434.1 protein_id gnl|my_center|LOCUS_36170 1595 2281 gene locus_tag LOCUS_36180 1595 2281 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044775.1 protein_id gnl|my_center|LOCUS_36180 2350 4875 gene locus_tag LOCUS_36190 2350 4875 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136459.1 protein_id gnl|my_center|LOCUS_36190 4886 5977 gene locus_tag LOCUS_36200 4886 5977 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816992.1 protein_id gnl|my_center|LOCUS_36200 >Feature sequence131 1095 481 gene locus_tag LOCUS_36210 1095 481 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388662.1 protein_id gnl|my_center|LOCUS_36210 2295 1108 gene locus_tag LOCUS_36220 gene metK 2295 1108 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098658.1 protein_id gnl|my_center|LOCUS_36220 3479 2427 gene locus_tag LOCUS_36230 3479 2427 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388674.1 protein_id gnl|my_center|LOCUS_36230 4724 3495 gene locus_tag LOCUS_36240 4724 3495 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388673.1 protein_id gnl|my_center|LOCUS_36240 5780 5325 gene locus_tag LOCUS_36250 5780 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36250 6079 5807 gene locus_tag LOCUS_36260 6079 5807 CDS product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179111.1 protein_id gnl|my_center|LOCUS_36260 >Feature sequence132 2792 699 gene locus_tag LOCUS_36270 2792 699 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745768.1 protein_id gnl|my_center|LOCUS_36270 3532 2789 gene locus_tag LOCUS_36280 3532 2789 CDS product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038092.1 protein_id gnl|my_center|LOCUS_36280 4185 3529 gene locus_tag LOCUS_36290 gene gfcB 4185 3529 CDS product lipoprotein GfcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247610.1 protein_id gnl|my_center|LOCUS_36290 4475 4260 gene locus_tag LOCUS_36300 4475 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 5436 4741 gene locus_tag LOCUS_36310 5436 4741 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209740.1 protein_id gnl|my_center|LOCUS_36310 6109 5525 gene locus_tag LOCUS_36320 6109 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 >Feature sequence133 143 514 gene locus_tag LOCUS_36330 143 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 561 1319 gene locus_tag LOCUS_36340 gene sctJ 561 1319 CDS product type III secretion inner membrane ring lipoprotein SctJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763897.1 protein_id gnl|my_center|LOCUS_36340 1337 1951 gene locus_tag LOCUS_36350 1337 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763896.1 protein_id gnl|my_center|LOCUS_36350 1911 2534 gene locus_tag LOCUS_36360 gene sctL 1911 2534 CDS product type III secretion system stator protein SctL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266882.1 protein_id gnl|my_center|LOCUS_36360 2607 2840 gene locus_tag LOCUS_36370 2607 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 2950 4998 gene locus_tag LOCUS_36380 gene sctC 2950 4998 CDS product type III secretion system outer membrane ring subunit SctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244827.1 protein_id gnl|my_center|LOCUS_36380 5008 5190 gene locus_tag LOCUS_36390 5008 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence134 649 458 gene locus_tag LOCUS_36400 649 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 946 2271 gene locus_tag LOCUS_36410 946 2271 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099207.1 protein_id gnl|my_center|LOCUS_36410 2489 3442 gene locus_tag LOCUS_36420 2489 3442 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703756.1 protein_id gnl|my_center|LOCUS_36420 4979 3510 gene locus_tag LOCUS_36430 4979 3510 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817388.1 protein_id gnl|my_center|LOCUS_36430 <5929 5318 gene locus_tag LOCUS_36440 <5929 5318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369244.1:dicarboxylate/amino acid:cation symporter >Feature sequence135 135 485 gene locus_tag LOCUS_36450 135 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36450 1302 487 gene locus_tag LOCUS_36460 gene fepC 1302 487 CDS product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367776.1 protein_id gnl|my_center|LOCUS_36460 2291 1299 gene locus_tag LOCUS_36470 gene fepG 2291 1299 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480067.1 protein_id gnl|my_center|LOCUS_36470 3292 2288 gene locus_tag LOCUS_36480 gene fepD 3292 2288 CDS product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453810.1 protein_id gnl|my_center|LOCUS_36480 3404 4663 gene locus_tag LOCUS_36490 gene entS 3404 4663 CDS product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081657.1 protein_id gnl|my_center|LOCUS_36490 5635 4664 gene locus_tag LOCUS_36500 gene fepB 5635 4664 CDS product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234314.1 protein_id gnl|my_center|LOCUS_36500 >Feature sequence136 1115 621 gene locus_tag LOCUS_36510 1115 621 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208442.1 protein_id gnl|my_center|LOCUS_36510 1274 2782 gene locus_tag LOCUS_36520 1274 2782 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 protein_id gnl|my_center|LOCUS_36520 4209 2851 gene locus_tag LOCUS_36530 4209 2851 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097840.1 protein_id gnl|my_center|LOCUS_36530 4399 4199 gene locus_tag LOCUS_36540 4399 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 5635 4811 gene locus_tag LOCUS_36550 5635 4811 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754712.1 protein_id gnl|my_center|LOCUS_36550 >Feature sequence137 774 214 gene locus_tag LOCUS_36560 gene gmhB 774 214 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140178.1 protein_id gnl|my_center|LOCUS_36560 954 1985 gene locus_tag LOCUS_36570 gene metN 954 1985 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368136.1 protein_id gnl|my_center|LOCUS_36570 1978 2631 gene locus_tag LOCUS_36580 1978 2631 CDS product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 protein_id gnl|my_center|LOCUS_36580 2668 3483 gene locus_tag LOCUS_36590 gene metQ 2668 3483 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 protein_id gnl|my_center|LOCUS_36590 3741 4148 gene locus_tag LOCUS_36600 gene rcsF 3741 4148 CDS product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704458.1 protein_id gnl|my_center|LOCUS_36600 4145 4849 gene locus_tag LOCUS_36610 gene tsaA 4145 4849 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 protein_id gnl|my_center|LOCUS_36610 >Feature sequence138 175 363 gene locus_tag LOCUS_36620 175 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36620 789 971 gene locus_tag LOCUS_36630 789 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 1270 1917 gene locus_tag LOCUS_36640 1270 1917 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082696.1 protein_id gnl|my_center|LOCUS_36640 2899 3333 gene locus_tag LOCUS_36650 2899 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 4639 3533 gene locus_tag LOCUS_36660 4639 3533 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437089.1 protein_id gnl|my_center|LOCUS_36660 5249 4716 gene locus_tag LOCUS_36670 5249 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 >Feature sequence139 883 152 gene locus_tag LOCUS_36680 gene bamD 883 152 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209469.1 protein_id gnl|my_center|LOCUS_36680 1014 1994 gene locus_tag LOCUS_36690 gene rluD 1014 1994 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370269.1 protein_id gnl|my_center|LOCUS_36690 1991 2731 gene locus_tag LOCUS_36700 gene yfiH 1991 2731 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815687.1 protein_id gnl|my_center|LOCUS_36700 2856 5429 gene locus_tag LOCUS_36710 gene clpB 2856 5429 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098336.1 protein_id gnl|my_center|LOCUS_36710 >Feature sequence140 1380 526 gene locus_tag LOCUS_36720 1380 526 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208954.1 protein_id gnl|my_center|LOCUS_36720 1811 2050 gene locus_tag LOCUS_36730 gene zapB 1811 2050 CDS product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392238.1 protein_id gnl|my_center|LOCUS_36730 2599 2114 gene locus_tag LOCUS_36740 gene rraA 2599 2114 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099315.1 protein_id gnl|my_center|LOCUS_36740 3632 2706 gene locus_tag LOCUS_36750 gene menA 3632 2706 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305044.1 protein_id gnl|my_center|LOCUS_36750 4499 3831 gene locus_tag LOCUS_36760 4499 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 4523 5128 gene locus_tag LOCUS_36770 4523 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence141 778 1803 gene locus_tag LOCUS_36780 778 1803 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174361.1 protein_id gnl|my_center|LOCUS_36780 1870 3048 gene locus_tag LOCUS_36790 1870 3048 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019643.1 protein_id gnl|my_center|LOCUS_36790 3194 4165 gene locus_tag LOCUS_36800 3194 4165 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299298.1 protein_id gnl|my_center|LOCUS_36800 4208 4936 gene locus_tag LOCUS_36810 4208 4936 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172654773.1 protein_id gnl|my_center|LOCUS_36810 5289 5179 gene locus_tag LOCUS_r00010 5289 5179 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence142 <1 854 gene locus_tag LOCUS_36820 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005175870.1:glycerol kinase GlpK 955 1965 gene locus_tag LOCUS_36830 gene glpX 955 1965 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703815.1 protein_id gnl|my_center|LOCUS_36830 2220 2966 gene locus_tag LOCUS_36840 gene fpr 2220 2966 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796307.1 protein_id gnl|my_center|LOCUS_36840 3162 3770 gene locus_tag LOCUS_36850 3162 3770 CDS product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802217.1 protein_id gnl|my_center|LOCUS_36850 3892 4662 gene locus_tag LOCUS_36860 gene tpiA 3892 4662 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862019.1 protein_id gnl|my_center|LOCUS_36860 5273 4848 gene locus_tag LOCUS_36870 5273 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 >Feature sequence143 1512 226 gene locus_tag LOCUS_36880 gene bioA 1512 226 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704793.1 protein_id gnl|my_center|LOCUS_36880 1600 2631 gene locus_tag LOCUS_36890 gene bioB 1600 2631 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951218.1 protein_id gnl|my_center|LOCUS_36890 2628 3785 gene locus_tag LOCUS_36900 gene bioF 2628 3785 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168073.1 protein_id gnl|my_center|LOCUS_36900 3766 4521 gene locus_tag LOCUS_36910 gene bioC 3766 4521 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704796.1 protein_id gnl|my_center|LOCUS_36910 >Feature sequence144 1418 447 gene locus_tag LOCUS_36920 gene ispB 1418 447 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098929.1 protein_id gnl|my_center|LOCUS_36920 1676 1987 gene locus_tag LOCUS_36930 gene rplU 1676 1987 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210178.1 protein_id gnl|my_center|LOCUS_36930 2003 2260 gene locus_tag LOCUS_36940 gene rpmA 2003 2260 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 protein_id gnl|my_center|LOCUS_36940 2377 3342 gene locus_tag LOCUS_36950 2377 3342 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369509.1 protein_id gnl|my_center|LOCUS_36950 3359 4534 gene locus_tag LOCUS_36960 gene cgtA 3359 4534 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369510.1 protein_id gnl|my_center|LOCUS_36960 >Feature sequence145 1015 230 gene locus_tag LOCUS_36970 1015 230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040904057.1 protein_id gnl|my_center|LOCUS_36970 1256 1035 gene locus_tag LOCUS_36980 1256 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 2304 1267 gene locus_tag LOCUS_36990 2304 1267 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140538.1 protein_id gnl|my_center|LOCUS_36990 3641 2292 gene locus_tag LOCUS_37000 3641 2292 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140537.1 protein_id gnl|my_center|LOCUS_37000 <4759 3961 gene locus_tag LOCUS_37010 <4759 3961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086016636.1:IS3 family transposase >Feature sequence146 46 318 gene locus_tag LOCUS_37020 gene hupA 46 318 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044509.1 protein_id gnl|my_center|LOCUS_37020 616 1281 gene locus_tag LOCUS_37030 616 1281 CDS product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704017.1 protein_id gnl|my_center|LOCUS_37030 2643 1363 gene locus_tag LOCUS_37040 gene purD 2643 1363 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175672.1 protein_id gnl|my_center|LOCUS_37040 4252 2663 gene locus_tag LOCUS_37050 gene purH 4252 2663 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095020.1 protein_id gnl|my_center|LOCUS_37050 >Feature sequence147 502 101 gene locus_tag LOCUS_37060 502 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 1613 624 gene locus_tag LOCUS_37070 1613 624 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099326.1 protein_id gnl|my_center|LOCUS_37070 2726 1764 gene locus_tag LOCUS_37080 gene pfkA 2726 1764 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 protein_id gnl|my_center|LOCUS_37080 3959 3057 gene locus_tag LOCUS_37090 gene fieF 3959 3057 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368935.1 protein_id gnl|my_center|LOCUS_37090 4490 4215 gene locus_tag LOCUS_37100 4490 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 >Feature sequence148 1292 1107 gene locus_tag LOCUS_37110 1292 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 2229 1600 gene locus_tag LOCUS_37120 2229 1600 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_37120 2785 2384 gene locus_tag LOCUS_37130 2785 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175101.1 protein_id gnl|my_center|LOCUS_37130 3064 3954 gene locus_tag LOCUS_37140 3064 3954 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926200.1 protein_id gnl|my_center|LOCUS_37140 >Feature sequence149 2044 509 gene locus_tag LOCUS_37150 2044 509 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112615.1 protein_id gnl|my_center|LOCUS_37150 3233 2079 gene locus_tag LOCUS_37160 3233 2079 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 protein_id gnl|my_center|LOCUS_37160 3714 3259 gene locus_tag LOCUS_37170 3714 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 >Feature sequence150 2 754 gene locus_tag LOCUS_37180 2 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 782 1498 gene locus_tag LOCUS_37190 gene pnuC 782 1498 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367656.1 protein_id gnl|my_center|LOCUS_37190 2448 1501 gene locus_tag LOCUS_37200 gene zitB 2448 1501 CDS product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 protein_id gnl|my_center|LOCUS_37200 2956 4008 gene locus_tag LOCUS_37210 gene aroG 2956 4008 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109211.1 protein_id gnl|my_center|LOCUS_37210 >Feature sequence151 1363 230 gene locus_tag LOCUS_37220 1363 230 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_37220 1479 2396 gene locus_tag LOCUS_37230 1479 2396 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767818.1 protein_id gnl|my_center|LOCUS_37230 2524 2670 gene locus_tag LOCUS_37240 2524 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 3217 2924 gene locus_tag LOCUS_37250 3217 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence152 705 911 gene locus_tag LOCUS_37260 705 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 1279 1130 gene locus_tag LOCUS_37270 1279 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 1370 2806 gene locus_tag LOCUS_37280 1370 2806 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223883297.1 protein_id gnl|my_center|LOCUS_37280 >Feature sequence153 <1 1266 gene locus_tag LOCUS_37290 <1 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005168296.1:NAD-dependent malic enzyme 2061 1333 gene locus_tag LOCUS_37300 2061 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 <3133 2483 gene locus_tag LOCUS_37310 <3133 2483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097688.1:LacI family DNA-binding transcriptional regulator >Feature sequence154 1137 259 gene locus_tag LOCUS_37320 1137 259 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405623.1 protein_id gnl|my_center|LOCUS_37320 1236 1997 gene locus_tag LOCUS_37330 1236 1997 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368402.1 protein_id gnl|my_center|LOCUS_37330 2241 2906 gene locus_tag LOCUS_37340 2241 2906 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454937.1 protein_id gnl|my_center|LOCUS_37340 >Feature sequence155 >Feature sequence156 1383 421 gene locus_tag LOCUS_37350 gene birA 1383 421 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704003.1 protein_id gnl|my_center|LOCUS_37350 2417 1380 gene locus_tag LOCUS_37360 gene murB 2417 1380 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099225.1 protein_id gnl|my_center|LOCUS_37360