>Feature sequence001 1403 900 gene locus_tag LOCUS_00010 1403 900 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263336.1 protein_id gnl|my_center|LOCUS_00010 1555 2925 gene locus_tag LOCUS_00020 1555 2925 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_00020 3115 3960 gene locus_tag LOCUS_00030 gene lptB 3115 3960 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_00030 4039 5565 gene locus_tag LOCUS_00040 gene eptA 4039 5565 CDS product phosphoethanolamine--lipid A transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157542.1 protein_id gnl|my_center|LOCUS_00040 5922 5641 gene locus_tag LOCUS_00050 5922 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6234 7394 gene locus_tag LOCUS_00060 6234 7394 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_00060 7436 8791 gene locus_tag LOCUS_00070 gene rseP 7436 8791 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_00070 8884 10014 gene locus_tag LOCUS_00080 8884 10014 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_00080 10060 10641 gene locus_tag LOCUS_00090 10060 10641 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383606.1 protein_id gnl|my_center|LOCUS_00090 10645 11217 gene locus_tag LOCUS_00100 gene gmhB 10645 11217 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107287.1 protein_id gnl|my_center|LOCUS_00100 11248 11907 gene locus_tag LOCUS_00110 11248 11907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12007 13191 gene locus_tag LOCUS_00120 12007 13191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13202 14542 gene locus_tag LOCUS_00130 13202 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17378 14643 gene locus_tag LOCUS_00140 gene alaS 17378 14643 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_00140 17837 17505 gene locus_tag LOCUS_00150 17837 17505 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_00150 17908 18270 gene locus_tag LOCUS_00160 17908 18270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18361 19848 gene locus_tag LOCUS_00170 gene amyA 18361 19848 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245699.1 protein_id gnl|my_center|LOCUS_00170 19946 21037 gene locus_tag LOCUS_00180 19946 21037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21089 21865 gene locus_tag LOCUS_00190 21089 21865 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_00190 22234 21917 gene locus_tag LOCUS_00200 22234 21917 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_00200 23979 22534 gene locus_tag LOCUS_00210 23979 22534 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048092.1 protein_id gnl|my_center|LOCUS_00210 24055 25917 gene locus_tag LOCUS_00220 24055 25917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26074 26757 gene locus_tag LOCUS_00230 26074 26757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27906 26809 gene locus_tag LOCUS_00240 27906 26809 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072052.1 protein_id gnl|my_center|LOCUS_00240 28522 27917 gene locus_tag LOCUS_00250 gene nfsB 28522 27917 CDS product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021632.1 protein_id gnl|my_center|LOCUS_00250 28660 28959 gene locus_tag LOCUS_00260 28660 28959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30004 29030 gene locus_tag LOCUS_00270 30004 29030 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_00270 30431 30102 gene locus_tag LOCUS_00280 30431 30102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31135 30506 gene locus_tag LOCUS_00290 31135 30506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31199 31735 gene locus_tag LOCUS_00300 gene dcd 31199 31735 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_00300 31850 34699 gene locus_tag LOCUS_00310 31850 34699 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_00310 34761 37709 gene locus_tag LOCUS_00320 34761 37709 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_00320 38328 38059 gene locus_tag LOCUS_00330 gene rpmA 38328 38059 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_00330 38570 38382 gene locus_tag LOCUS_00340 38570 38382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 >Feature sequence002 <1 555 gene locus_tag LOCUS_00350 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405558.1:histidine kinase 736 1485 gene locus_tag LOCUS_00360 736 1485 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_00360 1681 2043 gene locus_tag LOCUS_00370 1681 2043 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_00370 2161 3525 gene locus_tag LOCUS_00380 2161 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 4188 3655 gene locus_tag LOCUS_00390 4188 3655 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_00390 4357 6846 gene locus_tag LOCUS_00400 4357 6846 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_00400 6928 7749 gene locus_tag LOCUS_00410 gene panB 6928 7749 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765576.1 protein_id gnl|my_center|LOCUS_00410 7961 8611 gene locus_tag LOCUS_00420 7961 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 10952 8757 gene locus_tag LOCUS_00430 gene katG 10952 8757 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_00430 11388 12323 gene locus_tag LOCUS_00440 11388 12323 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767372.1 protein_id gnl|my_center|LOCUS_00440 12361 13401 gene locus_tag LOCUS_00450 12361 13401 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767698.1 protein_id gnl|my_center|LOCUS_00450 13546 13475 gene locus_tag LOCUS_t00010 13546 13475 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13639 13568 gene locus_tag LOCUS_t00020 13639 13568 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13783 17019 gene locus_tag LOCUS_00460 gene recC 13783 17019 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693290.1 protein_id gnl|my_center|LOCUS_00460 17745 17032 gene locus_tag LOCUS_00470 17745 17032 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_00470 17867 20314 gene locus_tag LOCUS_00480 17867 20314 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_00480 20446 21420 gene locus_tag LOCUS_00490 20446 21420 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_00490 21499 22290 gene locus_tag LOCUS_00500 21499 22290 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_00500 22527 23414 gene locus_tag LOCUS_00510 22527 23414 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148287.1 protein_id gnl|my_center|LOCUS_00510 24455 23613 gene locus_tag LOCUS_00520 gene mgrA 24455 23613 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_00520 24698 25306 gene locus_tag LOCUS_00530 24698 25306 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_00530 25396 26277 gene locus_tag LOCUS_00540 25396 26277 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444152.1 protein_id gnl|my_center|LOCUS_00540 26307 27233 gene locus_tag LOCUS_00550 26307 27233 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037844.1 protein_id gnl|my_center|LOCUS_00550 27782 27300 gene locus_tag LOCUS_00560 27782 27300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 28057 27779 gene locus_tag LOCUS_00570 28057 27779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 28915 28169 gene locus_tag LOCUS_00580 28915 28169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 29170 29481 gene locus_tag LOCUS_00590 29170 29481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 29488 32031 gene locus_tag LOCUS_00600 29488 32031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 32056 33576 gene locus_tag LOCUS_00610 32056 33576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 36444 33859 gene locus_tag LOCUS_00620 36444 33859 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_00620 >Feature sequence003 465 782 gene locus_tag LOCUS_00630 465 782 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_00630 772 1140 gene locus_tag LOCUS_00640 772 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 1141 2445 gene locus_tag LOCUS_00650 1141 2445 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_00650 2438 2983 gene locus_tag LOCUS_00660 2438 2983 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 protein_id gnl|my_center|LOCUS_00660 3046 4572 gene locus_tag LOCUS_00670 3046 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 4579 4929 gene locus_tag LOCUS_00680 4579 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 5138 6178 gene locus_tag LOCUS_00690 gene mltG 5138 6178 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_00690 6200 7171 gene locus_tag LOCUS_00700 6200 7171 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_00700 7218 8234 gene locus_tag LOCUS_00710 7218 8234 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_00710 8289 9023 gene locus_tag LOCUS_00720 8289 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 9283 9819 gene locus_tag LOCUS_00730 9283 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 9867 10229 gene locus_tag LOCUS_00740 9867 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 11524 10343 gene locus_tag LOCUS_00750 11524 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 12983 11535 gene locus_tag LOCUS_00760 12983 11535 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_00760 16453 12995 gene locus_tag LOCUS_00770 16453 12995 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_00770 17662 16496 gene locus_tag LOCUS_00780 17662 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 18349 17747 gene locus_tag LOCUS_00790 18349 17747 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_00790 18978 18574 gene locus_tag LOCUS_00800 gene rplL 18978 18574 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_00800 19612 19082 gene locus_tag LOCUS_00810 gene rplJ 19612 19082 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_00810 20383 19688 gene locus_tag LOCUS_00820 gene rplA 20383 19688 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_00820 20857 20414 gene locus_tag LOCUS_00830 gene rplK 20857 20414 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_00830 21629 21003 gene locus_tag LOCUS_00840 21629 21003 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766588.1 protein_id gnl|my_center|LOCUS_00840 22230 21604 gene locus_tag LOCUS_00850 22230 21604 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_00850 23450 22476 gene locus_tag LOCUS_00860 23450 22476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 23678 24394 gene locus_tag LOCUS_00870 gene cutC 23678 24394 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211209.1 protein_id gnl|my_center|LOCUS_00870 24413 25255 gene locus_tag LOCUS_00880 24413 25255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 26550 25252 gene locus_tag LOCUS_00890 26550 25252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 26658 28223 gene locus_tag LOCUS_00900 gene gltX 26658 28223 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_00900 28915 29532 gene locus_tag LOCUS_00910 28915 29532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 29649 30359 gene locus_tag LOCUS_00920 29649 30359 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_00920 30590 31246 gene locus_tag LOCUS_00930 30590 31246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 31677 31318 gene locus_tag LOCUS_00940 31677 31318 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 protein_id gnl|my_center|LOCUS_00940 31787 32734 gene locus_tag LOCUS_00950 31787 32734 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_00950 32839 34002 gene locus_tag LOCUS_00960 32839 34002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 34986 34198 gene locus_tag LOCUS_00970 34986 34198 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_00970 >Feature sequence004 2249 1743 gene locus_tag LOCUS_00980 gene pyrR 2249 1743 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704375.1 protein_id gnl|my_center|LOCUS_00980 2439 3887 gene locus_tag LOCUS_00990 gene gatB 2439 3887 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_00990 4001 5389 gene locus_tag LOCUS_01000 4001 5389 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_01000 5530 5997 gene locus_tag LOCUS_01010 5530 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 6196 6588 gene locus_tag LOCUS_01020 6196 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 6722 8935 gene locus_tag LOCUS_01030 6722 8935 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_01030 8940 9704 gene locus_tag LOCUS_01040 8940 9704 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111108.1 protein_id gnl|my_center|LOCUS_01040 10003 11256 gene locus_tag LOCUS_01050 gene hemA 10003 11256 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_01050 11261 12220 gene locus_tag LOCUS_01060 gene hemC 11261 12220 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962224.1 protein_id gnl|my_center|LOCUS_01060 12204 12650 gene locus_tag LOCUS_01070 12204 12650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 12654 12902 gene locus_tag LOCUS_01080 12654 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01080 12956 14122 gene locus_tag LOCUS_01090 12956 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962429.1 protein_id gnl|my_center|LOCUS_01090 14139 15179 gene locus_tag LOCUS_01100 gene hemE 14139 15179 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962222.1 protein_id gnl|my_center|LOCUS_01100 15377 15733 gene locus_tag LOCUS_01110 15377 15733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 16641 15730 gene locus_tag LOCUS_01120 16641 15730 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767448.1 protein_id gnl|my_center|LOCUS_01120 16759 18111 gene locus_tag LOCUS_01130 16759 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 18127 20721 gene locus_tag LOCUS_01140 18127 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 20741 21721 gene locus_tag LOCUS_01150 20741 21721 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608770.1 protein_id gnl|my_center|LOCUS_01150 21866 23728 gene locus_tag LOCUS_01160 21866 23728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 23753 24382 gene locus_tag LOCUS_01170 23753 24382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 24985 24392 gene locus_tag LOCUS_01180 24985 24392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 26718 25030 gene locus_tag LOCUS_01190 26718 25030 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791194.1 protein_id gnl|my_center|LOCUS_01190 29869 26816 gene locus_tag LOCUS_01200 29869 26816 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_01200 31218 30151 gene locus_tag LOCUS_01210 gene prfA 31218 30151 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_01210 31413 32567 gene locus_tag LOCUS_01220 31413 32567 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_01220 32696 34399 gene locus_tag LOCUS_01230 32696 34399 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963883.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence005 905 1999 gene locus_tag LOCUS_01240 905 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 3336 2035 gene locus_tag LOCUS_01250 3336 2035 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555764.1 protein_id gnl|my_center|LOCUS_01250 4774 3389 gene locus_tag LOCUS_01260 4774 3389 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_01260 4830 5525 gene locus_tag LOCUS_01270 4830 5525 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_01270 6257 5628 gene locus_tag LOCUS_01280 6257 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 8636 6387 gene locus_tag LOCUS_01290 8636 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 9179 8778 gene locus_tag LOCUS_01300 9179 8778 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_01300 9263 11143 gene locus_tag LOCUS_01310 9263 11143 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086595297.1 protein_id gnl|my_center|LOCUS_01310 11144 11521 gene locus_tag LOCUS_01320 gene ctb 11144 11521 CDS product truncated hemoglobin Ctb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858471.1 protein_id gnl|my_center|LOCUS_01320 12426 11530 gene locus_tag LOCUS_01330 12426 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 12567 15425 gene locus_tag LOCUS_01340 gene uvrA 12567 15425 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813763.1 protein_id gnl|my_center|LOCUS_01340 15943 15599 gene locus_tag LOCUS_01350 15943 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088092.1 protein_id gnl|my_center|LOCUS_01350 16254 16829 gene locus_tag LOCUS_01360 gene def 16254 16829 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_01360 16970 17863 gene locus_tag LOCUS_01370 16970 17863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 19208 17931 gene locus_tag LOCUS_01380 19208 17931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 19527 20408 gene locus_tag LOCUS_01390 19527 20408 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_01390 21185 20415 gene locus_tag LOCUS_01400 21185 20415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 22551 21349 gene locus_tag LOCUS_01410 22551 21349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 23334 22573 gene locus_tag LOCUS_01420 gene rsmA 23334 22573 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_01420 24299 23433 gene locus_tag LOCUS_01430 24299 23433 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 protein_id gnl|my_center|LOCUS_01430 25410 24322 gene locus_tag LOCUS_01440 gene pdxA 25410 24322 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964471.1 protein_id gnl|my_center|LOCUS_01440 26911 25517 gene locus_tag LOCUS_01450 26911 25517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 30416 27120 gene locus_tag LOCUS_01460 gene infB 30416 27120 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_01460 31720 30470 gene locus_tag LOCUS_01470 gene nusA 31720 30470 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_01470 32237 31767 gene locus_tag LOCUS_01480 gene rimP 32237 31767 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962637.1 protein_id gnl|my_center|LOCUS_01480 >Feature sequence006 <1 898 gene locus_tag LOCUS_01490 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813169.1:AIR synthase-related protein 933 1865 gene locus_tag LOCUS_01500 933 1865 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107658.1 protein_id gnl|my_center|LOCUS_01500 1913 1986 gene locus_tag LOCUS_t00030 1913 1986 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3052 2264 gene locus_tag LOCUS_01510 3052 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 4401 3313 gene locus_tag LOCUS_01520 4401 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 4412 5278 gene locus_tag LOCUS_01530 4412 5278 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_01530 5391 6113 gene locus_tag LOCUS_01540 gene gldF 5391 6113 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_01540 6115 7872 gene locus_tag LOCUS_01550 gene gldG 6115 7872 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_01550 7936 8892 gene locus_tag LOCUS_01560 7936 8892 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941519.1 protein_id gnl|my_center|LOCUS_01560 10011 8917 gene locus_tag LOCUS_01570 10011 8917 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524106.1 protein_id gnl|my_center|LOCUS_01570 10836 10417 gene locus_tag LOCUS_01580 gene aroQ 10836 10417 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_01580 10989 11390 gene locus_tag LOCUS_01590 10989 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 12572 11466 gene locus_tag LOCUS_01600 gene carA 12572 11466 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_01600 13094 12726 gene locus_tag LOCUS_01610 13094 12726 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_01610 13697 13140 gene locus_tag LOCUS_01620 13697 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 13783 14814 gene locus_tag LOCUS_01630 13783 14814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 16092 15001 gene locus_tag LOCUS_01640 16092 15001 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_01640 17761 16229 gene locus_tag LOCUS_01650 17761 16229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 18050 18859 gene locus_tag LOCUS_01660 18050 18859 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_01660 19003 19317 gene locus_tag LOCUS_01670 19003 19317 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_01670 19385 19855 gene locus_tag LOCUS_01680 19385 19855 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_01680 19991 20407 gene locus_tag LOCUS_01690 19991 20407 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_01690 20621 21769 gene locus_tag LOCUS_01700 20621 21769 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_01700 22796 21924 gene locus_tag LOCUS_01710 22796 21924 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_01710 22889 23359 gene locus_tag LOCUS_01720 22889 23359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098264.1 protein_id gnl|my_center|LOCUS_01720 23857 23420 gene locus_tag LOCUS_01730 23857 23420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 24073 24684 gene locus_tag LOCUS_01740 24073 24684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 25279 24677 gene locus_tag LOCUS_01750 gene mtgA 25279 24677 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047091.1 protein_id gnl|my_center|LOCUS_01750 25471 26517 gene locus_tag LOCUS_01760 25471 26517 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_01760 26553 26996 gene locus_tag LOCUS_01770 26553 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 27036 27458 gene locus_tag LOCUS_01780 27036 27458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788103.1 protein_id gnl|my_center|LOCUS_01780 27461 28408 gene locus_tag LOCUS_01790 27461 28408 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947661.1 protein_id gnl|my_center|LOCUS_01790 29277 28444 gene locus_tag LOCUS_01800 gene lipA 29277 28444 CDS product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 protein_id gnl|my_center|LOCUS_01800 30070 29258 gene locus_tag LOCUS_01810 30070 29258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 31515 30064 gene locus_tag LOCUS_01820 31515 30064 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794953.1 protein_id gnl|my_center|LOCUS_01820 <32541 31609 gene locus_tag LOCUS_01830 <32541 31609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202552.1:TonB-dependent receptor >Feature sequence007 576 1391 gene locus_tag LOCUS_01840 576 1391 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_01840 1477 2253 gene locus_tag LOCUS_01850 1477 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 3567 2275 gene locus_tag LOCUS_01860 3567 2275 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_01860 4876 3560 gene locus_tag LOCUS_01870 4876 3560 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_01870 5435 4866 gene locus_tag LOCUS_01880 5435 4866 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_01880 7012 5483 gene locus_tag LOCUS_01890 gene lnt 7012 5483 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146786132.1 protein_id gnl|my_center|LOCUS_01890 8825 7227 gene locus_tag LOCUS_01900 8825 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 9292 9747 gene locus_tag LOCUS_01910 9292 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 9763 11478 gene locus_tag LOCUS_01920 9763 11478 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_01920 13481 11577 gene locus_tag LOCUS_01930 13481 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 14300 13485 gene locus_tag LOCUS_01940 14300 13485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 14466 14927 gene locus_tag LOCUS_01950 14466 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01950 14985 16274 gene locus_tag LOCUS_01960 14985 16274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01960 16443 16676 gene locus_tag LOCUS_01970 16443 16676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 16763 17392 gene locus_tag LOCUS_01980 16763 17392 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_01980 18262 17432 gene locus_tag LOCUS_01990 18262 17432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 19544 18387 gene locus_tag LOCUS_02000 19544 18387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 20648 19725 gene locus_tag LOCUS_02010 20648 19725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 20829 21290 gene locus_tag LOCUS_02020 20829 21290 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02020 21482 21691 gene locus_tag LOCUS_02030 21482 21691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 21850 22671 gene locus_tag LOCUS_02040 21850 22671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 22782 23756 gene locus_tag LOCUS_02050 22782 23756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433093.1 protein_id gnl|my_center|LOCUS_02050 23758 24282 gene locus_tag LOCUS_02060 23758 24282 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208164.1 protein_id gnl|my_center|LOCUS_02060 24352 24870 gene locus_tag LOCUS_02070 24352 24870 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_02070 24888 25529 gene locus_tag LOCUS_02080 gene yihA 24888 25529 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_02080 25961 25569 gene locus_tag LOCUS_02090 25961 25569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 28640 26202 gene locus_tag LOCUS_02100 gene ccsA 28640 26202 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_02100 29098 28685 gene locus_tag LOCUS_02110 29098 28685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 29690 29217 gene locus_tag LOCUS_02120 29690 29217 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence008 1432 860 gene locus_tag LOCUS_02130 1432 860 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962396.1 protein_id gnl|my_center|LOCUS_02130 1981 1448 gene locus_tag LOCUS_02140 1981 1448 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_02140 2802 1978 gene locus_tag LOCUS_02150 2802 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 2966 3682 gene locus_tag LOCUS_02160 2966 3682 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_02160 3776 4312 gene locus_tag LOCUS_02170 3776 4312 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_02170 4367 4768 gene locus_tag LOCUS_02180 4367 4768 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206564.1 protein_id gnl|my_center|LOCUS_02180 5442 4765 gene locus_tag LOCUS_02190 5442 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 6641 5496 gene locus_tag LOCUS_02200 6641 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 7292 6693 gene locus_tag LOCUS_02210 7292 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 7940 7302 gene locus_tag LOCUS_02220 7940 7302 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_02220 8506 7997 gene locus_tag LOCUS_02230 8506 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 9735 8506 gene locus_tag LOCUS_02240 9735 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 9780 10208 gene locus_tag LOCUS_02250 9780 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 10364 10564 gene locus_tag LOCUS_02260 10364 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 10761 10689 gene locus_tag LOCUS_t00040 10761 10689 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10898 11548 gene locus_tag LOCUS_02270 10898 11548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 11643 12467 gene locus_tag LOCUS_02280 11643 12467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 12657 14033 gene locus_tag LOCUS_02290 12657 14033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 14145 14762 gene locus_tag LOCUS_02300 gene recR 14145 14762 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_02300 16349 14772 gene locus_tag LOCUS_02310 16349 14772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 16646 16380 gene locus_tag LOCUS_02320 16646 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 17430 16813 gene locus_tag LOCUS_02330 17430 16813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 17474 17908 gene locus_tag LOCUS_02340 17474 17908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 18702 17905 gene locus_tag LOCUS_02350 18702 17905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02350 20018 18699 gene locus_tag LOCUS_02360 20018 18699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02360 20747 20115 gene locus_tag LOCUS_02370 20747 20115 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_02370 21451 20771 gene locus_tag LOCUS_02380 21451 20771 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461579.1 protein_id gnl|my_center|LOCUS_02380 22633 21509 gene locus_tag LOCUS_02390 22633 21509 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_02390 22772 23578 gene locus_tag LOCUS_02400 22772 23578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 23714 24415 gene locus_tag LOCUS_02410 23714 24415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 27446 24552 gene locus_tag LOCUS_02420 27446 24552 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_02420 27686 28885 gene locus_tag LOCUS_02430 27686 28885 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107986.1 protein_id gnl|my_center|LOCUS_02430 28866 29570 gene locus_tag LOCUS_02440 28866 29570 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_02440 >Feature sequence009 3035 1932 gene locus_tag LOCUS_02450 3035 1932 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_02450 3638 3459 gene locus_tag LOCUS_02460 3638 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 4839 3739 gene locus_tag LOCUS_02470 4839 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02470 5237 4836 gene locus_tag LOCUS_02480 5237 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02480 5696 5621 gene locus_tag LOCUS_t00050 5696 5621 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5907 7112 gene locus_tag LOCUS_02490 5907 7112 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_02490 7214 8233 gene locus_tag LOCUS_02500 gene tsaD 7214 8233 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_02500 8289 8828 gene locus_tag LOCUS_02510 8289 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 8940 9824 gene locus_tag LOCUS_02520 gene folD 8940 9824 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_02520 9898 10542 gene locus_tag LOCUS_02530 9898 10542 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_02530 10626 11522 gene locus_tag LOCUS_02540 10626 11522 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_02540 11653 12594 gene locus_tag LOCUS_02550 11653 12594 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529392.1 protein_id gnl|my_center|LOCUS_02550 13688 12687 gene locus_tag LOCUS_02560 gene nrdF 13688 12687 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203029.1 protein_id gnl|my_center|LOCUS_02560 13986 14777 gene locus_tag LOCUS_02570 13986 14777 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065081.1 protein_id gnl|my_center|LOCUS_02570 14836 15237 gene locus_tag LOCUS_02580 14836 15237 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727730.1 protein_id gnl|my_center|LOCUS_02580 15256 16059 gene locus_tag LOCUS_02590 15256 16059 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963150.1 protein_id gnl|my_center|LOCUS_02590 16187 16774 gene locus_tag LOCUS_02600 16187 16774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 18949 16847 gene locus_tag LOCUS_02610 gene nrdE 18949 16847 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215839.1 protein_id gnl|my_center|LOCUS_02610 19256 19062 gene locus_tag LOCUS_02620 19256 19062 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399328.1 protein_id gnl|my_center|LOCUS_02620 20323 19730 gene locus_tag LOCUS_02630 20323 19730 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_02630 20420 20752 gene locus_tag LOCUS_02640 20420 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 20923 23532 gene locus_tag LOCUS_02650 gene clpB 20923 23532 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963875.1 protein_id gnl|my_center|LOCUS_02650 23649 24983 gene locus_tag LOCUS_02660 23649 24983 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878613.1 protein_id gnl|my_center|LOCUS_02660 27669 25042 gene locus_tag LOCUS_02670 27669 25042 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_02670 28787 27741 gene locus_tag LOCUS_02680 28787 27741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 29346 28807 gene locus_tag LOCUS_02690 29346 28807 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767805.1 protein_id gnl|my_center|LOCUS_02690 29835 29422 gene locus_tag LOCUS_02700 29835 29422 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence010 2352 937 gene locus_tag LOCUS_02710 2352 937 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_02710 2741 2397 gene locus_tag LOCUS_02720 2741 2397 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_02720 3449 2763 gene locus_tag LOCUS_02730 gene tsaB 3449 2763 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_02730 3604 3987 gene locus_tag LOCUS_02740 3604 3987 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_02740 5593 4067 gene locus_tag LOCUS_02750 5593 4067 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083762.1 protein_id gnl|my_center|LOCUS_02750 6876 5707 gene locus_tag LOCUS_02760 6876 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 7127 7936 gene locus_tag LOCUS_02770 gene lpxA 7127 7936 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_02770 8061 8714 gene locus_tag LOCUS_02780 gene ccmA 8061 8714 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_02780 9580 8768 gene locus_tag LOCUS_02790 9580 8768 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964232.1 protein_id gnl|my_center|LOCUS_02790 10835 9843 gene locus_tag LOCUS_02800 10835 9843 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_02800 10964 12130 gene locus_tag LOCUS_02810 10964 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 12151 12579 gene locus_tag LOCUS_02820 12151 12579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 12678 13163 gene locus_tag LOCUS_02830 12678 13163 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582494.1 protein_id gnl|my_center|LOCUS_02830 13175 14248 gene locus_tag LOCUS_02840 13175 14248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 14304 15131 gene locus_tag LOCUS_02850 14304 15131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 15260 16996 gene locus_tag LOCUS_02860 15260 16996 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789735.1 protein_id gnl|my_center|LOCUS_02860 17315 18988 gene locus_tag LOCUS_02870 17315 18988 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203551.1 protein_id gnl|my_center|LOCUS_02870 19072 20343 gene locus_tag LOCUS_02880 19072 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 20469 20385 gene locus_tag LOCUS_t00060 20469 20385 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20576 21280 gene locus_tag LOCUS_02890 20576 21280 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_02890 21264 22604 gene locus_tag LOCUS_02900 21264 22604 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202771.1 protein_id gnl|my_center|LOCUS_02900 22724 23674 gene locus_tag LOCUS_02910 22724 23674 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768336.1 protein_id gnl|my_center|LOCUS_02910 24310 23771 gene locus_tag LOCUS_02920 24310 23771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 24896 24330 gene locus_tag LOCUS_02930 24896 24330 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789731.1 protein_id gnl|my_center|LOCUS_02930 25138 25419 gene locus_tag LOCUS_02940 25138 25419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 25511 26161 gene locus_tag LOCUS_02950 gene nth 25511 26161 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_02950 26444 26827 gene locus_tag LOCUS_02960 26444 26827 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_02960 27004 28677 gene locus_tag LOCUS_02970 27004 28677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 29579 28680 gene locus_tag LOCUS_02980 29579 28680 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803426.1 protein_id gnl|my_center|LOCUS_02980 >Feature sequence011 523 1797 gene locus_tag LOCUS_02990 523 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 5493 1861 gene locus_tag LOCUS_03000 5493 1861 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202282.1 protein_id gnl|my_center|LOCUS_03000 5935 6471 gene locus_tag LOCUS_03010 5935 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 6882 6553 gene locus_tag LOCUS_03020 6882 6553 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_03020 7762 7355 gene locus_tag LOCUS_03030 7762 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 8436 7789 gene locus_tag LOCUS_03040 8436 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 9318 8554 gene locus_tag LOCUS_03050 9318 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672055.1 protein_id gnl|my_center|LOCUS_03050 9745 9476 gene locus_tag LOCUS_03060 9745 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 10703 10233 gene locus_tag LOCUS_03070 10703 10233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 11817 11560 gene locus_tag LOCUS_03080 11817 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 12452 11877 gene locus_tag LOCUS_03090 12452 11877 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_03090 13456 12746 gene locus_tag LOCUS_03100 13456 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 13935 13714 gene locus_tag LOCUS_03110 13935 13714 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_03110 16072 14015 gene locus_tag LOCUS_03120 gene uvrB 16072 14015 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963054.1 protein_id gnl|my_center|LOCUS_03120 16519 17241 gene locus_tag LOCUS_03130 16519 17241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 17321 17821 gene locus_tag LOCUS_03140 17321 17821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 17873 19036 gene locus_tag LOCUS_03150 17873 19036 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_03150 20247 19144 gene locus_tag LOCUS_03160 20247 19144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 22328 20391 gene locus_tag LOCUS_03170 gene dxs 22328 20391 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_03170 22375 22683 gene locus_tag LOCUS_03180 22375 22683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 23351 22725 gene locus_tag LOCUS_03190 23351 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 24667 23585 gene locus_tag LOCUS_03200 24667 23585 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_03200 25171 24842 gene locus_tag LOCUS_03210 25171 24842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 25382 25948 gene locus_tag LOCUS_03220 gene efp 25382 25948 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_03220 26041 26520 gene locus_tag LOCUS_03230 gene accB 26041 26520 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_03230 26610 27953 gene locus_tag LOCUS_03240 gene accC 26610 27953 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence012 1009 446 gene locus_tag LOCUS_03250 1009 446 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293714.1 protein_id gnl|my_center|LOCUS_03250 1229 1960 gene locus_tag LOCUS_03260 1229 1960 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_03260 2425 2039 gene locus_tag LOCUS_03270 2425 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 3971 2562 gene locus_tag LOCUS_03280 3971 2562 CDS product DUF4972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108860.1 protein_id gnl|my_center|LOCUS_03280 5135 4047 gene locus_tag LOCUS_03290 5135 4047 CDS product DUF4972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767172.1 protein_id gnl|my_center|LOCUS_03290 6474 5194 gene locus_tag LOCUS_03300 6474 5194 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108858.1 protein_id gnl|my_center|LOCUS_03300 8420 6486 gene locus_tag LOCUS_03310 8420 6486 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767174.1 protein_id gnl|my_center|LOCUS_03310 11886 8431 gene locus_tag LOCUS_03320 11886 8431 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048699137.1 protein_id gnl|my_center|LOCUS_03320 13116 12025 gene locus_tag LOCUS_03330 13116 12025 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_03330 13723 13094 gene locus_tag LOCUS_03340 13723 13094 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_03340 14351 15379 gene locus_tag LOCUS_03350 14351 15379 CDS product IS630-like element ISMsm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727030.1 protein_id gnl|my_center|LOCUS_03350 16226 15387 gene locus_tag LOCUS_03360 16226 15387 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966735.1 protein_id gnl|my_center|LOCUS_03360 16637 16230 gene locus_tag LOCUS_03370 16637 16230 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_03370 17151 16717 gene locus_tag LOCUS_03380 17151 16717 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_03380 17409 18083 gene locus_tag LOCUS_03390 17409 18083 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_03390 18093 19367 gene locus_tag LOCUS_03400 18093 19367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 19398 19880 gene locus_tag LOCUS_03410 19398 19880 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905907.1 protein_id gnl|my_center|LOCUS_03410 19964 20524 gene locus_tag LOCUS_03420 19964 20524 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_03420 20517 21281 gene locus_tag LOCUS_03430 20517 21281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 21292 23019 gene locus_tag LOCUS_03440 21292 23019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 23971 23075 gene locus_tag LOCUS_03450 23971 23075 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_03450 25320 23971 gene locus_tag LOCUS_03460 gene tilS 25320 23971 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_03460 27060 25390 gene locus_tag LOCUS_03470 27060 25390 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964580.1 protein_id gnl|my_center|LOCUS_03470 >Feature sequence013 1284 211 gene locus_tag LOCUS_03480 1284 211 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699793.1 protein_id gnl|my_center|LOCUS_03480 2712 1360 gene locus_tag LOCUS_03490 2712 1360 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_03490 3715 2777 gene locus_tag LOCUS_03500 3715 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 4408 3722 gene locus_tag LOCUS_03510 4408 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 4828 4418 gene locus_tag LOCUS_03520 4828 4418 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_03520 5806 4886 gene locus_tag LOCUS_03530 5806 4886 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963182.1 protein_id gnl|my_center|LOCUS_03530 7423 5924 gene locus_tag LOCUS_03540 gene pyk 7423 5924 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_03540 8470 7487 gene locus_tag LOCUS_03550 gene pfkA 8470 7487 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963726.1 protein_id gnl|my_center|LOCUS_03550 10292 8808 gene locus_tag LOCUS_03560 10292 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 10692 10315 gene locus_tag LOCUS_03570 10692 10315 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813773.1 protein_id gnl|my_center|LOCUS_03570 12336 10792 gene locus_tag LOCUS_03580 12336 10792 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_03580 13013 12552 gene locus_tag LOCUS_03590 13013 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 13968 13096 gene locus_tag LOCUS_03600 13968 13096 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092195.1 protein_id gnl|my_center|LOCUS_03600 14055 14582 gene locus_tag LOCUS_03610 14055 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 17057 14925 gene locus_tag LOCUS_03620 17057 14925 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_03620 17253 19301 gene locus_tag LOCUS_03630 17253 19301 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_03630 19367 21760 gene locus_tag LOCUS_03640 19367 21760 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_03640 23130 21868 gene locus_tag LOCUS_03650 23130 21868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 25572 23188 gene locus_tag LOCUS_03660 25572 23188 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108117.1 protein_id gnl|my_center|LOCUS_03660 25819 26844 gene locus_tag LOCUS_03670 25819 26844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 >Feature sequence014 1178 57 gene locus_tag LOCUS_03680 1178 57 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_03680 2703 1189 gene locus_tag LOCUS_03690 2703 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 3972 2722 gene locus_tag LOCUS_03700 3972 2722 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070750838.1 protein_id gnl|my_center|LOCUS_03700 8215 4124 gene locus_tag LOCUS_03710 8215 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 9486 8341 gene locus_tag LOCUS_03720 9486 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 10153 9539 gene locus_tag LOCUS_03730 10153 9539 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_03730 12966 10510 gene locus_tag LOCUS_03740 12966 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 14848 13577 gene locus_tag LOCUS_03750 gene tyrS 14848 13577 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762838.1 protein_id gnl|my_center|LOCUS_03750 15037 16113 gene locus_tag LOCUS_03760 15037 16113 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_03760 16144 21288 gene locus_tag LOCUS_03770 16144 21288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 21298 21675 gene locus_tag LOCUS_03780 21298 21675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 22213 21677 gene locus_tag LOCUS_03790 22213 21677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 22782 22372 gene locus_tag LOCUS_03800 22782 22372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 24607 23240 gene locus_tag LOCUS_03810 24607 23240 CDS product DUF4302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767466.1 protein_id gnl|my_center|LOCUS_03810 26010 24616 gene locus_tag LOCUS_03820 26010 24616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence015 1592 807 gene locus_tag LOCUS_03830 1592 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 3157 2159 gene locus_tag LOCUS_03840 3157 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4141 3182 gene locus_tag LOCUS_03850 4141 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 5218 4241 gene locus_tag LOCUS_03860 5218 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 6175 5231 gene locus_tag LOCUS_03870 6175 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 7154 6168 gene locus_tag LOCUS_03880 7154 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 8084 7182 gene locus_tag LOCUS_03890 8084 7182 CDS product capsular polysaccharide synthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196337679.1 protein_id gnl|my_center|LOCUS_03890 8882 8100 gene locus_tag LOCUS_03900 8882 8100 CDS product PGL/p-HBAD biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003918527.1 protein_id gnl|my_center|LOCUS_03900 10106 8943 gene locus_tag LOCUS_03910 10106 8943 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_03910 10915 10106 gene locus_tag LOCUS_03920 10915 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 11690 10905 gene locus_tag LOCUS_03930 11690 10905 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230819.1 protein_id gnl|my_center|LOCUS_03930 12939 11701 gene locus_tag LOCUS_03940 12939 11701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_03940 13854 12991 gene locus_tag LOCUS_03950 13854 12991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_03950 15127 13871 gene locus_tag LOCUS_03960 gene tviB 15127 13871 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208043.1 protein_id gnl|my_center|LOCUS_03960 16071 15130 gene locus_tag LOCUS_03970 16071 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03970 17543 16068 gene locus_tag LOCUS_03980 17543 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03980 18380 17577 gene locus_tag LOCUS_03990 18380 17577 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107248.1 protein_id gnl|my_center|LOCUS_03990 18594 19625 gene locus_tag LOCUS_04000 gene ruvB 18594 19625 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_04000 20110 19622 gene locus_tag LOCUS_04010 20110 19622 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_04010 20603 20190 gene locus_tag LOCUS_04020 20603 20190 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_04020 20748 21251 gene locus_tag LOCUS_04030 20748 21251 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245055.1 protein_id gnl|my_center|LOCUS_04030 22213 21293 gene locus_tag LOCUS_04040 22213 21293 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_04040 23092 22229 gene locus_tag LOCUS_04050 gene rfbA 23092 22229 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_04050 23660 23100 gene locus_tag LOCUS_04060 gene rfbC 23660 23100 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_04060 24721 23663 gene locus_tag LOCUS_04070 gene rfbB 24721 23663 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932000.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence016 215 442 gene locus_tag LOCUS_04080 215 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1120 530 gene locus_tag LOCUS_04090 1120 530 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_04090 1404 4241 gene locus_tag LOCUS_04100 gene uvrA 1404 4241 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_04100 4350 5753 gene locus_tag LOCUS_04110 4350 5753 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_04110 6636 5800 gene locus_tag LOCUS_04120 gene serB 6636 5800 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_04120 6868 9309 gene locus_tag LOCUS_04130 6868 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 12336 9352 gene locus_tag LOCUS_04140 12336 9352 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108636457.1 protein_id gnl|my_center|LOCUS_04140 18121 12698 gene locus_tag LOCUS_04150 18121 12698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 18340 19875 gene locus_tag LOCUS_04160 18340 19875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 22114 19877 gene locus_tag LOCUS_04170 gene pbpC 22114 19877 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444434.1 protein_id gnl|my_center|LOCUS_04170 22744 22274 gene locus_tag LOCUS_04180 22744 22274 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461717.1 protein_id gnl|my_center|LOCUS_04180 <24758 22762 gene locus_tag LOCUS_04190 <24758 22762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962512.1:DNA polymerase III subunit alpha >Feature sequence017 306 1139 gene locus_tag LOCUS_04200 306 1139 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_04200 1173 1949 gene locus_tag LOCUS_04210 1173 1949 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703669.1 protein_id gnl|my_center|LOCUS_04210 2010 3659 gene locus_tag LOCUS_04220 2010 3659 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 protein_id gnl|my_center|LOCUS_04220 3961 6702 gene locus_tag LOCUS_04230 3961 6702 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_04230 6764 7483 gene locus_tag LOCUS_04240 6764 7483 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109413831.1 protein_id gnl|my_center|LOCUS_04240 8058 7480 gene locus_tag LOCUS_04250 8058 7480 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_04250 8396 8671 gene locus_tag LOCUS_04260 8396 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 8731 8973 gene locus_tag LOCUS_04270 8731 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 9597 9091 gene locus_tag LOCUS_04280 9597 9091 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_04280 10058 12502 gene locus_tag LOCUS_04290 10058 12502 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109335.1 protein_id gnl|my_center|LOCUS_04290 13222 13419 gene locus_tag LOCUS_04300 13222 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 14055 13369 gene locus_tag LOCUS_04310 14055 13369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 14594 14052 gene locus_tag LOCUS_04320 14594 14052 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_04320 14696 15187 gene locus_tag LOCUS_04330 14696 15187 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939267.1 protein_id gnl|my_center|LOCUS_04330 15187 15666 gene locus_tag LOCUS_04340 gene ybaK 15187 15666 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_04340 15820 16917 gene locus_tag LOCUS_04350 15820 16917 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_04350 17613 16975 gene locus_tag LOCUS_04360 17613 16975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 18861 17701 gene locus_tag LOCUS_04370 18861 17701 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963656.1 protein_id gnl|my_center|LOCUS_04370 19646 18888 gene locus_tag LOCUS_04380 19646 18888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 20096 19713 gene locus_tag LOCUS_04390 20096 19713 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_04390 20767 20174 gene locus_tag LOCUS_04400 20767 20174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 21305 20748 gene locus_tag LOCUS_04410 21305 20748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 <23508 21489 gene locus_tag LOCUS_04420 <23508 21489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639902.1:TonB-dependent receptor >Feature sequence018 601 1248 gene locus_tag LOCUS_04430 gene can 601 1248 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_04430 2243 1341 gene locus_tag LOCUS_04440 2243 1341 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_04440 2442 2819 gene locus_tag LOCUS_04450 2442 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 2883 3314 gene locus_tag LOCUS_04460 2883 3314 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_04460 3414 4022 gene locus_tag LOCUS_04470 gene sodA 3414 4022 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_04470 4205 4534 gene locus_tag LOCUS_04480 4205 4534 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112957.1 protein_id gnl|my_center|LOCUS_04480 5848 4610 gene locus_tag LOCUS_04490 gene clpX 5848 4610 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964183.1 protein_id gnl|my_center|LOCUS_04490 8777 5952 gene locus_tag LOCUS_04500 8777 5952 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_04500 10033 8777 gene locus_tag LOCUS_04510 10033 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 10886 10248 gene locus_tag LOCUS_04520 10886 10248 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115288.1 protein_id gnl|my_center|LOCUS_04520 11677 10979 gene locus_tag LOCUS_04530 gene clpP 11677 10979 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_04530 13336 11912 gene locus_tag LOCUS_04540 13336 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 13554 16181 gene locus_tag LOCUS_04550 gene gyrA 13554 16181 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765727.1 protein_id gnl|my_center|LOCUS_04550 16251 17555 gene locus_tag LOCUS_04560 16251 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 18770 17634 gene locus_tag LOCUS_04570 gene bshA 18770 17634 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_04570 19347 18775 gene locus_tag LOCUS_04580 gene gmk 19347 18775 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_04580 19988 19404 gene locus_tag LOCUS_04590 19988 19404 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214810.1 protein_id gnl|my_center|LOCUS_04590 20009 21451 gene locus_tag LOCUS_04600 20009 21451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 21619 22260 gene locus_tag LOCUS_04610 21619 22260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 <22879 22273 gene locus_tag LOCUS_04620 <22879 22273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398525.1:aldo/keto reductase >Feature sequence019 1904 324 gene locus_tag LOCUS_04630 gene atpA 1904 324 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_04630 2538 1978 gene locus_tag LOCUS_04640 gene atpH 2538 1978 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_04640 3073 2579 gene locus_tag LOCUS_04650 3073 2579 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_04650 3416 3174 gene locus_tag LOCUS_04660 gene atpE 3416 3174 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295758.1 protein_id gnl|my_center|LOCUS_04660 4668 3514 gene locus_tag LOCUS_04670 gene atpB 4668 3514 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107411.1 protein_id gnl|my_center|LOCUS_04670 5170 4775 gene locus_tag LOCUS_04680 5170 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 6011 5184 gene locus_tag LOCUS_04690 6011 5184 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932424.1 protein_id gnl|my_center|LOCUS_04690 6962 6078 gene locus_tag LOCUS_04700 6962 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 7111 8244 gene locus_tag LOCUS_04710 7111 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 8502 9725 gene locus_tag LOCUS_04720 8502 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 9915 10661 gene locus_tag LOCUS_04730 9915 10661 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963141.1 protein_id gnl|my_center|LOCUS_04730 10762 12705 gene locus_tag LOCUS_04740 10762 12705 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254216.1 protein_id gnl|my_center|LOCUS_04740 13734 12832 gene locus_tag LOCUS_04750 gene hemB 13734 12832 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962216.1 protein_id gnl|my_center|LOCUS_04750 14855 13899 gene locus_tag LOCUS_04760 gene hemF 14855 13899 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962218.1 protein_id gnl|my_center|LOCUS_04760 15924 14968 gene locus_tag LOCUS_04770 15924 14968 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094813.1 protein_id gnl|my_center|LOCUS_04770 16497 16084 gene locus_tag LOCUS_04780 16497 16084 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_04780 16692 17663 gene locus_tag LOCUS_04790 16692 17663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 17667 17873 gene locus_tag LOCUS_04800 17667 17873 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_04800 17955 19877 gene locus_tag LOCUS_04810 gene htpG 17955 19877 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765725.1 protein_id gnl|my_center|LOCUS_04810 19991 20602 gene locus_tag LOCUS_04820 19991 20602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 <22574 20665 gene locus_tag LOCUS_04830 <22574 20665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275152.1:peptidyl-dipeptidase Dcp >Feature sequence020 428 1078 gene locus_tag LOCUS_04840 428 1078 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963146.1 protein_id gnl|my_center|LOCUS_04840 1121 2155 gene locus_tag LOCUS_04850 1121 2155 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766890.1 protein_id gnl|my_center|LOCUS_04850 2292 6806 gene locus_tag LOCUS_04860 2292 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 6983 10660 gene locus_tag LOCUS_04870 6983 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 11157 10663 gene locus_tag LOCUS_04880 11157 10663 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527197.1 protein_id gnl|my_center|LOCUS_04880 13039 11165 gene locus_tag LOCUS_04890 13039 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 14691 15419 gene locus_tag LOCUS_04900 14691 15419 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_04900 15444 16322 gene locus_tag LOCUS_04910 15444 16322 CDS product PGL/p-HBAD biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003918527.1 protein_id gnl|my_center|LOCUS_04910 16571 17521 gene locus_tag LOCUS_04920 16571 17521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 17522 18529 gene locus_tag LOCUS_04930 17522 18529 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965618.1 protein_id gnl|my_center|LOCUS_04930 19531 18713 gene locus_tag LOCUS_04940 19531 18713 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_04940 19651 19896 gene locus_tag LOCUS_04950 19651 19896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 21911 20016 gene locus_tag LOCUS_04960 21911 20016 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962257.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence021 <1 1665 gene locus_tag LOCUS_04970 <1 1665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072067041.1:Tex family protein 3585 1915 gene locus_tag LOCUS_04980 3585 1915 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202473.1 protein_id gnl|my_center|LOCUS_04980 3708 4205 gene locus_tag LOCUS_04990 3708 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 4312 4908 gene locus_tag LOCUS_05000 4312 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 4905 5636 gene locus_tag LOCUS_05010 4905 5636 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836846.1 protein_id gnl|my_center|LOCUS_05010 6822 5680 gene locus_tag LOCUS_05020 6822 5680 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402885.1 protein_id gnl|my_center|LOCUS_05020 8572 6917 gene locus_tag LOCUS_05030 8572 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 9872 8622 gene locus_tag LOCUS_05040 9872 8622 CDS product DUF4876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402883.1 protein_id gnl|my_center|LOCUS_05040 12754 10016 gene locus_tag LOCUS_05050 12754 10016 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203196.1 protein_id gnl|my_center|LOCUS_05050 14263 12890 gene locus_tag LOCUS_05060 14263 12890 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_05060 15397 14411 gene locus_tag LOCUS_05070 15397 14411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 17388 15457 gene locus_tag LOCUS_05080 17388 15457 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_05080 18013 17573 gene locus_tag LOCUS_05090 18013 17573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 18773 18066 gene locus_tag LOCUS_05100 gene purQ 18773 18066 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933006.1 protein_id gnl|my_center|LOCUS_05100 19810 18803 gene locus_tag LOCUS_05110 19810 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 20046 22046 gene locus_tag LOCUS_05120 20046 22046 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence022 237 638 gene locus_tag LOCUS_05130 237 638 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962706.1 protein_id gnl|my_center|LOCUS_05130 756 1262 gene locus_tag LOCUS_05140 756 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 1273 2592 gene locus_tag LOCUS_05150 1273 2592 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_05150 2609 3202 gene locus_tag LOCUS_05160 gene gldD 2609 3202 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_05160 3268 3852 gene locus_tag LOCUS_05170 3268 3852 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_05170 3849 4463 gene locus_tag LOCUS_05180 gene trmH 3849 4463 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174221.1 protein_id gnl|my_center|LOCUS_05180 4525 4749 gene locus_tag LOCUS_05190 4525 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 5429 4881 gene locus_tag LOCUS_05200 5429 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 7121 5553 gene locus_tag LOCUS_05210 gene odhB 7121 5553 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003725.1 protein_id gnl|my_center|LOCUS_05210 9878 7158 gene locus_tag LOCUS_05220 9878 7158 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_05220 11159 10287 gene locus_tag LOCUS_05230 11159 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 11811 11170 gene locus_tag LOCUS_05240 11811 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 12222 12482 gene locus_tag LOCUS_05250 gene rpsT 12222 12482 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783989.1 protein_id gnl|my_center|LOCUS_05250 12590 14125 gene locus_tag LOCUS_05260 gene guaA 12590 14125 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_05260 14299 14649 gene locus_tag LOCUS_05270 14299 14649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 14747 15235 gene locus_tag LOCUS_05280 14747 15235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 16299 15319 gene locus_tag LOCUS_05290 16299 15319 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549454.1 protein_id gnl|my_center|LOCUS_05290 17103 16510 gene locus_tag LOCUS_05300 17103 16510 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530163.1 protein_id gnl|my_center|LOCUS_05300 18053 17340 gene locus_tag LOCUS_05310 18053 17340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 18105 19643 gene locus_tag LOCUS_05320 gene lysS 18105 19643 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_05320 20406 19732 gene locus_tag LOCUS_05330 20406 19732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 20615 20995 gene locus_tag LOCUS_05340 20615 20995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence023 296 84 gene locus_tag LOCUS_05350 296 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2620 938 gene locus_tag LOCUS_05360 2620 938 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_05360 4310 2832 gene locus_tag LOCUS_05370 4310 2832 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_05370 5008 4433 gene locus_tag LOCUS_05380 5008 4433 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785533.1 protein_id gnl|my_center|LOCUS_05380 6416 5073 gene locus_tag LOCUS_05390 gene rodA 6416 5073 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_05390 8554 6431 gene locus_tag LOCUS_05400 gene mrdA 8554 6431 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_05400 9209 8673 gene locus_tag LOCUS_05410 9209 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 10006 9206 gene locus_tag LOCUS_05420 10006 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 11143 10118 gene locus_tag LOCUS_05430 11143 10118 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_05430 12554 11274 gene locus_tag LOCUS_05440 12554 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 13869 12598 gene locus_tag LOCUS_05450 gene purD 13869 12598 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_05450 14001 15569 gene locus_tag LOCUS_05460 14001 15569 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964426.1 protein_id gnl|my_center|LOCUS_05460 15738 16172 gene locus_tag LOCUS_05470 15738 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 16363 17082 gene locus_tag LOCUS_05480 16363 17082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 17104 18189 gene locus_tag LOCUS_05490 17104 18189 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_05490 18282 19007 gene locus_tag LOCUS_05500 18282 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence024 1117 395 gene locus_tag LOCUS_05510 1117 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1944 1243 gene locus_tag LOCUS_05520 1944 1243 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_05520 2992 2069 gene locus_tag LOCUS_05530 2992 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 3206 4579 gene locus_tag LOCUS_05540 3206 4579 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_05540 4868 7114 gene locus_tag LOCUS_05550 4868 7114 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_05550 7794 7192 gene locus_tag LOCUS_05560 7794 7192 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_05560 8803 7931 gene locus_tag LOCUS_05570 8803 7931 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_05570 8883 9434 gene locus_tag LOCUS_05580 8883 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 11914 9479 gene locus_tag LOCUS_05590 11914 9479 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_05590 12769 12101 gene locus_tag LOCUS_05600 12769 12101 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_05600 14011 12779 gene locus_tag LOCUS_05610 gene serA 14011 12779 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382085.1 protein_id gnl|my_center|LOCUS_05610 14400 14143 gene locus_tag LOCUS_05620 14400 14143 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678397.1 protein_id gnl|my_center|LOCUS_05620 15771 14473 gene locus_tag LOCUS_05630 15771 14473 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_05630 16572 15775 gene locus_tag LOCUS_05640 16572 15775 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_05640 17669 16755 gene locus_tag LOCUS_05650 gene xerC 17669 16755 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_05650 18097 17900 gene locus_tag LOCUS_05660 18097 17900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 19592 18285 gene locus_tag LOCUS_05670 gene murA 19592 18285 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence025 1581 691 gene locus_tag LOCUS_05680 gene fabD 1581 691 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_05680 2743 1646 gene locus_tag LOCUS_05690 2743 1646 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_05690 3969 2755 gene locus_tag LOCUS_05700 3969 2755 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_05700 4310 6646 gene locus_tag LOCUS_05710 4310 6646 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303180.1 protein_id gnl|my_center|LOCUS_05710 7029 11888 gene locus_tag LOCUS_05720 7029 11888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 11937 15905 gene locus_tag LOCUS_05730 11937 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 16093 17022 gene locus_tag LOCUS_05740 16093 17022 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_05740 17136 17609 gene locus_tag LOCUS_05750 gene greA 17136 17609 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_05750 17792 17616 gene locus_tag LOCUS_05760 17792 17616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 17791 18180 gene locus_tag LOCUS_05770 17791 18180 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_05770 18187 18474 gene locus_tag LOCUS_05780 18187 18474 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703275.1 protein_id gnl|my_center|LOCUS_05780 18604 19752 gene locus_tag LOCUS_05790 gene nhaA 18604 19752 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963884.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence026 <1 1323 gene locus_tag LOCUS_05800 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963512.1:pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase 1509 2420 gene locus_tag LOCUS_05810 1509 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 2559 5219 gene locus_tag LOCUS_05820 2559 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 7129 5282 gene locus_tag LOCUS_05830 7129 5282 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_05830 7795 7271 gene locus_tag LOCUS_05840 7795 7271 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_05840 7970 8605 gene locus_tag LOCUS_05850 7970 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 8708 10363 gene locus_tag LOCUS_05860 8708 10363 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_05860 10734 10420 gene locus_tag LOCUS_05870 10734 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 11156 10809 gene locus_tag LOCUS_05880 11156 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_05880 11281 12558 gene locus_tag LOCUS_05890 gene serS 11281 12558 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_05890 12630 13391 gene locus_tag LOCUS_05900 12630 13391 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_05900 13833 13417 gene locus_tag LOCUS_05910 13833 13417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 13957 14592 gene locus_tag LOCUS_05920 13957 14592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 14639 16972 gene locus_tag LOCUS_05930 14639 16972 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_05930 17121 17513 gene locus_tag LOCUS_05940 17121 17513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 18012 18386 gene locus_tag LOCUS_05950 18012 18386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 18478 19044 gene locus_tag LOCUS_05960 18478 19044 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_05960 19724 19041 gene locus_tag LOCUS_05970 19724 19041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence027 241 894 gene locus_tag LOCUS_05980 241 894 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_05980 1630 992 gene locus_tag LOCUS_05990 1630 992 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647470.1 protein_id gnl|my_center|LOCUS_05990 2039 4381 gene locus_tag LOCUS_06000 2039 4381 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_06000 4503 5504 gene locus_tag LOCUS_06010 gene rfaD 4503 5504 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_06010 5580 6380 gene locus_tag LOCUS_06020 gene proC 5580 6380 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_06020 6821 6405 gene locus_tag LOCUS_06030 6821 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 7363 7157 gene locus_tag LOCUS_06040 7363 7157 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113289.1 protein_id gnl|my_center|LOCUS_06040 7779 7363 gene locus_tag LOCUS_06050 7779 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 7937 8845 gene locus_tag LOCUS_06060 gene gldA 7937 8845 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_06060 8972 9523 gene locus_tag LOCUS_06070 8972 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06070 10222 9527 gene locus_tag LOCUS_06080 10222 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 11768 10338 gene locus_tag LOCUS_06090 11768 10338 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_06090 12308 11826 gene locus_tag LOCUS_06100 12308 11826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 13031 12513 gene locus_tag LOCUS_06110 13031 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 13326 13844 gene locus_tag LOCUS_06120 13326 13844 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_06120 13931 15433 gene locus_tag LOCUS_06130 13931 15433 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963862.1 protein_id gnl|my_center|LOCUS_06130 15510 15956 gene locus_tag LOCUS_06140 15510 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 15989 18121 gene locus_tag LOCUS_06150 15989 18121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 18124 18891 gene locus_tag LOCUS_06160 18124 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 19228 18944 gene locus_tag LOCUS_06170 19228 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 <19760 19238 gene locus_tag LOCUS_06180 <19760 19238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965653.1:phenylalanine--tRNA ligase subunit beta >Feature sequence028 339 1097 gene locus_tag LOCUS_06190 339 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1205 1939 gene locus_tag LOCUS_06200 1205 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2054 3082 gene locus_tag LOCUS_06210 2054 3082 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129003072.1 protein_id gnl|my_center|LOCUS_06210 3204 3845 gene locus_tag LOCUS_06220 3204 3845 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763637.1 protein_id gnl|my_center|LOCUS_06220 3879 4541 gene locus_tag LOCUS_06230 3879 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 5182 4670 gene locus_tag LOCUS_06240 5182 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5817 5398 gene locus_tag LOCUS_06250 5817 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 5990 6334 gene locus_tag LOCUS_06260 5990 6334 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814177.1 protein_id gnl|my_center|LOCUS_06260 6957 6409 gene locus_tag LOCUS_06270 6957 6409 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948547.1 protein_id gnl|my_center|LOCUS_06270 7360 7100 gene locus_tag LOCUS_06280 7360 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 7924 8496 gene locus_tag LOCUS_06290 7924 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 8601 9629 gene locus_tag LOCUS_06300 gene hemH 8601 9629 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_06300 9636 10181 gene locus_tag LOCUS_06310 9636 10181 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_06310 10280 11125 gene locus_tag LOCUS_06320 10280 11125 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_06320 12633 11194 gene locus_tag LOCUS_06330 12633 11194 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_06330 12820 16287 gene locus_tag LOCUS_06340 12820 16287 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784823.1 protein_id gnl|my_center|LOCUS_06340 16306 17907 gene locus_tag LOCUS_06350 16306 17907 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150090626.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence029 <1 1463 gene locus_tag LOCUS_06360 <1 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000213800.1:DUF4132 domain-containing protein 1486 3747 gene locus_tag LOCUS_06370 1486 3747 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_06370 3744 4892 gene locus_tag LOCUS_06380 3744 4892 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_06380 5369 4956 gene locus_tag LOCUS_06390 5369 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 5857 5552 gene locus_tag LOCUS_06400 5857 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 7215 6028 gene locus_tag LOCUS_06410 7215 6028 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_06410 8916 7492 gene locus_tag LOCUS_06420 8916 7492 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797085.1 protein_id gnl|my_center|LOCUS_06420 11116 8930 gene locus_tag LOCUS_06430 11116 8930 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767251.1 protein_id gnl|my_center|LOCUS_06430 13156 11117 gene locus_tag LOCUS_06440 13156 11117 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797084.1 protein_id gnl|my_center|LOCUS_06440 15023 13296 gene locus_tag LOCUS_06450 15023 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 15477 18248 gene locus_tag LOCUS_06460 15477 18248 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence030 <1 1124 gene locus_tag LOCUS_06470 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963337.1:glucosaminidase domain-containing protein 1210 1746 gene locus_tag LOCUS_06480 gene hpt 1210 1746 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_06480 1842 3683 gene locus_tag LOCUS_06490 gene glmS 1842 3683 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_06490 3713 5899 gene locus_tag LOCUS_06500 3713 5899 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682106.1 protein_id gnl|my_center|LOCUS_06500 5949 6473 gene locus_tag LOCUS_06510 gene purE 5949 6473 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_06510 6957 7430 gene locus_tag LOCUS_06520 6957 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 7593 8678 gene locus_tag LOCUS_06530 7593 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 10731 8770 gene locus_tag LOCUS_06540 10731 8770 CDS product family 2A encapsulin nanocompartment cargo protein cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206474.1 protein_id gnl|my_center|LOCUS_06540 11632 10715 gene locus_tag LOCUS_06550 11632 10715 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_06550 12341 11721 gene locus_tag LOCUS_06560 12341 11721 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966718.1 protein_id gnl|my_center|LOCUS_06560 14215 12842 gene locus_tag LOCUS_06570 14215 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 15312 14359 gene locus_tag LOCUS_06580 15312 14359 CDS product glycoside hydrolase family 18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786048.1 protein_id gnl|my_center|LOCUS_06580 16646 15411 gene locus_tag LOCUS_06590 16646 15411 CDS product DUF1735 and LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763539.1 protein_id gnl|my_center|LOCUS_06590 18259 16622 gene locus_tag LOCUS_06600 18259 16622 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766778.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence031 183 530 gene locus_tag LOCUS_06610 gene yajC 183 530 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_06610 612 1208 gene locus_tag LOCUS_06620 gene coaE 612 1208 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_06620 1357 1974 gene locus_tag LOCUS_06630 1357 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 2108 3796 gene locus_tag LOCUS_06640 2108 3796 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839088.1 protein_id gnl|my_center|LOCUS_06640 3806 4117 gene locus_tag LOCUS_06650 3806 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 5470 4214 gene locus_tag LOCUS_06660 5470 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 6501 5956 gene locus_tag LOCUS_06670 6501 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06670 7393 6734 gene locus_tag LOCUS_06680 7393 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 8232 7450 gene locus_tag LOCUS_06690 8232 7450 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_06690 8785 8264 gene locus_tag LOCUS_06700 8785 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 9234 8782 gene locus_tag LOCUS_06710 9234 8782 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_06710 9650 9300 gene locus_tag LOCUS_06720 gene gldC 9650 9300 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_06720 9758 10282 gene locus_tag LOCUS_06730 9758 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 10294 10806 gene locus_tag LOCUS_06740 10294 10806 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076326.1 protein_id gnl|my_center|LOCUS_06740 12987 10807 gene locus_tag LOCUS_06750 12987 10807 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_06750 13158 13829 gene locus_tag LOCUS_06760 13158 13829 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_06760 15723 13888 gene locus_tag LOCUS_06770 gene rho 15723 13888 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962876.1 protein_id gnl|my_center|LOCUS_06770 16082 17521 gene locus_tag LOCUS_06780 gene asnS 16082 17521 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_06780 17579 18346 gene locus_tag LOCUS_06790 17579 18346 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091901756.1 protein_id gnl|my_center|LOCUS_06790 18419 18492 gene locus_tag LOCUS_t00070 18419 18492 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 <1 522 gene locus_tag LOCUS_06800 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962283.1:DNA repair protein RadA 1344 691 gene locus_tag LOCUS_06810 1344 691 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110820.1 protein_id gnl|my_center|LOCUS_06810 1792 1379 gene locus_tag LOCUS_06820 1792 1379 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383201.1 protein_id gnl|my_center|LOCUS_06820 3395 1893 gene locus_tag LOCUS_06830 3395 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4287 3580 gene locus_tag LOCUS_06840 4287 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 5575 4958 gene locus_tag LOCUS_06850 gene prfH 5575 4958 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107793.1 protein_id gnl|my_center|LOCUS_06850 6994 5579 gene locus_tag LOCUS_06860 6994 5579 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107794.1 protein_id gnl|my_center|LOCUS_06860 7841 11536 gene locus_tag LOCUS_06870 7841 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 13077 11641 gene locus_tag LOCUS_06880 gene aroP 13077 11641 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277864.1 protein_id gnl|my_center|LOCUS_06880 13234 13833 gene locus_tag LOCUS_06890 13234 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 15239 13854 gene locus_tag LOCUS_06900 15239 13854 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_06900 16074 15313 gene locus_tag LOCUS_06910 16074 15313 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 protein_id gnl|my_center|LOCUS_06910 17226 16132 gene locus_tag LOCUS_06920 17226 16132 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966652.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence033 <1 567 gene locus_tag LOCUS_06930 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765466.1:signal peptide peptidase SppA 1207 635 gene locus_tag LOCUS_06940 1207 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1870 1280 gene locus_tag LOCUS_06950 1870 1280 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_06950 2385 1933 gene locus_tag LOCUS_06960 2385 1933 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_06960 3541 2504 gene locus_tag LOCUS_06970 gene recA 3541 2504 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785787.1 protein_id gnl|my_center|LOCUS_06970 4097 3627 gene locus_tag LOCUS_06980 4097 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4251 4790 gene locus_tag LOCUS_06990 4251 4790 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962711.1 protein_id gnl|my_center|LOCUS_06990 4792 7383 gene locus_tag LOCUS_07000 4792 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 7872 7441 gene locus_tag LOCUS_07010 7872 7441 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_07010 7970 9247 gene locus_tag LOCUS_07020 7970 9247 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_07020 9501 9244 gene locus_tag LOCUS_07030 9501 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 9898 11520 gene locus_tag LOCUS_07040 9898 11520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964054.1 protein_id gnl|my_center|LOCUS_07040 11683 13176 gene locus_tag LOCUS_07050 11683 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 13935 13240 gene locus_tag LOCUS_07060 13935 13240 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_07060 14197 14985 gene locus_tag LOCUS_07070 14197 14985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 16054 15149 gene locus_tag LOCUS_07080 16054 15149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 17153 16104 gene locus_tag LOCUS_07090 17153 16104 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence034 53 415 gene locus_tag LOCUS_07100 53 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 1715 513 gene locus_tag LOCUS_07110 1715 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 1877 2512 gene locus_tag LOCUS_07120 1877 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2609 3895 gene locus_tag LOCUS_07130 2609 3895 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_07130 3957 4808 gene locus_tag LOCUS_07140 3957 4808 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_07140 6017 4863 gene locus_tag LOCUS_07150 6017 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 9559 6176 gene locus_tag LOCUS_07160 9559 6176 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414323.1 protein_id gnl|my_center|LOCUS_07160 9621 10484 gene locus_tag LOCUS_07170 9621 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 10536 12341 gene locus_tag LOCUS_07180 10536 12341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_07180 12890 12357 gene locus_tag LOCUS_07190 12890 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 13096 14145 gene locus_tag LOCUS_07200 gene queA 13096 14145 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_07200 14269 14571 gene locus_tag LOCUS_07210 14269 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 14905 14624 gene locus_tag LOCUS_07220 14905 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence035 215 955 gene locus_tag LOCUS_07230 215 955 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_07230 1020 2006 gene locus_tag LOCUS_07240 1020 2006 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_07240 2144 3955 gene locus_tag LOCUS_07250 2144 3955 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_07250 3977 4429 gene locus_tag LOCUS_07260 3977 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4450 4965 gene locus_tag LOCUS_07270 4450 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5118 6239 gene locus_tag LOCUS_07280 5118 6239 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839408.1 protein_id gnl|my_center|LOCUS_07280 6260 7762 gene locus_tag LOCUS_07290 6260 7762 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_07290 7787 8224 gene locus_tag LOCUS_07300 7787 8224 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_07300 8312 8563 gene locus_tag LOCUS_07310 8312 8563 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_07310 9200 8568 gene locus_tag LOCUS_07320 9200 8568 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_07320 9594 9172 gene locus_tag LOCUS_07330 9594 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 11383 9974 gene locus_tag LOCUS_07340 11383 9974 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298165.1 protein_id gnl|my_center|LOCUS_07340 11522 12028 gene locus_tag LOCUS_07350 11522 12028 CDS product DUF2314 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121651.1 protein_id gnl|my_center|LOCUS_07350 12033 12671 gene locus_tag LOCUS_07360 12033 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 12704 13093 gene locus_tag LOCUS_07370 12704 13093 CDS product DUF1398 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886004.1 protein_id gnl|my_center|LOCUS_07370 13438 13109 gene locus_tag LOCUS_07380 13438 13109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 13593 13919 gene locus_tag LOCUS_07390 13593 13919 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_07390 14235 13945 gene locus_tag LOCUS_07400 14235 13945 CDS product DUF3861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114086.1 protein_id gnl|my_center|LOCUS_07400 15175 14273 gene locus_tag LOCUS_07410 15175 14273 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140485.1 protein_id gnl|my_center|LOCUS_07410 15450 15172 gene locus_tag LOCUS_07420 15450 15172 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580382.1 protein_id gnl|my_center|LOCUS_07420 15967 15458 gene locus_tag LOCUS_07430 15967 15458 CDS product GlcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853257.1 protein_id gnl|my_center|LOCUS_07430 16067 16918 gene locus_tag LOCUS_07440 16067 16918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence036 <1 915 gene locus_tag LOCUS_07450 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107713.1:DUF3078 domain-containing protein 982 1854 gene locus_tag LOCUS_07460 982 1854 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_07460 1968 2849 gene locus_tag LOCUS_07470 1968 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 2905 3660 gene locus_tag LOCUS_07480 2905 3660 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_07480 3847 6558 gene locus_tag LOCUS_07490 3847 6558 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_07490 6622 6834 gene locus_tag LOCUS_07500 6622 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 6831 7208 gene locus_tag LOCUS_07510 6831 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07510 7259 7861 gene locus_tag LOCUS_07520 7259 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 7933 8757 gene locus_tag LOCUS_07530 gene murI 7933 8757 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_07530 8836 10359 gene locus_tag LOCUS_07540 8836 10359 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_07540 10457 11440 gene locus_tag LOCUS_07550 10457 11440 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_07550 11454 12905 gene locus_tag LOCUS_07560 11454 12905 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143780.1 protein_id gnl|my_center|LOCUS_07560 13011 15128 gene locus_tag LOCUS_07570 13011 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 15242 16030 gene locus_tag LOCUS_07580 15242 16030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 16706 16020 gene locus_tag LOCUS_07590 16706 16020 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence037 3820 584 gene locus_tag LOCUS_07600 3820 584 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083133.1 protein_id gnl|my_center|LOCUS_07600 5197 3851 gene locus_tag LOCUS_07610 5197 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 6412 5879 gene locus_tag LOCUS_07620 6412 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 7939 6467 gene locus_tag LOCUS_07630 7939 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 8463 7999 gene locus_tag LOCUS_07640 gene smpB 8463 7999 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760495.1 protein_id gnl|my_center|LOCUS_07640 9452 8523 gene locus_tag LOCUS_07650 gene accD 9452 8523 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_07650 10153 9536 gene locus_tag LOCUS_07660 10153 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 10558 11658 gene locus_tag LOCUS_07670 10558 11658 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_07670 12357 11878 gene locus_tag LOCUS_07680 12357 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 13486 12470 gene locus_tag LOCUS_07690 13486 12470 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265797.1 protein_id gnl|my_center|LOCUS_07690 13697 14227 gene locus_tag LOCUS_07700 gene pyrR 13697 14227 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_07700 14251 14562 gene locus_tag LOCUS_07710 14251 14562 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_07710 14588 15235 gene locus_tag LOCUS_07720 gene aat 14588 15235 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_07720 15629 15225 gene locus_tag LOCUS_07730 15629 15225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 15765 16526 gene locus_tag LOCUS_07740 15765 16526 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487177.1 protein_id gnl|my_center|LOCUS_07740 16913 17095 gene locus_tag LOCUS_07750 16913 17095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence038 174 383 gene locus_tag LOCUS_07760 174 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 578 802 gene locus_tag LOCUS_07770 578 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 1388 1227 gene locus_tag LOCUS_07780 1388 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2493 1660 gene locus_tag LOCUS_07790 2493 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 2959 3525 gene locus_tag LOCUS_07800 2959 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 3562 4188 gene locus_tag LOCUS_07810 3562 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 5073 4714 gene locus_tag LOCUS_07820 5073 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07820 5472 5278 gene locus_tag LOCUS_07830 5472 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 5719 5459 gene locus_tag LOCUS_07840 5719 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6010 6429 gene locus_tag LOCUS_07850 6010 6429 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037875.1 protein_id gnl|my_center|LOCUS_07850 6547 7392 gene locus_tag LOCUS_07860 6547 7392 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790194.1 protein_id gnl|my_center|LOCUS_07860 7513 8028 gene locus_tag LOCUS_07870 7513 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 8379 8675 gene locus_tag LOCUS_07880 8379 8675 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_07880 8811 9251 gene locus_tag LOCUS_07890 8811 9251 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 protein_id gnl|my_center|LOCUS_07890 9326 9580 gene locus_tag LOCUS_07900 9326 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 10373 9648 gene locus_tag LOCUS_07910 10373 9648 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_07910 11110 10373 gene locus_tag LOCUS_07920 11110 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 11642 12997 gene locus_tag LOCUS_07930 11642 12997 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_07930 13070 14251 gene locus_tag LOCUS_07940 13070 14251 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_07940 14256 15005 gene locus_tag LOCUS_07950 14256 15005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 protein_id gnl|my_center|LOCUS_07950 15032 16258 gene locus_tag LOCUS_07960 15032 16258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_07960 <17145 16416 gene locus_tag LOCUS_07970 <17145 16416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210830.1:2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD >Feature sequence039 869 450 gene locus_tag LOCUS_07980 869 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1455 931 gene locus_tag LOCUS_07990 1455 931 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468869.1 protein_id gnl|my_center|LOCUS_07990 2330 1464 gene locus_tag LOCUS_08000 gene rfbD 2330 1464 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_08000 3465 2335 gene locus_tag LOCUS_08010 3465 2335 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_08010 4671 3550 gene locus_tag LOCUS_08020 4671 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 4830 6344 gene locus_tag LOCUS_08030 4830 6344 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783769.1 protein_id gnl|my_center|LOCUS_08030 6452 7663 gene locus_tag LOCUS_08040 6452 7663 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_08040 7857 9263 gene locus_tag LOCUS_08050 gene lpdA 7857 9263 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_08050 9494 10186 gene locus_tag LOCUS_08060 9494 10186 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530097.1 protein_id gnl|my_center|LOCUS_08060 10386 11189 gene locus_tag LOCUS_08070 10386 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 11978 11274 gene locus_tag LOCUS_08080 11978 11274 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_08080 13934 13167 gene locus_tag LOCUS_08090 13934 13167 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_08090 14144 15484 gene locus_tag LOCUS_08100 14144 15484 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_08100 15503 16849 gene locus_tag LOCUS_08110 15503 16849 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence040 877 1344 gene locus_tag LOCUS_08120 877 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1556 2182 gene locus_tag LOCUS_08130 1556 2182 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_08130 3978 2278 gene locus_tag LOCUS_08140 3978 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 5018 4053 gene locus_tag LOCUS_08150 5018 4053 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_08150 6059 5202 gene locus_tag LOCUS_08160 6059 5202 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_08160 6476 8134 gene locus_tag LOCUS_08170 gene pgi 6476 8134 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789986.1 protein_id gnl|my_center|LOCUS_08170 9757 9185 gene locus_tag LOCUS_08180 9757 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 10039 10521 gene locus_tag LOCUS_08190 10039 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 10605 10892 gene locus_tag LOCUS_08200 10605 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 10997 11143 gene locus_tag LOCUS_08210 10997 11143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 11575 11504 gene locus_tag LOCUS_t00080 11575 11504 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 11684 12559 gene locus_tag LOCUS_08220 11684 12559 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_08220 12636 13439 gene locus_tag LOCUS_08230 gene dapF 12636 13439 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_08230 13436 14374 gene locus_tag LOCUS_08240 13436 14374 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_08240 14384 14857 gene locus_tag LOCUS_08250 14384 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 <16622 14942 gene locus_tag LOCUS_08260 <16622 14942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076054074.1:glycoside hydrolase family 2 >Feature sequence041 <1 867 gene locus_tag LOCUS_08270 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202169.1:4-O-beta-D-mannosyl-D-glucose phosphorylase 885 2072 gene locus_tag LOCUS_08280 885 2072 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_08280 2175 2360 gene locus_tag LOCUS_08290 2175 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08290 5229 3277 gene locus_tag LOCUS_08300 5229 3277 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_08300 6643 5255 gene locus_tag LOCUS_08310 6643 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 7567 6659 gene locus_tag LOCUS_08320 7567 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 8652 7564 gene locus_tag LOCUS_08330 8652 7564 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767206.1 protein_id gnl|my_center|LOCUS_08330 9228 8716 gene locus_tag LOCUS_08340 9228 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 11390 9249 gene locus_tag LOCUS_08350 11390 9249 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767251.1 protein_id gnl|my_center|LOCUS_08350 12431 11481 gene locus_tag LOCUS_08360 12431 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 14303 12453 gene locus_tag LOCUS_08370 14303 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 <16515 14326 gene locus_tag LOCUS_08380 <16515 14326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108774.1:TonB-dependent receptor >Feature sequence042 1215 544 gene locus_tag LOCUS_08390 1215 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1881 2339 gene locus_tag LOCUS_08400 1881 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2376 3578 gene locus_tag LOCUS_08410 gene zigA 2376 3578 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446171.1 protein_id gnl|my_center|LOCUS_08410 3610 4626 gene locus_tag LOCUS_08420 3610 4626 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613438.1 protein_id gnl|my_center|LOCUS_08420 4647 5483 gene locus_tag LOCUS_08430 gene lgt 4647 5483 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_08430 6316 5504 gene locus_tag LOCUS_08440 6316 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08440 8039 6336 gene locus_tag LOCUS_08450 8039 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08450 9509 8127 gene locus_tag LOCUS_08460 9509 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08460 9850 11715 gene locus_tag LOCUS_08470 9850 11715 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_08470 11957 15364 gene locus_tag LOCUS_08480 11957 15364 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291394.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence043 <1 1381 gene locus_tag LOCUS_08490 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964339.1:RNA polymerase factor sigma-54 1386 2087 gene locus_tag LOCUS_08500 1386 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962552.1 protein_id gnl|my_center|LOCUS_08500 2227 3369 gene locus_tag LOCUS_08510 2227 3369 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 protein_id gnl|my_center|LOCUS_08510 3386 4927 gene locus_tag LOCUS_08520 3386 4927 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_08520 4979 5314 gene locus_tag LOCUS_08530 4979 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 5452 6183 gene locus_tag LOCUS_08540 5452 6183 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_08540 6982 6242 gene locus_tag LOCUS_08550 6982 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 7069 7839 gene locus_tag LOCUS_08560 7069 7839 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788098.1 protein_id gnl|my_center|LOCUS_08560 7895 8230 gene locus_tag LOCUS_08570 7895 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 8399 8668 gene locus_tag LOCUS_08580 8399 8668 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_08580 8984 9817 gene locus_tag LOCUS_08590 8984 9817 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_08590 9817 10605 gene locus_tag LOCUS_08600 9817 10605 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_08600 10613 11383 gene locus_tag LOCUS_08610 10613 11383 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328575.1 protein_id gnl|my_center|LOCUS_08610 12021 11392 gene locus_tag LOCUS_08620 12021 11392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 12969 12043 gene locus_tag LOCUS_08630 gene fmt 12969 12043 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109030.1 protein_id gnl|my_center|LOCUS_08630 13501 13043 gene locus_tag LOCUS_08640 13501 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 13881 13561 gene locus_tag LOCUS_08650 13881 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 14023 14096 gene locus_tag LOCUS_t00090 14023 14096 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15394 14096 gene locus_tag LOCUS_08660 15394 14096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence044 2497 1307 gene locus_tag LOCUS_08670 2497 1307 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_08670 3234 2665 gene locus_tag LOCUS_08680 3234 2665 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802164.1 protein_id gnl|my_center|LOCUS_08680 4711 3278 gene locus_tag LOCUS_08690 4711 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4857 5501 gene locus_tag LOCUS_08700 4857 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 6111 5527 gene locus_tag LOCUS_08710 6111 5527 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_08710 6901 6308 gene locus_tag LOCUS_08720 6901 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 7046 7711 gene locus_tag LOCUS_08730 7046 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 7761 8183 gene locus_tag LOCUS_08740 7761 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 11073 8269 gene locus_tag LOCUS_08750 gene polA 11073 8269 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_08750 11160 11810 gene locus_tag LOCUS_08760 11160 11810 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263126.1 protein_id gnl|my_center|LOCUS_08760 12900 11866 gene locus_tag LOCUS_08770 12900 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 13099 14919 gene locus_tag LOCUS_08780 13099 14919 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_08780 15532 15008 gene locus_tag LOCUS_08790 15532 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 16071 15721 gene locus_tag LOCUS_08800 16071 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence045 542 1183 gene locus_tag LOCUS_08810 542 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1227 1787 gene locus_tag LOCUS_08820 1227 1787 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 protein_id gnl|my_center|LOCUS_08820 1878 2564 gene locus_tag LOCUS_08830 1878 2564 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 protein_id gnl|my_center|LOCUS_08830 2666 2959 gene locus_tag LOCUS_08840 2666 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 4949 3051 gene locus_tag LOCUS_08850 4949 3051 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962866.1 protein_id gnl|my_center|LOCUS_08850 5440 6240 gene locus_tag LOCUS_08860 5440 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 6416 6688 gene locus_tag LOCUS_08870 gene rpsO 6416 6688 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890045.1 protein_id gnl|my_center|LOCUS_08870 6811 8961 gene locus_tag LOCUS_08880 gene pnp 6811 8961 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_08880 9093 9566 gene locus_tag LOCUS_08890 9093 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 9920 9636 gene locus_tag LOCUS_08900 9920 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 11258 10056 gene locus_tag LOCUS_08910 gene mtaB 11258 10056 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_08910 11984 11532 gene locus_tag LOCUS_08920 11984 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 12448 12104 gene locus_tag LOCUS_08930 12448 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 13176 12475 gene locus_tag LOCUS_08940 13176 12475 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_08940 14041 13166 gene locus_tag LOCUS_08950 14041 13166 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_08950 14285 15148 gene locus_tag LOCUS_08960 14285 15148 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_08960 15162 15632 gene locus_tag LOCUS_08970 15162 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence046 1395 292 gene locus_tag LOCUS_08980 1395 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1595 2560 gene locus_tag LOCUS_08990 1595 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2563 3039 gene locus_tag LOCUS_09000 2563 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002653215.1 protein_id gnl|my_center|LOCUS_09000 3221 3904 gene locus_tag LOCUS_09010 3221 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3912 4430 gene locus_tag LOCUS_09020 gene msrB 3912 4430 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926800.1 protein_id gnl|my_center|LOCUS_09020 4568 4481 gene locus_tag LOCUS_t00100 4568 4481 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6166 4616 gene locus_tag LOCUS_09030 6166 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 7142 6195 gene locus_tag LOCUS_09040 7142 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 7439 7170 gene locus_tag LOCUS_09050 7439 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 8856 7564 gene locus_tag LOCUS_09060 gene hemL 8856 7564 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963336.1 protein_id gnl|my_center|LOCUS_09060 9117 10208 gene locus_tag LOCUS_09070 9117 10208 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_09070 11067 10306 gene locus_tag LOCUS_09080 11067 10306 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_09080 12080 11118 gene locus_tag LOCUS_09090 12080 11118 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109044.1 protein_id gnl|my_center|LOCUS_09090 12363 13316 gene locus_tag LOCUS_09100 12363 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 13743 13384 gene locus_tag LOCUS_09110 13743 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 14693 13764 gene locus_tag LOCUS_09120 14693 13764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 15226 14873 gene locus_tag LOCUS_09130 15226 14873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence047 <1 2466 gene locus_tag LOCUS_09140 <1 2466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796251.1:TonB-dependent receptor 2526 3275 gene locus_tag LOCUS_09150 2526 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 3287 3895 gene locus_tag LOCUS_09160 3287 3895 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964094.1 protein_id gnl|my_center|LOCUS_09160 3966 5621 gene locus_tag LOCUS_09170 gene recN 3966 5621 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203085.1 protein_id gnl|my_center|LOCUS_09170 6466 5879 gene locus_tag LOCUS_09180 gene pnuC 6466 5879 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_09180 7074 6466 gene locus_tag LOCUS_09190 gene pnuC 7074 6466 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206028.1 protein_id gnl|my_center|LOCUS_09190 7402 8220 gene locus_tag LOCUS_09200 7402 8220 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_09200 8851 8279 gene locus_tag LOCUS_09210 8851 8279 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_09210 8854 10200 gene locus_tag LOCUS_09220 8854 10200 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_09220 10293 10913 gene locus_tag LOCUS_09230 10293 10913 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_09230 10945 11712 gene locus_tag LOCUS_09240 10945 11712 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567380.1 protein_id gnl|my_center|LOCUS_09240 11752 11839 gene locus_tag LOCUS_t00110 11752 11839 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12252 12809 gene locus_tag LOCUS_09250 12252 12809 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681497.1 protein_id gnl|my_center|LOCUS_09250 12880 13947 gene locus_tag LOCUS_09260 12880 13947 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 protein_id gnl|my_center|LOCUS_09260 14218 14883 gene locus_tag LOCUS_09270 14218 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09270 >Feature sequence048 1369 764 gene locus_tag LOCUS_09280 1369 764 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_09280 2725 1430 gene locus_tag LOCUS_09290 gene aroA 2725 1430 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_09290 3796 2765 gene locus_tag LOCUS_09300 gene aroB 3796 2765 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052388.1 protein_id gnl|my_center|LOCUS_09300 4942 3854 gene locus_tag LOCUS_09310 4942 3854 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_09310 6040 4955 gene locus_tag LOCUS_09320 6040 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09320 8318 6615 gene locus_tag LOCUS_09330 8318 6615 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_09330 9283 8417 gene locus_tag LOCUS_09340 9283 8417 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_09340 10466 9312 gene locus_tag LOCUS_09350 10466 9312 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203532.1 protein_id gnl|my_center|LOCUS_09350 11382 10543 gene locus_tag LOCUS_09360 11382 10543 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_09360 12823 11840 gene locus_tag LOCUS_09370 12823 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 13953 12928 gene locus_tag LOCUS_09380 13953 12928 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_09380 14084 14500 gene locus_tag LOCUS_09390 14084 14500 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_09390 15060 14581 gene locus_tag LOCUS_09400 15060 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence049 <1 1066 gene locus_tag LOCUS_09410 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203526.1:RecQ family ATP-dependent DNA helicase 2175 1138 gene locus_tag LOCUS_09420 2175 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3887 2307 gene locus_tag LOCUS_09430 3887 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4777 3974 gene locus_tag LOCUS_09440 4777 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 5230 4787 gene locus_tag LOCUS_09450 gene dut 5230 4787 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784036.1 protein_id gnl|my_center|LOCUS_09450 6145 5351 gene locus_tag LOCUS_09460 6145 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 7325 6276 gene locus_tag LOCUS_09470 gene hisC 7325 6276 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789125.1 protein_id gnl|my_center|LOCUS_09470 8692 7409 gene locus_tag LOCUS_09480 gene hisD 8692 7409 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_09480 9589 8711 gene locus_tag LOCUS_09490 gene hisG 9589 8711 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_09490 9872 11686 gene locus_tag LOCUS_09500 9872 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 14059 12005 gene locus_tag LOCUS_09510 14059 12005 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence050 855 319 gene locus_tag LOCUS_09520 855 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1241 3676 gene locus_tag LOCUS_09530 1241 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3681 4862 gene locus_tag LOCUS_09540 3681 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4868 5707 gene locus_tag LOCUS_09550 4868 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 5799 9350 gene locus_tag LOCUS_09560 5799 9350 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_09560 10303 9347 gene locus_tag LOCUS_09570 10303 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 10633 11028 gene locus_tag LOCUS_09580 10633 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 11184 12962 gene locus_tag LOCUS_09590 11184 12962 CDS product SAV1866 family putative multidrug efflux ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597238.1 protein_id gnl|my_center|LOCUS_09590 13252 14646 gene locus_tag LOCUS_09600 gene glmM 13252 14646 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence051 853 29 gene locus_tag LOCUS_09610 853 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3319 986 gene locus_tag LOCUS_09620 gene recQ 3319 986 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_09620 3544 4083 gene locus_tag LOCUS_09630 3544 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4714 6627 gene locus_tag LOCUS_09640 gene rpsA 4714 6627 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_09640 6799 8814 gene locus_tag LOCUS_09650 6799 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 8972 9949 gene locus_tag LOCUS_09660 8972 9949 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_09660 10039 10563 gene locus_tag LOCUS_09670 10039 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 11032 10640 gene locus_tag LOCUS_09680 11032 10640 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551711.1 protein_id gnl|my_center|LOCUS_09680 12225 11053 gene locus_tag LOCUS_09690 gene mqnE 12225 11053 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941110.1 protein_id gnl|my_center|LOCUS_09690 13072 12713 gene locus_tag LOCUS_09700 13072 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 13865 13170 gene locus_tag LOCUS_09710 13865 13170 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_09710 14768 13875 gene locus_tag LOCUS_09720 14768 13875 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence052 1102 641 gene locus_tag LOCUS_09730 1102 641 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_09730 2290 1115 gene locus_tag LOCUS_09740 2290 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2331 3947 gene locus_tag LOCUS_09750 2331 3947 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_09750 3998 5545 gene locus_tag LOCUS_09760 3998 5545 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203002.1 protein_id gnl|my_center|LOCUS_09760 5570 6814 gene locus_tag LOCUS_09770 5570 6814 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973131.1 protein_id gnl|my_center|LOCUS_09770 6811 8040 gene locus_tag LOCUS_09780 6811 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 8091 9407 gene locus_tag LOCUS_09790 8091 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 9397 10341 gene locus_tag LOCUS_09800 9397 10341 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_09800 10360 11223 gene locus_tag LOCUS_09810 10360 11223 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836797.1 protein_id gnl|my_center|LOCUS_09810 11251 12339 gene locus_tag LOCUS_09820 11251 12339 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_09820 13037 12855 gene locus_tag LOCUS_09830 13037 12855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 13649 13095 gene locus_tag LOCUS_09840 13649 13095 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926937.1 protein_id gnl|my_center|LOCUS_09840 13882 14238 gene locus_tag LOCUS_09850 gene rpsF 13882 14238 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583717.1 protein_id gnl|my_center|LOCUS_09850 14244 14510 gene locus_tag LOCUS_09860 gene rpsR 14244 14510 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790946.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence053 183 3248 gene locus_tag LOCUS_09870 183 3248 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767767.1 protein_id gnl|my_center|LOCUS_09870 4306 3368 gene locus_tag LOCUS_09880 4306 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4954 6561 gene locus_tag LOCUS_09890 4954 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 6567 7232 gene locus_tag LOCUS_09900 6567 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 7380 7592 gene locus_tag LOCUS_09910 7380 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933333.1 protein_id gnl|my_center|LOCUS_09910 7642 9705 gene locus_tag LOCUS_09920 7642 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 9736 10719 gene locus_tag LOCUS_09930 9736 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence054 1196 27 gene locus_tag LOCUS_09940 1196 27 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_09940 1387 2949 gene locus_tag LOCUS_09950 1387 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_09950 3826 2999 gene locus_tag LOCUS_09960 3826 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 4724 3831 gene locus_tag LOCUS_09970 4724 3831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860908.1 protein_id gnl|my_center|LOCUS_09970 4866 5477 gene locus_tag LOCUS_09980 4866 5477 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_09980 6127 5546 gene locus_tag LOCUS_09990 6127 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 6672 6127 gene locus_tag LOCUS_10000 gene scuA 6672 6127 CDS product cytochrome c oxidase assembly accessory protein ScuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245947.1 protein_id gnl|my_center|LOCUS_10000 8421 6778 gene locus_tag LOCUS_10010 8421 6778 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930821.1 protein_id gnl|my_center|LOCUS_10010 8928 8488 gene locus_tag LOCUS_10020 8928 8488 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258287.1 protein_id gnl|my_center|LOCUS_10020 10147 9434 gene locus_tag LOCUS_10030 10147 9434 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829810.1 protein_id gnl|my_center|LOCUS_10030 11157 10180 gene locus_tag LOCUS_10040 11157 10180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970876.1 protein_id gnl|my_center|LOCUS_10040 11282 12130 gene locus_tag LOCUS_10050 11282 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 13382 12207 gene locus_tag LOCUS_10060 13382 12207 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence055 <1 2855 gene locus_tag LOCUS_10070 <1 2855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963312.1:DNA-directed RNA polymerase subunit beta 3023 4393 gene locus_tag LOCUS_10080 3023 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 5881 4517 gene locus_tag LOCUS_10090 5881 4517 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_10090 6086 6916 gene locus_tag LOCUS_10100 6086 6916 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_10100 6959 7771 gene locus_tag LOCUS_10110 6959 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 7784 8152 gene locus_tag LOCUS_10120 7784 8152 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538531.1 protein_id gnl|my_center|LOCUS_10120 8154 8909 gene locus_tag LOCUS_10130 8154 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 9009 10289 gene locus_tag LOCUS_10140 9009 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 10434 13181 gene locus_tag LOCUS_10150 10434 13181 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962501.1 protein_id gnl|my_center|LOCUS_10150 13281 13811 gene locus_tag LOCUS_10160 13281 13811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence056 457 68 gene locus_tag LOCUS_10170 457 68 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227644.1 protein_id gnl|my_center|LOCUS_10170 1367 519 gene locus_tag LOCUS_10180 1367 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3338 1446 gene locus_tag LOCUS_10190 3338 1446 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_10190 6842 3546 gene locus_tag LOCUS_10200 6842 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 7009 7392 gene locus_tag LOCUS_10210 7009 7392 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384930.1 protein_id gnl|my_center|LOCUS_10210 7495 10266 gene locus_tag LOCUS_10220 7495 10266 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109197.1 protein_id gnl|my_center|LOCUS_10220 13710 10351 gene locus_tag LOCUS_10230 gene secA 13710 10351 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence057 62 871 gene locus_tag LOCUS_10240 62 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1854 1189 gene locus_tag LOCUS_10250 gene pdeM 1854 1189 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_10250 4313 1851 gene locus_tag LOCUS_10260 4313 1851 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921429.1 protein_id gnl|my_center|LOCUS_10260 5895 4315 gene locus_tag LOCUS_10270 5895 4315 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_10270 6917 5892 gene locus_tag LOCUS_10280 6917 5892 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_10280 8090 6918 gene locus_tag LOCUS_10290 8090 6918 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108952.1 protein_id gnl|my_center|LOCUS_10290 8992 8231 gene locus_tag LOCUS_10300 8992 8231 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_10300 10248 8992 gene locus_tag LOCUS_10310 10248 8992 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_10310 11302 11781 gene locus_tag LOCUS_10320 11302 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10320 11800 12042 gene locus_tag LOCUS_10330 11800 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10330 13785 12631 gene locus_tag LOCUS_10340 13785 12631 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659589.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence058 1557 1138 gene locus_tag LOCUS_10350 gene tsaE 1557 1138 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_10350 1634 1954 gene locus_tag LOCUS_10360 1634 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 2002 2739 gene locus_tag LOCUS_10370 2002 2739 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_10370 2842 3432 gene locus_tag LOCUS_10380 2842 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3782 4981 gene locus_tag LOCUS_10390 3782 4981 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_10390 5051 5911 gene locus_tag LOCUS_10400 gene tatC 5051 5911 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_10400 6226 5969 gene locus_tag LOCUS_10410 6226 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 6886 6317 gene locus_tag LOCUS_10420 6886 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 9455 7302 gene locus_tag LOCUS_10430 9455 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 9633 10157 gene locus_tag LOCUS_10440 9633 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 10262 11107 gene locus_tag LOCUS_10450 10262 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 11192 11923 gene locus_tag LOCUS_10460 11192 11923 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_10460 13784 12093 gene locus_tag LOCUS_10470 13784 12093 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199111712.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence059 771 1064 gene locus_tag LOCUS_10480 771 1064 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_10480 1070 1426 gene locus_tag LOCUS_10490 1070 1426 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_10490 1826 1545 gene locus_tag LOCUS_10500 1826 1545 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484947.1 protein_id gnl|my_center|LOCUS_10500 1971 3137 gene locus_tag LOCUS_10510 1971 3137 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_10510 3207 4220 gene locus_tag LOCUS_10520 3207 4220 CDS product DUF4097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963894.1 protein_id gnl|my_center|LOCUS_10520 4374 5390 gene locus_tag LOCUS_10530 4374 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 6010 5453 gene locus_tag LOCUS_10540 6010 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 6851 6030 gene locus_tag LOCUS_10550 6851 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 7364 6933 gene locus_tag LOCUS_10560 7364 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 8078 7398 gene locus_tag LOCUS_10570 8078 7398 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394318.1 protein_id gnl|my_center|LOCUS_10570 8685 8110 gene locus_tag LOCUS_10580 8685 8110 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_10580 9615 8695 gene locus_tag LOCUS_10590 gene cyoE 9615 8695 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_10590 11576 9759 gene locus_tag LOCUS_10600 11576 9759 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_10600 12700 11630 gene locus_tag LOCUS_10610 12700 11630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 <13849 12766 gene locus_tag LOCUS_10620 <13849 12766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962548.1:quinol:cytochrome C oxidoreductase >Feature sequence060 5926 1163 gene locus_tag LOCUS_10630 5926 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 6434 6069 gene locus_tag LOCUS_10640 6434 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 7485 6457 gene locus_tag LOCUS_10650 7485 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 7934 7506 gene locus_tag LOCUS_10660 7934 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 9441 8554 gene locus_tag LOCUS_10670 9441 8554 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496450.1 protein_id gnl|my_center|LOCUS_10670 10956 9511 gene locus_tag LOCUS_10680 10956 9511 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762559.1 protein_id gnl|my_center|LOCUS_10680 12199 11048 gene locus_tag LOCUS_10690 12199 11048 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence061 634 2712 gene locus_tag LOCUS_10700 634 2712 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784055.1 protein_id gnl|my_center|LOCUS_10700 2753 3916 gene locus_tag LOCUS_10710 2753 3916 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201945.1 protein_id gnl|my_center|LOCUS_10710 4010 6439 gene locus_tag LOCUS_10720 4010 6439 CDS product DUF4965 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108862.1 protein_id gnl|my_center|LOCUS_10720 6588 7034 gene locus_tag LOCUS_10730 6588 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 8079 7102 gene locus_tag LOCUS_10740 8079 7102 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110392.1 protein_id gnl|my_center|LOCUS_10740 8721 8161 gene locus_tag LOCUS_10750 8721 8161 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_10750 8917 10905 gene locus_tag LOCUS_10760 8917 10905 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_10760 11551 10985 gene locus_tag LOCUS_10770 11551 10985 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088195.1 protein_id gnl|my_center|LOCUS_10770 12712 11564 gene locus_tag LOCUS_10780 12712 11564 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_10780 13425 12850 gene locus_tag LOCUS_10790 13425 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence062 1591 479 gene locus_tag LOCUS_10800 1591 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2855 1635 gene locus_tag LOCUS_10810 2855 1635 CDS product DUF5000 domain-containing lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767187.1 protein_id gnl|my_center|LOCUS_10810 4813 2921 gene locus_tag LOCUS_10820 4813 2921 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767204.1 protein_id gnl|my_center|LOCUS_10820 8210 4848 gene locus_tag LOCUS_10830 8210 4848 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767205.1 protein_id gnl|my_center|LOCUS_10830 9547 8423 gene locus_tag LOCUS_10840 9547 8423 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_10840 10205 9630 gene locus_tag LOCUS_10850 10205 9630 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766766.1 protein_id gnl|my_center|LOCUS_10850 10738 11808 gene locus_tag LOCUS_10860 gene recF 10738 11808 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_10860 12075 12374 gene locus_tag LOCUS_10870 12075 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 12430 12711 gene locus_tag LOCUS_10880 12430 12711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 12841 12914 gene locus_tag LOCUS_t00120 12841 12914 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12942 13025 gene locus_tag LOCUS_t00130 12942 13025 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 13097 13170 gene locus_tag LOCUS_t00140 13097 13170 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13225 13297 gene locus_tag LOCUS_t00150 13225 13297 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence063 2223 859 gene locus_tag LOCUS_10890 2223 859 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618774.1 protein_id gnl|my_center|LOCUS_10890 3721 2867 gene locus_tag LOCUS_10900 3721 2867 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_10900 4684 3728 gene locus_tag LOCUS_10910 4684 3728 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931924.1 protein_id gnl|my_center|LOCUS_10910 4824 5861 gene locus_tag LOCUS_10920 gene dusB 4824 5861 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_10920 6731 6162 gene locus_tag LOCUS_10930 6731 6162 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765910.1 protein_id gnl|my_center|LOCUS_10930 7437 6736 gene locus_tag LOCUS_10940 7437 6736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_10940 7740 7447 gene locus_tag LOCUS_10950 gene gatC 7740 7447 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_10950 10129 7841 gene locus_tag LOCUS_10960 10129 7841 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764319.1 protein_id gnl|my_center|LOCUS_10960 10271 10981 gene locus_tag LOCUS_10970 10271 10981 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_10970 11078 11929 gene locus_tag LOCUS_10980 11078 11929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 12272 13438 gene locus_tag LOCUS_10990 12272 13438 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765343.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence064 3009 1720 gene locus_tag LOCUS_11000 3009 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 4424 3021 gene locus_tag LOCUS_11010 4424 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 4539 5096 gene locus_tag LOCUS_11020 4539 5096 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_11020 5976 5230 gene locus_tag LOCUS_11030 gene pyrH 5976 5230 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_11030 6748 6011 gene locus_tag LOCUS_11040 6748 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 6909 8918 gene locus_tag LOCUS_11050 6909 8918 CDS product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_11050 9567 8998 gene locus_tag LOCUS_11060 9567 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 10763 9579 gene locus_tag LOCUS_11070 10763 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 11145 12140 gene locus_tag LOCUS_11080 11145 12140 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_11080 12460 13089 gene locus_tag LOCUS_11090 12460 13089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 13592 13176 gene locus_tag LOCUS_11100 13592 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence065 2358 3368 gene locus_tag LOCUS_11110 gene nadA 2358 3368 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_11110 4270 3446 gene locus_tag LOCUS_11120 4270 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 6214 4346 gene locus_tag LOCUS_11130 gene mnmG 6214 4346 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_11130 6838 6251 gene locus_tag LOCUS_11140 6838 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 7468 7016 gene locus_tag LOCUS_11150 gene ybeY 7468 7016 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_11150 7549 7779 gene locus_tag LOCUS_11160 7549 7779 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545730.1 protein_id gnl|my_center|LOCUS_11160 7848 8420 gene locus_tag LOCUS_11170 gene nadD 7848 8420 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_11170 8575 9372 gene locus_tag LOCUS_11180 8575 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 9491 10681 gene locus_tag LOCUS_11190 gene hflX 9491 10681 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964502.1 protein_id gnl|my_center|LOCUS_11190 10686 11009 gene locus_tag LOCUS_11200 10686 11009 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004151769.1 protein_id gnl|my_center|LOCUS_11200 11108 12574 gene locus_tag LOCUS_11210 11108 12574 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence066 894 469 gene locus_tag LOCUS_11220 894 469 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_11220 1216 2931 gene locus_tag LOCUS_11230 1216 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3026 4714 gene locus_tag LOCUS_11240 3026 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 4784 6475 gene locus_tag LOCUS_11250 4784 6475 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767962.1 protein_id gnl|my_center|LOCUS_11250 6472 6927 gene locus_tag LOCUS_11260 gene bcp 6472 6927 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_11260 7026 7523 gene locus_tag LOCUS_11270 gene tpx 7026 7523 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894924.1 protein_id gnl|my_center|LOCUS_11270 8098 7589 gene locus_tag LOCUS_11280 8098 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 8659 8117 gene locus_tag LOCUS_11290 8659 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 10454 8694 gene locus_tag LOCUS_11300 10454 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 12685 10697 gene locus_tag LOCUS_11310 12685 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 <13275 12733 gene locus_tag LOCUS_11320 <13275 12733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098180.1:LytTR family DNA-binding domain-containing protein >Feature sequence067 <1 974 gene locus_tag LOCUS_11330 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108035.1:glycoside hydrolase family 76 protein 1046 1987 gene locus_tag LOCUS_11340 1046 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 1959 4571 gene locus_tag LOCUS_11350 1959 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11350 4845 5894 gene locus_tag LOCUS_11360 gene rlmN 4845 5894 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_11360 5962 7035 gene locus_tag LOCUS_11370 5962 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 7168 7878 gene locus_tag LOCUS_11380 7168 7878 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_11380 9150 7954 gene locus_tag LOCUS_11390 gene manA 9150 7954 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170701.1 protein_id gnl|my_center|LOCUS_11390 9254 9619 gene locus_tag LOCUS_11400 9254 9619 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_11400 9649 9894 gene locus_tag LOCUS_11410 9649 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 11063 9927 gene locus_tag LOCUS_11420 11063 9927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966748.1 protein_id gnl|my_center|LOCUS_11420 12400 11153 gene locus_tag LOCUS_11430 12400 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 13126 12710 gene locus_tag LOCUS_11440 13126 12710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence068 1254 397 gene locus_tag LOCUS_11450 1254 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2270 1308 gene locus_tag LOCUS_11460 2270 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2848 2774 gene locus_tag LOCUS_t00160 2848 2774 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3001 3975 gene locus_tag LOCUS_11470 3001 3975 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_11470 4015 4893 gene locus_tag LOCUS_11480 gene dapA 4015 4893 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_11480 5047 6582 gene locus_tag LOCUS_11490 5047 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 6619 7395 gene locus_tag LOCUS_11500 6619 7395 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_11500 8505 7399 gene locus_tag LOCUS_11510 8505 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 8643 10574 gene locus_tag LOCUS_11520 gene thrS 8643 10574 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_11520 10639 11298 gene locus_tag LOCUS_11530 10639 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 11514 12632 gene locus_tag LOCUS_11540 11514 12632 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence069 1182 589 gene locus_tag LOCUS_11550 1182 589 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_11550 2678 1236 gene locus_tag LOCUS_11560 gene nrfD 2678 1236 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_11560 5840 2736 gene locus_tag LOCUS_11570 5840 2736 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_11570 7142 5895 gene locus_tag LOCUS_11580 7142 5895 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_11580 7480 8064 gene locus_tag LOCUS_11590 gene purN 7480 8064 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_11590 10623 8086 gene locus_tag LOCUS_11600 10623 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 12057 11074 gene locus_tag LOCUS_11610 gene corA 12057 11074 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence070 662 222 gene locus_tag LOCUS_11620 662 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1576 806 gene locus_tag LOCUS_11630 gene radC 1576 806 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_11630 1635 2597 gene locus_tag LOCUS_11640 1635 2597 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_11640 2618 3202 gene locus_tag LOCUS_11650 2618 3202 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_11650 3339 3917 gene locus_tag LOCUS_11660 gene pth 3339 3917 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764745.1 protein_id gnl|my_center|LOCUS_11660 3954 6188 gene locus_tag LOCUS_11670 3954 6188 CDS product FUSC family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534567.1 protein_id gnl|my_center|LOCUS_11670 8187 6175 gene locus_tag LOCUS_11680 8187 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11680 8825 8274 gene locus_tag LOCUS_11690 8825 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11690 8984 10159 gene locus_tag LOCUS_11700 8984 10159 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_11700 10175 10534 gene locus_tag LOCUS_11710 10175 10534 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715468.1 protein_id gnl|my_center|LOCUS_11710 10751 10539 gene locus_tag LOCUS_11720 10751 10539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 11695 11309 gene locus_tag LOCUS_11730 11695 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11730 <13036 12109 gene locus_tag LOCUS_11740 <13036 12109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962449.1:aspartate--tRNA ligase >Feature sequence071 <1 1182 gene locus_tag LOCUS_11750 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962646.1:serine hydrolase domain-containing protein 1189 1731 gene locus_tag LOCUS_11760 1189 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2648 1743 gene locus_tag LOCUS_11770 gene xerD 2648 1743 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_11770 3558 2659 gene locus_tag LOCUS_11780 3558 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5455 3542 gene locus_tag LOCUS_11790 5455 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 8025 5569 gene locus_tag LOCUS_11800 8025 5569 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_11800 9661 8171 gene locus_tag LOCUS_11810 9661 8171 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116671.1 protein_id gnl|my_center|LOCUS_11810 10886 9852 gene locus_tag LOCUS_11820 gene adhP 10886 9852 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_11820 12580 11057 gene locus_tag LOCUS_11830 12580 11057 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence072 976 320 gene locus_tag LOCUS_11840 976 320 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_11840 1604 990 gene locus_tag LOCUS_11850 1604 990 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963208.1 protein_id gnl|my_center|LOCUS_11850 1698 2684 gene locus_tag LOCUS_11860 1698 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2760 4859 gene locus_tag LOCUS_11870 2760 4859 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_11870 5036 5779 gene locus_tag LOCUS_11880 5036 5779 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_11880 5968 8091 gene locus_tag LOCUS_11890 5968 8091 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_11890 8874 8161 gene locus_tag LOCUS_11900 8874 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 9400 8912 gene locus_tag LOCUS_11910 9400 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 10104 9697 gene locus_tag LOCUS_11920 10104 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 10683 10177 gene locus_tag LOCUS_11930 10683 10177 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_11930 10936 10685 gene locus_tag LOCUS_11940 10936 10685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 11808 11188 gene locus_tag LOCUS_11950 11808 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 <13004 12206 gene locus_tag LOCUS_11960 <13004 12206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792044.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence073 104 505 gene locus_tag LOCUS_11970 104 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 515 1243 gene locus_tag LOCUS_11980 515 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1278 2576 gene locus_tag LOCUS_11990 1278 2576 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 protein_id gnl|my_center|LOCUS_11990 2581 3468 gene locus_tag LOCUS_12000 2581 3468 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_12000 3505 4383 gene locus_tag LOCUS_12010 3505 4383 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_12010 4433 5167 gene locus_tag LOCUS_12020 4433 5167 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_12020 5149 5853 gene locus_tag LOCUS_12030 5149 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5957 6412 gene locus_tag LOCUS_12040 gene ftnA 5957 6412 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348910.1 protein_id gnl|my_center|LOCUS_12040 8121 6487 gene locus_tag LOCUS_12050 8121 6487 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_12050 8494 9849 gene locus_tag LOCUS_12060 8494 9849 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530022.1 protein_id gnl|my_center|LOCUS_12060 10147 11190 gene locus_tag LOCUS_12070 10147 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 <12897 11419 gene locus_tag LOCUS_12080 <12897 11419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268270.1:NADP-dependent isocitrate dehydrogenase >Feature sequence074 344 1642 gene locus_tag LOCUS_12090 344 1642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_12090 2145 1741 gene locus_tag LOCUS_12100 2145 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2524 2312 gene locus_tag LOCUS_12110 2524 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 3166 2663 gene locus_tag LOCUS_12120 3166 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3601 4470 gene locus_tag LOCUS_12130 3601 4470 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_12130 5366 4737 gene locus_tag LOCUS_12140 5366 4737 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_12140 6359 5622 gene locus_tag LOCUS_12150 6359 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 7156 6566 gene locus_tag LOCUS_12160 gene pncA 7156 6566 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444893.1 protein_id gnl|my_center|LOCUS_12160 9333 7228 gene locus_tag LOCUS_12170 9333 7228 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963184.1 protein_id gnl|my_center|LOCUS_12170 9560 10324 gene locus_tag LOCUS_12180 9560 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 11768 10431 gene locus_tag LOCUS_12190 11768 10431 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence075 3649 2750 gene locus_tag LOCUS_12200 3649 2750 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_12200 3942 5372 gene locus_tag LOCUS_12210 3942 5372 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_12210 5555 8920 gene locus_tag LOCUS_12220 5555 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 9009 10508 gene locus_tag LOCUS_12230 9009 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 11170 10733 gene locus_tag LOCUS_12240 11170 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 11547 11161 gene locus_tag LOCUS_12250 11547 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 <12485 11667 gene locus_tag LOCUS_12260 <12485 11667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767195.1:AraC family transcriptional regulator >Feature sequence076 344 1753 gene locus_tag LOCUS_12270 344 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3010 1760 gene locus_tag LOCUS_12280 3010 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 3259 4371 gene locus_tag LOCUS_12290 3259 4371 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486313.1 protein_id gnl|my_center|LOCUS_12290 4414 5943 gene locus_tag LOCUS_12300 4414 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 6194 6592 gene locus_tag LOCUS_12310 6194 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 6589 7206 gene locus_tag LOCUS_12320 6589 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 7736 7269 gene locus_tag LOCUS_12330 7736 7269 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705527.1 protein_id gnl|my_center|LOCUS_12330 9971 7815 gene locus_tag LOCUS_12340 9971 7815 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_12340 10231 10305 gene locus_tag LOCUS_t00170 10231 10305 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence077 201 1628 gene locus_tag LOCUS_12350 201 1628 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762491.1 protein_id gnl|my_center|LOCUS_12350 2069 8314 gene locus_tag LOCUS_12360 2069 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 8465 9727 gene locus_tag LOCUS_12370 gene fucP 8465 9727 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_12370 9729 10058 gene locus_tag LOCUS_12380 9729 10058 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039139.1 protein_id gnl|my_center|LOCUS_12380 10076 10267 gene locus_tag LOCUS_12390 10076 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12390 10462 11226 gene locus_tag LOCUS_12400 10462 11226 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_12400 11240 11749 gene locus_tag LOCUS_12410 11240 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence078 2093 666 gene locus_tag LOCUS_12420 2093 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2297 2671 gene locus_tag LOCUS_12430 2297 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2796 2951 gene locus_tag LOCUS_12440 gene rpmH 2796 2951 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_12440 3065 4093 gene locus_tag LOCUS_12450 3065 4093 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_12450 4144 5325 gene locus_tag LOCUS_12460 4144 5325 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932730.1 protein_id gnl|my_center|LOCUS_12460 5353 7704 gene locus_tag LOCUS_12470 5353 7704 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_12470 7769 8512 gene locus_tag LOCUS_12480 7769 8512 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_12480 8555 9517 gene locus_tag LOCUS_12490 8555 9517 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_12490 9527 9679 gene locus_tag LOCUS_12500 9527 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 11408 10788 gene locus_tag LOCUS_12510 11408 10788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206206158.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence079 1128 481 gene locus_tag LOCUS_12520 1128 481 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207528.1 protein_id gnl|my_center|LOCUS_12520 1231 1623 gene locus_tag LOCUS_12530 1231 1623 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206336.1 protein_id gnl|my_center|LOCUS_12530 1667 3691 gene locus_tag LOCUS_12540 1667 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990092.1 protein_id gnl|my_center|LOCUS_12540 4803 3754 gene locus_tag LOCUS_12550 4803 3754 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862382.1 protein_id gnl|my_center|LOCUS_12550 8313 4936 gene locus_tag LOCUS_12560 8313 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8459 9334 gene locus_tag LOCUS_12570 8459 9334 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_12570 9405 9665 gene locus_tag LOCUS_12580 9405 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 10130 9753 gene locus_tag LOCUS_12590 10130 9753 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207903.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence080 877 308 gene locus_tag LOCUS_12600 877 308 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_12600 2349 937 gene locus_tag LOCUS_12610 2349 937 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_12610 3993 2971 gene locus_tag LOCUS_12620 3993 2971 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705075.1 protein_id gnl|my_center|LOCUS_12620 5210 4056 gene locus_tag LOCUS_12630 gene hisB 5210 4056 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963105.1 protein_id gnl|my_center|LOCUS_12630 6135 5221 gene locus_tag LOCUS_12640 6135 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 7312 6302 gene locus_tag LOCUS_12650 7312 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 8780 7386 gene locus_tag LOCUS_12660 gene mgtE 8780 7386 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933513.1 protein_id gnl|my_center|LOCUS_12660 8905 9678 gene locus_tag LOCUS_12670 8905 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 9857 10495 gene locus_tag LOCUS_12680 9857 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 10638 11375 gene locus_tag LOCUS_12690 10638 11375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 <12091 11450 gene locus_tag LOCUS_12700 <12091 11450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962584.1:L-glutamate gamma-semialdehyde dehydrogenase >Feature sequence081 312 1088 gene locus_tag LOCUS_12710 312 1088 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_12710 1248 1976 gene locus_tag LOCUS_12720 1248 1976 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_12720 2570 1998 gene locus_tag LOCUS_12730 2570 1998 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963926.1 protein_id gnl|my_center|LOCUS_12730 3334 2765 gene locus_tag LOCUS_12740 3334 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3401 4465 gene locus_tag LOCUS_12750 3401 4465 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_12750 5247 4507 gene locus_tag LOCUS_12760 5247 4507 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_12760 7036 5258 gene locus_tag LOCUS_12770 7036 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 7999 7052 gene locus_tag LOCUS_12780 7999 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 8440 8820 gene locus_tag LOCUS_12790 gene rpsL 8440 8820 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_12790 8882 9349 gene locus_tag LOCUS_12800 gene rpsG 8882 9349 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_12800 9500 11047 gene locus_tag LOCUS_12810 9500 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence082 544 41 gene locus_tag LOCUS_12820 544 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12820 2444 525 gene locus_tag LOCUS_12830 2444 525 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12830 2606 3211 gene locus_tag LOCUS_12840 2606 3211 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 protein_id gnl|my_center|LOCUS_12840 3215 3904 gene locus_tag LOCUS_12850 3215 3904 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555511.1 protein_id gnl|my_center|LOCUS_12850 3911 4387 gene locus_tag LOCUS_12860 3911 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 4962 4504 gene locus_tag LOCUS_12870 4962 4504 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229703.1 protein_id gnl|my_center|LOCUS_12870 5392 4955 gene locus_tag LOCUS_12880 5392 4955 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529580.1 protein_id gnl|my_center|LOCUS_12880 5760 5404 gene locus_tag LOCUS_12890 5760 5404 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385272.1 protein_id gnl|my_center|LOCUS_12890 6997 5873 gene locus_tag LOCUS_12900 6997 5873 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963656.1 protein_id gnl|my_center|LOCUS_12900 7773 7027 gene locus_tag LOCUS_12910 7773 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 8814 8113 gene locus_tag LOCUS_12920 8814 8113 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12920 9674 8865 gene locus_tag LOCUS_12930 9674 8865 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_12930 11279 10365 gene locus_tag LOCUS_12940 11279 10365 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138475095.1 protein_id gnl|my_center|LOCUS_12940 <11822 11298 gene locus_tag LOCUS_12950 <11822 11298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099204.1:SDR family oxidoreductase >Feature sequence083 1572 22 gene locus_tag LOCUS_12960 1572 22 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_12960 2685 1939 gene locus_tag LOCUS_12970 2685 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 3005 2814 gene locus_tag LOCUS_12980 3005 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12980 3598 3224 gene locus_tag LOCUS_12990 3598 3224 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 protein_id gnl|my_center|LOCUS_12990 3721 4725 gene locus_tag LOCUS_13000 3721 4725 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_13000 5732 4722 gene locus_tag LOCUS_13010 5732 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6991 5963 gene locus_tag LOCUS_13020 6991 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 7128 7931 gene locus_tag LOCUS_13030 gene scpB 7128 7931 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932165.1 protein_id gnl|my_center|LOCUS_13030 7952 9679 gene locus_tag LOCUS_13040 7952 9679 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_13040 10598 9843 gene locus_tag LOCUS_13050 10598 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 <11814 10784 gene locus_tag LOCUS_13060 <11814 10784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963204.1:adenine deaminase >Feature sequence084 483 2417 gene locus_tag LOCUS_13070 483 2417 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_13070 3392 4048 gene locus_tag LOCUS_13080 gene fsa 3392 4048 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107927.1 protein_id gnl|my_center|LOCUS_13080 6991 4103 gene locus_tag LOCUS_13090 6991 4103 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_13090 7174 10296 gene locus_tag LOCUS_13100 7174 10296 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence085 2055 3431 gene locus_tag LOCUS_13110 2055 3431 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_13110 3716 4639 gene locus_tag LOCUS_13120 3716 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_13120 4830 5342 gene locus_tag LOCUS_13130 4830 5342 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_13130 6449 6084 gene locus_tag LOCUS_13140 6449 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 7462 6539 gene locus_tag LOCUS_13150 7462 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 7739 7664 gene locus_tag LOCUS_t00180 7739 7664 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8626 7805 gene locus_tag LOCUS_13160 8626 7805 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963590.1 protein_id gnl|my_center|LOCUS_13160 11671 8639 gene locus_tag LOCUS_13170 11671 8639 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence086 <1 1206 gene locus_tag LOCUS_13180 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107458.1:isoleucine--tRNA ligase 1211 2026 gene locus_tag LOCUS_13190 1211 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2074 2223 gene locus_tag LOCUS_13200 2074 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3037 2312 gene locus_tag LOCUS_13210 3037 2312 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694907.1 protein_id gnl|my_center|LOCUS_13210 4116 3361 gene locus_tag LOCUS_13220 4116 3361 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208271.1 protein_id gnl|my_center|LOCUS_13220 4581 4162 gene locus_tag LOCUS_13230 4581 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6264 5032 gene locus_tag LOCUS_13240 6264 5032 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767609.1 protein_id gnl|my_center|LOCUS_13240 7713 6394 gene locus_tag LOCUS_13250 gene sufD 7713 6394 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194301.1 protein_id gnl|my_center|LOCUS_13250 8599 7838 gene locus_tag LOCUS_13260 gene sufC 8599 7838 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_13260 10161 8713 gene locus_tag LOCUS_13270 gene sufB 10161 8713 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_13270 10623 10276 gene locus_tag LOCUS_13280 10623 10276 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_13280 11276 10728 gene locus_tag LOCUS_13290 11276 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence087 356 78 gene locus_tag LOCUS_13300 356 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 564 2189 gene locus_tag LOCUS_13310 564 2189 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_13310 2238 3029 gene locus_tag LOCUS_13320 gene surE 2238 3029 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_13320 3033 3335 gene locus_tag LOCUS_13330 3033 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 3346 4104 gene locus_tag LOCUS_13340 3346 4104 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_13340 4139 5167 gene locus_tag LOCUS_13350 gene galE 4139 5167 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_13350 5278 6246 gene locus_tag LOCUS_13360 5278 6246 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_13360 6278 6886 gene locus_tag LOCUS_13370 6278 6886 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_13370 6935 7675 gene locus_tag LOCUS_13380 6935 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 7687 8109 gene locus_tag LOCUS_13390 7687 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 8572 8339 gene locus_tag LOCUS_13400 8572 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 8642 9532 gene locus_tag LOCUS_13410 8642 9532 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245396.1 protein_id gnl|my_center|LOCUS_13410 10867 9542 gene locus_tag LOCUS_13420 10867 9542 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence088 3240 1855 gene locus_tag LOCUS_13430 3240 1855 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963042.1 protein_id gnl|my_center|LOCUS_13430 3934 3257 gene locus_tag LOCUS_13440 3934 3257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_13440 6389 4023 gene locus_tag LOCUS_13450 6389 4023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_13450 8897 6438 gene locus_tag LOCUS_13460 8897 6438 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_13460 9690 8935 gene locus_tag LOCUS_13470 9690 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 9978 9733 gene locus_tag LOCUS_13480 9978 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 11247 9997 gene locus_tag LOCUS_13490 11247 9997 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence089 2548 1502 gene locus_tag LOCUS_13500 2548 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 4224 2632 gene locus_tag LOCUS_13510 4224 2632 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766147.1 protein_id gnl|my_center|LOCUS_13510 7609 4262 gene locus_tag LOCUS_13520 7609 4262 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_13520 8987 7863 gene locus_tag LOCUS_13530 8987 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 9659 9078 gene locus_tag LOCUS_13540 9659 9078 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_13540 10244 10999 gene locus_tag LOCUS_13550 10244 10999 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963028.1 protein_id gnl|my_center|LOCUS_13550 11210 11061 gene locus_tag LOCUS_13560 11210 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence090 990 346 gene locus_tag LOCUS_13570 990 346 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_13570 4271 1002 gene locus_tag LOCUS_13580 4271 1002 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157567585.1 protein_id gnl|my_center|LOCUS_13580 5752 4268 gene locus_tag LOCUS_13590 5752 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13590 7540 5915 gene locus_tag LOCUS_13600 7540 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13600 8782 7574 gene locus_tag LOCUS_13610 gene mtrC 8782 7574 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224968.1 protein_id gnl|my_center|LOCUS_13610 10110 8809 gene locus_tag LOCUS_13620 10110 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 11046 10462 gene locus_tag LOCUS_13630 11046 10462 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence091 223 1224 gene locus_tag LOCUS_13640 223 1224 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084062.1 protein_id gnl|my_center|LOCUS_13640 1525 2889 gene locus_tag LOCUS_13650 1525 2889 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_13650 4380 2968 gene locus_tag LOCUS_13660 gene dacB 4380 2968 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_13660 4473 5723 gene locus_tag LOCUS_13670 4473 5723 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693669.1 protein_id gnl|my_center|LOCUS_13670 5856 7184 gene locus_tag LOCUS_13680 5856 7184 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_13680 7351 7644 gene locus_tag LOCUS_13690 7351 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 8283 7675 gene locus_tag LOCUS_13700 8283 7675 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_13700 8978 8280 gene locus_tag LOCUS_13710 8978 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 9247 8978 gene locus_tag LOCUS_13720 9247 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 10111 9257 gene locus_tag LOCUS_13730 10111 9257 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_13730 <11030 10190 gene locus_tag LOCUS_13740 <11030 10190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203674.1:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase >Feature sequence092 956 321 gene locus_tag LOCUS_13750 956 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1522 2772 gene locus_tag LOCUS_13760 1522 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3660 4112 gene locus_tag LOCUS_13770 3660 4112 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314059.1 protein_id gnl|my_center|LOCUS_13770 5236 4712 gene locus_tag LOCUS_13780 5236 4712 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974717.1 protein_id gnl|my_center|LOCUS_13780 7417 5291 gene locus_tag LOCUS_13790 gene katE 7417 5291 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266295.1 protein_id gnl|my_center|LOCUS_13790 7971 8201 gene locus_tag LOCUS_13800 7971 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 8633 8905 gene locus_tag LOCUS_13810 8633 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13810 9266 8889 gene locus_tag LOCUS_13820 9266 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 9561 9884 gene locus_tag LOCUS_13830 9561 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 10487 10281 gene locus_tag LOCUS_13840 10487 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence093 1573 1061 gene locus_tag LOCUS_13850 1573 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2849 1959 gene locus_tag LOCUS_13860 2849 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 3799 2816 gene locus_tag LOCUS_13870 3799 2816 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_13870 3921 4652 gene locus_tag LOCUS_13880 3921 4652 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_13880 4751 5461 gene locus_tag LOCUS_13890 gene trmB 4751 5461 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_13890 5606 8707 gene locus_tag LOCUS_13900 5606 8707 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_13900 9243 8782 gene locus_tag LOCUS_13910 9243 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 9548 9276 gene locus_tag LOCUS_13920 9548 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 10313 9762 gene locus_tag LOCUS_13930 10313 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 10759 10427 gene locus_tag LOCUS_13940 10759 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence094 1916 363 gene locus_tag LOCUS_13950 1916 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3138 1936 gene locus_tag LOCUS_13960 3138 1936 CDS product DUF4876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312956.1 protein_id gnl|my_center|LOCUS_13960 5932 3164 gene locus_tag LOCUS_13970 5932 3164 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005829323.1 protein_id gnl|my_center|LOCUS_13970 6640 7179 gene locus_tag LOCUS_13980 6640 7179 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_13980 7232 8227 gene locus_tag LOCUS_13990 7232 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence095 3 251 gene locus_tag LOCUS_14000 3 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 346 804 gene locus_tag LOCUS_14010 gene rpsK 346 804 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_14010 958 1563 gene locus_tag LOCUS_14020 gene rpsD 958 1563 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_14020 1669 2673 gene locus_tag LOCUS_14030 1669 2673 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782229.1 protein_id gnl|my_center|LOCUS_14030 2736 3317 gene locus_tag LOCUS_14040 gene rplQ 2736 3317 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762052.1 protein_id gnl|my_center|LOCUS_14040 3448 4482 gene locus_tag LOCUS_14050 gene thiL 3448 4482 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_14050 4579 5091 gene locus_tag LOCUS_14060 4579 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 5829 5239 gene locus_tag LOCUS_14070 5829 5239 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_14070 6294 7043 gene locus_tag LOCUS_14080 6294 7043 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_14080 7121 8320 gene locus_tag LOCUS_14090 7121 8320 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_14090 8497 9162 gene locus_tag LOCUS_14100 8497 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 9258 9521 gene locus_tag LOCUS_14110 9258 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 9549 10574 gene locus_tag LOCUS_14120 gene argC 9549 10574 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence096 <1 2110 gene locus_tag LOCUS_14130 <1 2110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203260.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 3345 2206 gene locus_tag LOCUS_14140 3345 2206 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962872.1 protein_id gnl|my_center|LOCUS_14140 3737 3453 gene locus_tag LOCUS_14150 3737 3453 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_14150 4332 3730 gene locus_tag LOCUS_14160 4332 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4955 4323 gene locus_tag LOCUS_14170 4955 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 7160 4983 gene locus_tag LOCUS_14180 7160 4983 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_14180 7621 7460 gene locus_tag LOCUS_14190 7621 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 8133 7555 gene locus_tag LOCUS_14200 8133 7555 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258961.1 protein_id gnl|my_center|LOCUS_14200 9748 8297 gene locus_tag LOCUS_14210 9748 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 10503 9865 gene locus_tag LOCUS_14220 10503 9865 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence097 66 857 gene locus_tag LOCUS_14230 66 857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791872.1 protein_id gnl|my_center|LOCUS_14230 1273 2880 gene locus_tag LOCUS_14240 1273 2880 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206450.1 protein_id gnl|my_center|LOCUS_14240 2893 3681 gene locus_tag LOCUS_14250 2893 3681 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088598.1 protein_id gnl|my_center|LOCUS_14250 3682 5718 gene locus_tag LOCUS_14260 3682 5718 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206448.1 protein_id gnl|my_center|LOCUS_14260 5769 6914 gene locus_tag LOCUS_14270 5769 6914 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_14270 6939 7814 gene locus_tag LOCUS_14280 6939 7814 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_14280 7830 8522 gene locus_tag LOCUS_14290 7830 8522 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_14290 8575 9231 gene locus_tag LOCUS_14300 8575 9231 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088567.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence098 1906 947 gene locus_tag LOCUS_14310 1906 947 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_14310 1978 2808 gene locus_tag LOCUS_14320 1978 2808 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_14320 2811 3683 gene locus_tag LOCUS_14330 gene cysM 2811 3683 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_14330 3702 4265 gene locus_tag LOCUS_14340 3702 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 4440 7085 gene locus_tag LOCUS_14350 4440 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 7232 8218 gene locus_tag LOCUS_14360 7232 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 9015 8215 gene locus_tag LOCUS_14370 gene pyrF 9015 8215 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_14370 9164 10264 gene locus_tag LOCUS_14380 9164 10264 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813038.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence099 808 212 gene locus_tag LOCUS_14390 808 212 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_14390 917 1714 gene locus_tag LOCUS_14400 917 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1787 2437 gene locus_tag LOCUS_14410 gene rpe 1787 2437 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_14410 3796 2522 gene locus_tag LOCUS_14420 3796 2522 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963654.1 protein_id gnl|my_center|LOCUS_14420 4401 3808 gene locus_tag LOCUS_14430 4401 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7370 4557 gene locus_tag LOCUS_14440 7370 4557 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_14440 8014 7430 gene locus_tag LOCUS_14450 8014 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 8266 9198 gene locus_tag LOCUS_14460 gene prfB 8266 9198 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14460 9258 9332 gene locus_tag LOCUS_t00190 9258 9332 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9471 10220 gene locus_tag LOCUS_14470 9471 10220 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_14470 10234 10431 gene locus_tag LOCUS_14480 10234 10431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14480 >Feature sequence100 1505 489 gene locus_tag LOCUS_14490 1505 489 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_14490 1730 2923 gene locus_tag LOCUS_14500 gene kbl 1730 2923 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_14500 3044 4003 gene locus_tag LOCUS_14510 3044 4003 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_14510 5230 4298 gene locus_tag LOCUS_14520 gene queG 5230 4298 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_14520 5293 5709 gene locus_tag LOCUS_14530 5293 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 5845 7179 gene locus_tag LOCUS_14540 5845 7179 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_14540 7271 8311 gene locus_tag LOCUS_14550 7271 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 9273 8317 gene locus_tag LOCUS_14560 9273 8317 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_14560 <10426 9458 gene locus_tag LOCUS_14570 <10426 9458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963471.1:elongation factor G >Feature sequence101 437 353 gene locus_tag LOCUS_t00200 437 353 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 703 1479 gene locus_tag LOCUS_14580 703 1479 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_14580 1904 1524 gene locus_tag LOCUS_14590 gene gcvH 1904 1524 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_14590 2073 2684 gene locus_tag LOCUS_14600 2073 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2719 3111 gene locus_tag LOCUS_14610 2719 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3342 3698 gene locus_tag LOCUS_14620 3342 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 5993 3804 gene locus_tag LOCUS_14630 5993 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 6492 6007 gene locus_tag LOCUS_14640 6492 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 8016 6502 gene locus_tag LOCUS_14650 8016 6502 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208888955.1 protein_id gnl|my_center|LOCUS_14650 9269 8184 gene locus_tag LOCUS_14660 9269 8184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence102 <1 820 gene locus_tag LOCUS_14670 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963912.1:adenylosuccinate lyase 1137 2057 gene locus_tag LOCUS_14680 1137 2057 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926866.1 protein_id gnl|my_center|LOCUS_14680 2156 3151 gene locus_tag LOCUS_14690 gene trpS 2156 3151 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165562.1 protein_id gnl|my_center|LOCUS_14690 3168 3803 gene locus_tag LOCUS_14700 3168 3803 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_14700 3831 5609 gene locus_tag LOCUS_14710 gene argS 3831 5609 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_14710 6956 5694 gene locus_tag LOCUS_14720 6956 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 7114 8340 gene locus_tag LOCUS_14730 gene pepT 7114 8340 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_14730 9626 8391 gene locus_tag LOCUS_14740 9626 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 10026 9742 gene locus_tag LOCUS_14750 10026 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence103 1232 201 gene locus_tag LOCUS_14760 1232 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1677 1222 gene locus_tag LOCUS_14770 1677 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2146 1811 gene locus_tag LOCUS_14780 2146 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2265 3107 gene locus_tag LOCUS_14790 2265 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3851 4102 gene locus_tag LOCUS_14800 3851 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 4109 4438 gene locus_tag LOCUS_14810 4109 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 4539 4742 gene locus_tag LOCUS_14820 4539 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 4781 5017 gene locus_tag LOCUS_14830 4781 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 5734 6675 gene locus_tag LOCUS_14840 5734 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 6668 7345 gene locus_tag LOCUS_14850 gene kdpE 6668 7345 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405305.1 protein_id gnl|my_center|LOCUS_14850 7459 9426 gene locus_tag LOCUS_14860 7459 9426 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_14860 9430 9723 gene locus_tag LOCUS_14870 9430 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence104 4605 2221 gene locus_tag LOCUS_14880 4605 2221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_14880 7105 4709 gene locus_tag LOCUS_14890 7105 4709 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_14890 9512 7143 gene locus_tag LOCUS_14900 9512 7143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_14900 <10106 9539 gene locus_tag LOCUS_14910 <10106 9539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_121811552.1:ABC transporter permease >Feature sequence105 1805 798 gene locus_tag LOCUS_14920 1805 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3009 1936 gene locus_tag LOCUS_14930 gene serC 3009 1936 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962801.1 protein_id gnl|my_center|LOCUS_14930 3757 3101 gene locus_tag LOCUS_14940 3757 3101 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_14940 3896 4600 gene locus_tag LOCUS_14950 3896 4600 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_14950 4612 5394 gene locus_tag LOCUS_14960 4612 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 5694 7202 gene locus_tag LOCUS_14970 5694 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 7226 7954 gene locus_tag LOCUS_14980 7226 7954 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_14980 9095 7998 gene locus_tag LOCUS_14990 9095 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 9557 9141 gene locus_tag LOCUS_15000 9557 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence106 <1 1548 gene locus_tag LOCUS_15010 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963971.1:RelA/SpoT family protein 2579 1638 gene locus_tag LOCUS_15020 2579 1638 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_15020 3330 2596 gene locus_tag LOCUS_15030 3330 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5048 3402 gene locus_tag LOCUS_15040 5048 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 5709 5176 gene locus_tag LOCUS_15050 5709 5176 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_15050 6271 5756 gene locus_tag LOCUS_15060 6271 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_15060 6914 6384 gene locus_tag LOCUS_15070 6914 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 6929 7129 gene locus_tag LOCUS_15080 6929 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 7782 7408 gene locus_tag LOCUS_15090 7782 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 7921 8856 gene locus_tag LOCUS_15100 7921 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 9713 8949 gene locus_tag LOCUS_15110 9713 8949 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence107 1701 802 gene locus_tag LOCUS_15120 1701 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2240 1767 gene locus_tag LOCUS_15130 2240 1767 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_15130 2983 2255 gene locus_tag LOCUS_15140 2983 2255 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_15140 4067 2988 gene locus_tag LOCUS_15150 4067 2988 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_15150 4392 4153 gene locus_tag LOCUS_15160 4392 4153 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213369.1 protein_id gnl|my_center|LOCUS_15160 4536 5264 gene locus_tag LOCUS_15170 4536 5264 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_15170 5292 6197 gene locus_tag LOCUS_15180 gene cysD 5292 6197 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_15180 6229 6609 gene locus_tag LOCUS_15190 6229 6609 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_15190 6656 7897 gene locus_tag LOCUS_15200 6656 7897 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087711038.1 protein_id gnl|my_center|LOCUS_15200 7931 8746 gene locus_tag LOCUS_15210 gene cobA 7931 8746 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480270.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence108 1778 1860 gene locus_tag LOCUS_t00210 1778 1860 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1945 3324 gene locus_tag LOCUS_15220 gene tig 1945 3324 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_15220 3495 3854 gene locus_tag LOCUS_15230 3495 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 3913 6876 gene locus_tag LOCUS_15240 3913 6876 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_15240 6968 7531 gene locus_tag LOCUS_15250 6968 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 8583 7528 gene locus_tag LOCUS_15260 8583 7528 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_15260 <9876 8661 gene locus_tag LOCUS_15270 <9876 8661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073016.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence109 1 678 gene locus_tag LOCUS_15280 1 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 852 4205 gene locus_tag LOCUS_15290 852 4205 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_15290 4431 6011 gene locus_tag LOCUS_15300 4431 6011 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_15300 6993 6172 gene locus_tag LOCUS_15310 6993 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 9442 6995 gene locus_tag LOCUS_15320 9442 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence110 306 112 gene locus_tag LOCUS_15330 306 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1020 334 gene locus_tag LOCUS_15340 1020 334 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267339.1 protein_id gnl|my_center|LOCUS_15340 1634 1053 gene locus_tag LOCUS_15350 1634 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2857 1640 gene locus_tag LOCUS_15360 2857 1640 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_15360 3262 2873 gene locus_tag LOCUS_15370 gene rbfA 3262 2873 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_15370 3454 4080 gene locus_tag LOCUS_15380 3454 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4096 4704 gene locus_tag LOCUS_15390 4096 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 4924 5358 gene locus_tag LOCUS_15400 4924 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 6271 5438 gene locus_tag LOCUS_15410 gene tsf 6271 5438 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_15410 7345 6455 gene locus_tag LOCUS_15420 gene rpsB 7345 6455 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_15420 7771 7382 gene locus_tag LOCUS_15430 gene rpsI 7771 7382 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_15430 8254 7811 gene locus_tag LOCUS_15440 gene rplM 8254 7811 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933443.1 protein_id gnl|my_center|LOCUS_15440 8975 8415 gene locus_tag LOCUS_15450 8975 8415 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_15450 9344 9102 gene locus_tag LOCUS_15460 9344 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence111 1126 83 gene locus_tag LOCUS_15470 1126 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1851 1294 gene locus_tag LOCUS_15480 1851 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 2387 2022 gene locus_tag LOCUS_15490 gene nrdI 2387 2022 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959447.1 protein_id gnl|my_center|LOCUS_15490 3343 2384 gene locus_tag LOCUS_15500 gene ftsY 3343 2384 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_15500 4087 3389 gene locus_tag LOCUS_15510 gene pyrE 4087 3389 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762667.1 protein_id gnl|my_center|LOCUS_15510 4407 4823 gene locus_tag LOCUS_15520 4407 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 4920 7106 gene locus_tag LOCUS_15530 4920 7106 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_15530 7586 7107 gene locus_tag LOCUS_15540 gene ispF 7586 7107 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_15540 8831 7689 gene locus_tag LOCUS_15550 gene porV 8831 7689 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence112 1045 2172 gene locus_tag LOCUS_15560 1045 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2837 2169 gene locus_tag LOCUS_15570 2837 2169 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992806.1 protein_id gnl|my_center|LOCUS_15570 3235 3852 gene locus_tag LOCUS_15580 3235 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 4488 3934 gene locus_tag LOCUS_15590 4488 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15590 5592 4498 gene locus_tag LOCUS_15600 5592 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15600 6080 5676 gene locus_tag LOCUS_15610 6080 5676 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_15610 6676 6194 gene locus_tag LOCUS_15620 gene ribH 6676 6194 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_15620 7429 6689 gene locus_tag LOCUS_15630 7429 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 8476 7475 gene locus_tag LOCUS_15640 gene pdhA 8476 7475 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence113 2735 195 gene locus_tag LOCUS_15650 2735 195 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_15650 2854 3237 gene locus_tag LOCUS_15660 2854 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 3314 4366 gene locus_tag LOCUS_15670 gene mutY 3314 4366 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_15670 5612 4416 gene locus_tag LOCUS_15680 5612 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 6535 5630 gene locus_tag LOCUS_15690 6535 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 7802 6699 gene locus_tag LOCUS_15700 7802 6699 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_15700 8779 7826 gene locus_tag LOCUS_15710 8779 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_15710 <9501 8803 gene locus_tag LOCUS_15720 <9501 8803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259732.1:alpha/beta hydrolase-fold protein >Feature sequence114 452 1663 gene locus_tag LOCUS_15730 452 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1751 2305 gene locus_tag LOCUS_15740 1751 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3322 2372 gene locus_tag LOCUS_15750 3322 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 5745 3352 gene locus_tag LOCUS_15760 5745 3352 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_15760 8846 5844 gene locus_tag LOCUS_15770 8846 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence115 1605 2501 gene locus_tag LOCUS_15780 1605 2501 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_15780 2581 3783 gene locus_tag LOCUS_15790 2581 3783 CDS product Bcr/CflA family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957917.1 protein_id gnl|my_center|LOCUS_15790 7610 3840 gene locus_tag LOCUS_15800 7610 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 8284 7754 gene locus_tag LOCUS_15810 8284 7754 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792003.1 protein_id gnl|my_center|LOCUS_15810 <9410 8371 gene locus_tag LOCUS_15820 <9410 8371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201961.1:M20 family metallo-hydrolase >Feature sequence116 236 96 gene locus_tag LOCUS_15830 236 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 668 258 gene locus_tag LOCUS_15840 668 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463820.1 protein_id gnl|my_center|LOCUS_15840 1639 827 gene locus_tag LOCUS_15850 1639 827 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_15850 1973 1758 gene locus_tag LOCUS_15860 1973 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2015 2578 gene locus_tag LOCUS_15870 2015 2578 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_15870 2665 3546 gene locus_tag LOCUS_15880 gene pdxI 2665 3546 CDS product pyridoxine 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097798.1 protein_id gnl|my_center|LOCUS_15880 3907 3716 gene locus_tag LOCUS_15890 3907 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 4523 4014 gene locus_tag LOCUS_15900 4523 4014 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106480813.1 protein_id gnl|my_center|LOCUS_15900 4777 5718 gene locus_tag LOCUS_15910 4777 5718 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920700.1 protein_id gnl|my_center|LOCUS_15910 6285 5857 gene locus_tag LOCUS_15920 6285 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 6835 6521 gene locus_tag LOCUS_15930 6835 6521 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084050946.1 protein_id gnl|my_center|LOCUS_15930 7167 6832 gene locus_tag LOCUS_15940 7167 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 9194 7479 gene locus_tag LOCUS_15950 9194 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence117 1091 216 gene locus_tag LOCUS_15960 1091 216 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192727398.1 protein_id gnl|my_center|LOCUS_15960 2025 1069 gene locus_tag LOCUS_15970 2025 1069 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001345592.1 protein_id gnl|my_center|LOCUS_15970 2938 2120 gene locus_tag LOCUS_15980 2938 2120 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192727398.1 protein_id gnl|my_center|LOCUS_15980 3021 3368 gene locus_tag LOCUS_15990 3021 3368 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365536.1 protein_id gnl|my_center|LOCUS_15990 3621 3466 gene locus_tag LOCUS_16000 3621 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 3822 3637 gene locus_tag LOCUS_16010 3822 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3737 4579 gene locus_tag LOCUS_16020 3737 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 4642 5031 gene locus_tag LOCUS_16030 4642 5031 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_16030 5158 5484 gene locus_tag LOCUS_16040 5158 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 5563 6003 gene locus_tag LOCUS_16050 5563 6003 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986713.1 protein_id gnl|my_center|LOCUS_16050 6022 6681 gene locus_tag LOCUS_16060 6022 6681 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_16060 6734 7444 gene locus_tag LOCUS_16070 6734 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 7554 8027 gene locus_tag LOCUS_16080 7554 8027 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_16080 8964 8044 gene locus_tag LOCUS_16090 8964 8044 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119289.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence118 <1 1144 gene locus_tag LOCUS_16100 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963871.1:alkaline phosphatase family protein 1335 2669 gene locus_tag LOCUS_16110 gene tolC 1335 2669 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703513.1 protein_id gnl|my_center|LOCUS_16110 2701 3864 gene locus_tag LOCUS_16120 gene muxA 2701 3864 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MuxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113320.1 protein_id gnl|my_center|LOCUS_16120 3931 7131 gene locus_tag LOCUS_16130 3931 7131 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157567585.1 protein_id gnl|my_center|LOCUS_16130 7541 7203 gene locus_tag LOCUS_16140 gene ytxJ 7541 7203 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_16140 7631 8995 gene locus_tag LOCUS_16150 7631 8995 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence119 1014 2282 gene locus_tag LOCUS_16160 1014 2282 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_16160 2413 3456 gene locus_tag LOCUS_16170 gene lpxD 2413 3456 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_16170 3500 4918 gene locus_tag LOCUS_16180 3500 4918 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_16180 4989 5903 gene locus_tag LOCUS_16190 4989 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 5931 6857 gene locus_tag LOCUS_16200 5931 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001974887.1 protein_id gnl|my_center|LOCUS_16200 8743 6983 gene locus_tag LOCUS_16210 8743 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence120 462 2345 gene locus_tag LOCUS_16220 462 2345 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 protein_id gnl|my_center|LOCUS_16220 3416 2487 gene locus_tag LOCUS_16230 3416 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 4097 5245 gene locus_tag LOCUS_16240 4097 5245 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_16240 5355 6107 gene locus_tag LOCUS_16250 5355 6107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_16250 6846 6148 gene locus_tag LOCUS_16260 6846 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 7480 6857 gene locus_tag LOCUS_16270 7480 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 9003 7525 gene locus_tag LOCUS_16280 9003 7525 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951984.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence121 681 34 gene locus_tag LOCUS_16290 681 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2124 724 gene locus_tag LOCUS_16300 2124 724 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_16300 2900 2175 gene locus_tag LOCUS_16310 gene dapB 2900 2175 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_16310 3583 2933 gene locus_tag LOCUS_16320 3583 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4631 3696 gene locus_tag LOCUS_16330 4631 3696 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_16330 5526 4726 gene locus_tag LOCUS_16340 5526 4726 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_16340 6253 5573 gene locus_tag LOCUS_16350 6253 5573 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_16350 6687 7673 gene locus_tag LOCUS_16360 6687 7673 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_16360 9122 7674 gene locus_tag LOCUS_16370 9122 7674 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence122 1430 195 gene locus_tag LOCUS_16380 1430 195 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_16380 1589 2428 gene locus_tag LOCUS_16390 1589 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2516 3643 gene locus_tag LOCUS_16400 2516 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16400 3659 4288 gene locus_tag LOCUS_16410 3659 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16410 4366 5199 gene locus_tag LOCUS_16420 4366 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 5273 6085 gene locus_tag LOCUS_16430 5273 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 6092 6367 gene locus_tag LOCUS_16440 6092 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6535 7053 gene locus_tag LOCUS_16450 6535 7053 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080283.1 protein_id gnl|my_center|LOCUS_16450 7145 7744 gene locus_tag LOCUS_16460 7145 7744 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_16460 7954 9135 gene locus_tag LOCUS_16470 7954 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence123 2221 3027 gene locus_tag LOCUS_16480 2221 3027 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_16480 4034 3063 gene locus_tag LOCUS_16490 4034 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 4483 4121 gene locus_tag LOCUS_16500 4483 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5606 4656 gene locus_tag LOCUS_16510 gene trxB 5606 4656 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_16510 5706 6437 gene locus_tag LOCUS_16520 5706 6437 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_16520 6555 7856 gene locus_tag LOCUS_16530 6555 7856 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963488.1 protein_id gnl|my_center|LOCUS_16530 <9142 7971 gene locus_tag LOCUS_16540 <9142 7971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109025.1:DNA primase >Feature sequence124 236 3361 gene locus_tag LOCUS_16550 236 3361 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_16550 3372 4850 gene locus_tag LOCUS_16560 3372 4850 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_16560 4876 6702 gene locus_tag LOCUS_16570 4876 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 6705 8105 gene locus_tag LOCUS_16580 6705 8105 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150981032.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence125 1589 1122 gene locus_tag LOCUS_16590 1589 1122 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_16590 8748 1609 gene locus_tag LOCUS_16600 gene sprA 8748 1609 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence126 1370 306 gene locus_tag LOCUS_16610 1370 306 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_16610 1449 2159 gene locus_tag LOCUS_16620 gene lipB 1449 2159 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_16620 2275 3204 gene locus_tag LOCUS_16630 2275 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 3274 3834 gene locus_tag LOCUS_16640 3274 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921973.1 protein_id gnl|my_center|LOCUS_16640 5071 3914 gene locus_tag LOCUS_16650 5071 3914 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764888.1 protein_id gnl|my_center|LOCUS_16650 5403 5125 gene locus_tag LOCUS_16660 5403 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 5566 6138 gene locus_tag LOCUS_16670 5566 6138 CDS product phosphatidylethanolamine N-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509340.1 protein_id gnl|my_center|LOCUS_16670 6766 6290 gene locus_tag LOCUS_16680 gene rnhA 6766 6290 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_16680 7865 6933 gene locus_tag LOCUS_16690 7865 6933 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_16690 8248 8715 gene locus_tag LOCUS_16700 gene mraZ 8248 8715 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence127 1629 1243 gene locus_tag LOCUS_16710 1629 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1906 4134 gene locus_tag LOCUS_16720 1906 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 4795 4190 gene locus_tag LOCUS_16730 gene hisIE 4795 4190 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963101.1 protein_id gnl|my_center|LOCUS_16730 5565 4807 gene locus_tag LOCUS_16740 gene hisF 5565 4807 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_16740 6602 5613 gene locus_tag LOCUS_16750 6602 5613 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130541252.1 protein_id gnl|my_center|LOCUS_16750 6751 8031 gene locus_tag LOCUS_16760 6751 8031 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_16760 8237 8908 gene locus_tag LOCUS_16770 8237 8908 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence128 227 1663 gene locus_tag LOCUS_16780 227 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1715 3472 gene locus_tag LOCUS_16790 1715 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 3513 5315 gene locus_tag LOCUS_16800 3513 5315 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765813.1 protein_id gnl|my_center|LOCUS_16800 5553 6575 gene locus_tag LOCUS_16810 5553 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 6600 6878 gene locus_tag LOCUS_16820 6600 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 6905 7639 gene locus_tag LOCUS_16830 6905 7639 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_16830 7669 8637 gene locus_tag LOCUS_16840 7669 8637 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence129 952 17 gene locus_tag LOCUS_16850 952 17 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_16850 2205 1009 gene locus_tag LOCUS_16860 gene coaBC 2205 1009 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_16860 2708 2364 gene locus_tag LOCUS_16870 2708 2364 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_16870 3483 2677 gene locus_tag LOCUS_16880 3483 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3713 4345 gene locus_tag LOCUS_16890 3713 4345 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_16890 5224 4406 gene locus_tag LOCUS_16900 5224 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 7541 5328 gene locus_tag LOCUS_16910 7541 5328 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_16910 <8796 7650 gene locus_tag LOCUS_16920 <8796 7650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295373.1:cysteine desulfurase >Feature sequence130 <1 1856 gene locus_tag LOCUS_16930 <1 1856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965973.1:glycoside hydrolase family 65 protein 1866 3611 gene locus_tag LOCUS_16940 1866 3611 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202799.1 protein_id gnl|my_center|LOCUS_16940 3623 4996 gene locus_tag LOCUS_16950 3623 4996 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_16950 5062 5628 gene locus_tag LOCUS_16960 5062 5628 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_16960 5715 6911 gene locus_tag LOCUS_16970 5715 6911 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252999.1 protein_id gnl|my_center|LOCUS_16970 6952 7713 gene locus_tag LOCUS_16980 6952 7713 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705962.1 protein_id gnl|my_center|LOCUS_16980 8295 7861 gene locus_tag LOCUS_16990 8295 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 8709 8395 gene locus_tag LOCUS_17000 8709 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence131 402 1793 gene locus_tag LOCUS_17010 gene aspA 402 1793 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791488.1 protein_id gnl|my_center|LOCUS_17010 4568 1893 gene locus_tag LOCUS_17020 4568 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 5663 4638 gene locus_tag LOCUS_17030 5663 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 5944 8307 gene locus_tag LOCUS_17040 5944 8307 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence132 1132 224 gene locus_tag LOCUS_17050 1132 224 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_17050 1191 2093 gene locus_tag LOCUS_17060 1191 2093 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_17060 2199 2810 gene locus_tag LOCUS_17070 2199 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2956 3426 gene locus_tag LOCUS_17080 2956 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17080 3592 4257 gene locus_tag LOCUS_17090 3592 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17090 4336 7755 gene locus_tag LOCUS_17100 gene recB 4336 7755 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703321.1 protein_id gnl|my_center|LOCUS_17100 7855 8259 gene locus_tag LOCUS_17110 gene ndhC 7855 8259 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964322.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence133 1280 348 gene locus_tag LOCUS_17120 gene rsgA 1280 348 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764015.1 protein_id gnl|my_center|LOCUS_17120 3791 1353 gene locus_tag LOCUS_17130 3791 1353 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_17130 4198 4563 gene locus_tag LOCUS_17140 4198 4563 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_17140 4547 4849 gene locus_tag LOCUS_17150 4547 4849 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005820814.1 protein_id gnl|my_center|LOCUS_17150 6013 4853 gene locus_tag LOCUS_17160 gene nreB 6013 4853 CDS product nickel resistance MFS transporter NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_17160 6623 6174 gene locus_tag LOCUS_17170 6623 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17170 7300 6812 gene locus_tag LOCUS_17180 gene folK 7300 6812 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence134 1009 104 gene locus_tag LOCUS_17190 1009 104 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_17190 1280 1990 gene locus_tag LOCUS_17200 1280 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2330 3826 gene locus_tag LOCUS_17210 2330 3826 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_17210 3913 6165 gene locus_tag LOCUS_17220 3913 6165 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203457.1 protein_id gnl|my_center|LOCUS_17220 6694 6194 gene locus_tag LOCUS_17230 gene folA 6694 6194 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_17230 7424 6708 gene locus_tag LOCUS_17240 7424 6708 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_17240 <8513 7500 gene locus_tag LOCUS_17250 <8513 7500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107905.1:RNase adapter RapZ >Feature sequence135 418 56 gene locus_tag LOCUS_17260 418 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1103 519 gene locus_tag LOCUS_17270 1103 519 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_17270 2132 1824 gene locus_tag LOCUS_17280 2132 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 5290 2156 gene locus_tag LOCUS_17290 5290 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 8356 5402 gene locus_tag LOCUS_17300 8356 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence136 555 358 gene locus_tag LOCUS_17310 555 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1682 717 gene locus_tag LOCUS_17320 1682 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17320 2480 1773 gene locus_tag LOCUS_17330 2480 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17330 3770 2760 gene locus_tag LOCUS_17340 3770 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 4651 3857 gene locus_tag LOCUS_17350 4651 3857 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_17350 4732 5829 gene locus_tag LOCUS_17360 4732 5829 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109241.1 protein_id gnl|my_center|LOCUS_17360 5855 6361 gene locus_tag LOCUS_17370 5855 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 6854 7294 gene locus_tag LOCUS_17380 6854 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 7445 8239 gene locus_tag LOCUS_17390 7445 8239 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019565706.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence137 627 1007 gene locus_tag LOCUS_17400 627 1007 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_17400 1872 1081 gene locus_tag LOCUS_17410 1872 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 4081 2057 gene locus_tag LOCUS_17420 4081 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 4648 4328 gene locus_tag LOCUS_17430 4648 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222093.1 protein_id gnl|my_center|LOCUS_17430 5422 4814 gene locus_tag LOCUS_17440 5422 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 6709 5546 gene locus_tag LOCUS_17450 6709 5546 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_17450 6876 7397 gene locus_tag LOCUS_17460 6876 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 8240 7398 gene locus_tag LOCUS_17470 8240 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence138 1438 767 gene locus_tag LOCUS_17480 1438 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3193 1649 gene locus_tag LOCUS_17490 3193 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3799 3299 gene locus_tag LOCUS_17500 3799 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 6406 3803 gene locus_tag LOCUS_17510 6406 3803 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_17510 8075 6420 gene locus_tag LOCUS_17520 8075 6420 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075356.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence139 2483 1788 gene locus_tag LOCUS_17530 2483 1788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_17530 3823 2477 gene locus_tag LOCUS_17540 3823 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 5186 3948 gene locus_tag LOCUS_17550 5186 3948 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919393.1 protein_id gnl|my_center|LOCUS_17550 6521 6706 gene locus_tag LOCUS_17560 6521 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 7559 6990 gene locus_tag LOCUS_17570 gene sigX 7559 6990 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence140 1153 4122 gene locus_tag LOCUS_17580 1153 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 4897 4241 gene locus_tag LOCUS_17590 4897 4241 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_17590 5176 4970 gene locus_tag LOCUS_17600 5176 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence141 1897 677 gene locus_tag LOCUS_17610 gene lat 1897 677 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080767.1 protein_id gnl|my_center|LOCUS_17610 2134 2931 gene locus_tag LOCUS_17620 2134 2931 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_17620 2944 4047 gene locus_tag LOCUS_17630 gene nagA 2944 4047 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478503.1 protein_id gnl|my_center|LOCUS_17630 4558 4028 gene locus_tag LOCUS_17640 4558 4028 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728445.1 protein_id gnl|my_center|LOCUS_17640 4682 5068 gene locus_tag LOCUS_17650 gene apaG 4682 5068 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610901.1 protein_id gnl|my_center|LOCUS_17650 6147 5194 gene locus_tag LOCUS_17660 6147 5194 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226288.1 protein_id gnl|my_center|LOCUS_17660 6236 7009 gene locus_tag LOCUS_17670 6236 7009 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_17670 7580 7888 gene locus_tag LOCUS_17680 7580 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence142 <1 849 gene locus_tag LOCUS_17690 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769575.1:DUF4270 family protein 880 2196 gene locus_tag LOCUS_17700 880 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 4299 2392 gene locus_tag LOCUS_17710 4299 2392 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_17710 4506 5696 gene locus_tag LOCUS_17720 4506 5696 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_17720 8153 5766 gene locus_tag LOCUS_17730 8153 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence143 568 2640 gene locus_tag LOCUS_17740 568 2640 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767003.1 protein_id gnl|my_center|LOCUS_17740 2834 3847 gene locus_tag LOCUS_17750 2834 3847 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_17750 4022 6988 gene locus_tag LOCUS_17760 4022 6988 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence144 141 69 gene locus_tag LOCUS_t00220 141 69 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 276 1037 gene locus_tag LOCUS_17770 276 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1246 2568 gene locus_tag LOCUS_17780 gene ffh 1246 2568 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963594.1 protein_id gnl|my_center|LOCUS_17780 2618 3025 gene locus_tag LOCUS_17790 2618 3025 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_17790 3106 3888 gene locus_tag LOCUS_17800 3106 3888 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_17800 4056 6470 gene locus_tag LOCUS_17810 4056 6470 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_17810 6543 7688 gene locus_tag LOCUS_17820 6543 7688 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence145 442 1539 gene locus_tag LOCUS_17830 442 1539 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_17830 1561 4701 gene locus_tag LOCUS_17840 1561 4701 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932956.1 protein_id gnl|my_center|LOCUS_17840 4714 6132 gene locus_tag LOCUS_17850 4714 6132 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932955.1 protein_id gnl|my_center|LOCUS_17850 <7856 7152 gene locus_tag LOCUS_17860 <7856 7152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228743.1:NADP-dependent isocitrate dehydrogenase >Feature sequence146 356 820 gene locus_tag LOCUS_17870 356 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 807 1325 gene locus_tag LOCUS_17880 807 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2509 1328 gene locus_tag LOCUS_17890 2509 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2978 2586 gene locus_tag LOCUS_17900 2978 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_17900 3656 2988 gene locus_tag LOCUS_17910 3656 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 4840 3824 gene locus_tag LOCUS_17920 4840 3824 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_17920 5080 6012 gene locus_tag LOCUS_17930 5080 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 6114 6974 gene locus_tag LOCUS_17940 6114 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 >Feature sequence147 223 633 gene locus_tag LOCUS_17950 223 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3579 811 gene locus_tag LOCUS_17960 3579 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4830 3844 gene locus_tag LOCUS_17970 4830 3844 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785429.1 protein_id gnl|my_center|LOCUS_17970 5454 4945 gene locus_tag LOCUS_17980 5454 4945 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_17980 <7776 6463 gene locus_tag LOCUS_17990 <7776 6463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107591.1:site-specific integrase >Feature sequence148 3683 777 gene locus_tag LOCUS_18000 3683 777 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766187.1 protein_id gnl|my_center|LOCUS_18000 4184 4930 gene locus_tag LOCUS_18010 4184 4930 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_18010 4999 5379 gene locus_tag LOCUS_18020 gene mscL 4999 5379 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990299.1 protein_id gnl|my_center|LOCUS_18020 5548 6363 gene locus_tag LOCUS_18030 5548 6363 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931830.1 protein_id gnl|my_center|LOCUS_18030 6560 7597 gene locus_tag LOCUS_18040 6560 7597 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225132.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence149 355 1134 gene locus_tag LOCUS_18050 gene folP 355 1134 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_18050 1608 1222 gene locus_tag LOCUS_18060 1608 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2827 1823 gene locus_tag LOCUS_18070 2827 1823 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_18070 3008 4141 gene locus_tag LOCUS_18080 3008 4141 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_18080 5578 4244 gene locus_tag LOCUS_18090 gene argH 5578 4244 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_18090 5841 6353 gene locus_tag LOCUS_18100 5841 6353 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174793.1 protein_id gnl|my_center|LOCUS_18100 6537 7463 gene locus_tag LOCUS_18110 gene nusB 6537 7463 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962698.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence150 1970 243 gene locus_tag LOCUS_18120 gene ggt 1970 243 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_18120 2086 2868 gene locus_tag LOCUS_18130 2086 2868 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_18130 2960 3970 gene locus_tag LOCUS_18140 2960 3970 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_18140 3960 4874 gene locus_tag LOCUS_18150 3960 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 4885 5877 gene locus_tag LOCUS_18160 4885 5877 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704186.1 protein_id gnl|my_center|LOCUS_18160 6788 5892 gene locus_tag LOCUS_18170 6788 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 7628 6855 gene locus_tag LOCUS_18180 7628 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence151 267 1712 gene locus_tag LOCUS_18190 267 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1838 2809 gene locus_tag LOCUS_18200 1838 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2844 3044 gene locus_tag LOCUS_18210 2844 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 4188 3049 gene locus_tag LOCUS_18220 4188 3049 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207152.1 protein_id gnl|my_center|LOCUS_18220 5221 4280 gene locus_tag LOCUS_18230 5221 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 6940 5231 gene locus_tag LOCUS_18240 6940 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 <7632 7058 gene locus_tag LOCUS_18250 <7632 7058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202181.1:alpha-L-fucosidase >Feature sequence152 1172 30 gene locus_tag LOCUS_18260 1172 30 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_18260 1363 1163 gene locus_tag LOCUS_18270 1363 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1720 1376 gene locus_tag LOCUS_18280 1720 1376 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764676.1 protein_id gnl|my_center|LOCUS_18280 3508 2138 gene locus_tag LOCUS_18290 gene mnmE 3508 2138 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_18290 4323 3511 gene locus_tag LOCUS_18300 4323 3511 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963585.1 protein_id gnl|my_center|LOCUS_18300 5331 4453 gene locus_tag LOCUS_18310 5331 4453 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964297.1 protein_id gnl|my_center|LOCUS_18310 5888 5355 gene locus_tag LOCUS_18320 5888 5355 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765212.1 protein_id gnl|my_center|LOCUS_18320 6563 5928 gene locus_tag LOCUS_18330 6563 5928 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964299.1 protein_id gnl|my_center|LOCUS_18330 <7477 6633 gene locus_tag LOCUS_18340 <7477 6633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763543.1:MotA/TolQ/ExbB proton channel family protein >Feature sequence153 <1 1201 gene locus_tag LOCUS_18350 <1 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097937.1:beta-glucosidase BglX 3005 1275 gene locus_tag LOCUS_18360 3005 1275 CDS product aromatic amino acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_18360 3153 4031 gene locus_tag LOCUS_18370 3153 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4086 4613 gene locus_tag LOCUS_18380 4086 4613 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_18380 4686 4892 gene locus_tag LOCUS_18390 4686 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 4977 5762 gene locus_tag LOCUS_18400 4977 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18400 5769 6152 gene locus_tag LOCUS_18410 5769 6152 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence154 254 727 gene locus_tag LOCUS_18420 254 727 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880015.1 protein_id gnl|my_center|LOCUS_18420 1311 796 gene locus_tag LOCUS_18430 1311 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1913 1413 gene locus_tag LOCUS_18440 1913 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3348 2038 gene locus_tag LOCUS_18450 3348 2038 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_18450 3794 3408 gene locus_tag LOCUS_18460 3794 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3900 5438 gene locus_tag LOCUS_18470 gene gpmI 3900 5438 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_18470 6164 5721 gene locus_tag LOCUS_18480 6164 5721 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_18480 6748 6260 gene locus_tag LOCUS_18490 6748 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence155 975 649 gene locus_tag LOCUS_18500 975 649 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_18500 2246 1026 gene locus_tag LOCUS_18510 2246 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730816.1 protein_id gnl|my_center|LOCUS_18510 3405 2398 gene locus_tag LOCUS_18520 3405 2398 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_18520 3656 4234 gene locus_tag LOCUS_18530 3656 4234 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_18530 4356 5513 gene locus_tag LOCUS_18540 gene dnaJ 4356 5513 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202549.1 protein_id gnl|my_center|LOCUS_18540 6728 5571 gene locus_tag LOCUS_18550 6728 5571 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence156 1197 169 gene locus_tag LOCUS_18560 1197 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2452 1337 gene locus_tag LOCUS_18570 2452 1337 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_18570 3530 2454 gene locus_tag LOCUS_18580 gene wecB 3530 2454 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012895956.1 protein_id gnl|my_center|LOCUS_18580 4638 3622 gene locus_tag LOCUS_18590 gene wlbA 4638 3622 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_18590 5162 4797 gene locus_tag LOCUS_18600 5162 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 6230 5253 gene locus_tag LOCUS_18610 gene gcvT 6230 5253 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_18610 <7211 6428 gene locus_tag LOCUS_18620 <7211 6428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762954.1:cysteine--tRNA ligase >Feature sequence157 395 1240 gene locus_tag LOCUS_18630 395 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18630 1337 1741 gene locus_tag LOCUS_18640 1337 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18640 2061 2717 gene locus_tag LOCUS_18650 2061 2717 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763958.1 protein_id gnl|my_center|LOCUS_18650 2836 3315 gene locus_tag LOCUS_18660 2836 3315 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251763.1 protein_id gnl|my_center|LOCUS_18660 3318 3818 gene locus_tag LOCUS_18670 3318 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3833 4321 gene locus_tag LOCUS_18680 3833 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 6077 4371 gene locus_tag LOCUS_18690 6077 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6908 6192 gene locus_tag LOCUS_18700 6908 6192 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence158 142 1248 gene locus_tag LOCUS_18710 142 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1316 2350 gene locus_tag LOCUS_18720 1316 2350 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094570644.1 protein_id gnl|my_center|LOCUS_18720 2399 3817 gene locus_tag LOCUS_18730 2399 3817 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762491.1 protein_id gnl|my_center|LOCUS_18730 3841 4953 gene locus_tag LOCUS_18740 3841 4953 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109096.1 protein_id gnl|my_center|LOCUS_18740 5005 5508 gene locus_tag LOCUS_18750 5005 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 6297 5584 gene locus_tag LOCUS_18760 6297 5584 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963636.1 protein_id gnl|my_center|LOCUS_18760 <7163 6310 gene locus_tag LOCUS_18770 <7163 6310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963137.1:HAMP domain-containing sensor histidine kinase >Feature sequence159 <1 2067 gene locus_tag LOCUS_18780 <1 2067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107855.1:SusC/RagA family TonB-linked outer membrane protein 2089 3459 gene locus_tag LOCUS_18790 2089 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 3933 3538 gene locus_tag LOCUS_18800 3933 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 4576 4115 gene locus_tag LOCUS_18810 4576 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4883 5467 gene locus_tag LOCUS_18820 4883 5467 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_18820 5469 6794 gene locus_tag LOCUS_18830 5469 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence160 904 89 gene locus_tag LOCUS_18840 gene traJ 904 89 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323338.1 protein_id gnl|my_center|LOCUS_18840 1703 1071 gene locus_tag LOCUS_18850 1703 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2398 1763 gene locus_tag LOCUS_18860 2398 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 3130 2450 gene locus_tag LOCUS_18870 3130 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 3812 3183 gene locus_tag LOCUS_18880 3812 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18880 5684 3825 gene locus_tag LOCUS_18890 5684 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18890 6147 5842 gene locus_tag LOCUS_18900 6147 5842 CDS product DUF4133 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040013.1 protein_id gnl|my_center|LOCUS_18900 6697 6251 gene locus_tag LOCUS_18910 6697 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence161 759 130 gene locus_tag LOCUS_18920 759 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 1766 756 gene locus_tag LOCUS_18930 1766 756 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_18930 2666 1848 gene locus_tag LOCUS_18940 gene blaOXA 2666 1848 CDS product OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071128.1 protein_id gnl|my_center|LOCUS_18940 3617 2709 gene locus_tag LOCUS_18950 3617 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3947 3621 gene locus_tag LOCUS_18960 3947 3621 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_18960 4403 3951 gene locus_tag LOCUS_18970 gene dtd 4403 3951 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_18970 4465 4860 gene locus_tag LOCUS_18980 gene arfB 4465 4860 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_18980 5039 6439 gene locus_tag LOCUS_18990 5039 6439 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence162 4588 2969 gene locus_tag LOCUS_19000 4588 2969 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861760.1 protein_id gnl|my_center|LOCUS_19000 2999 3075 gene locus_tag LOCUS_t00230 2999 3075 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4992 4744 gene locus_tag LOCUS_19010 4992 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 5271 5098 gene locus_tag LOCUS_19020 5271 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5803 6648 gene locus_tag LOCUS_19030 5803 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence163 <1 757 gene locus_tag LOCUS_19040 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001214632.1:cell envelope integrity protein CreD 970 2028 gene locus_tag LOCUS_19050 970 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2105 2674 gene locus_tag LOCUS_19060 2105 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19060 2681 3475 gene locus_tag LOCUS_19070 2681 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19070 4375 3494 gene locus_tag LOCUS_19080 4375 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 5154 4498 gene locus_tag LOCUS_19090 5154 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 6818 5280 gene locus_tag LOCUS_19100 6818 5280 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence164 3627 2485 gene locus_tag LOCUS_19110 3627 2485 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_19110 5005 3932 gene locus_tag LOCUS_19120 5005 3932 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946868.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence165 <1 1467 gene locus_tag LOCUS_19130 <1 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814533.1:M13 family metallopeptidase 1647 3086 gene locus_tag LOCUS_19140 1647 3086 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480751.1 protein_id gnl|my_center|LOCUS_19140 3974 3123 gene locus_tag LOCUS_19150 3974 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 4283 3993 gene locus_tag LOCUS_19160 4283 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 5230 4292 gene locus_tag LOCUS_19170 5230 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 6294 5218 gene locus_tag LOCUS_19180 6294 5218 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence166 1445 60 gene locus_tag LOCUS_19190 1445 60 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963595.1 protein_id gnl|my_center|LOCUS_19190 2623 1505 gene locus_tag LOCUS_19200 2623 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3066 2635 gene locus_tag LOCUS_19210 3066 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 4355 3081 gene locus_tag LOCUS_19220 4355 3081 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_19220 5042 4629 gene locus_tag LOCUS_19230 gene ruvX 5042 4629 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963861.1 protein_id gnl|my_center|LOCUS_19230 5961 5047 gene locus_tag LOCUS_19240 5961 5047 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_19240 <6990 5976 gene locus_tag LOCUS_19250 <6990 5976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963911.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence167 3305 723 gene locus_tag LOCUS_19260 3305 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 4165 3389 gene locus_tag LOCUS_19270 4165 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence168 <1 2081 gene locus_tag LOCUS_19280 <1 2081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:fibronectin type III domain-containing protein 2259 3044 gene locus_tag LOCUS_19290 2259 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3580 3206 gene locus_tag LOCUS_19300 3580 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 4696 3590 gene locus_tag LOCUS_19310 4696 3590 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695909.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence169 85 681 gene locus_tag LOCUS_19320 85 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19320 2198 1023 gene locus_tag LOCUS_19330 gene uxuA 2198 1023 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_19330 3035 2217 gene locus_tag LOCUS_19340 3035 2217 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783762.1 protein_id gnl|my_center|LOCUS_19340 4178 3159 gene locus_tag LOCUS_19350 gene fbp 4178 3159 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_19350 5616 4231 gene locus_tag LOCUS_19360 5616 4231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769494.1 protein_id gnl|my_center|LOCUS_19360 6325 5657 gene locus_tag LOCUS_19370 6325 5657 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919369.1 protein_id gnl|my_center|LOCUS_19370 <6915 6328 gene locus_tag LOCUS_19380 <6915 6328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965972.1:sugar kinase >Feature sequence170 1045 797 gene locus_tag LOCUS_19390 1045 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1376 1161 gene locus_tag LOCUS_19400 1376 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 1998 1702 gene locus_tag LOCUS_19410 1998 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 3306 2122 gene locus_tag LOCUS_19420 3306 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 3950 4540 gene locus_tag LOCUS_19430 3950 4540 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_19430 6149 6556 gene locus_tag LOCUS_19440 6149 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence171 <1 2600 gene locus_tag LOCUS_19450 <1 2600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932956.1:efflux RND transporter permease subunit 2638 4059 gene locus_tag LOCUS_19460 2638 4059 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932955.1 protein_id gnl|my_center|LOCUS_19460 4201 4953 gene locus_tag LOCUS_19470 4201 4953 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090604.1 protein_id gnl|my_center|LOCUS_19470 5670 5038 gene locus_tag LOCUS_19480 5670 5038 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_19480 6410 5802 gene locus_tag LOCUS_19490 6410 5802 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence172 2678 441 gene locus_tag LOCUS_19500 2678 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3048 2716 gene locus_tag LOCUS_19510 3048 2716 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_19510 4171 3440 gene locus_tag LOCUS_19520 4171 3440 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_19520 5190 4168 gene locus_tag LOCUS_19530 5190 4168 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence173 1722 907 gene locus_tag LOCUS_19540 gene metQ 1722 907 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 protein_id gnl|my_center|LOCUS_19540 2372 1719 gene locus_tag LOCUS_19550 2372 1719 CDS product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287483.1 protein_id gnl|my_center|LOCUS_19550 2751 2374 gene locus_tag LOCUS_19560 2751 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19560 3125 2748 gene locus_tag LOCUS_19570 3125 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19570 4213 3137 gene locus_tag LOCUS_19580 gene hisC 4213 3137 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694274.1 protein_id gnl|my_center|LOCUS_19580 5715 4267 gene locus_tag LOCUS_19590 5715 4267 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_19590 <6795 5728 gene locus_tag LOCUS_19600 <6795 5728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963475.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence174 182 1075 gene locus_tag LOCUS_19610 182 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1330 3762 gene locus_tag LOCUS_19620 1330 3762 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_19620 5302 4271 gene locus_tag LOCUS_19630 5302 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence175 1129 821 gene locus_tag LOCUS_19640 1129 821 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_19640 3610 1151 gene locus_tag LOCUS_19650 3610 1151 CDS product Plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658068.1 protein_id gnl|my_center|LOCUS_19650 5262 3700 gene locus_tag LOCUS_19660 gene dnaB 5262 3700 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_19660 5767 5693 gene locus_tag LOCUS_t00240 5767 5693 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6055 6414 gene locus_tag LOCUS_19670 6055 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence176 1635 607 gene locus_tag LOCUS_19680 1635 607 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_19680 3090 1702 gene locus_tag LOCUS_19690 3090 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3089 3283 gene locus_tag LOCUS_19700 3089 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 3271 3864 gene locus_tag LOCUS_19710 3271 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 4228 3845 gene locus_tag LOCUS_19720 4228 3845 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_19720 4406 4200 gene locus_tag LOCUS_19730 4406 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 4450 5913 gene locus_tag LOCUS_19740 4450 5913 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_19740 5919 6140 gene locus_tag LOCUS_19750 5919 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence177 1404 1138 gene locus_tag LOCUS_19760 1404 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1532 2122 gene locus_tag LOCUS_19770 1532 2122 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_19770 2663 2980 gene locus_tag LOCUS_19780 2663 2980 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_19780 3170 3736 gene locus_tag LOCUS_19790 3170 3736 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_19790 3770 4219 gene locus_tag LOCUS_19800 3770 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19800 4131 4670 gene locus_tag LOCUS_19810 4131 4670 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014065.1 protein_id gnl|my_center|LOCUS_19810 4848 5477 gene locus_tag LOCUS_19820 4848 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 5854 5507 gene locus_tag LOCUS_19830 5854 5507 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144188.1 protein_id gnl|my_center|LOCUS_19830 5939 6445 gene locus_tag LOCUS_19840 5939 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence178 1234 1971 gene locus_tag LOCUS_19850 gene bshB1 1234 1971 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_19850 2036 3121 gene locus_tag LOCUS_19860 2036 3121 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_19860 3247 4446 gene locus_tag LOCUS_19870 3247 4446 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763375.1 protein_id gnl|my_center|LOCUS_19870 5452 4568 gene locus_tag LOCUS_19880 5452 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 5948 5598 gene locus_tag LOCUS_19890 5948 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 6472 5951 gene locus_tag LOCUS_19900 6472 5951 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence179 950 786 gene locus_tag LOCUS_19910 950 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 895 2319 gene locus_tag LOCUS_19920 895 2319 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 protein_id gnl|my_center|LOCUS_19920 2951 2394 gene locus_tag LOCUS_19930 2951 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 3078 3458 gene locus_tag LOCUS_19940 3078 3458 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190990.1 protein_id gnl|my_center|LOCUS_19940 4184 3486 gene locus_tag LOCUS_19950 4184 3486 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_19950 4269 4658 gene locus_tag LOCUS_19960 4269 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 4801 5226 gene locus_tag LOCUS_19970 4801 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 5279 5923 gene locus_tag LOCUS_19980 5279 5923 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765667.1 protein_id gnl|my_center|LOCUS_19980 5937 6518 gene locus_tag LOCUS_19990 5937 6518 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence180 304 678 gene locus_tag LOCUS_20000 304 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 734 1765 gene locus_tag LOCUS_20010 734 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2368 2568 gene locus_tag LOCUS_20020 2368 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3073 3795 gene locus_tag LOCUS_20030 3073 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3989 4501 gene locus_tag LOCUS_20040 3989 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 4520 4813 gene locus_tag LOCUS_20050 4520 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 5552 4863 gene locus_tag LOCUS_20060 5552 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 6104 5595 gene locus_tag LOCUS_20070 6104 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence181 2896 1376 gene locus_tag LOCUS_20080 2896 1376 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_20080 3092 2889 gene locus_tag LOCUS_20090 3092 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 4595 3288 gene locus_tag LOCUS_20100 4595 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 4958 4599 gene locus_tag LOCUS_20110 4958 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence182 1858 449 gene locus_tag LOCUS_20120 1858 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 3511 2177 gene locus_tag LOCUS_20130 3511 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 4816 3587 gene locus_tag LOCUS_20140 4816 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 6354 4882 gene locus_tag LOCUS_20150 6354 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence183 428 1591 gene locus_tag LOCUS_20160 428 1591 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_20160 1652 2962 gene locus_tag LOCUS_20170 1652 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 4486 3035 gene locus_tag LOCUS_20180 gene prpD 4486 3035 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275861.1 protein_id gnl|my_center|LOCUS_20180 5705 4554 gene locus_tag LOCUS_20190 gene prpC 5705 4554 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187967.1 protein_id gnl|my_center|LOCUS_20190 <6439 5683 gene locus_tag LOCUS_20200 <6439 5683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267426.1:methylisocitrate lyase >Feature sequence184 1542 10 gene locus_tag LOCUS_20210 1542 10 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_20210 1726 2577 gene locus_tag LOCUS_20220 1726 2577 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_20220 4074 2671 gene locus_tag LOCUS_20230 4074 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 6030 4120 gene locus_tag LOCUS_20240 6030 4120 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964457.1 protein_id gnl|my_center|LOCUS_20240 6428 6144 gene locus_tag LOCUS_20250 6428 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence185 1176 262 gene locus_tag LOCUS_20260 1176 262 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 protein_id gnl|my_center|LOCUS_20260 2565 1183 gene locus_tag LOCUS_20270 gene murC 2565 1183 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_20270 3666 2572 gene locus_tag LOCUS_20280 gene murG 3666 2572 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108837.1 protein_id gnl|my_center|LOCUS_20280 4989 3691 gene locus_tag LOCUS_20290 4989 3691 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_20290 <6373 5000 gene locus_tag LOCUS_20300 <6373 5000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010991956.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence186 2022 136 gene locus_tag LOCUS_20310 2022 136 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_20310 3673 2039 gene locus_tag LOCUS_20320 3673 2039 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635999.1 protein_id gnl|my_center|LOCUS_20320 4163 3714 gene locus_tag LOCUS_20330 4163 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 5361 4285 gene locus_tag LOCUS_20340 5361 4285 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_20340 5526 6224 gene locus_tag LOCUS_20350 5526 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence187 397 744 gene locus_tag LOCUS_20360 397 744 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962286.1 protein_id gnl|my_center|LOCUS_20360 908 1399 gene locus_tag LOCUS_20370 908 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1489 3567 gene locus_tag LOCUS_20380 gene ppk1 1489 3567 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271572.1 protein_id gnl|my_center|LOCUS_20380 3579 4475 gene locus_tag LOCUS_20390 3579 4475 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_20390 4866 4465 gene locus_tag LOCUS_20400 4866 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 5004 5666 gene locus_tag LOCUS_20410 5004 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 <6351 5720 gene locus_tag LOCUS_20420 <6351 5720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405048.1:LytTR family DNA-binding domain-containing protein >Feature sequence188 1164 208 gene locus_tag LOCUS_20430 gene metF 1164 208 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404822.1 protein_id gnl|my_center|LOCUS_20430 2611 1319 gene locus_tag LOCUS_20440 2611 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 4201 2624 gene locus_tag LOCUS_20450 4201 2624 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_20450 5199 4207 gene locus_tag LOCUS_20460 5199 4207 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962667.1 protein_id gnl|my_center|LOCUS_20460 5949 5317 gene locus_tag LOCUS_20470 5949 5317 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence189 <1 1670 gene locus_tag LOCUS_20480 <1 1670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840167.1:T9SS type A sorting domain-containing protein 2101 1805 gene locus_tag LOCUS_20490 2101 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20490 2379 2912 gene locus_tag LOCUS_20500 2379 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20500 2919 3104 gene locus_tag LOCUS_20510 2919 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3104 3286 gene locus_tag LOCUS_20520 3104 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3665 3910 gene locus_tag LOCUS_20530 3665 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20530 4505 4245 gene locus_tag LOCUS_20540 4505 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 5346 5053 gene locus_tag LOCUS_20550 5346 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20550 <6320 5419 gene locus_tag LOCUS_20560 <6320 5419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036858670.1:site-specific integrase note possible pseudo, internal stop codon >Feature sequence190 99 1457 gene locus_tag LOCUS_20570 99 1457 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_20570 1567 2517 gene locus_tag LOCUS_20580 1567 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 3895 2615 gene locus_tag LOCUS_20590 3895 2615 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_20590 5569 4139 gene locus_tag LOCUS_20600 5569 4139 CDS product glycoside hydrolase family 30 beta sandwich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108760.1 protein_id gnl|my_center|LOCUS_20600 <6291 5636 gene locus_tag LOCUS_20610 <6291 5636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767524.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence191 1251 2150 gene locus_tag LOCUS_20620 1251 2150 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_20620 2270 3316 gene locus_tag LOCUS_20630 2270 3316 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 protein_id gnl|my_center|LOCUS_20630 3338 4339 gene locus_tag LOCUS_20640 3338 4339 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207884.1 protein_id gnl|my_center|LOCUS_20640 4543 5283 gene locus_tag LOCUS_20650 4543 5283 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968127.1 protein_id gnl|my_center|LOCUS_20650 5990 5418 gene locus_tag LOCUS_20660 5990 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence192 2325 154 gene locus_tag LOCUS_20670 2325 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 3735 2347 gene locus_tag LOCUS_20680 3735 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 5026 3827 gene locus_tag LOCUS_20690 5026 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 5708 5118 gene locus_tag LOCUS_20700 5708 5118 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence193 3002 2538 gene locus_tag LOCUS_20710 3002 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 4347 3085 gene locus_tag LOCUS_20720 4347 3085 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_20720 5395 4433 gene locus_tag LOCUS_20730 5395 4433 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence194 <1 1907 gene locus_tag LOCUS_20740 <1 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108758.1:TonB-dependent receptor 1921 3282 gene locus_tag LOCUS_20750 1921 3282 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767524.1 protein_id gnl|my_center|LOCUS_20750 3897 4661 gene locus_tag LOCUS_20760 3897 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 4793 6106 gene locus_tag LOCUS_20770 4793 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence195 1476 1003 gene locus_tag LOCUS_20780 gene rlmH 1476 1003 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107863.1 protein_id gnl|my_center|LOCUS_20780 4176 1549 gene locus_tag LOCUS_20790 gene mutS 4176 1549 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_20790 4372 5310 gene locus_tag LOCUS_20800 4372 5310 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence196 1188 1355 gene locus_tag LOCUS_20810 1188 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1678 1352 gene locus_tag LOCUS_20820 gene nuoK 1678 1352 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964311.1 protein_id gnl|my_center|LOCUS_20820 2268 1762 gene locus_tag LOCUS_20830 2268 1762 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964312.1 protein_id gnl|my_center|LOCUS_20830 2610 2308 gene locus_tag LOCUS_20840 2610 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20840 2841 2629 gene locus_tag LOCUS_20850 2841 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20850 3931 2882 gene locus_tag LOCUS_20860 gene nuoH 3931 2882 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_20860 5052 3967 gene locus_tag LOCUS_20870 5052 3967 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964315.1 protein_id gnl|my_center|LOCUS_20870 <6053 5094 gene locus_tag LOCUS_20880 <6053 5094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964317.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence197 2599 650 gene locus_tag LOCUS_20890 gene glgB 2599 650 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_20890 2919 2695 gene locus_tag LOCUS_20900 2919 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 4177 2912 gene locus_tag LOCUS_20910 gene xseA 4177 2912 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_20910 5384 4251 gene locus_tag LOCUS_20920 5384 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 6022 5387 gene locus_tag LOCUS_20930 6022 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence198 333 665 gene locus_tag LOCUS_20940 333 665 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_20940 668 1420 gene locus_tag LOCUS_20950 668 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1417 2136 gene locus_tag LOCUS_20960 1417 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2932 2138 gene locus_tag LOCUS_20970 2932 2138 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109413831.1 protein_id gnl|my_center|LOCUS_20970 5749 2951 gene locus_tag LOCUS_20980 5749 2951 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_20980 6012 5940 gene locus_tag LOCUS_t00250 6012 5940 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence199 <1 1375 gene locus_tag LOCUS_20990 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973088.1:FGGY-family carbohydrate kinase 1417 2559 gene locus_tag LOCUS_21000 1417 2559 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494242.1 protein_id gnl|my_center|LOCUS_21000 2717 3100 gene locus_tag LOCUS_21010 2717 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21010 3164 3751 gene locus_tag LOCUS_21020 3164 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21020 3925 4773 gene locus_tag LOCUS_21030 gene kduI 3925 4773 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762839.1 protein_id gnl|my_center|LOCUS_21030 4779 5930 gene locus_tag LOCUS_21040 4779 5930 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence200 555 1655 gene locus_tag LOCUS_21050 555 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1732 2244 gene locus_tag LOCUS_21060 1732 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2249 4861 gene locus_tag LOCUS_21070 2249 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 <5969 4868 gene locus_tag LOCUS_21080 <5969 4868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_168196249.1:LuxR C-terminal-related transcriptional regulator >Feature sequence201 2632 953 gene locus_tag LOCUS_21090 2632 953 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_21090 5686 2663 gene locus_tag LOCUS_21100 5686 2663 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203621.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence202 <1 1940 gene locus_tag LOCUS_21110 <1 1940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786936.1:DUF5686 and carboxypeptidase-like regulatory domain-containing protein 2013 3344 gene locus_tag LOCUS_21120 2013 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 3409 4020 gene locus_tag LOCUS_21130 3409 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 4032 4946 gene locus_tag LOCUS_21140 4032 4946 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055221127.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence203 509 435 gene locus_tag LOCUS_t00260 509 435 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 596 766 gene locus_tag LOCUS_21150 596 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1872 763 gene locus_tag LOCUS_21160 gene lpxB 1872 763 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_21160 2779 1901 gene locus_tag LOCUS_21170 2779 1901 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_21170 3601 2795 gene locus_tag LOCUS_21180 3601 2795 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_21180 3741 3814 gene locus_tag LOCUS_t00270 3741 3814 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4017 4403 gene locus_tag LOCUS_21190 4017 4403 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140715.1 protein_id gnl|my_center|LOCUS_21190 4393 4845 gene locus_tag LOCUS_21200 4393 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 5482 4982 gene locus_tag LOCUS_21210 5482 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence204 1279 2 gene locus_tag LOCUS_21220 gene mraY 1279 2 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_21220 2761 1295 gene locus_tag LOCUS_21230 2761 1295 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_21230 4897 2765 gene locus_tag LOCUS_21240 4897 2765 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_21240 5286 4936 gene locus_tag LOCUS_21250 5286 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 <5946 5290 gene locus_tag LOCUS_21260 <5946 5290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763720.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH >Feature sequence205 348 806 gene locus_tag LOCUS_21270 348 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 1387 803 gene locus_tag LOCUS_21280 1387 803 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_21280 1582 4956 gene locus_tag LOCUS_21290 gene smc 1582 4956 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092731919.1 protein_id gnl|my_center|LOCUS_21290 4899 5108 gene locus_tag LOCUS_21300 4899 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21300 >Feature sequence206 2698 1622 gene locus_tag LOCUS_21310 2698 1622 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_21310 4206 2701 gene locus_tag LOCUS_21320 4206 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 5513 4203 gene locus_tag LOCUS_21330 5513 4203 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109014.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence207 741 2882 gene locus_tag LOCUS_21340 741 2882 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156899988.1 protein_id gnl|my_center|LOCUS_21340 3027 4007 gene locus_tag LOCUS_21350 3027 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 4527 4021 gene locus_tag LOCUS_21360 4527 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5289 4531 gene locus_tag LOCUS_21370 5289 4531 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence208 <1 769 gene locus_tag LOCUS_21380 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_221065779.1:alpha/beta hydrolase 912 1769 gene locus_tag LOCUS_21390 912 1769 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108181.1 protein_id gnl|my_center|LOCUS_21390 1847 2536 gene locus_tag LOCUS_21400 1847 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 3468 2578 gene locus_tag LOCUS_21410 3468 2578 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_21410 3508 3936 gene locus_tag LOCUS_21420 3508 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 <5816 4566 gene locus_tag LOCUS_21430 <5816 4566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764318.1:sialate O-acetylesterase >Feature sequence209 2026 2463 gene locus_tag LOCUS_21440 2026 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 3236 2469 gene locus_tag LOCUS_21450 3236 2469 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761475.1 protein_id gnl|my_center|LOCUS_21450 5737 3392 gene locus_tag LOCUS_21460 gene topA 5737 3392 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence210 1502 204 gene locus_tag LOCUS_21470 1502 204 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_21470 2094 1627 gene locus_tag LOCUS_21480 2094 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962890.1 protein_id gnl|my_center|LOCUS_21480 3072 2197 gene locus_tag LOCUS_21490 3072 2197 CDS product lipid II flippase Amj family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948918.1 protein_id gnl|my_center|LOCUS_21490 3540 3244 gene locus_tag LOCUS_21500 3540 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 3810 3565 gene locus_tag LOCUS_21510 3810 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 4884 3928 gene locus_tag LOCUS_21520 4884 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence211 <1 1210 gene locus_tag LOCUS_21530 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107265.1:ROK family transcriptional regulator 2241 1264 gene locus_tag LOCUS_21540 2241 1264 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_21540 4387 2399 gene locus_tag LOCUS_21550 gene gyrB 4387 2399 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence212 2568 859 gene locus_tag LOCUS_21560 2568 859 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_21560 3866 2763 gene locus_tag LOCUS_21570 gene ychF 3866 2763 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_21570 4672 4058 gene locus_tag LOCUS_21580 4672 4058 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence213 1488 55 gene locus_tag LOCUS_21590 1488 55 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_21590 2936 1626 gene locus_tag LOCUS_21600 2936 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3465 3121 gene locus_tag LOCUS_21610 gene rplT 3465 3121 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_21610 3727 3530 gene locus_tag LOCUS_21620 gene rpmI 3727 3530 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_21620 3992 5038 gene locus_tag LOCUS_21630 3992 5038 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 protein_id gnl|my_center|LOCUS_21630 5561 5157 gene locus_tag LOCUS_21640 5561 5157 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence214 2361 154 gene locus_tag LOCUS_21650 2361 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 protein_id gnl|my_center|LOCUS_21650 2735 2421 gene locus_tag LOCUS_21660 2735 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21660 3211 3005 gene locus_tag LOCUS_21670 3211 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 4072 3491 gene locus_tag LOCUS_21680 4072 3491 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190894.1 protein_id gnl|my_center|LOCUS_21680 5476 4094 gene locus_tag LOCUS_21690 5476 4094 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529374.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence215 3669 412 gene locus_tag LOCUS_21700 3669 412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791110.1 protein_id gnl|my_center|LOCUS_21700 4102 5382 gene locus_tag LOCUS_21710 4102 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence216 216 602 gene locus_tag LOCUS_21720 216 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 967 620 gene locus_tag LOCUS_21730 967 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1154 1573 gene locus_tag LOCUS_21740 1154 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2814 2629 gene locus_tag LOCUS_21750 2814 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 3519 3331 gene locus_tag LOCUS_21760 3519 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence217 3 719 gene locus_tag LOCUS_21770 3 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 794 3289 gene locus_tag LOCUS_21780 794 3289 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769358.1 protein_id gnl|my_center|LOCUS_21780 3671 3940 gene locus_tag LOCUS_21790 3671 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 4542 3937 gene locus_tag LOCUS_21800 4542 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence218 2719 1400 gene locus_tag LOCUS_21810 2719 1400 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_21810 4941 2734 gene locus_tag LOCUS_21820 4941 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311265.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence219 <1 1725 gene locus_tag LOCUS_21830 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963285.1:DNA mismatch repair endonuclease MutL 1823 2941 gene locus_tag LOCUS_21840 1823 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 3019 4257 gene locus_tag LOCUS_21850 3019 4257 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223621.1 protein_id gnl|my_center|LOCUS_21850 4266 4829 gene locus_tag LOCUS_21860 4266 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence220 897 379 gene locus_tag LOCUS_21870 897 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 1628 3241 gene locus_tag LOCUS_21880 1628 3241 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_21880 5261 3477 gene locus_tag LOCUS_21890 5261 3477 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202102.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence221 331 1386 gene locus_tag LOCUS_21900 331 1386 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_21900 2361 2990 gene locus_tag LOCUS_21910 2361 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 3032 4009 gene locus_tag LOCUS_21920 3032 4009 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_21920 4086 4170 gene locus_tag LOCUS_t00280 4086 4170 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4376 5443 gene locus_tag LOCUS_21930 4376 5443 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777415.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence222 1091 45 gene locus_tag LOCUS_21940 1091 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1499 1194 gene locus_tag LOCUS_21950 1499 1194 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661705.1 protein_id gnl|my_center|LOCUS_21950 2274 1534 gene locus_tag LOCUS_21960 2274 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 3397 2393 gene locus_tag LOCUS_21970 3397 2393 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_21970 3759 3412 gene locus_tag LOCUS_21980 3759 3412 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_21980 3817 4821 gene locus_tag LOCUS_21990 3817 4821 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence223 849 109 gene locus_tag LOCUS_22000 849 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22000 1161 952 gene locus_tag LOCUS_22010 1161 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22010 2365 1211 gene locus_tag LOCUS_22020 2365 1211 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067002.1 protein_id gnl|my_center|LOCUS_22020 2984 2409 gene locus_tag LOCUS_22030 2984 2409 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 protein_id gnl|my_center|LOCUS_22030 4724 3045 gene locus_tag LOCUS_22040 4724 3045 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence224 1945 1259 gene locus_tag LOCUS_22050 1945 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2886 1849 gene locus_tag LOCUS_22060 2886 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 3421 2873 gene locus_tag LOCUS_22070 3421 2873 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_22070 3882 3454 gene locus_tag LOCUS_22080 3882 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 3770 4030 gene locus_tag LOCUS_22090 3770 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 4522 4100 gene locus_tag LOCUS_22100 4522 4100 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_22100 5029 4535 gene locus_tag LOCUS_22110 5029 4535 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence225 645 46 gene locus_tag LOCUS_22120 645 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1038 1538 gene locus_tag LOCUS_22130 1038 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1557 1979 gene locus_tag LOCUS_22140 1557 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2911 2060 gene locus_tag LOCUS_22150 2911 2060 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_22150 3162 3725 gene locus_tag LOCUS_22160 gene frr 3162 3725 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_22160 4600 3845 gene locus_tag LOCUS_22170 4600 3845 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence226 586 1515 gene locus_tag LOCUS_22180 586 1515 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_22180 2487 1630 gene locus_tag LOCUS_22190 2487 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 4093 2507 gene locus_tag LOCUS_22200 4093 2507 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100991023.1 protein_id gnl|my_center|LOCUS_22200 <5341 4105 gene locus_tag LOCUS_22210 <5341 4105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062695755.1:TonB-dependent receptor >Feature sequence227 <1 678 gene locus_tag LOCUS_22220 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973724.1:Na+/H+ antiporter 1515 688 gene locus_tag LOCUS_22230 1515 688 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038886.1 protein_id gnl|my_center|LOCUS_22230 1614 2459 gene locus_tag LOCUS_22240 gene ygiD 1614 2459 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_22240 3856 2468 gene locus_tag LOCUS_22250 3856 2468 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963821.1 protein_id gnl|my_center|LOCUS_22250 4844 3924 gene locus_tag LOCUS_22260 4844 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence228 2497 1268 gene locus_tag LOCUS_22270 2497 1268 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649370.1 protein_id gnl|my_center|LOCUS_22270 3472 2534 gene locus_tag LOCUS_22280 gene plsX 3472 2534 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_22280 3909 3715 gene locus_tag LOCUS_22290 gene rpmF 3909 3715 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_22290 4539 3964 gene locus_tag LOCUS_22300 4539 3964 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_22300 <5317 4668 gene locus_tag LOCUS_22310 <5317 4668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963211.1:PglZ domain-containing protein >Feature sequence229 651 1580 gene locus_tag LOCUS_22320 651 1580 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_22320 1596 2069 gene locus_tag LOCUS_22330 gene coaD 1596 2069 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_22330 2196 3158 gene locus_tag LOCUS_22340 2196 3158 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256717.1 protein_id gnl|my_center|LOCUS_22340 4188 3274 gene locus_tag LOCUS_22350 4188 3274 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_22350 5031 4198 gene locus_tag LOCUS_22360 5031 4198 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975379.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence230 1458 787 gene locus_tag LOCUS_22370 1458 787 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_22370 3255 1495 gene locus_tag LOCUS_22380 3255 1495 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_22380 4553 3282 gene locus_tag LOCUS_22390 4553 3282 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_22390 4791 4630 gene locus_tag LOCUS_22400 4791 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence231 1441 1067 gene locus_tag LOCUS_22410 1441 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1890 2777 gene locus_tag LOCUS_22420 gene sucD 1890 2777 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_22420 2868 3944 gene locus_tag LOCUS_22430 2868 3944 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258998.1 protein_id gnl|my_center|LOCUS_22430 4172 4807 gene locus_tag LOCUS_22440 4172 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence232 <1 611 gene locus_tag LOCUS_22450 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004326095.1:RteC domain-containing protein 706 1158 gene locus_tag LOCUS_22460 706 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1787 1362 gene locus_tag LOCUS_22470 1787 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2341 2252 gene locus_tag LOCUS_t00290 2341 2252 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3537 2809 gene locus_tag LOCUS_22480 3537 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 4280 3552 gene locus_tag LOCUS_22490 4280 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 4659 4282 gene locus_tag LOCUS_22500 4659 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence233 2254 503 gene locus_tag LOCUS_22510 2254 503 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963046.1 protein_id gnl|my_center|LOCUS_22510 3620 2463 gene locus_tag LOCUS_22520 3620 2463 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762566.1 protein_id gnl|my_center|LOCUS_22520 3671 4243 gene locus_tag LOCUS_22530 3671 4243 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_22530 <5127 4238 gene locus_tag LOCUS_22540 <5127 4238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963986.1:outer membrane beta-barrel family protein >Feature sequence234 <1 2439 gene locus_tag LOCUS_22550 <1 2439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964117.1:DUF5686 and carboxypeptidase regulatory-like domain-containing protein 2616 3581 gene locus_tag LOCUS_22560 2616 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895914.1 protein_id gnl|my_center|LOCUS_22560 5103 3619 gene locus_tag LOCUS_22570 5103 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence235 3017 468 gene locus_tag LOCUS_22580 3017 468 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849784.1 protein_id gnl|my_center|LOCUS_22580 4606 3131 gene locus_tag LOCUS_22590 4606 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence236 <1 1968 gene locus_tag LOCUS_22600 <1 1968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764202.1:GH92 family glycosyl hydrolase 2132 2932 gene locus_tag LOCUS_22610 2132 2932 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_22610 4993 3023 gene locus_tag LOCUS_22620 gene yidC 4993 3023 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964004.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence237 727 1875 gene locus_tag LOCUS_22630 727 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090662474.1 protein_id gnl|my_center|LOCUS_22630 1908 2339 gene locus_tag LOCUS_22640 1908 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2314 2904 gene locus_tag LOCUS_22650 2314 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2901 3656 gene locus_tag LOCUS_22660 2901 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 3667 4125 gene locus_tag LOCUS_22670 3667 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22670 4204 4398 gene locus_tag LOCUS_22680 4204 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22680 >Feature sequence238 <1 1033 gene locus_tag LOCUS_22690 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119585.1:DPP IV N-terminal domain-containing protein 1235 1603 gene locus_tag LOCUS_22700 1235 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2673 1663 gene locus_tag LOCUS_22710 2673 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2964 3911 gene locus_tag LOCUS_22720 2964 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 4601 3918 gene locus_tag LOCUS_22730 gene rsmI 4601 3918 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_22730 4853 4605 gene locus_tag LOCUS_22740 gene purS 4853 4605 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403723.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence239 <1 2400 gene locus_tag LOCUS_22750 <1 2400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:glycoside hydrolase family 3 N-terminal domain-containing protein 2666 4525 gene locus_tag LOCUS_22760 2666 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 4548 4985 gene locus_tag LOCUS_22770 4548 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence240 423 707 gene locus_tag LOCUS_22780 423 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 719 1123 gene locus_tag LOCUS_22790 719 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2606 1239 gene locus_tag LOCUS_22800 2606 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22800 3458 2622 gene locus_tag LOCUS_22810 3458 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22810 3631 4323 gene locus_tag LOCUS_22820 3631 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence241 246 515 gene locus_tag LOCUS_22830 246 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1015 2445 gene locus_tag LOCUS_22840 1015 2445 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_22840 2846 4804 gene locus_tag LOCUS_22850 2846 4804 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence242 <1 561 gene locus_tag LOCUS_22860 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962675.1:anthranilate phosphoribosyltransferase 565 996 gene locus_tag LOCUS_22870 565 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 993 1790 gene locus_tag LOCUS_22880 gene trpC 993 1790 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_22880 1780 2430 gene locus_tag LOCUS_22890 1780 2430 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765047.1 protein_id gnl|my_center|LOCUS_22890 2420 3436 gene locus_tag LOCUS_22900 2420 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3462 4496 gene locus_tag LOCUS_22910 3462 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence243 307 2433 gene locus_tag LOCUS_22920 gene katE 307 2433 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105396.1 protein_id gnl|my_center|LOCUS_22920 2562 3344 gene locus_tag LOCUS_22930 2562 3344 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664611.1 protein_id gnl|my_center|LOCUS_22930 3429 3599 gene locus_tag LOCUS_22940 3429 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 4180 3932 gene locus_tag LOCUS_22950 4180 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 >Feature sequence244 54 647 gene locus_tag LOCUS_22960 54 647 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_22960 3106 743 gene locus_tag LOCUS_22970 3106 743 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_22970 4909 3413 gene locus_tag LOCUS_22980 4909 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence245 <1 1329 gene locus_tag LOCUS_22990 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964543.1:TonB-dependent receptor 1658 1434 gene locus_tag LOCUS_23000 1658 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1786 2394 gene locus_tag LOCUS_23010 1786 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3044 2400 gene locus_tag LOCUS_23020 3044 2400 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 protein_id gnl|my_center|LOCUS_23020 3498 3055 gene locus_tag LOCUS_23030 3498 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 4354 3647 gene locus_tag LOCUS_23040 gene sodA 4354 3647 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence246 <1 875 gene locus_tag LOCUS_23050 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_112904003.1:AraC family transcriptional regulator 948 1622 gene locus_tag LOCUS_23060 gene cmk 948 1622 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963822.1 protein_id gnl|my_center|LOCUS_23060 1657 2601 gene locus_tag LOCUS_23070 1657 2601 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905132.1 protein_id gnl|my_center|LOCUS_23070 <4865 2686 gene locus_tag LOCUS_23080 <4865 2686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963824.1:endopeptidase La >Feature sequence247 1 1755 gene locus_tag LOCUS_23090 1 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 1825 3348 gene locus_tag LOCUS_23100 1825 3348 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_23100 3452 4471 gene locus_tag LOCUS_23110 3452 4471 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061440.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence248 <1 1549 gene locus_tag LOCUS_23120 <1 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839988.1:zinc-dependent metalloprotease 1830 3023 gene locus_tag LOCUS_23130 1830 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 4670 3165 gene locus_tag LOCUS_23140 gene guaB 4670 3165 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence249 2230 1115 gene locus_tag LOCUS_23150 gene leuB 2230 1115 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_23150 3714 2227 gene locus_tag LOCUS_23160 3714 2227 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107930.1 protein_id gnl|my_center|LOCUS_23160 4411 3731 gene locus_tag LOCUS_23170 gene leuD 4411 3731 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence250 <1 1987 gene locus_tag LOCUS_23180 <1 1987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444477.1:mechanosensitive ion channel 3043 2087 gene locus_tag LOCUS_23190 3043 2087 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_23190 4078 3077 gene locus_tag LOCUS_23200 4078 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 <4792 4102 gene locus_tag LOCUS_23210 <4792 4102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788605.1:undecaprenyl-phosphate glucose phosphotransferase >Feature sequence251 1017 688 gene locus_tag LOCUS_23220 1017 688 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_23220 1097 2860 gene locus_tag LOCUS_23230 gene recD 1097 2860 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261336.1 protein_id gnl|my_center|LOCUS_23230 3582 2857 gene locus_tag LOCUS_23240 3582 2857 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_23240 4480 3731 gene locus_tag LOCUS_23250 4480 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence252 1062 73 gene locus_tag LOCUS_23260 gene rfaE1 1062 73 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_23260 2560 1049 gene locus_tag LOCUS_23270 2560 1049 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_23270 3886 2645 gene locus_tag LOCUS_23280 3886 2645 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_23280 <4708 4126 gene locus_tag LOCUS_23290 <4708 4126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759877.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA >Feature sequence253 1144 620 gene locus_tag LOCUS_23300 1144 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 1883 1293 gene locus_tag LOCUS_23310 1883 1293 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_23310 2185 1979 gene locus_tag LOCUS_23320 2185 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23320 2719 2255 gene locus_tag LOCUS_23330 2719 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23330 2793 3374 gene locus_tag LOCUS_23340 2793 3374 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_23340 3377 3841 gene locus_tag LOCUS_23350 3377 3841 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_23350 3933 4655 gene locus_tag LOCUS_23360 3933 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence254 1731 706 gene locus_tag LOCUS_23370 1731 706 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_23370 2151 1768 gene locus_tag LOCUS_23380 2151 1768 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_23380 2640 2164 gene locus_tag LOCUS_23390 2640 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 4648 3200 gene locus_tag LOCUS_23400 gene cls 4648 3200 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435010.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence255 404 892 gene locus_tag LOCUS_23410 404 892 CDS product JAB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_23410 1043 1321 gene locus_tag LOCUS_23420 1043 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence256 395 469 gene locus_tag LOCUS_t00300 395 469 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2030 426 gene locus_tag LOCUS_23430 2030 426 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143918059.1 protein_id gnl|my_center|LOCUS_23430 2420 2247 gene locus_tag LOCUS_23440 2420 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 3370 2726 gene locus_tag LOCUS_23450 3370 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 3756 3367 gene locus_tag LOCUS_23460 3756 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence257 <1 610 gene locus_tag LOCUS_23470 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767657.1:DUF1080 domain-containing protein 677 2095 gene locus_tag LOCUS_23480 677 2095 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_23480 2137 3438 gene locus_tag LOCUS_23490 2137 3438 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_23490 3967 3521 gene locus_tag LOCUS_23500 gene rplI 3967 3521 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769978.1 protein_id gnl|my_center|LOCUS_23500 4396 4130 gene locus_tag LOCUS_23510 gene rpsR 4396 4130 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790946.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence258 1621 1953 gene locus_tag LOCUS_23520 1621 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2793 2275 gene locus_tag LOCUS_23530 2793 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 <4528 2805 gene locus_tag LOCUS_23540 <4528 2805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108702.1:DUF6443 domain-containing protein >Feature sequence259 1151 726 gene locus_tag LOCUS_23550 1151 726 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_23550 1418 1164 gene locus_tag LOCUS_23560 1418 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 2081 1467 gene locus_tag LOCUS_23570 2081 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2327 3595 gene locus_tag LOCUS_23580 2327 3595 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288985.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence260 316 2361 gene locus_tag LOCUS_23590 316 2361 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_23590 3625 2369 gene locus_tag LOCUS_23600 3625 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 <4475 3600 gene locus_tag LOCUS_23610 <4475 3600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_065451001.1:DUF2339 domain-containing protein >Feature sequence261 46 804 gene locus_tag LOCUS_23620 46 804 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_23620 1916 888 gene locus_tag LOCUS_23630 1916 888 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405546.1 protein_id gnl|my_center|LOCUS_23630 2859 1960 gene locus_tag LOCUS_23640 2859 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 4442 2874 gene locus_tag LOCUS_23650 4442 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence262 449 718 gene locus_tag LOCUS_23660 gene rpsS 449 718 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_23660 811 1167 gene locus_tag LOCUS_23670 gene rplV 811 1167 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_23670 1225 2007 gene locus_tag LOCUS_23680 gene rpsC 1225 2007 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_23680 2100 2522 gene locus_tag LOCUS_23690 gene rplP 2100 2522 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_23690 2590 2796 gene locus_tag LOCUS_23700 2590 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2888 3145 gene locus_tag LOCUS_23710 gene rpsQ 2888 3145 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_23710 3259 3627 gene locus_tag LOCUS_23720 gene rplN 3259 3627 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776366.1 protein_id gnl|my_center|LOCUS_23720 3730 4068 gene locus_tag LOCUS_23730 gene rplX 3730 4068 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427723.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence263 428 1945 gene locus_tag LOCUS_23740 gene arcA 428 1945 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526983.1 protein_id gnl|my_center|LOCUS_23740 1950 2870 gene locus_tag LOCUS_23750 1950 2870 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_23750 2892 3551 gene locus_tag LOCUS_23760 2892 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 3608 4141 gene locus_tag LOCUS_23770 gene msrB 3608 4141 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926800.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence264 <1 501 gene locus_tag LOCUS_23780 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962814.1:D-alanine--D-alanine ligase 576 1049 gene locus_tag LOCUS_23790 gene coaD 576 1049 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_23790 1568 1416 gene locus_tag LOCUS_23800 1568 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 1792 1526 gene locus_tag LOCUS_23810 1792 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23810 1891 3138 gene locus_tag LOCUS_23820 1891 3138 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_23820 3135 4295 gene locus_tag LOCUS_23830 3135 4295 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764888.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence265 2466 2591 gene locus_tag LOCUS_23840 2466 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2683 3069 gene locus_tag LOCUS_23850 2683 3069 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755946.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence266 1427 747 gene locus_tag LOCUS_23860 1427 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 3242 1581 gene locus_tag LOCUS_23870 3242 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 <4328 3422 gene locus_tag LOCUS_23880 <4328 3422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963718.1:class II fumarate hydratase >Feature sequence267 2449 38 gene locus_tag LOCUS_23890 2449 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2734 2612 gene locus_tag LOCUS_23900 2734 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23900 4064 3051 gene locus_tag LOCUS_23910 gene gap 4064 3051 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357093.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence268 466 918 gene locus_tag LOCUS_23920 466 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 1138 1374 gene locus_tag LOCUS_23930 gene rpmB 1138 1374 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810297.1 protein_id gnl|my_center|LOCUS_23930 1404 1586 gene locus_tag LOCUS_23940 gene rpmG 1404 1586 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_23940 1644 1817 gene locus_tag LOCUS_23950 1644 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 3684 2032 gene locus_tag LOCUS_23960 3684 2032 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_23960 3575 3904 gene locus_tag LOCUS_23970 3575 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence269 344 1060 gene locus_tag LOCUS_23980 344 1060 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_23980 1057 2679 gene locus_tag LOCUS_23990 1057 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2718 3767 gene locus_tag LOCUS_24000 2718 3767 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727367.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence270 <1 810 gene locus_tag LOCUS_24010 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963024.1:3'-5' exonuclease 833 1804 gene locus_tag LOCUS_24020 833 1804 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765632.1 protein_id gnl|my_center|LOCUS_24020 1788 2396 gene locus_tag LOCUS_24030 1788 2396 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794135.1 protein_id gnl|my_center|LOCUS_24030 2467 3132 gene locus_tag LOCUS_24040 gene deoC 2467 3132 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_24040 3142 3846 gene locus_tag LOCUS_24050 3142 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence271 118 1419 gene locus_tag LOCUS_24060 gene thrC 118 1419 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_24060 3932 1431 gene locus_tag LOCUS_24070 3932 1431 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence272 407 243 gene locus_tag LOCUS_24080 407 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 466 888 gene locus_tag LOCUS_24090 466 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2434 968 gene locus_tag LOCUS_24100 gene gatA 2434 968 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931960.1 protein_id gnl|my_center|LOCUS_24100 2681 2439 gene locus_tag LOCUS_24110 2681 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3178 2828 gene locus_tag LOCUS_24120 gene rplS 3178 2828 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_24120 <4151 3330 gene locus_tag LOCUS_24130 <4151 3330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962327.1:dipeptidase >Feature sequence273 573 229 gene locus_tag LOCUS_24140 573 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 3895 845 gene locus_tag LOCUS_24150 3895 845 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546332.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence274 257 1294 gene locus_tag LOCUS_24160 257 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842007.1 protein_id gnl|my_center|LOCUS_24160 1566 1360 gene locus_tag LOCUS_24170 1566 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence275 <1 650 gene locus_tag LOCUS_24180 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964013.1:protein-L-isoaspartate(D-aspartate) O-methyltransferase 1525 1169 gene locus_tag LOCUS_24190 1525 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 1932 2627 gene locus_tag LOCUS_24200 1932 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2753 3631 gene locus_tag LOCUS_24210 2753 3631 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence276 2513 1614 gene locus_tag LOCUS_24220 2513 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_24220 3474 2710 gene locus_tag LOCUS_24230 3474 2710 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence277 535 176 gene locus_tag LOCUS_24240 535 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2337 706 gene locus_tag LOCUS_24250 2337 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 <3990 2408 gene locus_tag LOCUS_24260 <3990 2408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037381.1:CocE/NonD family hydrolase >Feature sequence278 1007 3946 gene locus_tag LOCUS_24270 1007 3946 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence279 176 751 gene locus_tag LOCUS_24280 176 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 840 1598 gene locus_tag LOCUS_24290 840 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2684 1686 gene locus_tag LOCUS_24300 2684 1686 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674004.1 protein_id gnl|my_center|LOCUS_24300 3792 2698 gene locus_tag LOCUS_24310 gene hppD 3792 2698 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence280 <1 848 gene locus_tag LOCUS_24320 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582861.1:phosphate ABC transporter permease PstA 758 1588 gene locus_tag LOCUS_24330 gene pstB 758 1588 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382998.1 protein_id gnl|my_center|LOCUS_24330 1614 2279 gene locus_tag LOCUS_24340 gene phoU 1614 2279 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788573.1 protein_id gnl|my_center|LOCUS_24340 2988 2383 gene locus_tag LOCUS_24350 gene gpmA 2988 2383 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870165.1 protein_id gnl|my_center|LOCUS_24350 3704 3069 gene locus_tag LOCUS_24360 3704 3069 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence281 <1 684 gene locus_tag LOCUS_24370 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:OmpA family protein 830 3355 gene locus_tag LOCUS_24380 830 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence282 <1 606 gene locus_tag LOCUS_24390 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107767.1:TonB-dependent receptor 670 1116 gene locus_tag LOCUS_24400 670 1116 CDS product DUF4625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107766.1 protein_id gnl|my_center|LOCUS_24400 1152 1865 gene locus_tag LOCUS_24410 1152 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 1960 2601 gene locus_tag LOCUS_24420 1960 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2624 3442 gene locus_tag LOCUS_24430 2624 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence283 1699 650 gene locus_tag LOCUS_24440 1699 650 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_24440 2708 2109 gene locus_tag LOCUS_24450 2708 2109 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726626.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence284 614 1798 gene locus_tag LOCUS_24460 614 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1881 2516 gene locus_tag LOCUS_24470 1881 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2555 3004 gene locus_tag LOCUS_24480 2555 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24480 3014 3166 gene locus_tag LOCUS_24490 3014 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence285 <1 561 gene locus_tag LOCUS_24500 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787927.1:AAA family ATPase 672 1595 gene locus_tag LOCUS_24510 672 1595 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_24510 1595 2563 gene locus_tag LOCUS_24520 1595 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2566 3570 gene locus_tag LOCUS_24530 2566 3570 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence286 <1 1088 gene locus_tag LOCUS_24540 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034098846.1:cell division protein FtsA 1185 1523 gene locus_tag LOCUS_24550 1185 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24550 1698 2936 gene locus_tag LOCUS_24560 1698 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24560 >Feature sequence287 88 1797 gene locus_tag LOCUS_24570 88 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2096 2485 gene locus_tag LOCUS_24580 2096 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2553 3086 gene locus_tag LOCUS_24590 2553 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 3192 3614 gene locus_tag LOCUS_24600 3192 3614 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence288 1474 29 gene locus_tag LOCUS_24610 1474 29 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_24610 2948 1524 gene locus_tag LOCUS_24620 2948 1524 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964309.1 protein_id gnl|my_center|LOCUS_24620 3272 2979 gene locus_tag LOCUS_24630 3272 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24630 3665 3315 gene locus_tag LOCUS_24640 3665 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24640 >Feature sequence289 2958 427 gene locus_tag LOCUS_24650 2958 427 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849784.1 protein_id gnl|my_center|LOCUS_24650 <3674 2981 gene locus_tag LOCUS_24660 <3674 2981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000782763.1:5'-nucleotidase, lipoprotein e(P4) family >Feature sequence290 <1 1046 gene locus_tag LOCUS_24670 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963479.1:replication-associated recombination protein A 1150 1785 gene locus_tag LOCUS_24680 1150 1785 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943685.1 protein_id gnl|my_center|LOCUS_24680 1867 3192 gene locus_tag LOCUS_24690 1867 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence291 3591 1075 gene locus_tag LOCUS_24700 3591 1075 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence292 1879 2 gene locus_tag LOCUS_24710 1879 2 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_24710 2022 2753 gene locus_tag LOCUS_24720 2022 2753 CDS product bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367887.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence293 492 1871 gene locus_tag LOCUS_24730 gene hisS 492 1871 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_24730 1917 2441 gene locus_tag LOCUS_24740 1917 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence294 103 960 gene locus_tag LOCUS_24750 103 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 <3593 965 gene locus_tag LOCUS_24760 <3593 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962910.1:putative LPS assembly protein LptD >Feature sequence295 <1 584 gene locus_tag LOCUS_24770 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002255036.1:IMPACT family protein 2717 621 gene locus_tag LOCUS_24780 2717 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 <3570 2719 gene locus_tag LOCUS_24790 <3570 2719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759761.1:MlaD family protein >Feature sequence296 321 85 gene locus_tag LOCUS_24800 321 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 1265 396 gene locus_tag LOCUS_24810 1265 396 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_24810 1352 1681 gene locus_tag LOCUS_24820 1352 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence297 785 93 gene locus_tag LOCUS_24830 785 93 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964128.1 protein_id gnl|my_center|LOCUS_24830 2143 827 gene locus_tag LOCUS_24840 2143 827 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962925.1 protein_id gnl|my_center|LOCUS_24840 2992 2222 gene locus_tag LOCUS_24850 gene rlmB 2992 2222 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_24850 3525 3025 gene locus_tag LOCUS_24860 3525 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence298 334 1497 gene locus_tag LOCUS_24870 334 1497 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_24870 1518 2279 gene locus_tag LOCUS_24880 gene tpiA 1518 2279 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_24880 3087 2308 gene locus_tag LOCUS_24890 3087 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence299 2704 32 gene locus_tag LOCUS_24900 2704 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157307892.1 protein_id gnl|my_center|LOCUS_24900 3206 2802 gene locus_tag LOCUS_24910 3206 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence300 1059 901 gene locus_tag LOCUS_24920 1059 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2431 1532 gene locus_tag LOCUS_24930 2431 1532 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964732.1 protein_id gnl|my_center|LOCUS_24930 3161 2610 gene locus_tag LOCUS_24940 3161 2610 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391311.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence301 2344 218 gene locus_tag LOCUS_24950 gene feoB 2344 218 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_24950 2490 2927 gene locus_tag LOCUS_24960 2490 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 >Feature sequence302 <1 2138 gene locus_tag LOCUS_24970 <1 2138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057830.1:M1 family metallopeptidase 2231 2665 gene locus_tag LOCUS_24980 2231 2665 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369539.1 protein_id gnl|my_center|LOCUS_24980 2725 3300 gene locus_tag LOCUS_24990 2725 3300 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975053.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence303 1780 620 gene locus_tag LOCUS_25000 1780 620 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_25000 1952 2785 gene locus_tag LOCUS_25010 1952 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence304 1981 386 gene locus_tag LOCUS_25020 gene pckA 1981 386 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence305 463 1899 gene locus_tag LOCUS_25030 463 1899 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_25030 2069 2416 gene locus_tag LOCUS_25040 2069 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence306 1584 88 gene locus_tag LOCUS_25050 1584 88 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036501.1 protein_id gnl|my_center|LOCUS_25050 2142 1705 gene locus_tag LOCUS_25060 2142 1705 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928568.1 protein_id gnl|my_center|LOCUS_25060 2781 2209 gene locus_tag LOCUS_25070 2781 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence307 2452 2123 gene locus_tag LOCUS_25080 2452 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 3112 2870 gene locus_tag LOCUS_25090 3112 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence308 <1 1734 gene locus_tag LOCUS_25100 <1 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108997.1:GH92 family glycosyl hydrolase 2462 1731 gene locus_tag LOCUS_25110 2462 1731 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_25110 2479 3252 gene locus_tag LOCUS_25120 2479 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence309 <1 1059 gene locus_tag LOCUS_25130 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118046.1:family 78 glycoside hydrolase catalytic domain 1268 2800 gene locus_tag LOCUS_25140 1268 2800 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence310 <1 722 gene locus_tag LOCUS_25150 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530115.1:SDR family oxidoreductase 820 1524 gene locus_tag LOCUS_25160 820 1524 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence311 2310 1201 gene locus_tag LOCUS_25170 2310 1201 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence312 1221 82 gene locus_tag LOCUS_25180 1221 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2067 1231 gene locus_tag LOCUS_25190 2067 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2852 2064 gene locus_tag LOCUS_25200 2852 2064 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence313 1861 872 gene locus_tag LOCUS_25210 1861 872 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791183.1 protein_id gnl|my_center|LOCUS_25210 2876 2043 gene locus_tag LOCUS_25220 2876 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25220 >Feature sequence314 1082 156 gene locus_tag LOCUS_25230 1082 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25230 1354 2031 gene locus_tag LOCUS_25240 1354 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2184 3017 gene locus_tag LOCUS_25250 2184 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence315 1364 168 gene locus_tag LOCUS_25260 1364 168 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107809.1 protein_id gnl|my_center|LOCUS_25260 2394 1429 gene locus_tag LOCUS_25270 2394 1429 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_25270 2973 2458 gene locus_tag LOCUS_25280 2973 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence316 1228 470 gene locus_tag LOCUS_25290 1228 470 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_25290 2107 1325 gene locus_tag LOCUS_25300 2107 1325 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_25300 2713 2249 gene locus_tag LOCUS_25310 2713 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence317 769 2421 gene locus_tag LOCUS_25320 gene glgP 769 2421 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_25320 3082 2495 gene locus_tag LOCUS_25330 3082 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence318 1323 97 gene locus_tag LOCUS_25340 1323 97 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 protein_id gnl|my_center|LOCUS_25340 2111 1371 gene locus_tag LOCUS_25350 gene truA 2111 1371 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence319 1631 633 gene locus_tag LOCUS_25360 1631 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2647 1997 gene locus_tag LOCUS_25370 2647 1997 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791447.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence320 1 1428 gene locus_tag LOCUS_25380 1 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 1468 1992 gene locus_tag LOCUS_25390 1468 1992 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974717.1 protein_id gnl|my_center|LOCUS_25390 2453 2148 gene locus_tag LOCUS_25400 2453 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2547 2894 gene locus_tag LOCUS_25410 2547 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25410 >Feature sequence321 <1 1102 gene locus_tag LOCUS_25420 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962672.1:tryptophan synthase subunit beta 1178 1951 gene locus_tag LOCUS_25430 gene trpA 1178 1951 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_25430 2021 2614 gene locus_tag LOCUS_25440 gene hisH 2021 2614 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence322 1613 879 gene locus_tag LOCUS_25450 1613 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1842 1648 gene locus_tag LOCUS_25460 1842 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25460 <2977 1852 gene locus_tag LOCUS_25470 <2977 1852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962618.1:dihydroxy-acid dehydratase note possible pseudo, internal stop codon >Feature sequence323 529 1098 gene locus_tag LOCUS_25480 gene xpt 529 1098 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230744.1 protein_id gnl|my_center|LOCUS_25480 1123 2412 gene locus_tag LOCUS_25490 gene pbuX 1123 2412 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230748.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence324 <1 722 gene locus_tag LOCUS_25500 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787240.1:heavy metal translocating P-type ATPase note possible pseudo, frameshifted 785 1894 gene locus_tag LOCUS_25510 785 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25510 1897 2106 gene locus_tag LOCUS_25520 1897 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2138 2620 gene locus_tag LOCUS_25530 2138 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence325 <1 1073 gene locus_tag LOCUS_25540 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107396.1:TolC family protein 1078 2193 gene locus_tag LOCUS_25550 1078 2193 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787502.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence326 <1 553 gene locus_tag LOCUS_25560 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786040.1:RNA polymerase sigma-70 factor 1469 2044 gene locus_tag LOCUS_25570 1469 2044 CDS product JAB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence327 496 1092 gene locus_tag LOCUS_25580 496 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 2664 1333 gene locus_tag LOCUS_25590 2664 1333 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence328 263 2587 gene locus_tag LOCUS_25600 gene metE 263 2587 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404021.1 protein_id gnl|my_center|LOCUS_25600 >Feature sequence329 302 979 gene locus_tag LOCUS_25610 gene rpiA 302 979 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049992.1 protein_id gnl|my_center|LOCUS_25610 983 1645 gene locus_tag LOCUS_25620 983 1645 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_25620 1722 2408 gene locus_tag LOCUS_25630 1722 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2580 2783 gene locus_tag LOCUS_25640 2580 2783 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence330 <1 919 gene locus_tag LOCUS_25650 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048697949.1:glycoside hydrolase family 92 protein 940 2481 gene locus_tag LOCUS_25660 940 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25660 >Feature sequence331 110 802 gene locus_tag LOCUS_25670 110 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 884 1354 gene locus_tag LOCUS_25680 884 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 1436 2713 gene locus_tag LOCUS_25690 1436 2713 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395916.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence332 <1 800 gene locus_tag LOCUS_25700 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108035.1:glycoside hydrolase family 76 protein 950 2104 gene locus_tag LOCUS_25710 gene rhaT 950 2104 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence333 2622 1174 gene locus_tag LOCUS_25720 2622 1174 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106462662.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence334 <1 1443 gene locus_tag LOCUS_25730 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034099187.1:chromosomal replication initiator protein DnaA <2821 1518 gene locus_tag LOCUS_25740 <2821 1518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920956.1:efflux RND transporter permease subunit >Feature sequence335 <1 1143 gene locus_tag LOCUS_25750 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932499.1:peptide chain release factor 3 1528 1244 gene locus_tag LOCUS_25760 1528 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2612 1560 gene locus_tag LOCUS_25770 2612 1560 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence336 >Feature sequence337 1652 108 gene locus_tag LOCUS_25780 gene treA 1652 108 CDS product alpha,alpha-trehalase TreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895614.1 protein_id gnl|my_center|LOCUS_25780 <2776 1680 gene locus_tag LOCUS_25790 <2776 1680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_101886611.1:glycosyl hydrolase family 65 protein >Feature sequence338 188 1507 gene locus_tag LOCUS_25800 188 1507 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_25800 1775 1572 gene locus_tag LOCUS_25810 1775 1572 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 protein_id gnl|my_center|LOCUS_25810 2658 1789 gene locus_tag LOCUS_25820 2658 1789 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence339 <1 1608 gene locus_tag LOCUS_25830 <1 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788089.1:translation elongation factor 4 1699 2274 gene locus_tag LOCUS_25840 1699 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2727 2332 gene locus_tag LOCUS_25850 2727 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence340 588 950 gene locus_tag LOCUS_25860 588 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 954 1313 gene locus_tag LOCUS_25870 954 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974119.1 protein_id gnl|my_center|LOCUS_25870 1325 1711 gene locus_tag LOCUS_25880 1325 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224588.1 protein_id gnl|my_center|LOCUS_25880 1716 2423 gene locus_tag LOCUS_25890 1716 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence341 >Feature sequence342 <1 510 gene locus_tag LOCUS_25900 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028525108.1:pyruvate dehydrogenase complex E1 component subunit beta 539 1198 gene locus_tag LOCUS_25910 gene hxpB 539 1198 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070789.1 protein_id gnl|my_center|LOCUS_25910 1311 1517 gene locus_tag LOCUS_25920 1311 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 <2687 1587 gene locus_tag LOCUS_25930 <2687 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404617.1:4-hydroxy-3-methylbut-2-enyl diphosphate reductase >Feature sequence343 1368 775 gene locus_tag LOCUS_25940 gene ilvN 1368 775 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_25940 1783 1382 gene locus_tag LOCUS_25950 1783 1382 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_25950 <2680 1819 gene locus_tag LOCUS_25960 <2680 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962617.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence344 1154 189 gene locus_tag LOCUS_25970 1154 189 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_25970 1251 1931 gene locus_tag LOCUS_25980 gene upp 1251 1931 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence345 1494 184 gene locus_tag LOCUS_25990 gene rimO 1494 184 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_25990 2223 1630 gene locus_tag LOCUS_26000 2223 1630 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence346 969 2291 gene locus_tag LOCUS_26010 969 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence347 2255 975 gene locus_tag LOCUS_26020 gene eno 2255 975 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence348 <1 1872 gene locus_tag LOCUS_26030 <1 1872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066403458.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence349 154 1614 gene locus_tag LOCUS_26040 154 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26040 2475 1669 gene locus_tag LOCUS_26050 2475 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence350 >Feature sequence351 416 1006 gene locus_tag LOCUS_26060 gene folE 416 1006 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062927.1 protein_id gnl|my_center|LOCUS_26060 1419 2120 gene locus_tag LOCUS_26070 1419 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence352 2037 2369 gene locus_tag LOCUS_26080 2037 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2548 2366 gene locus_tag LOCUS_26090 2548 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence353 1373 813 gene locus_tag LOCUS_26100 1373 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 2493 1513 gene locus_tag LOCUS_26110 gene metK 2493 1513 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence354 609 2012 gene locus_tag LOCUS_26120 609 2012 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404541.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence355 290 1567 gene locus_tag LOCUS_26130 290 1567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_26130 1631 2050 gene locus_tag LOCUS_26140 1631 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence356 313 975 gene locus_tag LOCUS_26150 313 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 1176 1919 gene locus_tag LOCUS_26160 1176 1919 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence357 <1 778 gene locus_tag LOCUS_26170 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034099197.1:KpsF/GutQ family sugar-phosphate isomerase 1228 791 gene locus_tag LOCUS_26180 1228 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1685 1329 gene locus_tag LOCUS_26190 1685 1329 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_26190 2015 1689 gene locus_tag LOCUS_26200 2015 1689 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence358 <2420 1183 gene locus_tag LOCUS_26210 <2420 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526730.1:glycosyl hydrolase family 79 C-terminal domain-containing protein >Feature sequence359 <2418 942 gene locus_tag LOCUS_26220 <2418 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000863308.1:aconitate hydratase >Feature sequence360 541 1869 gene locus_tag LOCUS_26230 541 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence361 1043 2020 gene locus_tag LOCUS_26240 1043 2020 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202327.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence362 207 1406 gene locus_tag LOCUS_26250 207 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence363 637 999 gene locus_tag LOCUS_26260 637 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1096 2136 gene locus_tag LOCUS_26270 1096 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence364 974 1777 gene locus_tag LOCUS_26280 974 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 2207 1833 gene locus_tag LOCUS_26290 2207 1833 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074110.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence365 <1 997 gene locus_tag LOCUS_26300 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008588454.1:cysteine desulfurase family protein 1724 1125 gene locus_tag LOCUS_26310 1724 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence366 1063 641 gene locus_tag LOCUS_26320 1063 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 2043 1210 gene locus_tag LOCUS_26330 2043 1210 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence367 <1 2280 gene locus_tag LOCUS_26340 <1 2280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202757.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence368 <1 537 gene locus_tag LOCUS_26350 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765765.1:MFS transporter 552 2324 gene locus_tag LOCUS_26360 552 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence369 >Feature sequence370 831 121 gene locus_tag LOCUS_26370 831 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 <2306 871 gene locus_tag LOCUS_26380 <2306 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108651.1:GH92 family glycosyl hydrolase >Feature sequence371 <1 534 gene locus_tag LOCUS_26390 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766719.1:MFS transporter 546 1289 gene locus_tag LOCUS_26400 546 1289 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence372 1270 845 gene locus_tag LOCUS_26410 1270 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 <2270 1603 gene locus_tag LOCUS_26420 <2270 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113836.1:NADH:flavin oxidoreductase/NADH oxidase >Feature sequence373 1288 899 gene locus_tag LOCUS_26430 1288 899 CDS product DUF1398 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886004.1 protein_id gnl|my_center|LOCUS_26430 1869 1459 gene locus_tag LOCUS_26440 1869 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2264 1815 gene locus_tag LOCUS_26450 2264 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence374 502 1455 gene locus_tag LOCUS_26460 502 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 <2256 1564 gene locus_tag LOCUS_26470 <2256 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933174.1:agmatine deiminase family protein >Feature sequence375 1042 134 gene locus_tag LOCUS_26480 1042 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1541 1062 gene locus_tag LOCUS_26490 1541 1062 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence376 668 1492 gene locus_tag LOCUS_26500 668 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 1602 2084 gene locus_tag LOCUS_26510 1602 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence377 1892 990 gene locus_tag LOCUS_26520 1892 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence378 601 2 gene locus_tag LOCUS_26530 601 2 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108164.1 protein_id gnl|my_center|LOCUS_26530 772 1056 gene locus_tag LOCUS_26540 772 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 1614 1168 gene locus_tag LOCUS_26550 1614 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence379 <1 2053 gene locus_tag LOCUS_26560 <1 2053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963407.1:tyrosine-protein kinase >Feature sequence380 <2198 393 gene locus_tag LOCUS_26570 <2198 393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973081.1:bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase >Feature sequence381 <1 513 gene locus_tag LOCUS_26580 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964458.1:C1 family peptidase <2184 919 gene locus_tag LOCUS_26590 <2184 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963517.1:gliding motility lipoprotein GldJ >Feature sequence382 252 1256 gene locus_tag LOCUS_26600 gene cas1b 252 1256 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768967.1 protein_id gnl|my_center|LOCUS_26600 1266 1529 gene locus_tag LOCUS_26610 gene cas2 1266 1529 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202914.1 protein_id gnl|my_center|LOCUS_26610 1737 >2156 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttaataggactattgtagaattgaaac >Feature sequence383 1180 461 gene locus_tag LOCUS_26620 1180 461 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761499.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence384 1180 461 gene locus_tag LOCUS_26630 gene pssA 1180 461 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_26630 1578 1796 gene locus_tag LOCUS_26640 gene infA 1578 1796 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_26640 >Feature sequence385 688 272 gene locus_tag LOCUS_26650 688 272 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_26650 1786 743 gene locus_tag LOCUS_26660 1786 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence386 890 1153 gene locus_tag LOCUS_26670 890 1153 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963685.1 protein_id gnl|my_center|LOCUS_26670 <2062 1509 gene locus_tag LOCUS_26680 <2062 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362010.1:site-specific integrase >Feature sequence387 1099 272 gene locus_tag LOCUS_26690 1099 272 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310179.1 protein_id gnl|my_center|LOCUS_26690 1760 1221 gene locus_tag LOCUS_26700 1760 1221 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106480813.1 protein_id gnl|my_center|LOCUS_26700