>Feature sequence001 477 160 gene locus_tag LOCUS_00010 gene trxA 477 160 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070766.1 protein_id gnl|my_center|LOCUS_00010 598 2583 gene locus_tag LOCUS_00020 598 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3299 2580 gene locus_tag LOCUS_00030 3299 2580 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 protein_id gnl|my_center|LOCUS_00030 3350 3934 gene locus_tag LOCUS_00040 3350 3934 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_00040 3944 4315 gene locus_tag LOCUS_00050 3944 4315 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_00050 4420 4346 gene locus_tag LOCUS_t00010 4420 4346 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4573 5190 gene locus_tag LOCUS_00060 4573 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5202 6791 gene locus_tag LOCUS_00070 5202 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6791 7813 gene locus_tag LOCUS_00080 6791 7813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7984 8880 gene locus_tag LOCUS_00090 gene recF 7984 8880 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 protein_id gnl|my_center|LOCUS_00090 10329 8872 gene locus_tag LOCUS_00100 10329 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11435 10332 gene locus_tag LOCUS_00110 11435 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12359 11508 gene locus_tag LOCUS_00120 12359 11508 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256676.1 protein_id gnl|my_center|LOCUS_00120 12400 12687 gene locus_tag LOCUS_00130 12400 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14018 12750 gene locus_tag LOCUS_00140 gene serS 14018 12750 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_00140 15302 14073 gene locus_tag LOCUS_00150 15302 14073 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_00150 15699 18014 gene locus_tag LOCUS_00160 15699 18014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18103 18765 gene locus_tag LOCUS_00170 gene ubiE 18103 18765 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545681.1 protein_id gnl|my_center|LOCUS_00170 18767 19324 gene locus_tag LOCUS_00180 18767 19324 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060752.1 protein_id gnl|my_center|LOCUS_00180 19317 20204 gene locus_tag LOCUS_00190 gene ubiA 19317 20204 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_00190 20197 20376 gene locus_tag LOCUS_00200 20197 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20398 21750 gene locus_tag LOCUS_00210 gene hemG 20398 21750 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202640.1 protein_id gnl|my_center|LOCUS_00210 21842 21924 gene locus_tag LOCUS_t00020 21842 21924 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21939 22379 gene locus_tag LOCUS_00220 21939 22379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22839 22312 gene locus_tag LOCUS_00230 22839 22312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24507 22843 gene locus_tag LOCUS_00240 24507 22843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25634 24507 gene locus_tag LOCUS_00250 25634 24507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014770990.1 protein_id gnl|my_center|LOCUS_00250 26842 25634 gene locus_tag LOCUS_00260 26842 25634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 27723 26839 gene locus_tag LOCUS_00270 27723 26839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27825 28787 gene locus_tag LOCUS_00280 27825 28787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28784 29794 gene locus_tag LOCUS_00290 gene tsaD 28784 29794 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_00290 29827 30231 gene locus_tag LOCUS_00300 29827 30231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 30228 30995 gene locus_tag LOCUS_00310 30228 30995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 31176 32294 gene locus_tag LOCUS_00320 31176 32294 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545957.1 protein_id gnl|my_center|LOCUS_00320 32482 33939 gene locus_tag LOCUS_00330 gene gatB 32482 33939 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_00330 33946 34260 gene locus_tag LOCUS_00340 33946 34260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 34299 35714 gene locus_tag LOCUS_00350 34299 35714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 35729 36847 gene locus_tag LOCUS_00360 35729 36847 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_00360 38306 36861 gene locus_tag LOCUS_00370 38306 36861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 38485 39420 gene locus_tag LOCUS_00380 gene cysK 38485 39420 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_00380 39493 39566 gene locus_tag LOCUS_t00030 39493 39566 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 39889 41295 gene locus_tag LOCUS_00390 39889 41295 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_00390 42681 41299 gene locus_tag LOCUS_00400 42681 41299 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024552.1 protein_id gnl|my_center|LOCUS_00400 43464 42691 gene locus_tag LOCUS_00410 gene hisF 43464 42691 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_00410 43684 43597 gene locus_tag LOCUS_t00040 43684 43597 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 43857 45716 gene locus_tag LOCUS_00420 43857 45716 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037772.1 protein_id gnl|my_center|LOCUS_00420 45903 46082 gene locus_tag LOCUS_00430 45903 46082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 46199 47383 gene locus_tag LOCUS_00440 gene coaBC 46199 47383 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016598.1 protein_id gnl|my_center|LOCUS_00440 47380 48207 gene locus_tag LOCUS_00450 47380 48207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 48262 49671 gene locus_tag LOCUS_00460 gene dnaB 48262 49671 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_00460 49668 50447 gene locus_tag LOCUS_00470 49668 50447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_00470 50455 51246 gene locus_tag LOCUS_00480 50455 51246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_00480 51423 52304 gene locus_tag LOCUS_00490 51423 52304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 52963 55611 gene locus_tag LOCUS_00500 gene alaS 52963 55611 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_00500 56804 55791 gene locus_tag LOCUS_00510 56804 55791 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_00510 58091 56829 gene locus_tag LOCUS_00520 58091 56829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 58205 60778 gene locus_tag LOCUS_00530 58205 60778 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_00530 60833 61531 gene locus_tag LOCUS_00540 60833 61531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 61607 63601 gene locus_tag LOCUS_00550 61607 63601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 64180 63659 gene locus_tag LOCUS_00560 gene def 64180 63659 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383428.1 protein_id gnl|my_center|LOCUS_00560 64551 64180 gene locus_tag LOCUS_00570 64551 64180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 65515 64592 gene locus_tag LOCUS_00580 65515 64592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 66420 65512 gene locus_tag LOCUS_00590 66420 65512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 66785 66438 gene locus_tag LOCUS_00600 gene rplS 66785 66438 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897519.1 protein_id gnl|my_center|LOCUS_00600 67501 66797 gene locus_tag LOCUS_00610 gene trmD 67501 66797 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_00610 68074 67502 gene locus_tag LOCUS_00620 gene rimM 68074 67502 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965064.1 protein_id gnl|my_center|LOCUS_00620 68537 68139 gene locus_tag LOCUS_00630 68537 68139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 70262 68826 gene locus_tag LOCUS_00640 gene hpnJ 70262 68826 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_00640 70381 70971 gene locus_tag LOCUS_00650 70381 70971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 70982 71989 gene locus_tag LOCUS_00660 gene hemB 70982 71989 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_00660 71998 73095 gene locus_tag LOCUS_00670 71998 73095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 73108 73668 gene locus_tag LOCUS_00680 73108 73668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 73728 74276 gene locus_tag LOCUS_00690 73728 74276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 74359 74431 gene locus_tag LOCUS_t00050 74359 74431 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 76107 74485 gene locus_tag LOCUS_00700 76107 74485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 76259 77338 gene locus_tag LOCUS_00710 76259 77338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 77470 78255 gene locus_tag LOCUS_00720 77470 78255 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_00720 78596 78670 gene locus_tag LOCUS_t00060 78596 78670 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence002 <1 754 gene locus_tag LOCUS_00730 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805011.1:dipeptidase 747 1439 gene locus_tag LOCUS_00740 gene cobB 747 1439 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705056.1 protein_id gnl|my_center|LOCUS_00740 2378 1431 gene locus_tag LOCUS_00750 2378 1431 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_00750 3312 2383 gene locus_tag LOCUS_00760 3312 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 4431 3328 gene locus_tag LOCUS_00770 4431 3328 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_00770 6419 4431 gene locus_tag LOCUS_00780 6419 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 6675 6430 gene locus_tag LOCUS_00790 6675 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 8438 6897 gene locus_tag LOCUS_00800 8438 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 9151 8438 gene locus_tag LOCUS_00810 9151 8438 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_00810 10078 9152 gene locus_tag LOCUS_00820 10078 9152 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405124.1 protein_id gnl|my_center|LOCUS_00820 13126 10082 gene locus_tag LOCUS_00830 13126 10082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 13576 13127 gene locus_tag LOCUS_00840 gene nusB 13576 13127 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_00840 14048 13581 gene locus_tag LOCUS_00850 gene ribE 14048 13581 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_00850 15259 14051 gene locus_tag LOCUS_00860 15259 14051 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763746.1 protein_id gnl|my_center|LOCUS_00860 15956 15270 gene locus_tag LOCUS_00870 15956 15270 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014470.1 protein_id gnl|my_center|LOCUS_00870 16868 16047 gene locus_tag LOCUS_00880 16868 16047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 18497 16884 gene locus_tag LOCUS_00890 18497 16884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 20761 18677 gene locus_tag LOCUS_00900 20761 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 22409 20787 gene locus_tag LOCUS_00910 22409 20787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 23963 22731 gene locus_tag LOCUS_00920 gene fabF 23963 22731 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927158.1 protein_id gnl|my_center|LOCUS_00920 24203 25504 gene locus_tag LOCUS_00930 24203 25504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 25551 26096 gene locus_tag LOCUS_00940 gene orn 25551 26096 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_00940 26172 27395 gene locus_tag LOCUS_00950 26172 27395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 27397 28260 gene locus_tag LOCUS_00960 gene lgt 27397 28260 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932768.1 protein_id gnl|my_center|LOCUS_00960 28422 29774 gene locus_tag LOCUS_00970 gene gdhA 28422 29774 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051757.1 protein_id gnl|my_center|LOCUS_00970 29982 29776 gene locus_tag LOCUS_00980 29982 29776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 31540 29939 gene locus_tag LOCUS_00990 31540 29939 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_00990 32657 31623 gene locus_tag LOCUS_01000 32657 31623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 34275 32821 gene locus_tag LOCUS_01010 34275 32821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 35973 34429 gene locus_tag LOCUS_01020 35973 34429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 37093 37367 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctttaagctttgcagctttttc 38452 37817 gene locus_tag LOCUS_01030 38452 37817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 39060 38449 gene locus_tag LOCUS_01040 39060 38449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 40148 39060 gene locus_tag LOCUS_01050 40148 39060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 41239 40238 gene locus_tag LOCUS_01060 41239 40238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 42548 41232 gene locus_tag LOCUS_01070 42548 41232 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_01070 43476 42541 gene locus_tag LOCUS_01080 43476 42541 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_01080 44039 43473 gene locus_tag LOCUS_01090 gene pyrR 44039 43473 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565527.1 protein_id gnl|my_center|LOCUS_01090 45230 46336 gene locus_tag LOCUS_01100 45230 46336 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548666.1 protein_id gnl|my_center|LOCUS_01100 46353 47276 gene locus_tag LOCUS_01110 46353 47276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 47288 48490 gene locus_tag LOCUS_01120 47288 48490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 48490 49164 gene locus_tag LOCUS_01130 gene ung 48490 49164 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_01130 49204 49518 gene locus_tag LOCUS_01140 49204 49518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 49518 50933 gene locus_tag LOCUS_01150 gene gatA 49518 50933 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112871.1 protein_id gnl|my_center|LOCUS_01150 51524 50994 gene locus_tag LOCUS_01160 51524 50994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 52517 51528 gene locus_tag LOCUS_01170 gene floA 52517 51528 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_01170 53961 52537 gene locus_tag LOCUS_01180 53961 52537 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_01180 54073 54975 gene locus_tag LOCUS_01190 54073 54975 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899655.1 protein_id gnl|my_center|LOCUS_01190 54999 55532 gene locus_tag LOCUS_01200 54999 55532 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_01200 56672 55533 gene locus_tag LOCUS_01210 gene proB 56672 55533 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_01210 59630 56682 gene locus_tag LOCUS_01220 gene rapA 59630 56682 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063652658.1 protein_id gnl|my_center|LOCUS_01220 59829 60581 gene locus_tag LOCUS_01230 59829 60581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 60584 61855 gene locus_tag LOCUS_01240 gene murA 60584 61855 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115380.1 protein_id gnl|my_center|LOCUS_01240 61880 62845 gene locus_tag LOCUS_01250 61880 62845 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_01250 63230 62880 gene locus_tag LOCUS_01260 63230 62880 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948189.1 protein_id gnl|my_center|LOCUS_01260 63978 63232 gene locus_tag LOCUS_01270 63978 63232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 64086 64003 gene locus_tag LOCUS_t00070 64086 64003 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 64964 64155 gene locus_tag LOCUS_01280 64964 64155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 66261 64957 gene locus_tag LOCUS_01290 gene miaB 66261 64957 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_01290 66902 66258 gene locus_tag LOCUS_01300 66902 66258 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113205.1 protein_id gnl|my_center|LOCUS_01300 67505 66921 gene locus_tag LOCUS_01310 gene hisB 67505 66921 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 protein_id gnl|my_center|LOCUS_01310 68488 67508 gene locus_tag LOCUS_01320 68488 67508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 69050 68481 gene locus_tag LOCUS_01330 69050 68481 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 protein_id gnl|my_center|LOCUS_01330 70024 69047 gene locus_tag LOCUS_01340 70024 69047 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_01340 70269 72113 gene locus_tag LOCUS_01350 70269 72113 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_01350 72123 74654 gene locus_tag LOCUS_01360 72123 74654 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence003 401 1108 gene locus_tag LOCUS_01370 401 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 1127 2782 gene locus_tag LOCUS_01380 gene recN 1127 2782 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830981.1 protein_id gnl|my_center|LOCUS_01380 2775 3932 gene locus_tag LOCUS_01390 2775 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 3935 5116 gene locus_tag LOCUS_01400 3935 5116 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_01400 5921 5208 gene locus_tag LOCUS_01410 gene rnhB 5921 5208 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770967.1 protein_id gnl|my_center|LOCUS_01410 6514 5921 gene locus_tag LOCUS_01420 gene purN 6514 5921 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932011.1 protein_id gnl|my_center|LOCUS_01420 6672 9824 gene locus_tag LOCUS_01430 6672 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 9993 10361 gene locus_tag LOCUS_01440 9993 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 11822 10410 gene locus_tag LOCUS_01450 gene glyS 11822 10410 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287157.1 protein_id gnl|my_center|LOCUS_01450 11907 12902 gene locus_tag LOCUS_01460 11907 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 13509 12904 gene locus_tag LOCUS_01470 13509 12904 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448965.1 protein_id gnl|my_center|LOCUS_01470 13739 16054 gene locus_tag LOCUS_01480 13739 16054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 16202 16789 gene locus_tag LOCUS_01490 16202 16789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 16863 18248 gene locus_tag LOCUS_01500 gene argH 16863 18248 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_01500 19105 18395 gene locus_tag LOCUS_01510 19105 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 19288 20310 gene locus_tag LOCUS_01520 19288 20310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 20492 20917 gene locus_tag LOCUS_01530 gene tnpA 20492 20917 CDS product IS200/IS605-like element IS1541D family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815747.1 protein_id gnl|my_center|LOCUS_01530 21236 21012 gene locus_tag LOCUS_01540 21236 21012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 21582 21211 gene locus_tag LOCUS_01550 21582 21211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01550 22654 22004 gene locus_tag LOCUS_01560 22654 22004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 23108 25321 gene locus_tag LOCUS_01570 23108 25321 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142855.1 protein_id gnl|my_center|LOCUS_01570 25321 26484 gene locus_tag LOCUS_01580 gene hflX 25321 26484 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933052.1 protein_id gnl|my_center|LOCUS_01580 26477 26965 gene locus_tag LOCUS_01590 26477 26965 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_01590 27755 26955 gene locus_tag LOCUS_01600 27755 26955 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583263.1 protein_id gnl|my_center|LOCUS_01600 30495 27829 gene locus_tag LOCUS_01610 gene gyrA 30495 27829 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857904.1 protein_id gnl|my_center|LOCUS_01610 31268 30498 gene locus_tag LOCUS_01620 gene surE 31268 30498 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478553.1 protein_id gnl|my_center|LOCUS_01620 31348 32100 gene locus_tag LOCUS_01630 31348 32100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 32224 33984 gene locus_tag LOCUS_01640 32224 33984 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_01640 34705 33989 gene locus_tag LOCUS_01650 34705 33989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 35943 34705 gene locus_tag LOCUS_01660 35943 34705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 36490 36044 gene locus_tag LOCUS_01670 gene rplI 36490 36044 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_01670 36753 36502 gene locus_tag LOCUS_01680 gene rpsR 36753 36502 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831354.1 protein_id gnl|my_center|LOCUS_01680 37121 36753 gene locus_tag LOCUS_01690 37121 36753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 38011 37241 gene locus_tag LOCUS_01700 38011 37241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 38076 39374 gene locus_tag LOCUS_01710 gene asnS 38076 39374 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_01710 39790 39371 gene locus_tag LOCUS_01720 39790 39371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 40568 39897 gene locus_tag LOCUS_01730 40568 39897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 41209 40568 gene locus_tag LOCUS_01740 41209 40568 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038795.1 protein_id gnl|my_center|LOCUS_01740 42903 41209 gene locus_tag LOCUS_01750 42903 41209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 43811 42900 gene locus_tag LOCUS_01760 43811 42900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 44515 43820 gene locus_tag LOCUS_01770 44515 43820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 45332 44508 gene locus_tag LOCUS_01780 45332 44508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 45872 45372 gene locus_tag LOCUS_01790 gene tadA 45872 45372 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291874.1 protein_id gnl|my_center|LOCUS_01790 49068 45898 gene locus_tag LOCUS_01800 49068 45898 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 protein_id gnl|my_center|LOCUS_01800 49147 49401 gene locus_tag LOCUS_01810 49147 49401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 50335 49981 gene locus_tag LOCUS_tm00010 50335 49981 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 50497 51057 gene locus_tag LOCUS_01820 50497 51057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 51188 51114 gene locus_tag LOCUS_t00080 51188 51114 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 51277 52248 gene locus_tag LOCUS_01830 51277 52248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 52336 52635 gene locus_tag LOCUS_01840 52336 52635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 53229 52861 gene locus_tag LOCUS_01850 53229 52861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 53573 55654 gene locus_tag LOCUS_01860 53573 55654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 56345 57268 gene locus_tag LOCUS_01870 56345 57268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 58989 57265 gene locus_tag LOCUS_01880 58989 57265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 60709 59000 gene locus_tag LOCUS_01890 60709 59000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 63632 60819 gene locus_tag LOCUS_01900 63632 60819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 64544 63966 gene locus_tag LOCUS_01910 64544 63966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence004 <1 898 gene locus_tag LOCUS_01920 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114089.1:glutamate-5-semialdehyde dehydrogenase 901 1248 gene locus_tag LOCUS_01930 gene hisI 901 1248 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546303.1 protein_id gnl|my_center|LOCUS_01930 1352 3136 gene locus_tag LOCUS_01940 gene aspS 1352 3136 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_01940 3298 4296 gene locus_tag LOCUS_01950 3298 4296 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 protein_id gnl|my_center|LOCUS_01950 4333 5499 gene locus_tag LOCUS_01960 4333 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 5486 6064 gene locus_tag LOCUS_01970 5486 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 6036 6812 gene locus_tag LOCUS_01980 6036 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 6815 7231 gene locus_tag LOCUS_01990 6815 7231 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_01990 8218 7232 gene locus_tag LOCUS_02000 8218 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 8335 9006 gene locus_tag LOCUS_02010 gene radC 8335 9006 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_02010 9018 9239 gene locus_tag LOCUS_02020 9018 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 9236 11752 gene locus_tag LOCUS_02030 9236 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 11970 12803 gene locus_tag LOCUS_02040 11970 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 12793 14124 gene locus_tag LOCUS_02050 12793 14124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 14124 14552 gene locus_tag LOCUS_02060 14124 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 17049 14617 gene locus_tag LOCUS_02070 17049 14617 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257164.1 protein_id gnl|my_center|LOCUS_02070 19112 17058 gene locus_tag LOCUS_02080 gene metG 19112 17058 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545288.1 protein_id gnl|my_center|LOCUS_02080 20255 19254 gene locus_tag LOCUS_02090 gene obgE 20255 19254 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933866.1 protein_id gnl|my_center|LOCUS_02090 21245 20280 gene locus_tag LOCUS_02100 gene argC 21245 20280 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_02100 21757 21266 gene locus_tag LOCUS_02110 21757 21266 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_02110 22398 21778 gene locus_tag LOCUS_02120 22398 21778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 23470 22376 gene locus_tag LOCUS_02130 gene rlmN 23470 22376 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 protein_id gnl|my_center|LOCUS_02130 25684 23522 gene locus_tag LOCUS_02140 25684 23522 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880372.1 protein_id gnl|my_center|LOCUS_02140 25713 25871 gene locus_tag LOCUS_02150 25713 25871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 25955 26028 gene locus_tag LOCUS_t00090 25955 26028 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27032 26070 gene locus_tag LOCUS_02160 27032 26070 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080622.1 protein_id gnl|my_center|LOCUS_02160 28612 27041 gene locus_tag LOCUS_02170 28612 27041 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_02170 28735 29031 gene locus_tag LOCUS_02180 28735 29031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 29036 29488 gene locus_tag LOCUS_02190 29036 29488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 29481 30782 gene locus_tag LOCUS_02200 29481 30782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 30903 30829 gene locus_tag LOCUS_t00100 30903 30829 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31641 30955 gene locus_tag LOCUS_02210 gene rpiA 31641 30955 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 protein_id gnl|my_center|LOCUS_02210 32237 31644 gene locus_tag LOCUS_02220 gene slyD 32237 31644 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099037.1 protein_id gnl|my_center|LOCUS_02220 32356 33099 gene locus_tag LOCUS_02230 32356 33099 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_02230 33096 33557 gene locus_tag LOCUS_02240 33096 33557 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141337.1 protein_id gnl|my_center|LOCUS_02240 33991 33566 gene locus_tag LOCUS_02250 33991 33566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 34525 36252 gene locus_tag LOCUS_02260 34525 36252 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582596.1 protein_id gnl|my_center|LOCUS_02260 36367 37401 gene locus_tag LOCUS_02270 36367 37401 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062349.1 protein_id gnl|my_center|LOCUS_02270 37401 38036 gene locus_tag LOCUS_02280 37401 38036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 38023 38475 gene locus_tag LOCUS_02290 gene rimI 38023 38475 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205970.1 protein_id gnl|my_center|LOCUS_02290 38487 39302 gene locus_tag LOCUS_02300 38487 39302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 39302 39856 gene locus_tag LOCUS_02310 39302 39856 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_02310 41535 40036 gene locus_tag LOCUS_02320 41535 40036 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555722.1 protein_id gnl|my_center|LOCUS_02320 42227 41625 gene locus_tag LOCUS_02330 42227 41625 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_02330 42914 42228 gene locus_tag LOCUS_02340 42914 42228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 43648 42923 gene locus_tag LOCUS_02350 43648 42923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 45003 43672 gene locus_tag LOCUS_02360 gene dnaA 45003 43672 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_02360 46125 45289 gene locus_tag LOCUS_02370 46125 45289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 47948 46128 gene locus_tag LOCUS_02380 gene lepA 47948 46128 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019133.1 protein_id gnl|my_center|LOCUS_02380 48071 48601 gene locus_tag LOCUS_02390 48071 48601 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_02390 48610 49980 gene locus_tag LOCUS_02400 48610 49980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 51279 50074 gene locus_tag LOCUS_02410 51279 50074 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681770.1 protein_id gnl|my_center|LOCUS_02410 52545 51292 gene locus_tag LOCUS_02420 gene fabF 52545 51292 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673329.1 protein_id gnl|my_center|LOCUS_02420 <53505 52545 gene locus_tag LOCUS_02430 <53505 52545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680894.1:AMP-binding protein >Feature sequence005 <1 619 gene locus_tag LOCUS_02440 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933666.1:radical SAM family heme chaperone HemW 631 1059 gene locus_tag LOCUS_02450 631 1059 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062081852.1 protein_id gnl|my_center|LOCUS_02450 2050 1157 gene locus_tag LOCUS_02460 2050 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 2224 3861 gene locus_tag LOCUS_02470 gene fumB 2224 3861 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066697.1 protein_id gnl|my_center|LOCUS_02470 5156 4077 gene locus_tag LOCUS_02480 5156 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02480 5427 5113 gene locus_tag LOCUS_02490 5427 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 5872 6393 gene locus_tag LOCUS_02500 5872 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 7856 6453 gene locus_tag LOCUS_02510 7856 6453 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_02510 8237 7857 gene locus_tag LOCUS_02520 8237 7857 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_02520 10401 8215 gene locus_tag LOCUS_02530 10401 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02530 17184 10648 gene locus_tag LOCUS_02540 17184 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 17330 18433 gene locus_tag LOCUS_02550 17330 18433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 19398 18445 gene locus_tag LOCUS_02560 19398 18445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 19509 20336 gene locus_tag LOCUS_02570 19509 20336 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_02570 20779 20333 gene locus_tag LOCUS_02580 gene nrdR 20779 20333 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_02580 21388 20906 gene locus_tag LOCUS_02590 21388 20906 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454901.1 protein_id gnl|my_center|LOCUS_02590 22766 21375 gene locus_tag LOCUS_02600 22766 21375 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261686.1 protein_id gnl|my_center|LOCUS_02600 23349 22942 gene locus_tag LOCUS_02610 23349 22942 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_02610 23450 24364 gene locus_tag LOCUS_02620 23450 24364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 24424 24594 gene locus_tag LOCUS_02630 24424 24594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 24591 25271 gene locus_tag LOCUS_02640 24591 25271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 27120 25327 gene locus_tag LOCUS_02650 27120 25327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 27292 27762 gene locus_tag LOCUS_02660 gene greB 27292 27762 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208915.1 protein_id gnl|my_center|LOCUS_02660 27759 28532 gene locus_tag LOCUS_02670 27759 28532 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497154.1 protein_id gnl|my_center|LOCUS_02670 30427 28529 gene locus_tag LOCUS_02680 30427 28529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 30889 32718 gene locus_tag LOCUS_02690 gene glmS 30889 32718 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_02690 32719 33804 gene locus_tag LOCUS_02700 32719 33804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 34112 33834 gene locus_tag LOCUS_02710 34112 33834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 34831 34115 gene locus_tag LOCUS_02720 34831 34115 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_02720 35458 34982 gene locus_tag LOCUS_02730 gene rpsG 35458 34982 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021606.1 protein_id gnl|my_center|LOCUS_02730 35859 35470 gene locus_tag LOCUS_02740 gene rpsL 35859 35470 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933847.1 protein_id gnl|my_center|LOCUS_02740 40423 35981 gene locus_tag LOCUS_02750 gene rpoC 40423 35981 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957448.1 protein_id gnl|my_center|LOCUS_02750 44669 40425 gene locus_tag LOCUS_02760 44669 40425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 45141 44770 gene locus_tag LOCUS_02770 gene rplL 45141 44770 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722477.1 protein_id gnl|my_center|LOCUS_02770 45708 45190 gene locus_tag LOCUS_02780 gene rplJ 45708 45190 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404504.1 protein_id gnl|my_center|LOCUS_02780 46404 45718 gene locus_tag LOCUS_02790 gene rplA 46404 45718 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545797.1 protein_id gnl|my_center|LOCUS_02790 46871 46446 gene locus_tag LOCUS_02800 gene rplK 46871 46446 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943497.1 protein_id gnl|my_center|LOCUS_02800 47439 46903 gene locus_tag LOCUS_02810 gene nusG 47439 46903 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546677.1 protein_id gnl|my_center|LOCUS_02810 47633 47439 gene locus_tag LOCUS_02820 47633 47439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 47726 47653 gene locus_tag LOCUS_t00110 47726 47653 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence006 120 719 gene locus_tag LOCUS_02830 120 719 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108121.1 protein_id gnl|my_center|LOCUS_02830 1068 784 gene locus_tag LOCUS_02840 1068 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 1224 1775 gene locus_tag LOCUS_02850 1224 1775 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_02850 1941 2543 gene locus_tag LOCUS_02860 1941 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 2543 3079 gene locus_tag LOCUS_02870 2543 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 3097 4854 gene locus_tag LOCUS_02880 3097 4854 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_02880 4847 6148 gene locus_tag LOCUS_02890 4847 6148 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_02890 6152 6784 gene locus_tag LOCUS_02900 6152 6784 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556694.1 protein_id gnl|my_center|LOCUS_02900 6781 8616 gene locus_tag LOCUS_02910 6781 8616 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_02910 8640 9101 gene locus_tag LOCUS_02920 8640 9101 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556692.1 protein_id gnl|my_center|LOCUS_02920 9188 9646 gene locus_tag LOCUS_02930 9188 9646 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669353.1 protein_id gnl|my_center|LOCUS_02930 9741 10883 gene locus_tag LOCUS_02940 gene tgt 9741 10883 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_02940 10930 11958 gene locus_tag LOCUS_02950 10930 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 11968 12414 gene locus_tag LOCUS_02960 11968 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 12414 13763 gene locus_tag LOCUS_02970 gene trmFO 12414 13763 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880411.1 protein_id gnl|my_center|LOCUS_02970 13782 16352 gene locus_tag LOCUS_02980 13782 16352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 16349 17437 gene locus_tag LOCUS_02990 16349 17437 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_02990 17434 18126 gene locus_tag LOCUS_03000 17434 18126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 19320 18130 gene locus_tag LOCUS_03010 19320 18130 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764762.1 protein_id gnl|my_center|LOCUS_03010 20039 20752 gene locus_tag LOCUS_03020 20039 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 20801 20875 gene locus_tag LOCUS_t00120 20801 20875 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21072 21147 gene locus_tag LOCUS_t00130 21072 21147 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21414 22967 gene locus_tag LOCUS_03030 21414 22967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 24119 23052 gene locus_tag LOCUS_03040 24119 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 24979 24200 gene locus_tag LOCUS_03050 24979 24200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 25324 27066 gene locus_tag LOCUS_03060 25324 27066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 27075 29189 gene locus_tag LOCUS_03070 27075 29189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 29861 29370 gene locus_tag LOCUS_03080 29861 29370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 30557 29877 gene locus_tag LOCUS_03090 30557 29877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 32265 30670 gene locus_tag LOCUS_03100 32265 30670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 34070 32259 gene locus_tag LOCUS_03110 34070 32259 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791940.1 protein_id gnl|my_center|LOCUS_03110 34562 34080 gene locus_tag LOCUS_03120 34562 34080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 34655 34804 gene locus_tag LOCUS_03130 34655 34804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 35060 34758 gene locus_tag LOCUS_03140 35060 34758 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932932.1 protein_id gnl|my_center|LOCUS_03140 36257 35070 gene locus_tag LOCUS_03150 36257 35070 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101181.1 protein_id gnl|my_center|LOCUS_03150 38119 36257 gene locus_tag LOCUS_03160 38119 36257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 38290 38847 gene locus_tag LOCUS_03170 gene ruvC 38290 38847 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933328.1 protein_id gnl|my_center|LOCUS_03170 38844 39518 gene locus_tag LOCUS_03180 38844 39518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 39523 40215 gene locus_tag LOCUS_03190 gene mpaA 39523 40215 CDS product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219125.1 protein_id gnl|my_center|LOCUS_03190 41070 40282 gene locus_tag LOCUS_03200 41070 40282 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883616.1 protein_id gnl|my_center|LOCUS_03200 42862 41105 gene locus_tag LOCUS_03210 42862 41105 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146756.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence007 1047 160 gene locus_tag LOCUS_03220 1047 160 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_03220 1547 1155 gene locus_tag LOCUS_03230 1547 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 2788 1547 gene locus_tag LOCUS_03240 2788 1547 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483518.1 protein_id gnl|my_center|LOCUS_03240 4011 2962 gene locus_tag LOCUS_03250 4011 2962 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920312.1 protein_id gnl|my_center|LOCUS_03250 4544 4011 gene locus_tag LOCUS_03260 4544 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 4883 4623 gene locus_tag LOCUS_03270 4883 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 4765 5856 gene locus_tag LOCUS_03280 gene aroC 4765 5856 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_03280 6727 5879 gene locus_tag LOCUS_03290 gene mazG 6727 5879 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_03290 6660 7553 gene locus_tag LOCUS_03300 gene dprA 6660 7553 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795245.1 protein_id gnl|my_center|LOCUS_03300 7541 7846 gene locus_tag LOCUS_03310 7541 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 9730 7850 gene locus_tag LOCUS_03320 9730 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 12426 9742 gene locus_tag LOCUS_03330 12426 9742 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392668.1 protein_id gnl|my_center|LOCUS_03330 14160 12436 gene locus_tag LOCUS_03340 14160 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 15559 14198 gene locus_tag LOCUS_03350 15559 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 16385 15624 gene locus_tag LOCUS_03360 16385 15624 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_03360 16815 16387 gene locus_tag LOCUS_03370 16815 16387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 17766 16879 gene locus_tag LOCUS_03380 17766 16879 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_03380 21141 17776 gene locus_tag LOCUS_03390 21141 17776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 21834 21154 gene locus_tag LOCUS_03400 21834 21154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 23730 21868 gene locus_tag LOCUS_03410 23730 21868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 24493 23738 gene locus_tag LOCUS_03420 24493 23738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 25203 24493 gene locus_tag LOCUS_03430 25203 24493 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_03430 26490 25207 gene locus_tag LOCUS_03440 26490 25207 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205037.1 protein_id gnl|my_center|LOCUS_03440 26721 28142 gene locus_tag LOCUS_03450 26721 28142 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_03450 28201 28641 gene locus_tag LOCUS_03460 28201 28641 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_03460 28638 29444 gene locus_tag LOCUS_03470 28638 29444 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_03470 29454 30464 gene locus_tag LOCUS_03480 29454 30464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 30461 31654 gene locus_tag LOCUS_03490 30461 31654 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203519.1 protein_id gnl|my_center|LOCUS_03490 31685 33646 gene locus_tag LOCUS_03500 31685 33646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 33895 36375 gene locus_tag LOCUS_03510 33895 36375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 >Feature sequence008 1106 111 gene locus_tag LOCUS_03520 gene mgrA 1106 111 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_03520 1215 2231 gene locus_tag LOCUS_03530 1215 2231 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458995.1 protein_id gnl|my_center|LOCUS_03530 2235 3278 gene locus_tag LOCUS_03540 2235 3278 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 protein_id gnl|my_center|LOCUS_03540 3271 4236 gene locus_tag LOCUS_03550 3271 4236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_03550 4282 6321 gene locus_tag LOCUS_03560 gene recG 4282 6321 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933239.1 protein_id gnl|my_center|LOCUS_03560 6340 7101 gene locus_tag LOCUS_03570 6340 7101 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455494.1 protein_id gnl|my_center|LOCUS_03570 7277 8536 gene locus_tag LOCUS_03580 7277 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 8555 9154 gene locus_tag LOCUS_03590 8555 9154 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250651.1 protein_id gnl|my_center|LOCUS_03590 9965 9258 gene locus_tag LOCUS_03600 9965 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 10205 11557 gene locus_tag LOCUS_03610 10205 11557 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107869.1 protein_id gnl|my_center|LOCUS_03610 12786 11683 gene locus_tag LOCUS_03620 gene serC 12786 11683 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_03620 13435 12911 gene locus_tag LOCUS_03630 13435 12911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 13714 14913 gene locus_tag LOCUS_03640 gene metK 13714 14913 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225644.1 protein_id gnl|my_center|LOCUS_03640 15022 15255 gene locus_tag LOCUS_03650 15022 15255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 15258 16532 gene locus_tag LOCUS_03660 gene hemL 15258 16532 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_03660 16535 17860 gene locus_tag LOCUS_03670 16535 17860 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047260.1 protein_id gnl|my_center|LOCUS_03670 18264 17863 gene locus_tag LOCUS_03680 18264 17863 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016387.1 protein_id gnl|my_center|LOCUS_03680 18321 19628 gene locus_tag LOCUS_03690 18321 19628 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940793.1 protein_id gnl|my_center|LOCUS_03690 20499 19921 gene locus_tag LOCUS_03700 20499 19921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 23507 21078 gene locus_tag LOCUS_03710 gene pheT 23507 21078 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_03710 24966 23593 gene locus_tag LOCUS_03720 gene radA 24966 23593 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_03720 25718 27430 gene locus_tag LOCUS_03730 25718 27430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 27785 28372 gene locus_tag LOCUS_03740 27785 28372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 28513 29478 gene locus_tag LOCUS_03750 28513 29478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 29724 29479 gene locus_tag LOCUS_03760 29724 29479 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_03760 30289 29807 gene locus_tag LOCUS_03770 30289 29807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 30427 30933 gene locus_tag LOCUS_03780 30427 30933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 >Feature sequence009 1686 850 gene locus_tag LOCUS_03790 gene cdaA 1686 850 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_03790 2560 1664 gene locus_tag LOCUS_03800 gene folP 2560 1664 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948483.1 protein_id gnl|my_center|LOCUS_03800 4640 2550 gene locus_tag LOCUS_03810 gene ftsH 4640 2550 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040941435.1 protein_id gnl|my_center|LOCUS_03810 5882 4656 gene locus_tag LOCUS_03820 5882 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 5950 6993 gene locus_tag LOCUS_03830 5950 6993 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074216.1 protein_id gnl|my_center|LOCUS_03830 7099 8280 gene locus_tag LOCUS_03840 gene purT 7099 8280 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 protein_id gnl|my_center|LOCUS_03840 8277 10511 gene locus_tag LOCUS_03850 gene pflB 8277 10511 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390748.1 protein_id gnl|my_center|LOCUS_03850 10672 11655 gene locus_tag LOCUS_03860 10672 11655 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_03860 12503 11766 gene locus_tag LOCUS_03870 12503 11766 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939534.1 protein_id gnl|my_center|LOCUS_03870 13800 12601 gene locus_tag LOCUS_03880 13800 12601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 14264 13797 gene locus_tag LOCUS_03890 gene smpB 14264 13797 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812219.1 protein_id gnl|my_center|LOCUS_03890 14601 14257 gene locus_tag LOCUS_03900 14601 14257 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986832.1 protein_id gnl|my_center|LOCUS_03900 14837 15592 gene locus_tag LOCUS_03910 14837 15592 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962599.1 protein_id gnl|my_center|LOCUS_03910 15598 15804 gene locus_tag LOCUS_03920 15598 15804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 15812 16309 gene locus_tag LOCUS_03930 15812 16309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 16992 16315 gene locus_tag LOCUS_03940 16992 16315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 17513 18355 gene locus_tag LOCUS_03950 17513 18355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 18364 18780 gene locus_tag LOCUS_03960 18364 18780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 18880 19245 gene locus_tag LOCUS_03970 18880 19245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 19260 22109 gene locus_tag LOCUS_03980 19260 22109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 22106 23455 gene locus_tag LOCUS_03990 22106 23455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 24402 23452 gene locus_tag LOCUS_04000 gene epmB 24402 23452 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946049.1 protein_id gnl|my_center|LOCUS_04000 24440 25009 gene locus_tag LOCUS_04010 gene efp 24440 25009 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_04010 25464 26768 gene locus_tag LOCUS_04020 25464 26768 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091265.1 protein_id gnl|my_center|LOCUS_04020 26768 27445 gene locus_tag LOCUS_04030 26768 27445 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 protein_id gnl|my_center|LOCUS_04030 27438 28466 gene locus_tag LOCUS_04040 27438 28466 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947883.1 protein_id gnl|my_center|LOCUS_04040 28476 29282 gene locus_tag LOCUS_04050 28476 29282 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_04050 29287 30393 gene locus_tag LOCUS_04060 29287 30393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 30461 31285 gene locus_tag LOCUS_04070 30461 31285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 31648 34014 gene locus_tag LOCUS_04080 31648 34014 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence010 364 1956 gene locus_tag LOCUS_04090 364 1956 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_04090 3257 2256 gene locus_tag LOCUS_04100 3257 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3734 3877 gene locus_tag LOCUS_04110 3734 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 4105 4644 gene locus_tag LOCUS_04120 4105 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 4644 5444 gene locus_tag LOCUS_04130 4644 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 5559 5735 gene locus_tag LOCUS_04140 5559 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 5742 6020 gene locus_tag LOCUS_04150 5742 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6024 6551 gene locus_tag LOCUS_04160 6024 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04160 6593 8011 gene locus_tag LOCUS_04170 6593 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 8446 8027 gene locus_tag LOCUS_04180 8446 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 8389 8805 gene locus_tag LOCUS_04190 8389 8805 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208041.1 protein_id gnl|my_center|LOCUS_04190 8815 10938 gene locus_tag LOCUS_04200 8815 10938 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261021.1 protein_id gnl|my_center|LOCUS_04200 10949 12070 gene locus_tag LOCUS_04210 10949 12070 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420177.1 protein_id gnl|my_center|LOCUS_04210 12073 13443 gene locus_tag LOCUS_04220 12073 13443 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114106.1 protein_id gnl|my_center|LOCUS_04220 14344 13511 gene locus_tag LOCUS_04230 14344 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 16590 14353 gene locus_tag LOCUS_04240 16590 14353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 18413 16608 gene locus_tag LOCUS_04250 gene ptsP 18413 16608 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_04250 18657 18385 gene locus_tag LOCUS_04260 18657 18385 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_04260 19489 18665 gene locus_tag LOCUS_04270 19489 18665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 20302 19646 gene locus_tag LOCUS_04280 20302 19646 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939628.1 protein_id gnl|my_center|LOCUS_04280 21176 20292 gene locus_tag LOCUS_04290 21176 20292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 22676 21177 gene locus_tag LOCUS_04300 22676 21177 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_04300 24131 22680 gene locus_tag LOCUS_04310 24131 22680 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_04310 25258 24236 gene locus_tag LOCUS_04320 gene pheS 25258 24236 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546774.1 protein_id gnl|my_center|LOCUS_04320 26460 25279 gene locus_tag LOCUS_04330 26460 25279 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 protein_id gnl|my_center|LOCUS_04330 26494 27282 gene locus_tag LOCUS_04340 26494 27282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 27279 27836 gene locus_tag LOCUS_04350 27279 27836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 27842 28516 gene locus_tag LOCUS_04360 27842 28516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 28587 28670 gene locus_tag LOCUS_t00140 28587 28670 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30006 28705 gene locus_tag LOCUS_04370 30006 28705 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_04370 30103 30678 gene locus_tag LOCUS_04380 30103 30678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 30757 31605 gene locus_tag LOCUS_04390 30757 31605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 31605 32870 gene locus_tag LOCUS_04400 31605 32870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 33029 34231 gene locus_tag LOCUS_04410 33029 34231 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence011 442 2862 gene locus_tag LOCUS_04420 gene hrpB 442 2862 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262606.1 protein_id gnl|my_center|LOCUS_04420 4264 2867 gene locus_tag LOCUS_04430 gene dnaA 4264 2867 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_04430 5417 4545 gene locus_tag LOCUS_04440 gene wapR 5417 4545 CDS product alpha-1,3-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114547.1 protein_id gnl|my_center|LOCUS_04440 6667 5402 gene locus_tag LOCUS_04450 6667 5402 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963976.1 protein_id gnl|my_center|LOCUS_04450 7792 6677 gene locus_tag LOCUS_04460 7792 6677 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679043.1 protein_id gnl|my_center|LOCUS_04460 7870 8838 gene locus_tag LOCUS_04470 7870 8838 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679040.1 protein_id gnl|my_center|LOCUS_04470 10115 8835 gene locus_tag LOCUS_04480 gene yegQ 10115 8835 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105560.1 protein_id gnl|my_center|LOCUS_04480 11572 10109 gene locus_tag LOCUS_04490 11572 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 11771 13873 gene locus_tag LOCUS_04500 11771 13873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 14035 14502 gene locus_tag LOCUS_04510 14035 14502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 15325 14573 gene locus_tag LOCUS_04520 15325 14573 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_04520 16161 15325 gene locus_tag LOCUS_04530 16161 15325 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_04530 16970 16158 gene locus_tag LOCUS_04540 16970 16158 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939227.1 protein_id gnl|my_center|LOCUS_04540 17002 17709 gene locus_tag LOCUS_04550 17002 17709 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_04550 18141 17701 gene locus_tag LOCUS_04560 18141 17701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 19157 18141 gene locus_tag LOCUS_04570 19157 18141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 21553 19238 gene locus_tag LOCUS_04580 21553 19238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 23617 21560 gene locus_tag LOCUS_04590 23617 21560 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_04590 23810 23736 gene locus_tag LOCUS_t00150 23810 23736 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24361 23882 gene locus_tag LOCUS_04600 24361 23882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 24942 24373 gene locus_tag LOCUS_04610 24942 24373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 25401 25081 gene locus_tag LOCUS_04620 gene yciH 25401 25081 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663537.1 protein_id gnl|my_center|LOCUS_04620 26483 25422 gene locus_tag LOCUS_04630 gene prfB 26483 25422 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_04630 27525 26521 gene locus_tag LOCUS_04640 27525 26521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 29824 27713 gene locus_tag LOCUS_04650 29824 27713 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458358.1 protein_id gnl|my_center|LOCUS_04650 <33858 29919 gene locus_tag LOCUS_04660 <33858 29919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477759.1:tandem-95 repeat protein >Feature sequence012 258 554 gene locus_tag LOCUS_04670 258 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 616 1590 gene locus_tag LOCUS_04680 616 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 1747 3381 gene locus_tag LOCUS_04690 gene gpmI 1747 3381 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_04690 3489 5033 gene locus_tag LOCUS_04700 3489 5033 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_04700 5043 7781 gene locus_tag LOCUS_04710 gene polA 5043 7781 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249994.1 protein_id gnl|my_center|LOCUS_04710 7804 8916 gene locus_tag LOCUS_04720 7804 8916 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_04720 8913 9218 gene locus_tag LOCUS_04730 8913 9218 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113105.1 protein_id gnl|my_center|LOCUS_04730 9283 10128 gene locus_tag LOCUS_04740 9283 10128 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062346.1 protein_id gnl|my_center|LOCUS_04740 10131 11834 gene locus_tag LOCUS_04750 10131 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 11824 13782 gene locus_tag LOCUS_04760 11824 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 13736 14239 gene locus_tag LOCUS_04770 13736 14239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 15101 14241 gene locus_tag LOCUS_04780 gene prmC 15101 14241 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_04780 16168 15101 gene locus_tag LOCUS_04790 gene prfA 16168 15101 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931817.1 protein_id gnl|my_center|LOCUS_04790 16315 17622 gene locus_tag LOCUS_04800 gene tyrS 16315 17622 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_04800 17619 18593 gene locus_tag LOCUS_04810 gene pfkB 17619 18593 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706189.1 protein_id gnl|my_center|LOCUS_04810 18590 19270 gene locus_tag LOCUS_04820 18590 19270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 19261 20058 gene locus_tag LOCUS_04830 19261 20058 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940021.1 protein_id gnl|my_center|LOCUS_04830 20163 20345 gene locus_tag LOCUS_04840 20163 20345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 20543 22060 gene locus_tag LOCUS_04850 20543 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 22074 24305 gene locus_tag LOCUS_04860 22074 24305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 24351 28112 gene locus_tag LOCUS_04870 24351 28112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 28741 29361 gene locus_tag LOCUS_04880 28741 29361 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_04880 29408 30298 gene locus_tag LOCUS_04890 29408 30298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 30298 30792 gene locus_tag LOCUS_04900 30298 30792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 30795 31751 gene locus_tag LOCUS_04910 30795 31751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 32242 33531 gene locus_tag LOCUS_04920 32242 33531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence013 2797 965 gene locus_tag LOCUS_04930 2797 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4208 2817 gene locus_tag LOCUS_04940 4208 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 4183 4392 gene locus_tag LOCUS_04950 4183 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 6618 4342 gene locus_tag LOCUS_04960 6618 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 6918 10685 gene locus_tag LOCUS_04970 gene dnaE 6918 10685 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992125.1 protein_id gnl|my_center|LOCUS_04970 10687 11796 gene locus_tag LOCUS_04980 gene lpxB 10687 11796 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880923.1 protein_id gnl|my_center|LOCUS_04980 13581 11749 gene locus_tag LOCUS_04990 gene mutL 13581 11749 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933683.1 protein_id gnl|my_center|LOCUS_04990 13658 14926 gene locus_tag LOCUS_05000 13658 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 15206 18163 gene locus_tag LOCUS_05010 15206 18163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 18258 19667 gene locus_tag LOCUS_05020 gene cysS 18258 19667 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_05020 19664 20266 gene locus_tag LOCUS_05030 19664 20266 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 protein_id gnl|my_center|LOCUS_05030 20450 21724 gene locus_tag LOCUS_05040 20450 21724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 21821 22759 gene locus_tag LOCUS_05050 21821 22759 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_05050 23365 22751 gene locus_tag LOCUS_05060 gene nth 23365 22751 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_05060 24150 23362 gene locus_tag LOCUS_05070 gene cysE 24150 23362 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933103.1 protein_id gnl|my_center|LOCUS_05070 24568 24203 gene locus_tag LOCUS_05080 24568 24203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 25073 24582 gene locus_tag LOCUS_05090 25073 24582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 25105 26244 gene locus_tag LOCUS_05100 gene pdxB 25105 26244 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108789.1 protein_id gnl|my_center|LOCUS_05100 26335 27192 gene locus_tag LOCUS_05110 26335 27192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 27819 27157 gene locus_tag LOCUS_05120 27819 27157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 28012 29766 gene locus_tag LOCUS_05130 28012 29766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140922.1 protein_id gnl|my_center|LOCUS_05130 29768 30841 gene locus_tag LOCUS_05140 29768 30841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 30831 31601 gene locus_tag LOCUS_05150 30831 31601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 31598 32542 gene locus_tag LOCUS_05160 31598 32542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 32539 32850 gene locus_tag LOCUS_05170 32539 32850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 32823 33065 gene locus_tag LOCUS_05180 32823 33065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 <33747 33094 gene locus_tag LOCUS_05190 <33747 33094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405140.1:glycosyltransferase >Feature sequence014 2124 181 gene locus_tag LOCUS_05200 gene nuoL 2124 181 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_05200 2442 2128 gene locus_tag LOCUS_05210 gene nuoK 2442 2128 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056517.1 protein_id gnl|my_center|LOCUS_05210 2981 2442 gene locus_tag LOCUS_05220 2981 2442 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_05220 3553 2981 gene locus_tag LOCUS_05230 3553 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 4911 3553 gene locus_tag LOCUS_05240 4911 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 6449 4908 gene locus_tag LOCUS_05250 6449 4908 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_05250 7824 6517 gene locus_tag LOCUS_05260 gene nuoF 7824 6517 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_05260 8886 7828 gene locus_tag LOCUS_05270 8886 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 10076 8883 gene locus_tag LOCUS_05280 10076 8883 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990075.1 protein_id gnl|my_center|LOCUS_05280 10678 10073 gene locus_tag LOCUS_05290 10678 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 11317 10682 gene locus_tag LOCUS_05300 11317 10682 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_05300 12503 11706 gene locus_tag LOCUS_05310 12503 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 13177 12860 gene locus_tag LOCUS_05320 13177 12860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 14901 13174 gene locus_tag LOCUS_05330 14901 13174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 15679 16842 gene locus_tag LOCUS_05340 15679 16842 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016322.1 protein_id gnl|my_center|LOCUS_05340 16967 18025 gene locus_tag LOCUS_05350 gene potA 16967 18025 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005253.1 protein_id gnl|my_center|LOCUS_05350 18018 18929 gene locus_tag LOCUS_05360 18018 18929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887945.1 protein_id gnl|my_center|LOCUS_05360 18922 19734 gene locus_tag LOCUS_05370 18922 19734 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887946.1 protein_id gnl|my_center|LOCUS_05370 19731 20798 gene locus_tag LOCUS_05380 19731 20798 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964155.1 protein_id gnl|my_center|LOCUS_05380 20821 23082 gene locus_tag LOCUS_05390 20821 23082 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_05390 23128 24744 gene locus_tag LOCUS_05400 23128 24744 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_05400 24910 26607 gene locus_tag LOCUS_05410 24910 26607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 26613 27926 gene locus_tag LOCUS_05420 26613 27926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 27953 29122 gene locus_tag LOCUS_05430 27953 29122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 29259 31295 gene locus_tag LOCUS_05440 29259 31295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 31295 32002 gene locus_tag LOCUS_05450 31295 32002 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830897.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence015 757 1665 gene locus_tag LOCUS_05460 757 1665 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608770.1 protein_id gnl|my_center|LOCUS_05460 1717 2856 gene locus_tag LOCUS_05470 1717 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 2853 4709 gene locus_tag LOCUS_05480 2853 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5704 4706 gene locus_tag LOCUS_05490 5704 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 6453 5701 gene locus_tag LOCUS_05500 gene sufC 6453 5701 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_05500 8320 6455 gene locus_tag LOCUS_05510 8320 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 9701 8376 gene locus_tag LOCUS_05520 9701 8376 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035938.1 protein_id gnl|my_center|LOCUS_05520 10879 9794 gene locus_tag LOCUS_05530 10879 9794 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208046.1 protein_id gnl|my_center|LOCUS_05530 10994 11254 gene locus_tag LOCUS_05540 10994 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 11336 12157 gene locus_tag LOCUS_05550 11336 12157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680301.1 protein_id gnl|my_center|LOCUS_05550 14044 12164 gene locus_tag LOCUS_05560 14044 12164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 17831 14034 gene locus_tag LOCUS_05570 17831 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 18147 20495 gene locus_tag LOCUS_05580 18147 20495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 20622 21080 gene locus_tag LOCUS_05590 gene ndk 20622 21080 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065142.1 protein_id gnl|my_center|LOCUS_05590 21122 21958 gene locus_tag LOCUS_05600 21122 21958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_05600 21961 23874 gene locus_tag LOCUS_05610 21961 23874 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_05610 23874 24656 gene locus_tag LOCUS_05620 23874 24656 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_05620 24985 27243 gene locus_tag LOCUS_05630 24985 27243 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_05630 27227 27448 gene locus_tag LOCUS_05640 27227 27448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 28515 27514 gene locus_tag LOCUS_05650 28515 27514 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_05650 29616 28726 gene locus_tag LOCUS_05660 29616 28726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 31239 29626 gene locus_tag LOCUS_05670 31239 29626 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545176.1 protein_id gnl|my_center|LOCUS_05670 31348 32343 gene locus_tag LOCUS_05680 gene dapA 31348 32343 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311023.1 protein_id gnl|my_center|LOCUS_05680 32360 33013 gene locus_tag LOCUS_05690 32360 33013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence016 832 2634 gene locus_tag LOCUS_05700 832 2634 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922133.1 protein_id gnl|my_center|LOCUS_05700 2636 3517 gene locus_tag LOCUS_05710 2636 3517 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_05710 3626 5761 gene locus_tag LOCUS_05720 3626 5761 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_05720 5758 6348 gene locus_tag LOCUS_05730 5758 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 6360 6743 gene locus_tag LOCUS_05740 6360 6743 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186624.1 protein_id gnl|my_center|LOCUS_05740 6734 7951 gene locus_tag LOCUS_05750 6734 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 7954 9096 gene locus_tag LOCUS_05760 7954 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 9106 10233 gene locus_tag LOCUS_05770 gene nuoH 9106 10233 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109091.1 protein_id gnl|my_center|LOCUS_05770 10233 10709 gene locus_tag LOCUS_05780 10233 10709 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785046.1 protein_id gnl|my_center|LOCUS_05780 10706 11245 gene locus_tag LOCUS_05790 10706 11245 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785044.1 protein_id gnl|my_center|LOCUS_05790 11242 11547 gene locus_tag LOCUS_05800 gene nuoK 11242 11547 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100078.1 protein_id gnl|my_center|LOCUS_05800 11540 13492 gene locus_tag LOCUS_05810 gene nuoL 11540 13492 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764299.1 protein_id gnl|my_center|LOCUS_05810 13494 14984 gene locus_tag LOCUS_05820 13494 14984 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_05820 14989 16404 gene locus_tag LOCUS_05830 14989 16404 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_05830 17107 17844 gene locus_tag LOCUS_05840 17107 17844 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461015.1 protein_id gnl|my_center|LOCUS_05840 18007 21186 gene locus_tag LOCUS_05850 18007 21186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 21582 21301 gene locus_tag LOCUS_05860 21582 21301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 22140 21703 gene locus_tag LOCUS_05870 gene dutA 22140 21703 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_05870 26108 22245 gene locus_tag LOCUS_05880 gene purL 26108 22245 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073168.1 protein_id gnl|my_center|LOCUS_05880 26813 26211 gene locus_tag LOCUS_05890 26813 26211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 28322 26844 gene locus_tag LOCUS_05900 gene ilvC 28322 26844 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 protein_id gnl|my_center|LOCUS_05900 30731 28494 gene locus_tag LOCUS_05910 30731 28494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence017 727 389 gene locus_tag LOCUS_05920 727 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 1394 708 gene locus_tag LOCUS_05930 1394 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2326 1532 gene locus_tag LOCUS_05940 gene xth 2326 1532 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_05940 2679 2960 gene locus_tag LOCUS_05950 gene groES 2679 2960 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_05950 2980 4617 gene locus_tag LOCUS_05960 gene groL 2980 4617 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_05960 7407 4744 gene locus_tag LOCUS_05970 7407 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 9371 7416 gene locus_tag LOCUS_05980 9371 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 10220 9384 gene locus_tag LOCUS_05990 10220 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 protein_id gnl|my_center|LOCUS_05990 12860 10398 gene locus_tag LOCUS_06000 12860 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 14012 13101 gene locus_tag LOCUS_06010 14012 13101 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962750.1 protein_id gnl|my_center|LOCUS_06010 15106 14009 gene locus_tag LOCUS_06020 15106 14009 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_06020 16214 15123 gene locus_tag LOCUS_06030 16214 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 17187 16216 gene locus_tag LOCUS_06040 17187 16216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 17815 17177 gene locus_tag LOCUS_06050 17815 17177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 18219 17815 gene locus_tag LOCUS_06060 18219 17815 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_06060 18845 18216 gene locus_tag LOCUS_06070 18845 18216 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_06070 20302 18854 gene locus_tag LOCUS_06080 20302 18854 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_06080 21066 20302 gene locus_tag LOCUS_06090 21066 20302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 21932 21195 gene locus_tag LOCUS_06100 21932 21195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 22059 22709 gene locus_tag LOCUS_06110 22059 22709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 23686 22706 gene locus_tag LOCUS_06120 23686 22706 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021552.1 protein_id gnl|my_center|LOCUS_06120 24780 23671 gene locus_tag LOCUS_06130 24780 23671 CDS product DUF2914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405391.1 protein_id gnl|my_center|LOCUS_06130 25412 24777 gene locus_tag LOCUS_06140 25412 24777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 25935 25402 gene locus_tag LOCUS_06150 25935 25402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 26366 25932 gene locus_tag LOCUS_06160 26366 25932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 27384 26371 gene locus_tag LOCUS_06170 gene rsgA 27384 26371 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_06170 28743 27532 gene locus_tag LOCUS_06180 28743 27532 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence018 2758 410 gene locus_tag LOCUS_06190 2758 410 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_06190 3020 4048 gene locus_tag LOCUS_06200 gene nadA 3020 4048 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853488.1 protein_id gnl|my_center|LOCUS_06200 4057 4740 gene locus_tag LOCUS_06210 4057 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4763 5800 gene locus_tag LOCUS_06220 4763 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 6428 5790 gene locus_tag LOCUS_06230 6428 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 7403 6435 gene locus_tag LOCUS_06240 gene hemC 7403 6435 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_06240 8694 7396 gene locus_tag LOCUS_06250 gene hemA 8694 7396 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_06250 8789 9901 gene locus_tag LOCUS_06260 8789 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 9895 10260 gene locus_tag LOCUS_06270 9895 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 11791 10262 gene locus_tag LOCUS_06280 11791 10262 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_06280 12120 11794 gene locus_tag LOCUS_06290 12120 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 13421 12270 gene locus_tag LOCUS_06300 gene dxr 13421 12270 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245155.1 protein_id gnl|my_center|LOCUS_06300 15043 13517 gene locus_tag LOCUS_06310 15043 13517 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_06310 15422 17293 gene locus_tag LOCUS_06320 15422 17293 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_06320 20050 17861 gene locus_tag LOCUS_06330 20050 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 21498 20200 gene locus_tag LOCUS_06340 21498 20200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 22384 21515 gene locus_tag LOCUS_06350 22384 21515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 22645 26154 gene locus_tag LOCUS_06360 22645 26154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 26145 29402 gene locus_tag LOCUS_06370 26145 29402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence019 556 281 gene locus_tag LOCUS_06380 556 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 854 558 gene locus_tag LOCUS_06390 854 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2094 856 gene locus_tag LOCUS_06400 2094 856 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_06400 3644 2229 gene locus_tag LOCUS_06410 3644 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 3838 5043 gene locus_tag LOCUS_06420 3838 5043 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_06420 5043 5486 gene locus_tag LOCUS_06430 5043 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 5505 6056 gene locus_tag LOCUS_06440 5505 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 6456 6022 gene locus_tag LOCUS_06450 gene tsaE 6456 6022 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918074.1 protein_id gnl|my_center|LOCUS_06450 7588 6461 gene locus_tag LOCUS_06460 gene nspC 7588 6461 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056484.1 protein_id gnl|my_center|LOCUS_06460 7778 8701 gene locus_tag LOCUS_06470 7778 8701 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_06470 8694 9383 gene locus_tag LOCUS_06480 8694 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 9365 10273 gene locus_tag LOCUS_06490 9365 10273 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583996.1 protein_id gnl|my_center|LOCUS_06490 11627 10275 gene locus_tag LOCUS_06500 11627 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 12465 11638 gene locus_tag LOCUS_06510 gene proC 12465 11638 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_06510 14341 12470 gene locus_tag LOCUS_06520 14341 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 14604 15116 gene locus_tag LOCUS_06530 gene folK 14604 15116 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_06530 15113 15787 gene locus_tag LOCUS_06540 15113 15787 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_06540 15789 16637 gene locus_tag LOCUS_06550 gene panC 15789 16637 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_06550 17179 16634 gene locus_tag LOCUS_06560 gene yfcE 17179 16634 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_06560 20064 17248 gene locus_tag LOCUS_06570 20064 17248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 20253 20741 gene locus_tag LOCUS_06580 20253 20741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 20745 21002 gene locus_tag LOCUS_06590 gene rpmA 20745 21002 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902873.1 protein_id gnl|my_center|LOCUS_06590 21930 21328 gene locus_tag LOCUS_06600 gene leuD 21930 21328 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_06600 23353 21941 gene locus_tag LOCUS_06610 gene leuC 23353 21941 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920779.1 protein_id gnl|my_center|LOCUS_06610 23881 23447 gene locus_tag LOCUS_06620 23881 23447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 25390 23975 gene locus_tag LOCUS_06630 25390 23975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 25797 25387 gene locus_tag LOCUS_06640 25797 25387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence020 757 1926 gene locus_tag LOCUS_06650 757 1926 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_06650 1932 2963 gene locus_tag LOCUS_06660 1932 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2964 3830 gene locus_tag LOCUS_06670 2964 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3827 4489 gene locus_tag LOCUS_06680 3827 4489 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022654.1 protein_id gnl|my_center|LOCUS_06680 5469 4486 gene locus_tag LOCUS_06690 5469 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5874 6899 gene locus_tag LOCUS_06700 5874 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 7042 7710 gene locus_tag LOCUS_06710 7042 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 8617 7787 gene locus_tag LOCUS_06720 8617 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 8685 9860 gene locus_tag LOCUS_06730 8685 9860 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926854.1 protein_id gnl|my_center|LOCUS_06730 9864 10661 gene locus_tag LOCUS_06740 9864 10661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 10677 11702 gene locus_tag LOCUS_06750 gene purM 10677 11702 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_06750 12702 11731 gene locus_tag LOCUS_06760 12702 11731 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362119.1 protein_id gnl|my_center|LOCUS_06760 12819 13145 gene locus_tag LOCUS_06770 12819 13145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 13262 16135 gene locus_tag LOCUS_06780 gene secA 13262 16135 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_06780 16139 16777 gene locus_tag LOCUS_06790 gene tmk 16139 16777 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677237.1 protein_id gnl|my_center|LOCUS_06790 16818 17897 gene locus_tag LOCUS_06800 16818 17897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 17906 18097 gene locus_tag LOCUS_06810 17906 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 18233 18541 gene locus_tag LOCUS_06820 18233 18541 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257768.1 protein_id gnl|my_center|LOCUS_06820 18538 19296 gene locus_tag LOCUS_06830 18538 19296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 19423 20379 gene locus_tag LOCUS_06840 19423 20379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06840 20614 20426 gene locus_tag LOCUS_06850 20614 20426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 20830 21762 gene locus_tag LOCUS_06860 20830 21762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 23365 21911 gene locus_tag LOCUS_06870 23365 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 24916 23408 gene locus_tag LOCUS_06880 24916 23408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 25637 24999 gene locus_tag LOCUS_06890 25637 24999 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_06890 26480 25638 gene locus_tag LOCUS_06900 gene folD 26480 25638 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207454.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence021 <1 731 gene locus_tag LOCUS_06910 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000814466.1:phosphomethylpyrimidine synthase ThiC 733 1164 gene locus_tag LOCUS_06920 733 1164 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_06920 1856 1170 gene locus_tag LOCUS_06930 1856 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2662 1859 gene locus_tag LOCUS_06940 2662 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 3508 2666 gene locus_tag LOCUS_06950 3508 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 4355 3537 gene locus_tag LOCUS_06960 4355 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 4431 5528 gene locus_tag LOCUS_06970 gene ychF 4431 5528 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_06970 5977 7239 gene locus_tag LOCUS_06980 5977 7239 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 protein_id gnl|my_center|LOCUS_06980 7317 8006 gene locus_tag LOCUS_06990 7317 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 10533 7975 gene locus_tag LOCUS_07000 gene clpB 10533 7975 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435194.1 protein_id gnl|my_center|LOCUS_07000 10908 12122 gene locus_tag LOCUS_07010 10908 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 12119 13366 gene locus_tag LOCUS_07020 12119 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 13439 14278 gene locus_tag LOCUS_07030 gene purU 13439 14278 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881184.1 protein_id gnl|my_center|LOCUS_07030 14297 14830 gene locus_tag LOCUS_07040 14297 14830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 14847 15515 gene locus_tag LOCUS_07050 gene pyrE 14847 15515 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_07050 15517 16086 gene locus_tag LOCUS_07060 gene dcd 15517 16086 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_07060 16153 16929 gene locus_tag LOCUS_07070 16153 16929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 16926 18179 gene locus_tag LOCUS_07080 16926 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 18182 19576 gene locus_tag LOCUS_07090 18182 19576 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402834.1 protein_id gnl|my_center|LOCUS_07090 19580 20341 gene locus_tag LOCUS_07100 gene map 19580 20341 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142406.1 protein_id gnl|my_center|LOCUS_07100 20344 20643 gene locus_tag LOCUS_07110 20344 20643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 20656 20916 gene locus_tag LOCUS_07120 20656 20916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 20988 21614 gene locus_tag LOCUS_07130 20988 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 23012 22167 gene locus_tag LOCUS_07140 23012 22167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 23360 23064 gene locus_tag LOCUS_07150 23360 23064 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083634.1 protein_id gnl|my_center|LOCUS_07150 23521 24072 gene locus_tag LOCUS_07160 23521 24072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence022 2946 286 gene locus_tag LOCUS_07170 2946 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3042 3725 gene locus_tag LOCUS_07180 3042 3725 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_07180 4058 3714 gene locus_tag LOCUS_07190 4058 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 4233 4847 gene locus_tag LOCUS_07200 4233 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 6784 4844 gene locus_tag LOCUS_07210 gene lnt 6784 4844 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_07210 7473 6781 gene locus_tag LOCUS_07220 7473 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 8014 7475 gene locus_tag LOCUS_07230 8014 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 8097 8825 gene locus_tag LOCUS_07240 8097 8825 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_07240 10794 8899 gene locus_tag LOCUS_07250 10794 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 11094 11822 gene locus_tag LOCUS_07260 11094 11822 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393177.1 protein_id gnl|my_center|LOCUS_07260 11855 13327 gene locus_tag LOCUS_07270 11855 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 13460 14287 gene locus_tag LOCUS_07280 13460 14287 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582467.1 protein_id gnl|my_center|LOCUS_07280 14316 15722 gene locus_tag LOCUS_07290 14316 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 15688 16419 gene locus_tag LOCUS_07300 15688 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 16522 17805 gene locus_tag LOCUS_07310 16522 17805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 17867 18229 gene locus_tag LOCUS_07320 17867 18229 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228235.1 protein_id gnl|my_center|LOCUS_07320 18242 19444 gene locus_tag LOCUS_07330 18242 19444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 19441 20505 gene locus_tag LOCUS_07340 gene ribD 19441 20505 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880032.1 protein_id gnl|my_center|LOCUS_07340 21190 20495 gene locus_tag LOCUS_07350 21190 20495 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675739.1 protein_id gnl|my_center|LOCUS_07350 22887 21190 gene locus_tag LOCUS_07360 22887 21190 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_07360 24272 23049 gene locus_tag LOCUS_07370 gene alr 24272 23049 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817433.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence023 3682 2519 gene locus_tag LOCUS_07380 3682 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 4461 3685 gene locus_tag LOCUS_07390 4461 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 4665 5222 gene locus_tag LOCUS_07400 4665 5222 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461089.1 protein_id gnl|my_center|LOCUS_07400 5272 5682 gene locus_tag LOCUS_07410 5272 5682 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904077.1 protein_id gnl|my_center|LOCUS_07410 6340 5672 gene locus_tag LOCUS_07420 6340 5672 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504032.1 protein_id gnl|my_center|LOCUS_07420 7805 6342 gene locus_tag LOCUS_07430 7805 6342 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084504.1 protein_id gnl|my_center|LOCUS_07430 7804 8721 gene locus_tag LOCUS_07440 7804 8721 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_07440 8721 9776 gene locus_tag LOCUS_07450 8721 9776 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790927.1 protein_id gnl|my_center|LOCUS_07450 10446 9757 gene locus_tag LOCUS_07460 10446 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 10682 11056 gene locus_tag LOCUS_07470 10682 11056 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_07470 12527 11061 gene locus_tag LOCUS_07480 12527 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 12614 13588 gene locus_tag LOCUS_07490 gene hemH 12614 13588 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261488.1 protein_id gnl|my_center|LOCUS_07490 13585 14634 gene locus_tag LOCUS_07500 13585 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 15937 14636 gene locus_tag LOCUS_07510 gene rimO 15937 14636 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880515.1 protein_id gnl|my_center|LOCUS_07510 16897 16085 gene locus_tag LOCUS_07520 16897 16085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 17074 17283 gene locus_tag LOCUS_07530 gene rpsU 17074 17283 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656880.1 protein_id gnl|my_center|LOCUS_07530 17363 17812 gene locus_tag LOCUS_07540 17363 17812 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_07540 18585 17860 gene locus_tag LOCUS_07550 gene pflA 18585 17860 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390747.1 protein_id gnl|my_center|LOCUS_07550 22577 18621 gene locus_tag LOCUS_07560 22577 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 23502 22624 gene locus_tag LOCUS_07570 23502 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 23518 24417 gene locus_tag LOCUS_07580 23518 24417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence024 2055 1639 gene locus_tag LOCUS_07590 2055 1639 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228286.1 protein_id gnl|my_center|LOCUS_07590 4462 2174 gene locus_tag LOCUS_07600 4462 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4618 5877 gene locus_tag LOCUS_07610 4618 5877 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860915.1 protein_id gnl|my_center|LOCUS_07610 6987 5911 gene locus_tag LOCUS_07620 6987 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 7299 6991 gene locus_tag LOCUS_07630 7299 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 7549 8196 gene locus_tag LOCUS_07640 7549 8196 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_07640 8311 9192 gene locus_tag LOCUS_07650 8311 9192 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_07650 9822 9169 gene locus_tag LOCUS_07660 9822 9169 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729327.1 protein_id gnl|my_center|LOCUS_07660 9940 10689 gene locus_tag LOCUS_07670 9940 10689 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774606.1 protein_id gnl|my_center|LOCUS_07670 10852 10691 gene locus_tag LOCUS_07680 10852 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 11530 10877 gene locus_tag LOCUS_07690 11530 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07690 11639 12007 gene locus_tag LOCUS_07700 11639 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 12073 12147 gene locus_tag LOCUS_t00160 12073 12147 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 13231 12419 gene locus_tag LOCUS_07710 13231 12419 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062346.1 protein_id gnl|my_center|LOCUS_07710 13533 14318 gene locus_tag LOCUS_07720 13533 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 14322 15431 gene locus_tag LOCUS_07730 14322 15431 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_07730 15428 16408 gene locus_tag LOCUS_07740 15428 16408 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230075.1 protein_id gnl|my_center|LOCUS_07740 16479 18599 gene locus_tag LOCUS_07750 16479 18599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 18596 19411 gene locus_tag LOCUS_07760 gene murI 18596 19411 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_07760 19599 20246 gene locus_tag LOCUS_07770 19599 20246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 20371 21927 gene locus_tag LOCUS_07780 20371 21927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07780 21961 22908 gene locus_tag LOCUS_07790 21961 22908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07790 23037 23258 gene locus_tag LOCUS_07800 23037 23258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence025 1126 239 gene locus_tag LOCUS_07810 1126 239 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_07810 2237 1254 gene locus_tag LOCUS_07820 2237 1254 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_07820 3079 2249 gene locus_tag LOCUS_07830 3079 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4516 3188 gene locus_tag LOCUS_07840 4516 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 5698 4778 gene locus_tag LOCUS_07850 5698 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 7679 5913 gene locus_tag LOCUS_07860 7679 5913 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120247.1 protein_id gnl|my_center|LOCUS_07860 7911 7690 gene locus_tag LOCUS_07870 7911 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 8378 7914 gene locus_tag LOCUS_07880 gene divIVA 8378 7914 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221468.1 protein_id gnl|my_center|LOCUS_07880 9171 8656 gene locus_tag LOCUS_07890 9171 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 9318 11009 gene locus_tag LOCUS_07900 9318 11009 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_07900 11866 11006 gene locus_tag LOCUS_07910 11866 11006 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_07910 11994 12449 gene locus_tag LOCUS_07920 gene mscL 11994 12449 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 protein_id gnl|my_center|LOCUS_07920 13479 12541 gene locus_tag LOCUS_07930 13479 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 17787 13492 gene locus_tag LOCUS_07940 17787 13492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 20234 18033 gene locus_tag LOCUS_07950 20234 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence026 <1 1189 gene locus_tag LOCUS_07960 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005782155.1:elongation factor Tu 1199 1510 gene locus_tag LOCUS_07970 gene rpsJ 1199 1510 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002712302.1 protein_id gnl|my_center|LOCUS_07970 1515 2135 gene locus_tag LOCUS_07980 gene rplC 1515 2135 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393937.1 protein_id gnl|my_center|LOCUS_07980 2135 2755 gene locus_tag LOCUS_07990 gene rplD 2135 2755 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869927.1 protein_id gnl|my_center|LOCUS_07990 2755 3057 gene locus_tag LOCUS_08000 gene rplW 2755 3057 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037421480.1 protein_id gnl|my_center|LOCUS_08000 3060 3893 gene locus_tag LOCUS_08010 gene rplB 3060 3893 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390435.1 protein_id gnl|my_center|LOCUS_08010 3897 4178 gene locus_tag LOCUS_08020 gene rpsS 3897 4178 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173711.1 protein_id gnl|my_center|LOCUS_08020 4178 4534 gene locus_tag LOCUS_08030 gene rplV 4178 4534 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 protein_id gnl|my_center|LOCUS_08030 4538 5197 gene locus_tag LOCUS_08040 gene rpsC 4538 5197 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403801.1 protein_id gnl|my_center|LOCUS_08040 5201 5614 gene locus_tag LOCUS_08050 gene rplP 5201 5614 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_08050 5614 5805 gene locus_tag LOCUS_08060 gene rpmC 5614 5805 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495193.1 protein_id gnl|my_center|LOCUS_08060 5824 6078 gene locus_tag LOCUS_08070 gene rpsQ 5824 6078 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222609.1 protein_id gnl|my_center|LOCUS_08070 6100 6468 gene locus_tag LOCUS_08080 gene rplN 6100 6468 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_08080 6468 6773 gene locus_tag LOCUS_08090 gene rplX 6468 6773 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701316.1 protein_id gnl|my_center|LOCUS_08090 6782 7321 gene locus_tag LOCUS_08100 gene rplE 6782 7321 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 protein_id gnl|my_center|LOCUS_08100 7529 7924 gene locus_tag LOCUS_08110 gene rpsH 7529 7924 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_08110 7932 8471 gene locus_tag LOCUS_08120 gene rplF 7932 8471 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892857.1 protein_id gnl|my_center|LOCUS_08120 8481 8852 gene locus_tag LOCUS_08130 gene rplR 8481 8852 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814538.1 protein_id gnl|my_center|LOCUS_08130 8863 9342 gene locus_tag LOCUS_08140 gene rpsE 8863 9342 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_08140 9354 9533 gene locus_tag LOCUS_08150 gene rpmD 9354 9533 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860590.1 protein_id gnl|my_center|LOCUS_08150 9535 9978 gene locus_tag LOCUS_08160 gene rplO 9535 9978 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567527.1 protein_id gnl|my_center|LOCUS_08160 9978 11339 gene locus_tag LOCUS_08170 gene secY 9978 11339 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_08170 11339 11557 gene locus_tag LOCUS_08180 gene infA 11339 11557 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937325.1 protein_id gnl|my_center|LOCUS_08180 11711 12079 gene locus_tag LOCUS_08190 gene rpsM 11711 12079 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_08190 12091 12528 gene locus_tag LOCUS_08200 gene rpsK 12091 12528 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892910.1 protein_id gnl|my_center|LOCUS_08200 12548 13531 gene locus_tag LOCUS_08210 12548 13531 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_08210 13534 14007 gene locus_tag LOCUS_08220 gene rplQ 13534 14007 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943458.1 protein_id gnl|my_center|LOCUS_08220 14105 15280 gene locus_tag LOCUS_08230 14105 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 15282 16478 gene locus_tag LOCUS_08240 15282 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 16508 17833 gene locus_tag LOCUS_08250 16508 17833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 18811 17846 gene locus_tag LOCUS_08260 18811 17846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 20194 18821 gene locus_tag LOCUS_08270 20194 18821 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_08270 20292 20903 gene locus_tag LOCUS_08280 20292 20903 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267815.1 protein_id gnl|my_center|LOCUS_08280 20900 21508 gene locus_tag LOCUS_08290 20900 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence027 1822 593 gene locus_tag LOCUS_08300 gene glgA 1822 593 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839391.1 protein_id gnl|my_center|LOCUS_08300 3690 1864 gene locus_tag LOCUS_08310 3690 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3903 4394 gene locus_tag LOCUS_08320 3903 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 4536 6725 gene locus_tag LOCUS_08330 4536 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6769 8082 gene locus_tag LOCUS_08340 6769 8082 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868507.1 protein_id gnl|my_center|LOCUS_08340 9172 8069 gene locus_tag LOCUS_08350 9172 8069 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795161.1 protein_id gnl|my_center|LOCUS_08350 9200 9961 gene locus_tag LOCUS_08360 gene lpxA 9200 9961 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_08360 11132 9951 gene locus_tag LOCUS_08370 11132 9951 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583039.1 protein_id gnl|my_center|LOCUS_08370 11375 12112 gene locus_tag LOCUS_08380 11375 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 12122 14353 gene locus_tag LOCUS_08390 12122 14353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 14368 16611 gene locus_tag LOCUS_08400 14368 16611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 16627 18759 gene locus_tag LOCUS_08410 16627 18759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 18771 19634 gene locus_tag LOCUS_08420 18771 19634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 19644 20705 gene locus_tag LOCUS_08430 19644 20705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence028 4615 338 gene locus_tag LOCUS_08440 4615 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 5683 4853 gene locus_tag LOCUS_08450 5683 4853 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_08450 6564 5701 gene locus_tag LOCUS_08460 gene nadC 6564 5701 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_08460 8015 6564 gene locus_tag LOCUS_08470 8015 6564 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_08470 9300 8017 gene locus_tag LOCUS_08480 9300 8017 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_08480 9495 10667 gene locus_tag LOCUS_08490 9495 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 11424 10669 gene locus_tag LOCUS_08500 11424 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 12417 11533 gene locus_tag LOCUS_08510 12417 11533 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_08510 14289 12541 gene locus_tag LOCUS_08520 gene rpsA 14289 12541 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931980.1 protein_id gnl|my_center|LOCUS_08520 14987 14292 gene locus_tag LOCUS_08530 gene cmk 14987 14292 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358949.1 protein_id gnl|my_center|LOCUS_08530 17102 16470 gene locus_tag LOCUS_08540 17102 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 17205 18383 gene locus_tag LOCUS_08550 17205 18383 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_08550 18582 19520 gene locus_tag LOCUS_08560 18582 19520 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_08560 19520 20407 gene locus_tag LOCUS_08570 19520 20407 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence029 157 2643 gene locus_tag LOCUS_08580 157 2643 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_08580 2674 3270 gene locus_tag LOCUS_08590 2674 3270 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_08590 3428 6472 gene locus_tag LOCUS_08600 3428 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 6551 6624 gene locus_tag LOCUS_t00170 6551 6624 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6724 9357 gene locus_tag LOCUS_08610 6724 9357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 9368 10207 gene locus_tag LOCUS_08620 gene ispE 9368 10207 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133845424.1 protein_id gnl|my_center|LOCUS_08620 10228 10731 gene locus_tag LOCUS_08630 10228 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 10808 12541 gene locus_tag LOCUS_08640 10808 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 12569 13738 gene locus_tag LOCUS_08650 12569 13738 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_08650 13922 14608 gene locus_tag LOCUS_08660 13922 14608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 14722 15537 gene locus_tag LOCUS_08670 gene mscS 14722 15537 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_08670 15642 16586 gene locus_tag LOCUS_08680 gene mdh 15642 16586 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382961.1 protein_id gnl|my_center|LOCUS_08680 18395 16698 gene locus_tag LOCUS_08690 18395 16698 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_08690 18552 19748 gene locus_tag LOCUS_08700 18552 19748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence030 2900 1443 gene locus_tag LOCUS_08710 gene guaB 2900 1443 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 protein_id gnl|my_center|LOCUS_08710 3641 3090 gene locus_tag LOCUS_08720 gene pth 3641 3090 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_08720 4404 3661 gene locus_tag LOCUS_08730 4404 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 5440 4415 gene locus_tag LOCUS_08740 gene pdxA 5440 4415 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_08740 6487 5450 gene locus_tag LOCUS_08750 6487 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 6897 6484 gene locus_tag LOCUS_08760 gene ruvX 6897 6484 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940329.1 protein_id gnl|my_center|LOCUS_08760 7118 7636 gene locus_tag LOCUS_08770 7118 7636 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 protein_id gnl|my_center|LOCUS_08770 10998 7633 gene locus_tag LOCUS_08780 gene mfd 10998 7633 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_08780 12239 10995 gene locus_tag LOCUS_08790 12239 10995 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_08790 12802 12233 gene locus_tag LOCUS_08800 gene lspA 12802 12233 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358651.1 protein_id gnl|my_center|LOCUS_08800 13836 12796 gene locus_tag LOCUS_08810 13836 12796 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_08810 14411 13833 gene locus_tag LOCUS_08820 14411 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 14795 15496 gene locus_tag LOCUS_08830 14795 15496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 15483 17102 gene locus_tag LOCUS_08840 15483 17102 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_08840 17401 17105 gene locus_tag LOCUS_08850 17401 17105 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_08850 17667 17398 gene locus_tag LOCUS_08860 17667 17398 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369771.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence031 <1 1633 gene locus_tag LOCUS_08870 <1 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000503851.1:exodeoxyribonuclease V subunit alpha 2138 1626 gene locus_tag LOCUS_08880 2138 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 4829 2148 gene locus_tag LOCUS_08890 4829 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 5074 5244 gene locus_tag LOCUS_08900 5074 5244 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_08900 6002 5241 gene locus_tag LOCUS_08910 6002 5241 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679999.1 protein_id gnl|my_center|LOCUS_08910 7794 6028 gene locus_tag LOCUS_08920 7794 6028 CDS product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 protein_id gnl|my_center|LOCUS_08920 8372 8214 gene locus_tag LOCUS_08930 8372 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 9410 8391 gene locus_tag LOCUS_08940 9410 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 13262 9414 gene locus_tag LOCUS_08950 13262 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 13723 13265 gene locus_tag LOCUS_08960 13723 13265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 15597 13933 gene locus_tag LOCUS_08970 gene pgi 15597 13933 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 protein_id gnl|my_center|LOCUS_08970 16330 18261 gene locus_tag LOCUS_08980 16330 18261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 18397 19470 gene locus_tag LOCUS_08990 18397 19470 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence032 <1 994 gene locus_tag LOCUS_09000 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403652.1:chromosome segregation protein SMC 2985 991 gene locus_tag LOCUS_09010 gene ligA 2985 991 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_09010 3593 3006 gene locus_tag LOCUS_09020 3593 3006 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465083.1 protein_id gnl|my_center|LOCUS_09020 3998 3603 gene locus_tag LOCUS_09030 3998 3603 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_09030 5488 3995 gene locus_tag LOCUS_09040 5488 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 7587 5485 gene locus_tag LOCUS_09050 7587 5485 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258514.1 protein_id gnl|my_center|LOCUS_09050 8777 7584 gene locus_tag LOCUS_09060 8777 7584 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 protein_id gnl|my_center|LOCUS_09060 11067 8779 gene locus_tag LOCUS_09070 11067 8779 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402856.1 protein_id gnl|my_center|LOCUS_09070 11310 12722 gene locus_tag LOCUS_09080 11310 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 13771 12737 gene locus_tag LOCUS_09090 gene ruvB 13771 12737 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_09090 14363 13782 gene locus_tag LOCUS_09100 gene ruvA 14363 13782 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 protein_id gnl|my_center|LOCUS_09100 14639 14854 gene locus_tag LOCUS_09110 14639 14854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 15331 15570 gene locus_tag LOCUS_09120 15331 15570 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292400.1 protein_id gnl|my_center|LOCUS_09120 15612 15986 gene locus_tag LOCUS_09130 15612 15986 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_09130 16333 16953 gene locus_tag LOCUS_09140 16333 16953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 17347 18213 gene locus_tag LOCUS_09150 17347 18213 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263382.1 protein_id gnl|my_center|LOCUS_09150 18939 18406 gene locus_tag LOCUS_09160 18939 18406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence033 168 1295 gene locus_tag LOCUS_09170 168 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1497 1270 gene locus_tag LOCUS_09180 1497 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 5103 1786 gene locus_tag LOCUS_09190 5103 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 6387 5224 gene locus_tag LOCUS_09200 6387 5224 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_09200 6780 6397 gene locus_tag LOCUS_09210 6780 6397 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263230.1 protein_id gnl|my_center|LOCUS_09210 7621 6797 gene locus_tag LOCUS_09220 7621 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 9165 7618 gene locus_tag LOCUS_09230 9165 7618 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_09230 9374 11311 gene locus_tag LOCUS_09240 9374 11311 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_09240 12215 11313 gene locus_tag LOCUS_09250 12215 11313 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_09250 13107 12208 gene locus_tag LOCUS_09260 13107 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 13457 13104 gene locus_tag LOCUS_09270 gene rbfA 13457 13104 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719600.1 protein_id gnl|my_center|LOCUS_09270 16521 13573 gene locus_tag LOCUS_09280 16521 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 17790 16540 gene locus_tag LOCUS_09290 17790 16540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 18302 17814 gene locus_tag LOCUS_09300 18302 17814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence034 839 3 gene locus_tag LOCUS_09310 839 3 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_09310 902 1120 gene locus_tag LOCUS_09320 902 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1627 1139 gene locus_tag LOCUS_09330 1627 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2419 1661 gene locus_tag LOCUS_09340 2419 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2487 3398 gene locus_tag LOCUS_09350 2487 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4720 3401 gene locus_tag LOCUS_09360 gene mnmE 4720 3401 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582535.1 protein_id gnl|my_center|LOCUS_09360 4794 5744 gene locus_tag LOCUS_09370 4794 5744 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_09370 7032 5722 gene locus_tag LOCUS_09380 gene ctpA 7032 5722 CDS product carboxy-terminal processing protease CtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231186.1 protein_id gnl|my_center|LOCUS_09380 7121 7885 gene locus_tag LOCUS_09390 7121 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 7879 9252 gene locus_tag LOCUS_09400 7879 9252 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809528.1 protein_id gnl|my_center|LOCUS_09400 9314 9970 gene locus_tag LOCUS_09410 9314 9970 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174863573.1 protein_id gnl|my_center|LOCUS_09410 9971 10621 gene locus_tag LOCUS_09420 9971 10621 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_09420 10618 11007 gene locus_tag LOCUS_09430 10618 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 11025 11951 gene locus_tag LOCUS_09440 gene rfbD 11025 11951 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_09440 13543 12734 gene locus_tag LOCUS_09450 13543 12734 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257038.1 protein_id gnl|my_center|LOCUS_09450 14528 13533 gene locus_tag LOCUS_09460 14528 13533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257039.1 protein_id gnl|my_center|LOCUS_09460 15349 14540 gene locus_tag LOCUS_09470 15349 14540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 16638 15388 gene locus_tag LOCUS_09480 16638 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 18513 16648 gene locus_tag LOCUS_09490 18513 16648 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775805.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence035 1831 554 gene locus_tag LOCUS_09500 1831 554 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_09500 2123 3607 gene locus_tag LOCUS_09510 2123 3607 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_09510 3626 4015 gene locus_tag LOCUS_09520 3626 4015 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966538.1 protein_id gnl|my_center|LOCUS_09520 4808 4044 gene locus_tag LOCUS_09530 4808 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 5031 6506 gene locus_tag LOCUS_09540 5031 6506 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_09540 7439 6510 gene locus_tag LOCUS_09550 7439 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 7578 8063 gene locus_tag LOCUS_09560 7578 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 8056 9012 gene locus_tag LOCUS_09570 8056 9012 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922118.1 protein_id gnl|my_center|LOCUS_09570 9009 9749 gene locus_tag LOCUS_09580 9009 9749 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203389.1 protein_id gnl|my_center|LOCUS_09580 11000 9801 gene locus_tag LOCUS_09590 11000 9801 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459301.1 protein_id gnl|my_center|LOCUS_09590 11757 10981 gene locus_tag LOCUS_09600 gene argB 11757 10981 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_09600 11866 12063 gene locus_tag LOCUS_09610 11866 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 13058 12228 gene locus_tag LOCUS_09620 13058 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 13119 14354 gene locus_tag LOCUS_09630 13119 14354 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_09630 16686 14569 gene locus_tag LOCUS_09640 16686 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 18209 16728 gene locus_tag LOCUS_09650 18209 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence036 1481 432 gene locus_tag LOCUS_09660 1481 432 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964711.1 protein_id gnl|my_center|LOCUS_09660 2998 1469 gene locus_tag LOCUS_09670 2998 1469 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203002.1 protein_id gnl|my_center|LOCUS_09670 4155 2998 gene locus_tag LOCUS_09680 4155 2998 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362618.1 protein_id gnl|my_center|LOCUS_09680 5318 4149 gene locus_tag LOCUS_09690 5318 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 6391 5321 gene locus_tag LOCUS_09700 6391 5321 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184376.1 protein_id gnl|my_center|LOCUS_09700 7119 6394 gene locus_tag LOCUS_09710 7119 6394 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981011.1 protein_id gnl|my_center|LOCUS_09710 8758 7133 gene locus_tag LOCUS_09720 8758 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 9219 8758 gene locus_tag LOCUS_09730 9219 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 9548 9216 gene locus_tag LOCUS_09740 9548 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 10446 9523 gene locus_tag LOCUS_09750 gene ftsY 10446 9523 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_09750 11036 10446 gene locus_tag LOCUS_09760 gene clpP 11036 10446 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_09760 11120 11887 gene locus_tag LOCUS_09770 11120 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 11964 12428 gene locus_tag LOCUS_09780 11964 12428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 12434 12508 gene locus_tag LOCUS_t00180 12434 12508 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13246 12542 gene locus_tag LOCUS_09790 gene rpe 13246 12542 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_09790 13339 13716 gene locus_tag LOCUS_09800 13339 13716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 13977 15035 gene locus_tag LOCUS_09810 13977 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 15184 15606 gene locus_tag LOCUS_09820 15184 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence037 2115 652 gene locus_tag LOCUS_09830 2115 652 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_09830 3964 2120 gene locus_tag LOCUS_09840 3964 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5139 3973 gene locus_tag LOCUS_09850 5139 3973 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 protein_id gnl|my_center|LOCUS_09850 6533 5136 gene locus_tag LOCUS_09860 6533 5136 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926921.1 protein_id gnl|my_center|LOCUS_09860 6706 7464 gene locus_tag LOCUS_09870 6706 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 7473 8285 gene locus_tag LOCUS_09880 7473 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 8285 9814 gene locus_tag LOCUS_09890 8285 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 9879 10247 gene locus_tag LOCUS_09900 9879 10247 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_09900 10735 10298 gene locus_tag LOCUS_09910 10735 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 10919 10847 gene locus_tag LOCUS_t00190 10919 10847 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12853 10934 gene locus_tag LOCUS_09920 12853 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 12937 14505 gene locus_tag LOCUS_09930 gene nadB 12937 14505 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_09930 15841 14600 gene locus_tag LOCUS_09940 15841 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence038 670 849 gene locus_tag LOCUS_09950 670 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 862 1947 gene locus_tag LOCUS_09960 862 1947 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071538.1 protein_id gnl|my_center|LOCUS_09960 1963 2036 gene locus_tag LOCUS_t00200 1963 2036 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2211 2750 gene locus_tag LOCUS_09970 2211 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2840 4126 gene locus_tag LOCUS_09980 gene aroA 2840 4126 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262299.1 protein_id gnl|my_center|LOCUS_09980 4123 6267 gene locus_tag LOCUS_09990 4123 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7631 6264 gene locus_tag LOCUS_10000 7631 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 7776 9458 gene locus_tag LOCUS_10010 7776 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 9667 10224 gene locus_tag LOCUS_10020 9667 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 12103 10373 gene locus_tag LOCUS_10030 12103 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 12206 13015 gene locus_tag LOCUS_10040 12206 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 13177 14619 gene locus_tag LOCUS_10050 13177 14619 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229209.1 protein_id gnl|my_center|LOCUS_10050 14626 16314 gene locus_tag LOCUS_10060 14626 16314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence039 166 1332 gene locus_tag LOCUS_10070 166 1332 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664911.1 protein_id gnl|my_center|LOCUS_10070 2672 1425 gene locus_tag LOCUS_10080 gene glgC 2672 1425 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929348.1 protein_id gnl|my_center|LOCUS_10080 2933 4750 gene locus_tag LOCUS_10090 2933 4750 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_10090 5998 4817 gene locus_tag LOCUS_10100 5998 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 9058 6167 gene locus_tag LOCUS_10110 9058 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 9134 10219 gene locus_tag LOCUS_10120 gene leuB 9134 10219 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042353.1 protein_id gnl|my_center|LOCUS_10120 10337 11287 gene locus_tag LOCUS_10130 10337 11287 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_10130 11369 12103 gene locus_tag LOCUS_10140 11369 12103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 12100 12588 gene locus_tag LOCUS_10150 12100 12588 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_10150 15789 12676 gene locus_tag LOCUS_10160 15789 12676 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_10160 16744 15803 gene locus_tag LOCUS_10170 16744 15803 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760595.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence040 <1 600 gene locus_tag LOCUS_10180 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002485281.1:alanine/glycine:cation symporter family protein 2026 950 gene locus_tag LOCUS_10190 2026 950 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905400.1 protein_id gnl|my_center|LOCUS_10190 4618 2159 gene locus_tag LOCUS_10200 4618 2159 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_10200 5687 4629 gene locus_tag LOCUS_10210 5687 4629 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129003072.1 protein_id gnl|my_center|LOCUS_10210 5839 6396 gene locus_tag LOCUS_10220 5839 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 6406 6588 gene locus_tag LOCUS_10230 gene rpmF 6406 6588 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_10230 6632 7603 gene locus_tag LOCUS_10240 gene plsX 6632 7603 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_10240 7773 8693 gene locus_tag LOCUS_10250 gene fabD 7773 8693 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_10250 8696 9436 gene locus_tag LOCUS_10260 gene fabG 8696 9436 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_10260 9482 9721 gene locus_tag LOCUS_10270 9482 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 9862 10623 gene locus_tag LOCUS_10280 gene rnc 9862 10623 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_10280 10634 12403 gene locus_tag LOCUS_10290 10634 12403 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970104.1 protein_id gnl|my_center|LOCUS_10290 12427 14502 gene locus_tag LOCUS_10300 gene uvrB 12427 14502 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583249.1 protein_id gnl|my_center|LOCUS_10300 14731 15549 gene locus_tag LOCUS_10310 gene thiM 14731 15549 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092692.1 protein_id gnl|my_center|LOCUS_10310 15546 16184 gene locus_tag LOCUS_10320 gene thiE 15546 16184 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence041 1125 103 gene locus_tag LOCUS_10330 1125 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1727 1146 gene locus_tag LOCUS_10340 1727 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2911 1724 gene locus_tag LOCUS_10350 gene tolB 2911 1724 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_10350 2871 3182 gene locus_tag LOCUS_10360 2871 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3179 4582 gene locus_tag LOCUS_10370 3179 4582 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_10370 5025 4579 gene locus_tag LOCUS_10380 5025 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 6087 5029 gene locus_tag LOCUS_10390 6087 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 6848 6102 gene locus_tag LOCUS_10400 6848 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 7735 6845 gene locus_tag LOCUS_10410 7735 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 8225 7743 gene locus_tag LOCUS_10420 8225 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10420 9045 8200 gene locus_tag LOCUS_10430 9045 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 10000 9038 gene locus_tag LOCUS_10440 gene lpxD 10000 9038 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777041.1 protein_id gnl|my_center|LOCUS_10440 10963 10001 gene locus_tag LOCUS_10450 10963 10001 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101673.1 protein_id gnl|my_center|LOCUS_10450 11474 10956 gene locus_tag LOCUS_10460 11474 10956 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851622.1 protein_id gnl|my_center|LOCUS_10460 12144 11653 gene locus_tag LOCUS_10470 12144 11653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 12265 12879 gene locus_tag LOCUS_10480 12265 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 12911 13963 gene locus_tag LOCUS_10490 12911 13963 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence042 1313 291 gene locus_tag LOCUS_10500 1313 291 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_10500 1552 2841 gene locus_tag LOCUS_10510 1552 2841 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_10510 2853 4142 gene locus_tag LOCUS_10520 2853 4142 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_10520 4924 4202 gene locus_tag LOCUS_10530 gene rph 4924 4202 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811904.1 protein_id gnl|my_center|LOCUS_10530 5808 4948 gene locus_tag LOCUS_10540 gene pheA 5808 4948 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933330.1 protein_id gnl|my_center|LOCUS_10540 6344 5808 gene locus_tag LOCUS_10550 6344 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 7356 7652 gene locus_tag LOCUS_10560 7356 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 7645 10101 gene locus_tag LOCUS_10570 gene feoB 7645 10101 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 protein_id gnl|my_center|LOCUS_10570 10234 10542 gene locus_tag LOCUS_10580 10234 10542 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_10580 10543 11796 gene locus_tag LOCUS_10590 10543 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 12459 11896 gene locus_tag LOCUS_10600 12459 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 13643 12456 gene locus_tag LOCUS_10610 13643 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 14374 13655 gene locus_tag LOCUS_10620 14374 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 15232 14375 gene locus_tag LOCUS_10630 15232 14375 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence043 2545 2363 gene locus_tag LOCUS_10640 2545 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3633 2677 gene locus_tag LOCUS_10650 3633 2677 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_10650 4448 3645 gene locus_tag LOCUS_10660 4448 3645 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_10660 4930 4436 gene locus_tag LOCUS_10670 gene coaD 4930 4436 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_10670 5458 4931 gene locus_tag LOCUS_10680 gene rsmD 5458 4931 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_10680 6480 5461 gene locus_tag LOCUS_10690 6480 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 7391 6477 gene locus_tag LOCUS_10700 7391 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 7873 7427 gene locus_tag LOCUS_10710 7873 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 8677 7955 gene locus_tag LOCUS_10720 gene kdsB 8677 7955 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_10720 8968 8681 gene locus_tag LOCUS_10730 gene gatC 8968 8681 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903491.1 protein_id gnl|my_center|LOCUS_10730 11429 9021 gene locus_tag LOCUS_10740 11429 9021 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403314.1 protein_id gnl|my_center|LOCUS_10740 13451 11544 gene locus_tag LOCUS_10750 gene pilB 13451 11544 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_10750 14434 13448 gene locus_tag LOCUS_10760 gene thiL 14434 13448 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence044 3227 747 gene locus_tag LOCUS_10770 3227 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4471 3227 gene locus_tag LOCUS_10780 4471 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 5834 4692 gene locus_tag LOCUS_10790 5834 4692 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_10790 6007 6852 gene locus_tag LOCUS_10800 6007 6852 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_10800 7004 8779 gene locus_tag LOCUS_10810 7004 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 8782 9570 gene locus_tag LOCUS_10820 8782 9570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405213.1 protein_id gnl|my_center|LOCUS_10820 9567 9902 gene locus_tag LOCUS_10830 9567 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 9923 11833 gene locus_tag LOCUS_10840 gene gyrB 9923 11833 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_10840 11826 12836 gene locus_tag LOCUS_10850 11826 12836 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957539.1 protein_id gnl|my_center|LOCUS_10850 13759 12833 gene locus_tag LOCUS_10860 13759 12833 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_10860 14578 13844 gene locus_tag LOCUS_10870 14578 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence045 765 64 gene locus_tag LOCUS_10880 765 64 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227785.1 protein_id gnl|my_center|LOCUS_10880 1747 752 gene locus_tag LOCUS_10890 1747 752 CDS product bifunctional 3-dehydroquinate synthase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545527.1 protein_id gnl|my_center|LOCUS_10890 2072 1728 gene locus_tag LOCUS_10900 2072 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2718 2104 gene locus_tag LOCUS_10910 gene hisH 2718 2104 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_10910 2823 2896 gene locus_tag LOCUS_t00210 2823 2896 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2984 4747 gene locus_tag LOCUS_10920 2984 4747 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_10920 5894 5139 gene locus_tag LOCUS_10930 5894 5139 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_10930 6234 8843 gene locus_tag LOCUS_10940 6234 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 9087 9920 gene locus_tag LOCUS_10950 9087 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 9917 11245 gene locus_tag LOCUS_10960 9917 11245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 11321 11391 gene locus_tag LOCUS_t00220 11321 11391 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 <14471 11439 gene locus_tag LOCUS_10970 <14471 11439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764017.1:efflux RND transporter permease subunit >Feature sequence046 230 159 gene locus_tag LOCUS_t00230 230 159 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 362 279 gene locus_tag LOCUS_t00240 362 279 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 442 370 gene locus_tag LOCUS_t00250 442 370 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 784 1686 gene locus_tag LOCUS_10980 784 1686 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693993.1 protein_id gnl|my_center|LOCUS_10980 4426 1694 gene locus_tag LOCUS_10990 4426 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 4818 6191 gene locus_tag LOCUS_11000 4818 6191 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_11000 6221 7063 gene locus_tag LOCUS_11010 6221 7063 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_11010 7056 7901 gene locus_tag LOCUS_11020 7056 7901 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_11020 7901 8947 gene locus_tag LOCUS_11030 7901 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 10324 8954 gene locus_tag LOCUS_11040 10324 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 10726 10331 gene locus_tag LOCUS_11050 gene tagD 10726 10331 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880882.1 protein_id gnl|my_center|LOCUS_11050 11582 10764 gene locus_tag LOCUS_11060 11582 10764 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_11060 12815 11586 gene locus_tag LOCUS_11070 12815 11586 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765264.1 protein_id gnl|my_center|LOCUS_11070 <14324 12831 gene locus_tag LOCUS_11080 <14324 12831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704465.1:LTA synthase family protein >Feature sequence047 122 328 gene locus_tag LOCUS_11090 122 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 602 1129 gene locus_tag LOCUS_11100 602 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1307 1558 gene locus_tag LOCUS_11110 1307 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1674 1967 gene locus_tag LOCUS_11120 1674 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 2153 2416 gene locus_tag LOCUS_11130 2153 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2541 2759 gene locus_tag LOCUS_11140 2541 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 6131 3015 gene locus_tag LOCUS_11150 6131 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 6376 8304 gene locus_tag LOCUS_11160 6376 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 8498 9985 gene locus_tag LOCUS_11170 8498 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 11419 10079 gene locus_tag LOCUS_11180 gene glmM 11419 10079 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_11180 11634 13514 gene locus_tag LOCUS_11190 11634 13514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence048 1739 1431 gene locus_tag LOCUS_11200 1739 1431 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_11200 3535 1766 gene locus_tag LOCUS_11210 3535 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3721 4122 gene locus_tag LOCUS_11220 3721 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5234 4206 gene locus_tag LOCUS_11230 5234 4206 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_11230 5873 5253 gene locus_tag LOCUS_11240 5873 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 6389 5883 gene locus_tag LOCUS_11250 6389 5883 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_11250 6442 7542 gene locus_tag LOCUS_11260 6442 7542 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_11260 7708 7983 gene locus_tag LOCUS_11270 7708 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 8116 8358 gene locus_tag LOCUS_11280 8116 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 9197 8454 gene locus_tag LOCUS_11290 9197 8454 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943067.1 protein_id gnl|my_center|LOCUS_11290 10677 9187 gene locus_tag LOCUS_11300 10677 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 12239 10716 gene locus_tag LOCUS_11310 12239 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 12978 12241 gene locus_tag LOCUS_11320 12978 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 <13823 13274 gene locus_tag LOCUS_11330 <13823 13274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459538.1:tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO >Feature sequence049 430 942 gene locus_tag LOCUS_11340 430 942 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003041577.1 protein_id gnl|my_center|LOCUS_11340 993 1778 gene locus_tag LOCUS_11350 993 1778 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002840050.1 protein_id gnl|my_center|LOCUS_11350 1775 3190 gene locus_tag LOCUS_11360 gene sufB 1775 3190 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_11360 3543 3352 gene locus_tag LOCUS_11370 3543 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 4181 3624 gene locus_tag LOCUS_11380 4181 3624 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_11380 4205 5089 gene locus_tag LOCUS_11390 gene hslO 4205 5089 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460517.1 protein_id gnl|my_center|LOCUS_11390 5091 5717 gene locus_tag LOCUS_11400 gene thrH 5091 5717 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_11400 6296 6087 gene locus_tag LOCUS_11410 6296 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 7345 6395 gene locus_tag LOCUS_11420 7345 6395 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230181.1 protein_id gnl|my_center|LOCUS_11420 7452 8237 gene locus_tag LOCUS_11430 7452 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 8297 8369 gene locus_tag LOCUS_t00260 8297 8369 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9655 8459 gene locus_tag LOCUS_11440 9655 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 11390 9828 gene locus_tag LOCUS_11450 11390 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 11729 13642 gene locus_tag LOCUS_11460 11729 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence050 875 1315 gene locus_tag LOCUS_11470 875 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1783 3168 gene locus_tag LOCUS_11480 1783 3168 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_11480 3229 4068 gene locus_tag LOCUS_11490 3229 4068 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583389.1 protein_id gnl|my_center|LOCUS_11490 4777 4070 gene locus_tag LOCUS_11500 gene ispD 4777 4070 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989381.1 protein_id gnl|my_center|LOCUS_11500 5653 4796 gene locus_tag LOCUS_11510 5653 4796 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_11510 5694 6416 gene locus_tag LOCUS_11520 5694 6416 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722217.1 protein_id gnl|my_center|LOCUS_11520 6430 7218 gene locus_tag LOCUS_11530 6430 7218 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_11530 7228 9030 gene locus_tag LOCUS_11540 7228 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 9719 9027 gene locus_tag LOCUS_11550 9719 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 9831 10652 gene locus_tag LOCUS_11560 gene uppP 9831 10652 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_11560 11039 11112 gene locus_tag LOCUS_t00270 11039 11112 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11189 11271 gene locus_tag LOCUS_t00280 11189 11271 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11509 13428 gene locus_tag LOCUS_11570 11509 13428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence051 222 1088 gene locus_tag LOCUS_11580 222 1088 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000530044.1 protein_id gnl|my_center|LOCUS_11580 1174 1332 gene locus_tag LOCUS_11590 1174 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2074 1391 gene locus_tag LOCUS_11600 2074 1391 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426355.1 protein_id gnl|my_center|LOCUS_11600 3083 2103 gene locus_tag LOCUS_11610 3083 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3478 3795 gene locus_tag LOCUS_11620 gene hpf 3478 3795 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467451.1 protein_id gnl|my_center|LOCUS_11620 3798 4832 gene locus_tag LOCUS_11630 gene hprK 3798 4832 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839617.1 protein_id gnl|my_center|LOCUS_11630 4825 5721 gene locus_tag LOCUS_11640 4825 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 5791 6252 gene locus_tag LOCUS_11650 5791 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 6394 7125 gene locus_tag LOCUS_11660 6394 7125 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582876.1 protein_id gnl|my_center|LOCUS_11660 7235 8557 gene locus_tag LOCUS_11670 gene murD 7235 8557 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_11670 8604 10064 gene locus_tag LOCUS_11680 gene ahcY 8604 10064 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_11680 11970 10156 gene locus_tag LOCUS_11690 gene yidC 11970 10156 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545913.1 protein_id gnl|my_center|LOCUS_11690 12481 12233 gene locus_tag LOCUS_11700 12481 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 12739 12584 gene locus_tag LOCUS_11710 gene rpmH 12739 12584 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678985.1 protein_id gnl|my_center|LOCUS_11710 <13529 12919 gene locus_tag LOCUS_11720 <13529 12919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948368.1:DEAD/DEAH box helicase >Feature sequence052 1054 140 gene locus_tag LOCUS_11730 1054 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1301 2560 gene locus_tag LOCUS_11740 1301 2560 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438532.1 protein_id gnl|my_center|LOCUS_11740 2603 3670 gene locus_tag LOCUS_11750 gene recA 2603 3670 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_11750 5569 4589 gene locus_tag LOCUS_11760 5569 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5722 6156 gene locus_tag LOCUS_11770 5722 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6237 7001 gene locus_tag LOCUS_11780 gene tpiA 6237 7001 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902187.1 protein_id gnl|my_center|LOCUS_11780 7021 7425 gene locus_tag LOCUS_11790 7021 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 7448 7533 gene locus_tag LOCUS_t00290 7448 7533 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7673 7756 gene locus_tag LOCUS_t00300 7673 7756 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9047 8043 gene locus_tag LOCUS_11800 9047 8043 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_11800 9616 9083 gene locus_tag LOCUS_11810 9616 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 11117 9639 gene locus_tag LOCUS_11820 gene der 11117 9639 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760766.1 protein_id gnl|my_center|LOCUS_11820 11226 12137 gene locus_tag LOCUS_11830 11226 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 12167 12670 gene locus_tag LOCUS_11840 12167 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 13305 12643 gene locus_tag LOCUS_11850 13305 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 13493 13302 gene locus_tag LOCUS_11860 13493 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence053 790 278 gene locus_tag LOCUS_11870 790 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3390 787 gene locus_tag LOCUS_11880 gene mutS 3390 787 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_11880 4079 3390 gene locus_tag LOCUS_11890 gene scpB 4079 3390 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404243.1 protein_id gnl|my_center|LOCUS_11890 5374 4103 gene locus_tag LOCUS_11900 gene hisD 5374 4103 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243286.1 protein_id gnl|my_center|LOCUS_11900 7103 5385 gene locus_tag LOCUS_11910 gene cimA 7103 5385 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_11910 7421 7233 gene locus_tag LOCUS_11920 7421 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 8566 7421 gene locus_tag LOCUS_11930 8566 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 8955 8563 gene locus_tag LOCUS_11940 8955 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 9146 10462 gene locus_tag LOCUS_11950 gene xseA 9146 10462 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_11950 10939 10451 gene locus_tag LOCUS_11960 10939 10451 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531029.1 protein_id gnl|my_center|LOCUS_11960 11735 10941 gene locus_tag LOCUS_11970 11735 10941 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_11970 12782 11751 gene locus_tag LOCUS_11980 12782 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence054 408 2813 gene locus_tag LOCUS_11990 408 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2822 3343 gene locus_tag LOCUS_12000 gene hpt 2822 3343 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_12000 4394 3348 gene locus_tag LOCUS_12010 gene queA 4394 3348 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965581.1 protein_id gnl|my_center|LOCUS_12010 5374 4391 gene locus_tag LOCUS_12020 5374 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 6574 5384 gene locus_tag LOCUS_12030 6574 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 8112 6646 gene locus_tag LOCUS_12040 gene gltX 8112 6646 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904198.1 protein_id gnl|my_center|LOCUS_12040 8278 9249 gene locus_tag LOCUS_12050 gene epmA 8278 9249 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065622721.1 protein_id gnl|my_center|LOCUS_12050 9649 9221 gene locus_tag LOCUS_12060 gene stoA 9649 9221 CDS product sporulation thiol-disulfide oxidoreductase StoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245444.1 protein_id gnl|my_center|LOCUS_12060 9743 10810 gene locus_tag LOCUS_12070 9743 10810 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_12070 10814 12016 gene locus_tag LOCUS_12080 10814 12016 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_12080 12840 12217 gene locus_tag LOCUS_12090 12840 12217 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788037.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence055 1235 276 gene locus_tag LOCUS_12100 1235 276 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_12100 4144 1244 gene locus_tag LOCUS_12110 4144 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4465 6501 gene locus_tag LOCUS_12120 4465 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 7062 6502 gene locus_tag LOCUS_12130 gene gmk 7062 6502 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_12130 7988 7065 gene locus_tag LOCUS_12140 7988 7065 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_12140 10421 8001 gene locus_tag LOCUS_12150 10421 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 10650 12728 gene locus_tag LOCUS_12160 10650 12728 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786503.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence056 1532 297 gene locus_tag LOCUS_12170 1532 297 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924918.1 protein_id gnl|my_center|LOCUS_12170 1787 1569 gene locus_tag LOCUS_12180 1787 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2610 1795 gene locus_tag LOCUS_12190 2610 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 6045 2617 gene locus_tag LOCUS_12200 6045 2617 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 protein_id gnl|my_center|LOCUS_12200 7478 6096 gene locus_tag LOCUS_12210 gene pepP 7478 6096 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444958.1 protein_id gnl|my_center|LOCUS_12210 7559 7873 gene locus_tag LOCUS_12220 7559 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 7878 8837 gene locus_tag LOCUS_12230 7878 8837 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_12230 8834 11140 gene locus_tag LOCUS_12240 8834 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 11239 11433 gene locus_tag LOCUS_12250 11239 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 11424 11498 gene locus_tag LOCUS_t00310 11424 11498 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11509 11585 gene locus_tag LOCUS_t00320 11509 11585 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence057 763 1866 gene locus_tag LOCUS_12260 763 1866 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_12260 1856 5803 gene locus_tag LOCUS_12270 1856 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 7020 5884 gene locus_tag LOCUS_12280 gene dnaJ 7020 5884 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202549.1 protein_id gnl|my_center|LOCUS_12280 9035 7125 gene locus_tag LOCUS_12290 gene dnaK 9035 7125 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_12290 9745 9161 gene locus_tag LOCUS_12300 gene grpE 9745 9161 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_12300 10022 10507 gene locus_tag LOCUS_12310 10022 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 10648 12198 gene locus_tag LOCUS_12320 gene putP 10648 12198 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence058 1129 2094 gene locus_tag LOCUS_12330 1129 2094 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817148.1 protein_id gnl|my_center|LOCUS_12330 2177 2476 gene locus_tag LOCUS_12340 2177 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2473 3384 gene locus_tag LOCUS_12350 2473 3384 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_12350 3371 4174 gene locus_tag LOCUS_12360 3371 4174 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_12360 4171 5796 gene locus_tag LOCUS_12370 4171 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 5799 6788 gene locus_tag LOCUS_12380 5799 6788 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387879.1 protein_id gnl|my_center|LOCUS_12380 6791 8983 gene locus_tag LOCUS_12390 6791 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 10337 8991 gene locus_tag LOCUS_12400 gene hemN 10337 8991 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202641.1 protein_id gnl|my_center|LOCUS_12400 10749 10501 gene locus_tag LOCUS_12410 10749 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 <12595 11372 gene locus_tag LOCUS_12420 <12595 11372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458936.1:ATP-binding protein >Feature sequence059 706 356 gene locus_tag LOCUS_12430 gene rplT 706 356 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192938.1 protein_id gnl|my_center|LOCUS_12430 919 722 gene locus_tag LOCUS_12440 gene rpmI 919 722 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015481.1 protein_id gnl|my_center|LOCUS_12440 1570 938 gene locus_tag LOCUS_12450 gene infC 1570 938 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_12450 1695 1767 gene locus_tag LOCUS_t00330 1695 1767 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1828 2970 gene locus_tag LOCUS_12460 1828 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 3058 4077 gene locus_tag LOCUS_12470 gene pyrC 3058 4077 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958384.1 protein_id gnl|my_center|LOCUS_12470 4074 4814 gene locus_tag LOCUS_12480 4074 4814 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039081.1 protein_id gnl|my_center|LOCUS_12480 4833 6905 gene locus_tag LOCUS_12490 4833 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6905 7765 gene locus_tag LOCUS_12500 6905 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 7775 8413 gene locus_tag LOCUS_12510 7775 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815461.1 protein_id gnl|my_center|LOCUS_12510 8711 8505 gene locus_tag LOCUS_12520 8711 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 9505 8843 gene locus_tag LOCUS_12530 9505 8843 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553324.1 protein_id gnl|my_center|LOCUS_12530 9488 10291 gene locus_tag LOCUS_12540 9488 10291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 10360 12126 gene locus_tag LOCUS_12550 10360 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence060 943 11 gene locus_tag LOCUS_12560 943 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 2443 1499 gene locus_tag LOCUS_12570 2443 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2735 3709 gene locus_tag LOCUS_12580 2735 3709 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_12580 3761 5038 gene locus_tag LOCUS_12590 3761 5038 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_12590 6380 5277 gene locus_tag LOCUS_12600 6380 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 8393 6402 gene locus_tag LOCUS_12610 8393 6402 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926859.1 protein_id gnl|my_center|LOCUS_12610 8641 9117 gene locus_tag LOCUS_12620 gene ybaK 8641 9117 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_12620 9153 9803 gene locus_tag LOCUS_12630 9153 9803 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_12630 9908 10633 gene locus_tag LOCUS_12640 9908 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 10649 11002 gene locus_tag LOCUS_12650 10649 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 10999 11766 gene locus_tag LOCUS_12660 10999 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 11989 12132 gene locus_tag LOCUS_12670 11989 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence061 1118 1459 gene locus_tag LOCUS_12680 1118 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2658 1432 gene locus_tag LOCUS_12690 2658 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 3383 2652 gene locus_tag LOCUS_12700 3383 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 4024 3461 gene locus_tag LOCUS_12710 gene folE 4024 3461 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459178.1 protein_id gnl|my_center|LOCUS_12710 5491 4379 gene locus_tag LOCUS_12720 5491 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 6547 5516 gene locus_tag LOCUS_12730 6547 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 6865 7527 gene locus_tag LOCUS_12740 6865 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12740 7660 9444 gene locus_tag LOCUS_12750 7660 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12750 9612 10730 gene locus_tag LOCUS_12760 9612 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 10742 11881 gene locus_tag LOCUS_12770 10742 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence062 1071 2180 gene locus_tag LOCUS_12780 1071 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 3172 2288 gene locus_tag LOCUS_12790 gene metF 3172 2288 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_12790 4368 3319 gene locus_tag LOCUS_12800 4368 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 4525 5931 gene locus_tag LOCUS_12810 gene glgA 4525 5931 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944464.1 protein_id gnl|my_center|LOCUS_12810 9443 5997 gene locus_tag LOCUS_12820 9443 5997 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 protein_id gnl|my_center|LOCUS_12820 9977 9627 gene locus_tag LOCUS_12830 9977 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 10573 9989 gene locus_tag LOCUS_12840 10573 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 11175 10570 gene locus_tag LOCUS_12850 11175 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 <11878 11177 gene locus_tag LOCUS_12860 <11878 11177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461428.1:InlB B-repeat-containing protein >Feature sequence063 94 1290 gene locus_tag LOCUS_12870 94 1290 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262085.1 protein_id gnl|my_center|LOCUS_12870 2162 1287 gene locus_tag LOCUS_12880 2162 1287 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_12880 3499 2162 gene locus_tag LOCUS_12890 3499 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4614 3502 gene locus_tag LOCUS_12900 4614 3502 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839036.1 protein_id gnl|my_center|LOCUS_12900 4910 4617 gene locus_tag LOCUS_12910 4910 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 7387 5633 gene locus_tag LOCUS_12920 7387 5633 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002749.1 protein_id gnl|my_center|LOCUS_12920 8787 7384 gene locus_tag LOCUS_12930 8787 7384 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_12930 8892 10250 gene locus_tag LOCUS_12940 gene ffh 8892 10250 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863460.1 protein_id gnl|my_center|LOCUS_12940 10876 10277 gene locus_tag LOCUS_12950 10876 10277 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_12950 11580 11059 gene locus_tag LOCUS_12960 11580 11059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence064 1110 2348 gene locus_tag LOCUS_12970 1110 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2365 3423 gene locus_tag LOCUS_12980 2365 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3432 4985 gene locus_tag LOCUS_12990 3432 4985 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_12990 6423 5125 gene locus_tag LOCUS_13000 6423 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 8417 6519 gene locus_tag LOCUS_13010 gene speA 8417 6519 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_13010 8543 10210 gene locus_tag LOCUS_13020 8543 10210 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_13020 <11577 10293 gene locus_tag LOCUS_13030 <11577 10293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225147.1:glycoside hydrolase family 43 protein >Feature sequence065 <1 1023 gene locus_tag LOCUS_13040 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858356.1:type I restriction endonuclease subunit R note possible pseudo, frameshifted 921 3047 gene locus_tag LOCUS_13050 921 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13050 3154 3540 gene locus_tag LOCUS_13060 3154 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3512 7309 gene locus_tag LOCUS_13070 3512 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 7497 8216 gene locus_tag LOCUS_13080 7497 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 8224 9507 gene locus_tag LOCUS_13090 8224 9507 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_13090 9504 10244 gene locus_tag LOCUS_13100 9504 10244 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914162.1 protein_id gnl|my_center|LOCUS_13100 10244 10930 gene locus_tag LOCUS_13110 gene ftsE 10244 10930 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768285.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence066 301 591 gene locus_tag LOCUS_13120 301 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 793 1191 gene locus_tag LOCUS_13130 793 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1188 1607 gene locus_tag LOCUS_13140 1188 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1594 3309 gene locus_tag LOCUS_13150 gene argS 1594 3309 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948742.1 protein_id gnl|my_center|LOCUS_13150 5630 3798 gene locus_tag LOCUS_13160 gene typA 5630 3798 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_13160 5740 5907 gene locus_tag LOCUS_13170 5740 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 5904 6767 gene locus_tag LOCUS_13180 5904 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 7748 6768 gene locus_tag LOCUS_13190 7748 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 8219 7752 gene locus_tag LOCUS_13200 gene greA 8219 7752 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383382.1 protein_id gnl|my_center|LOCUS_13200 8303 9511 gene locus_tag LOCUS_13210 gene argJ 8303 9511 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_13210 9518 10927 gene locus_tag LOCUS_13220 gene murC 9518 10927 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530958.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence067 933 2873 gene locus_tag LOCUS_13230 933 2873 CDS product glycoside hydrolase family 44 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964233.1 protein_id gnl|my_center|LOCUS_13230 2876 3250 gene locus_tag LOCUS_13240 2876 3250 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007781386.1 protein_id gnl|my_center|LOCUS_13240 3347 4321 gene locus_tag LOCUS_13250 3347 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 4318 5106 gene locus_tag LOCUS_13260 gene hisA 4318 5106 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207860.1 protein_id gnl|my_center|LOCUS_13260 5075 6520 gene locus_tag LOCUS_13270 5075 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 8835 6919 gene locus_tag LOCUS_13280 gene sulP 8835 6919 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_13280 9196 8939 gene locus_tag LOCUS_13290 9196 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 9794 9216 gene locus_tag LOCUS_13300 9794 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 10321 9806 gene locus_tag LOCUS_13310 10321 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence068 534 2300 gene locus_tag LOCUS_13320 534 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 2302 3057 gene locus_tag LOCUS_13330 2302 3057 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_13330 3054 3839 gene locus_tag LOCUS_13340 3054 3839 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929674.1 protein_id gnl|my_center|LOCUS_13340 4618 3836 gene locus_tag LOCUS_13350 4618 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5361 4657 gene locus_tag LOCUS_13360 5361 4657 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480036.1 protein_id gnl|my_center|LOCUS_13360 6717 5452 gene locus_tag LOCUS_13370 gene rodA 6717 5452 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141486.1 protein_id gnl|my_center|LOCUS_13370 8576 6714 gene locus_tag LOCUS_13380 gene mrdA 8576 6714 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_13380 9063 8569 gene locus_tag LOCUS_13390 9063 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 9884 9060 gene locus_tag LOCUS_13400 9884 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 10931 9906 gene locus_tag LOCUS_13410 10931 9906 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545439.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence069 781 134 gene locus_tag LOCUS_13420 gene lexA 781 134 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_13420 1595 879 gene locus_tag LOCUS_13430 1595 879 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538559.1 protein_id gnl|my_center|LOCUS_13430 3150 1609 gene locus_tag LOCUS_13440 3150 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3768 3157 gene locus_tag LOCUS_13450 3768 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 5087 3765 gene locus_tag LOCUS_13460 5087 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 6550 5084 gene locus_tag LOCUS_13470 6550 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 7200 6553 gene locus_tag LOCUS_13480 7200 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 7316 7534 gene locus_tag LOCUS_13490 7316 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 7527 8477 gene locus_tag LOCUS_13500 gene appF 7527 8477 CDS product oligopeptide ABC transporter ATP-binding protein AppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232964.1 protein_id gnl|my_center|LOCUS_13500 8470 9621 gene locus_tag LOCUS_13510 8470 9621 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680626.1 protein_id gnl|my_center|LOCUS_13510 9728 10147 gene locus_tag LOCUS_13520 9728 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence070 262 2118 gene locus_tag LOCUS_13530 gene ilvD 262 2118 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693142.1 protein_id gnl|my_center|LOCUS_13530 4191 2185 gene locus_tag LOCUS_13540 4191 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 4384 5118 gene locus_tag LOCUS_13550 4384 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 5115 5885 gene locus_tag LOCUS_13560 5115 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 5959 7203 gene locus_tag LOCUS_13570 5959 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 7492 10239 gene locus_tag LOCUS_13580 7492 10239 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence071 65 1615 gene locus_tag LOCUS_13590 65 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1625 2467 gene locus_tag LOCUS_13600 1625 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 4374 2464 gene locus_tag LOCUS_13610 gene fusA 4374 2464 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545225.1 protein_id gnl|my_center|LOCUS_13610 5025 4378 gene locus_tag LOCUS_13620 5025 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 5750 5025 gene locus_tag LOCUS_13630 5750 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 6775 5747 gene locus_tag LOCUS_13640 6775 5747 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839879.1 protein_id gnl|my_center|LOCUS_13640 7749 6934 gene locus_tag LOCUS_13650 7749 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 8766 7858 gene locus_tag LOCUS_13660 8766 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 9902 8808 gene locus_tag LOCUS_13670 9902 8808 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_13670 10560 9910 gene locus_tag LOCUS_13680 10560 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence072 1770 127 gene locus_tag LOCUS_13690 1770 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4219 1877 gene locus_tag LOCUS_13700 4219 1877 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_13700 5196 4339 gene locus_tag LOCUS_13710 5196 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 5995 5213 gene locus_tag LOCUS_13720 5995 5213 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_13720 8322 6013 gene locus_tag LOCUS_13730 8322 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 8900 8499 gene locus_tag LOCUS_13740 8900 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 9817 8969 gene locus_tag LOCUS_13750 9817 8969 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence073 <1 528 gene locus_tag LOCUS_13760 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003704899.1:ribonuclease G 1480 575 gene locus_tag LOCUS_13770 1480 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2942 1482 gene locus_tag LOCUS_13780 2942 1482 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 protein_id gnl|my_center|LOCUS_13780 3016 3792 gene locus_tag LOCUS_13790 gene rsmA 3016 3792 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986025.1 protein_id gnl|my_center|LOCUS_13790 3811 5637 gene locus_tag LOCUS_13800 3811 5637 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_13800 9733 5642 gene locus_tag LOCUS_13810 9733 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence074 2060 462 gene locus_tag LOCUS_13820 2060 462 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418795.1 protein_id gnl|my_center|LOCUS_13820 2255 3067 gene locus_tag LOCUS_13830 2255 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3927 3073 gene locus_tag LOCUS_13840 3927 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 7955 3930 gene locus_tag LOCUS_13850 7955 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 8699 7974 gene locus_tag LOCUS_13860 8699 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 9518 8805 gene locus_tag LOCUS_13870 9518 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence075 746 1285 gene locus_tag LOCUS_13880 746 1285 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_13880 1278 1601 gene locus_tag LOCUS_13890 1278 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1602 2174 gene locus_tag LOCUS_13900 1602 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2348 4456 gene locus_tag LOCUS_13910 gene fusA 2348 4456 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102023.1 protein_id gnl|my_center|LOCUS_13910 4521 5630 gene locus_tag LOCUS_13920 4521 5630 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_13920 5723 6838 gene locus_tag LOCUS_13930 5723 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 7131 8195 gene locus_tag LOCUS_13940 7131 8195 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261018.1 protein_id gnl|my_center|LOCUS_13940 8480 8698 gene locus_tag LOCUS_13950 8480 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence076 5764 245 gene locus_tag LOCUS_13960 5764 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 8884 5777 gene locus_tag LOCUS_13970 8884 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence077 <1 1122 gene locus_tag LOCUS_13980 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004114264.1:ATP-binding protein 1520 1873 gene locus_tag LOCUS_13990 1520 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1870 3156 gene locus_tag LOCUS_14000 1870 3156 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_14000 5191 3311 gene locus_tag LOCUS_14010 5191 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 5490 6242 gene locus_tag LOCUS_14020 5490 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 6242 7486 gene locus_tag LOCUS_14030 6242 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 8699 7488 gene locus_tag LOCUS_14040 8699 7488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_14040 <9254 8696 gene locus_tag LOCUS_14050 <9254 8696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786909.1:ABC transporter ATP-binding protein >Feature sequence078 <1 1839 gene locus_tag LOCUS_14060 <1 1839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082399.1:glycosyl transferase 2451 1939 gene locus_tag LOCUS_14070 2451 1939 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969255.1 protein_id gnl|my_center|LOCUS_14070 2681 4369 gene locus_tag LOCUS_14080 gene ettA 2681 4369 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_14080 4479 5021 gene locus_tag LOCUS_14090 4479 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 5214 5483 gene locus_tag LOCUS_14100 5214 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 5752 6357 gene locus_tag LOCUS_14110 5752 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 6364 8055 gene locus_tag LOCUS_14120 6364 8055 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189365.1 protein_id gnl|my_center|LOCUS_14120 8323 8407 gene locus_tag LOCUS_t00340 8323 8407 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8431 8763 gene locus_tag LOCUS_14130 8431 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence079 2054 102 gene locus_tag LOCUS_14140 2054 102 CDS product glycoside hydrolase family 44 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964233.1 protein_id gnl|my_center|LOCUS_14140 3637 2078 gene locus_tag LOCUS_14150 gene murJ 3637 2078 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792519.1 protein_id gnl|my_center|LOCUS_14150 3712 4317 gene locus_tag LOCUS_14160 3712 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4537 4707 gene locus_tag LOCUS_14170 4537 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 4824 6155 gene locus_tag LOCUS_14180 4824 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6167 7180 gene locus_tag LOCUS_14190 6167 7180 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 protein_id gnl|my_center|LOCUS_14190 7696 7160 gene locus_tag LOCUS_14200 gene yfcD 7696 7160 CDS product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705180.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence080 3031 3645 gene locus_tag LOCUS_14210 gene cobC 3031 3645 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424906.1 protein_id gnl|my_center|LOCUS_14210 4048 5304 gene locus_tag LOCUS_14220 4048 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5390 7054 gene locus_tag LOCUS_14230 5390 7054 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence081 1052 105 gene locus_tag LOCUS_14240 1052 105 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_14240 1688 2467 gene locus_tag LOCUS_14250 1688 2467 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069020.1 protein_id gnl|my_center|LOCUS_14250 2576 4795 gene locus_tag LOCUS_14260 gene glgB 2576 4795 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113646.1 protein_id gnl|my_center|LOCUS_14260 5024 6523 gene locus_tag LOCUS_14270 gene lysS 5024 6523 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933055.1 protein_id gnl|my_center|LOCUS_14270 6545 7792 gene locus_tag LOCUS_14280 6545 7792 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence082 166 900 gene locus_tag LOCUS_14290 gene rpsB 166 900 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111483.1 protein_id gnl|my_center|LOCUS_14290 903 1784 gene locus_tag LOCUS_14300 gene tsf 903 1784 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733232.1 protein_id gnl|my_center|LOCUS_14300 2016 2723 gene locus_tag LOCUS_14310 gene pyrH 2016 2723 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 protein_id gnl|my_center|LOCUS_14310 2732 3271 gene locus_tag LOCUS_14320 gene frr 2732 3271 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_14320 3274 3984 gene locus_tag LOCUS_14330 3274 3984 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_14330 3977 4855 gene locus_tag LOCUS_14340 3977 4855 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359680.1 protein_id gnl|my_center|LOCUS_14340 5026 5628 gene locus_tag LOCUS_14350 gene rpsD 5026 5628 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703954.1 protein_id gnl|my_center|LOCUS_14350 6085 6690 gene locus_tag LOCUS_14360 6085 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 7450 6692 gene locus_tag LOCUS_14370 7450 6692 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812800.1 protein_id gnl|my_center|LOCUS_14370 7902 7489 gene locus_tag LOCUS_14380 7902 7489 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence083 920 3463 gene locus_tag LOCUS_14390 920 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3592 3789 gene locus_tag LOCUS_14400 3592 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 3807 4328 gene locus_tag LOCUS_14410 3807 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 4741 4400 gene locus_tag LOCUS_14420 4741 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence084 <1 572 gene locus_tag LOCUS_14430 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944063.1:uroporphyrinogen decarboxylase 1012 1458 gene locus_tag LOCUS_14440 1012 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1461 3059 gene locus_tag LOCUS_14450 1461 3059 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_14450 3071 4822 gene locus_tag LOCUS_14460 3071 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5001 4819 gene locus_tag LOCUS_14470 5001 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5189 5117 gene locus_tag LOCUS_t00350 5189 5117 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5235 5747 gene locus_tag LOCUS_14480 5235 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5925 6569 gene locus_tag LOCUS_14490 5925 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 7694 7182 gene locus_tag LOCUS_14500 7694 7182 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence085 1429 65 gene locus_tag LOCUS_14510 1429 65 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618671.1 protein_id gnl|my_center|LOCUS_14510 2122 1565 gene locus_tag LOCUS_14520 2122 1565 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813856.1 protein_id gnl|my_center|LOCUS_14520 2887 3498 gene locus_tag LOCUS_14530 2887 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 3610 4824 gene locus_tag LOCUS_14540 3610 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 4821 5177 gene locus_tag LOCUS_14550 4821 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence086 871 1428 gene locus_tag LOCUS_14560 871 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1516 2787 gene locus_tag LOCUS_14570 1516 2787 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_14570 2789 5896 gene locus_tag LOCUS_14580 2789 5896 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038877.1 protein_id gnl|my_center|LOCUS_14580 7388 5904 gene locus_tag LOCUS_14590 7388 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence087 2072 795 gene locus_tag LOCUS_14600 2072 795 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_14600 3403 2147 gene locus_tag LOCUS_14610 3403 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3556 4470 gene locus_tag LOCUS_14620 3556 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4698 5801 gene locus_tag LOCUS_14630 4698 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 7269 5824 gene locus_tag LOCUS_14640 gene purB 7269 5824 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence088 1261 173 gene locus_tag LOCUS_14650 1261 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 3720 1489 gene locus_tag LOCUS_14660 gene pnp 3720 1489 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_14660 4009 3737 gene locus_tag LOCUS_14670 gene rpsO 4009 3737 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671840.1 protein_id gnl|my_center|LOCUS_14670 4716 6434 gene locus_tag LOCUS_14680 gene ilvB 4716 6434 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880257.1 protein_id gnl|my_center|LOCUS_14680 6437 6940 gene locus_tag LOCUS_14690 gene ilvN 6437 6940 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence089 504 1595 gene locus_tag LOCUS_14700 gene hisC 504 1595 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_14700 1585 2388 gene locus_tag LOCUS_14710 1585 2388 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_14710 4696 2363 gene locus_tag LOCUS_14720 4696 2363 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 protein_id gnl|my_center|LOCUS_14720 4775 6010 gene locus_tag LOCUS_14730 4775 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 6722 6483 gene locus_tag LOCUS_14740 6722 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence090 448 1167 gene locus_tag LOCUS_14750 448 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1386 2774 gene locus_tag LOCUS_14760 gene rseP 1386 2774 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_14760 3012 4295 gene locus_tag LOCUS_14770 gene purD 3012 4295 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399692.1 protein_id gnl|my_center|LOCUS_14770 4306 4779 gene locus_tag LOCUS_14780 gene purE 4306 4779 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_14780 4782 5549 gene locus_tag LOCUS_14790 4782 5549 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_14790 5634 6527 gene locus_tag LOCUS_14800 5634 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence091 113 763 gene locus_tag LOCUS_14810 113 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 760 1923 gene locus_tag LOCUS_14820 760 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1920 2657 gene locus_tag LOCUS_14830 gene lptB 1920 2657 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016586.1 protein_id gnl|my_center|LOCUS_14830 2666 4183 gene locus_tag LOCUS_14840 gene rpoN 2666 4183 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403901.1 protein_id gnl|my_center|LOCUS_14840 4260 4955 gene locus_tag LOCUS_14850 4260 4955 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068586618.1 protein_id gnl|my_center|LOCUS_14850 4952 5269 gene locus_tag LOCUS_14860 4952 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 5488 6555 gene locus_tag LOCUS_14870 gene glk 5488 6555 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259043.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence092 1979 630 gene locus_tag LOCUS_14880 1979 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2808 3191 gene locus_tag LOCUS_14890 gene mutT 2808 3191 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_14890 3482 3198 gene locus_tag LOCUS_14900 3482 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3632 4981 gene locus_tag LOCUS_14910 3632 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 6536 5043 gene locus_tag LOCUS_14920 6536 5043 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890565.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence093 3020 327 gene locus_tag LOCUS_14930 gene leuS 3020 327 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122073.1 protein_id gnl|my_center|LOCUS_14930 3380 3637 gene locus_tag LOCUS_14940 3380 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3640 4920 gene locus_tag LOCUS_14950 3640 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 4920 5942 gene locus_tag LOCUS_14960 4920 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence094 382 2355 gene locus_tag LOCUS_14970 382 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2355 3668 gene locus_tag LOCUS_14980 2355 3668 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349591.1 protein_id gnl|my_center|LOCUS_14980 3712 6342 gene locus_tag LOCUS_14990 3712 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 6309 6599 gene locus_tag LOCUS_15000 6309 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence095 574 11 gene locus_tag LOCUS_15010 574 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 772 2238 gene locus_tag LOCUS_15020 772 2238 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133829731.1 protein_id gnl|my_center|LOCUS_15020 2501 3295 gene locus_tag LOCUS_15030 2501 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4933 3338 gene locus_tag LOCUS_15040 4933 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 5112 6155 gene locus_tag LOCUS_15050 5112 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence096 1094 516 gene locus_tag LOCUS_15060 1094 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2468 1104 gene locus_tag LOCUS_15070 2468 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3172 2465 gene locus_tag LOCUS_15080 3172 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3851 3162 gene locus_tag LOCUS_15090 3851 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 5689 3848 gene locus_tag LOCUS_15100 5689 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence097 >Feature sequence098 785 3937 gene locus_tag LOCUS_15110 785 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 3934 5094 gene locus_tag LOCUS_15120 3934 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 5100 5867 gene locus_tag LOCUS_15130 5100 5867 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence099 1390 956 gene locus_tag LOCUS_15140 1390 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1418 3292 gene locus_tag LOCUS_15150 1418 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3292 3843 gene locus_tag LOCUS_15160 3292 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 5309 3840 gene locus_tag LOCUS_15170 gene gltA 5309 3840 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926868.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence100 2656 965 gene locus_tag LOCUS_15180 2656 965 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229166.1 protein_id gnl|my_center|LOCUS_15180 2878 4566 gene locus_tag LOCUS_15190 2878 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence101 1232 21 gene locus_tag LOCUS_15200 gene nhaA 1232 21 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_15200 2458 1289 gene locus_tag LOCUS_15210 2458 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3898 2639 gene locus_tag LOCUS_15220 gene lysA 3898 2639 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209846.1 protein_id gnl|my_center|LOCUS_15220 5068 3986 gene locus_tag LOCUS_15230 5068 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 5218 5078 gene locus_tag LOCUS_15240 5218 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence102 2081 498 gene locus_tag LOCUS_15250 2081 498 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_15250 3034 2210 gene locus_tag LOCUS_15260 3034 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3099 3614 gene locus_tag LOCUS_15270 3099 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3611 4348 gene locus_tag LOCUS_15280 3611 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4335 5078 gene locus_tag LOCUS_15290 4335 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence103 1549 713 gene locus_tag LOCUS_15300 gene rlmB 1549 713 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957936.1 protein_id gnl|my_center|LOCUS_15300 1813 1565 gene locus_tag LOCUS_15310 1813 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3413 2151 gene locus_tag LOCUS_15320 3413 2151 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_15320 3566 4561 gene locus_tag LOCUS_15330 gene trpS 3566 4561 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022349.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence104 2485 146 gene locus_tag LOCUS_15340 2485 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3221 2658 gene locus_tag LOCUS_15350 gene rfbC 3221 2658 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_15350 4357 3221 gene locus_tag LOCUS_15360 gene rfbB 4357 3221 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766020.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence105 2078 513 gene locus_tag LOCUS_15370 2078 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 2194 4341 gene locus_tag LOCUS_15380 2194 4341 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence106 1596 202 gene locus_tag LOCUS_15390 1596 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 3470 1596 gene locus_tag LOCUS_15400 3470 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 <4470 3457 gene locus_tag LOCUS_15410 <4470 3457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876134.1:DNA cytosine methyltransferase >Feature sequence107 <1 529 gene locus_tag LOCUS_15420 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940358.1:protein TolQ 532 945 gene locus_tag LOCUS_15430 gene tolR 532 945 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_15430 935 1717 gene locus_tag LOCUS_15440 935 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1726 2610 gene locus_tag LOCUS_15450 1726 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2839 2913 gene locus_tag LOCUS_t00360 2839 2913 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2940 3515 gene locus_tag LOCUS_15460 2940 3515 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence108 738 2276 gene locus_tag LOCUS_15470 738 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence109 889 800 gene locus_tag LOCUS_t00370 889 800 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2075 948 gene locus_tag LOCUS_15480 2075 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3080 2106 gene locus_tag LOCUS_15490 gene galE 3080 2106 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_15490 3583 3245 gene locus_tag LOCUS_15500 3583 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence110 1681 836 gene locus_tag LOCUS_15510 1681 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3249 1684 gene locus_tag LOCUS_15520 3249 1684 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940814.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence111 63 620 gene locus_tag LOCUS_15530 63 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 629 1162 gene locus_tag LOCUS_15540 629 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1159 2478 gene locus_tag LOCUS_15550 1159 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence112 457 125 gene locus_tag LOCUS_15560 gene rpsI 457 125 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_15560 984 550 gene locus_tag LOCUS_15570 gene rplM 984 550 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_15570 2226 1144 gene locus_tag LOCUS_15580 gene dusB 2226 1144 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_15580 2323 2679 gene locus_tag LOCUS_15590 2323 2679 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126166.1 protein_id gnl|my_center|LOCUS_15590 3389 2676 gene locus_tag LOCUS_15600 3389 2676 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_15600 3742 3389 gene locus_tag LOCUS_15610 3742 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence113 1247 1912 gene locus_tag LOCUS_15620 1247 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2177 3637 gene locus_tag LOCUS_15630 2177 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15630 >Feature sequence114 1725 55 gene locus_tag LOCUS_15640 1725 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 3552 1738 gene locus_tag LOCUS_15650 3552 1738 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229166.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence115 1600 521 gene locus_tag LOCUS_15660 1600 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1619 2506 gene locus_tag LOCUS_15670 gene murB 1619 2506 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_15670 2508 3359 gene locus_tag LOCUS_15680 gene nudC 2508 3359 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence116 2740 1331 gene locus_tag LOCUS_15690 2740 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3285 2737 gene locus_tag LOCUS_15700 3285 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence117 750 2639 gene locus_tag LOCUS_15710 gene htpG 750 2639 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence118 2 604 gene locus_tag LOCUS_15720 2 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 601 1536 gene locus_tag LOCUS_15730 gene ispH 601 1536 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085791.1 protein_id gnl|my_center|LOCUS_15730 1679 1900 gene locus_tag LOCUS_15740 gene rpmB 1679 1900 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence119 806 270 gene locus_tag LOCUS_15750 806 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence120 <1 729 gene locus_tag LOCUS_15760 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000649925.1:GDP-mannose 4,6-dehydratase 1270 734 gene locus_tag LOCUS_15770 gene nrdG 1270 734 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_15770 <3233 1270 gene locus_tag LOCUS_15780 <3233 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459055.1:anaerobic ribonucleoside triphosphate reductase >Feature sequence121 2697 223 gene locus_tag LOCUS_15790 2697 223 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_15790 3064 2786 gene locus_tag LOCUS_15800 3064 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence122 49 696 gene locus_tag LOCUS_15810 49 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 818 891 gene locus_tag LOCUS_t00380 818 891 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1017 1442 gene locus_tag LOCUS_15820 1017 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1421 2425 gene locus_tag LOCUS_15830 1421 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 <3016 2429 gene locus_tag LOCUS_15840 <3016 2429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028842177.1:monofunctional biosynthetic peptidoglycan transglycosylase >Feature sequence123 1621 389 gene locus_tag LOCUS_15850 1621 389 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_15850 1710 2048 gene locus_tag LOCUS_15860 1710 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2413 2141 gene locus_tag LOCUS_15870 2413 2141 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481712.1 protein_id gnl|my_center|LOCUS_15870 2667 2398 gene locus_tag LOCUS_15880 2667 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence124 491 2581 gene locus_tag LOCUS_15890 491 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence125 >Feature sequence126 <1 1334 gene locus_tag LOCUS_15900 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010706701.1:autolysin 1342 1482 gene locus_tag LOCUS_15910 1342 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2515 2030 gene locus_tag LOCUS_15920 gene ispF 2515 2030 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225745.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence127 434 1732 gene locus_tag LOCUS_15930 gene hisS 434 1732 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence128 1411 239 gene locus_tag LOCUS_15940 1411 239 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389133.1 protein_id gnl|my_center|LOCUS_15940 1504 2061 gene locus_tag LOCUS_15950 1504 2061 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208337.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence129 1453 1064 gene locus_tag LOCUS_15960 1453 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1617 2111 gene locus_tag LOCUS_15970 1617 2111 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence130 425 1762 gene locus_tag LOCUS_15980 gene thrC 425 1762 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626010.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence131 2052 1048 gene locus_tag LOCUS_15990 2052 1048 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680321.1 protein_id gnl|my_center|LOCUS_15990