>Feature sequence001 443 273 gene locus_tag LOCUS_00010 443 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1316 774 gene locus_tag LOCUS_00020 1316 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1602 1303 gene locus_tag LOCUS_00030 1602 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2076 1711 gene locus_tag LOCUS_00040 2076 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2923 2267 gene locus_tag LOCUS_00050 2923 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3727 2963 gene locus_tag LOCUS_00060 3727 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 3876 3727 gene locus_tag LOCUS_00070 3876 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4269 3913 gene locus_tag LOCUS_00080 4269 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5323 4451 gene locus_tag LOCUS_00090 5323 4451 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_00090 5589 5320 gene locus_tag LOCUS_00100 5589 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 5756 5586 gene locus_tag LOCUS_00110 5756 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6520 5753 gene locus_tag LOCUS_00120 6520 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 7024 6746 gene locus_tag LOCUS_00130 7024 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 7228 7037 gene locus_tag LOCUS_00140 7228 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 7610 7347 gene locus_tag LOCUS_00150 7610 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 7936 7529 gene locus_tag LOCUS_00160 7936 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 8420 8064 gene locus_tag LOCUS_00170 8420 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 8881 8537 gene locus_tag LOCUS_00180 8881 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 9177 8878 gene locus_tag LOCUS_00190 9177 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 10112 9576 gene locus_tag LOCUS_00200 10112 9576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 10396 10109 gene locus_tag LOCUS_00210 10396 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 10635 10393 gene locus_tag LOCUS_00220 10635 10393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 10855 10628 gene locus_tag LOCUS_00230 10855 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 11194 10934 gene locus_tag LOCUS_00240 11194 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 11378 11163 gene locus_tag LOCUS_00250 11378 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 11560 11763 gene locus_tag LOCUS_00260 11560 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 11869 12084 gene locus_tag LOCUS_00270 11869 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 12337 12056 gene locus_tag LOCUS_00280 12337 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 13527 12541 gene locus_tag LOCUS_00290 13527 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 13923 13645 gene locus_tag LOCUS_00300 13923 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 16779 14173 gene locus_tag LOCUS_00310 16779 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 17165 16779 gene locus_tag LOCUS_00320 17165 16779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 17423 17256 gene locus_tag LOCUS_00330 17423 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 17587 17994 gene locus_tag LOCUS_00340 17587 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 20597 18414 gene locus_tag LOCUS_00350 20597 18414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 22496 20598 gene locus_tag LOCUS_00360 22496 20598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 23218 22736 gene locus_tag LOCUS_00370 23218 22736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 23834 23319 gene locus_tag LOCUS_00380 23834 23319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 24658 23918 gene locus_tag LOCUS_00390 24658 23918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 25527 25303 gene locus_tag LOCUS_00400 25527 25303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 25969 25541 gene locus_tag LOCUS_00410 25969 25541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 26473 25970 gene locus_tag LOCUS_00420 26473 25970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 27099 26473 gene locus_tag LOCUS_00430 27099 26473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 27381 27103 gene locus_tag LOCUS_00440 27381 27103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 27851 27432 gene locus_tag LOCUS_00450 27851 27432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 28303 27854 gene locus_tag LOCUS_00460 28303 27854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 28830 28390 gene locus_tag LOCUS_00470 28830 28390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 30167 28932 gene locus_tag LOCUS_00480 30167 28932 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938792.1 protein_id gnl|my_center|LOCUS_00480 >Feature sequence002 311 1405 gene locus_tag LOCUS_00490 311 1405 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00490 1402 2337 gene locus_tag LOCUS_00500 1402 2337 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_00500 2413 3471 gene locus_tag LOCUS_00510 2413 3471 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970219.1 protein_id gnl|my_center|LOCUS_00510 3537 5090 gene locus_tag LOCUS_00520 3537 5090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_00520 6586 5453 gene locus_tag LOCUS_00530 6586 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 7112 6762 gene locus_tag LOCUS_00540 7112 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00540 8235 7078 gene locus_tag LOCUS_00550 8235 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00550 10123 8378 gene locus_tag LOCUS_00560 10123 8378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 10847 10455 gene locus_tag LOCUS_00570 10847 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 11137 12102 gene locus_tag LOCUS_00580 11137 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 12099 13034 gene locus_tag LOCUS_00590 12099 13034 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888939.1 protein_id gnl|my_center|LOCUS_00590 15135 13039 gene locus_tag LOCUS_00600 15135 13039 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_00600 15556 15230 gene locus_tag LOCUS_00610 15556 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 15501 16022 gene locus_tag LOCUS_00620 15501 16022 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_00620 16229 17641 gene locus_tag LOCUS_00630 gene dnaB 16229 17641 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_00630 17854 18465 gene locus_tag LOCUS_00640 17854 18465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 18383 19825 gene locus_tag LOCUS_00650 18383 19825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 19901 19974 gene locus_tag LOCUS_t00010 19901 19974 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20352 20077 gene locus_tag LOCUS_00660 20352 20077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 >Feature sequence003 732 442 gene locus_tag LOCUS_00670 732 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 1155 841 gene locus_tag LOCUS_00680 1155 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 2293 1166 gene locus_tag LOCUS_00690 gene amrS 2293 1166 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_00690 2437 2883 gene locus_tag LOCUS_00700 2437 2883 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257463.1 protein_id gnl|my_center|LOCUS_00700 3118 3723 gene locus_tag LOCUS_00710 3118 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 3720 4940 gene locus_tag LOCUS_00720 3720 4940 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_00720 5149 5655 gene locus_tag LOCUS_00730 5149 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 5652 5912 gene locus_tag LOCUS_00740 5652 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 6707 6033 gene locus_tag LOCUS_00750 6707 6033 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_00750 7315 6704 gene locus_tag LOCUS_00760 7315 6704 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399467.1 protein_id gnl|my_center|LOCUS_00760 7734 7312 gene locus_tag LOCUS_00770 7734 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 8102 8311 gene locus_tag LOCUS_00780 8102 8311 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701233.1 protein_id gnl|my_center|LOCUS_00780 8420 9052 gene locus_tag LOCUS_00790 8420 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 11635 9113 gene locus_tag LOCUS_00800 gene pheT 11635 9113 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_00800 12003 11632 gene locus_tag LOCUS_00810 12003 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 13087 12014 gene locus_tag LOCUS_00820 gene pheS 13087 12014 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_00820 13847 13539 gene locus_tag LOCUS_00830 13847 13539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 13904 14197 gene locus_tag LOCUS_00840 13904 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 15114 14422 gene locus_tag LOCUS_00850 15114 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 15599 15111 gene locus_tag LOCUS_00860 15599 15111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 17023 15788 gene locus_tag LOCUS_00870 17023 15788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799718.1 protein_id gnl|my_center|LOCUS_00870 17864 17106 gene locus_tag LOCUS_00880 17864 17106 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867638.1 protein_id gnl|my_center|LOCUS_00880 18889 17867 gene locus_tag LOCUS_00890 18889 17867 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229029.1 protein_id gnl|my_center|LOCUS_00890 19120 18944 gene locus_tag LOCUS_00900 19120 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 20736 19117 gene locus_tag LOCUS_00910 20736 19117 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808649.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence004 1173 397 gene locus_tag LOCUS_00920 1173 397 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_00920 1971 1198 gene locus_tag LOCUS_00930 1971 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 3100 1964 gene locus_tag LOCUS_00940 3100 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 3395 3108 gene locus_tag LOCUS_00950 3395 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 3691 3392 gene locus_tag LOCUS_00960 3691 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 3938 3762 gene locus_tag LOCUS_00970 3938 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 4171 4932 gene locus_tag LOCUS_00980 4171 4932 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_00980 6400 5114 gene locus_tag LOCUS_00990 gene murA 6400 5114 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257774.1 protein_id gnl|my_center|LOCUS_00990 6592 7602 gene locus_tag LOCUS_01000 6592 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 7586 9523 gene locus_tag LOCUS_01010 gene gyrB 7586 9523 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_01010 9626 10177 gene locus_tag LOCUS_01020 9626 10177 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_01020 10273 10734 gene locus_tag LOCUS_01030 10273 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 10734 11216 gene locus_tag LOCUS_01040 10734 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 11614 12147 gene locus_tag LOCUS_01050 11614 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 12150 13625 gene locus_tag LOCUS_01060 12150 13625 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063852.1 protein_id gnl|my_center|LOCUS_01060 13648 14907 gene locus_tag LOCUS_01070 13648 14907 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_01070 15962 15084 gene locus_tag LOCUS_01080 15962 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 16236 18263 gene locus_tag LOCUS_01090 16236 18263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 >Feature sequence005 408 929 gene locus_tag LOCUS_01100 408 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 956 1330 gene locus_tag LOCUS_01110 956 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 1327 1833 gene locus_tag LOCUS_01120 1327 1833 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 protein_id gnl|my_center|LOCUS_01120 1830 3032 gene locus_tag LOCUS_01130 1830 3032 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257139.1 protein_id gnl|my_center|LOCUS_01130 3311 3069 gene locus_tag LOCUS_01140 3311 3069 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723866.1 protein_id gnl|my_center|LOCUS_01140 3416 4447 gene locus_tag LOCUS_01150 gene fni 3416 4447 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_01150 4444 5478 gene locus_tag LOCUS_01160 4444 5478 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257726.1 protein_id gnl|my_center|LOCUS_01160 5588 7468 gene locus_tag LOCUS_01170 5588 7468 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259648.1 protein_id gnl|my_center|LOCUS_01170 7505 8389 gene locus_tag LOCUS_01180 7505 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 8412 9893 gene locus_tag LOCUS_01190 8412 9893 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259646.1 protein_id gnl|my_center|LOCUS_01190 9890 10405 gene locus_tag LOCUS_01200 9890 10405 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259645.1 protein_id gnl|my_center|LOCUS_01200 10417 10659 gene locus_tag LOCUS_01210 10417 10659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 10784 11473 gene locus_tag LOCUS_01220 10784 11473 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_01220 11642 12295 gene locus_tag LOCUS_01230 11642 12295 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_01230 12796 12464 gene locus_tag LOCUS_01240 12796 12464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 13326 12829 gene locus_tag LOCUS_01250 13326 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 14411 13323 gene locus_tag LOCUS_01260 gene cax 14411 13323 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482137.1 protein_id gnl|my_center|LOCUS_01260 14799 14413 gene locus_tag LOCUS_01270 14799 14413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 15278 14778 gene locus_tag LOCUS_01280 15278 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 15382 16419 gene locus_tag LOCUS_01290 15382 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 >Feature sequence006 261 1397 gene locus_tag LOCUS_01300 gene chrA 261 1397 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_01300 2552 1479 gene locus_tag LOCUS_01310 gene mtnA 2552 1479 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_01310 2652 3686 gene locus_tag LOCUS_01320 2652 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3629 4414 gene locus_tag LOCUS_01330 3629 4414 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_01330 4441 4944 gene locus_tag LOCUS_01340 4441 4944 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_01340 6002 5010 gene locus_tag LOCUS_01350 6002 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 7120 6002 gene locus_tag LOCUS_01360 7120 6002 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_01360 8670 7117 gene locus_tag LOCUS_01370 8670 7117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_01370 9866 8799 gene locus_tag LOCUS_01380 9866 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 10991 10062 gene locus_tag LOCUS_01390 10991 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 13258 11078 gene locus_tag LOCUS_01400 13258 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 13653 15323 gene locus_tag LOCUS_01410 13653 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 15320 15847 gene locus_tag LOCUS_01420 gene def 15320 15847 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310211.1 protein_id gnl|my_center|LOCUS_01420 15865 16230 gene locus_tag LOCUS_01430 15865 16230 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256335.1 protein_id gnl|my_center|LOCUS_01430 17242 16538 gene locus_tag LOCUS_01440 17242 16538 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 protein_id gnl|my_center|LOCUS_01440 >Feature sequence007 2 697 gene locus_tag LOCUS_01450 2 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 741 2327 gene locus_tag LOCUS_01460 741 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 2717 3016 gene locus_tag LOCUS_01470 gene ndhC 2717 3016 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258748.1 protein_id gnl|my_center|LOCUS_01470 3007 3489 gene locus_tag LOCUS_01480 3007 3489 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258749.1 protein_id gnl|my_center|LOCUS_01480 3514 4029 gene locus_tag LOCUS_01490 3514 4029 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258750.1 protein_id gnl|my_center|LOCUS_01490 4291 5523 gene locus_tag LOCUS_01500 gene nuoD 4291 5523 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_01500 5520 6044 gene locus_tag LOCUS_01510 5520 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 6401 7225 gene locus_tag LOCUS_01520 6401 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01520 7222 7578 gene locus_tag LOCUS_01530 7222 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01530 7659 9686 gene locus_tag LOCUS_01540 gene nuoG 7659 9686 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258754.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01540 9683 10690 gene locus_tag LOCUS_01550 gene nuoH 9683 10690 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_01550 10692 11189 gene locus_tag LOCUS_01560 gene nuoI 10692 11189 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258756.1 protein_id gnl|my_center|LOCUS_01560 11198 11713 gene locus_tag LOCUS_01570 11198 11713 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_01570 11710 12015 gene locus_tag LOCUS_01580 gene nuoK 11710 12015 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_01580 12252 14252 gene locus_tag LOCUS_01590 gene nuoL 12252 14252 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence008 181 277 gene locus_tag LOCUS_t00020 181 277 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 490 1524 gene locus_tag LOCUS_01600 490 1524 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257004.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01600 2070 1603 gene locus_tag LOCUS_01610 gene bcp 2070 1603 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337529.1 protein_id gnl|my_center|LOCUS_01610 2585 2094 gene locus_tag LOCUS_01620 2585 2094 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258777.1 protein_id gnl|my_center|LOCUS_01620 2733 3392 gene locus_tag LOCUS_01630 2733 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 4219 3479 gene locus_tag LOCUS_01640 4219 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01640 6609 5368 gene locus_tag LOCUS_01650 6609 5368 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062420975.1 protein_id gnl|my_center|LOCUS_01650 7704 6790 gene locus_tag LOCUS_01660 7704 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 8117 7704 gene locus_tag LOCUS_01670 8117 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 8620 8126 gene locus_tag LOCUS_01680 8620 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 9173 8622 gene locus_tag LOCUS_01690 9173 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 9906 9178 gene locus_tag LOCUS_01700 gene fabG 9906 9178 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_01700 10915 9956 gene locus_tag LOCUS_01710 10915 9956 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_01710 11910 10909 gene locus_tag LOCUS_01720 11910 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 12103 12176 gene locus_tag LOCUS_t00030 12103 12176 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14504 12621 gene locus_tag LOCUS_01730 14504 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence009 1603 752 gene locus_tag LOCUS_01740 1603 752 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_01740 2966 1755 gene locus_tag LOCUS_01750 2966 1755 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257413.1 protein_id gnl|my_center|LOCUS_01750 3493 2996 gene locus_tag LOCUS_01760 3493 2996 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_01760 3624 4403 gene locus_tag LOCUS_01770 3624 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 4470 4682 gene locus_tag LOCUS_01780 4470 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 7310 4791 gene locus_tag LOCUS_01790 7310 4791 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_01790 7543 10017 gene locus_tag LOCUS_01800 gene gyrA 7543 10017 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_01800 10285 11739 gene locus_tag LOCUS_01810 10285 11739 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073841.1 protein_id gnl|my_center|LOCUS_01810 11736 14465 gene locus_tag LOCUS_01820 11736 14465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 >Feature sequence010 110 574 gene locus_tag LOCUS_01830 110 574 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404768.1 protein_id gnl|my_center|LOCUS_01830 571 1320 gene locus_tag LOCUS_01840 571 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 1324 1818 gene locus_tag LOCUS_01850 1324 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 1793 2971 gene locus_tag LOCUS_01860 gene moeB 1793 2971 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_01860 3709 5073 gene locus_tag LOCUS_01870 3709 5073 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_01870 5695 6843 gene locus_tag LOCUS_01880 5695 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6969 7952 gene locus_tag LOCUS_01890 gene pdhA 6969 7952 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719639.1 protein_id gnl|my_center|LOCUS_01890 7956 8927 gene locus_tag LOCUS_01900 7956 8927 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_01900 9705 10118 gene locus_tag LOCUS_01910 9705 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01910 10199 10600 gene locus_tag LOCUS_01920 10199 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 10584 11183 gene locus_tag LOCUS_01930 10584 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 12724 11189 gene locus_tag LOCUS_01940 gene rny 12724 11189 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258580.1 protein_id gnl|my_center|LOCUS_01940 13359 12721 gene locus_tag LOCUS_01950 13359 12721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 14264 13671 gene locus_tag LOCUS_01960 14264 13671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 >Feature sequence011 255 1067 gene locus_tag LOCUS_01970 gene surE 255 1067 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250088.1 protein_id gnl|my_center|LOCUS_01970 1276 1563 gene locus_tag LOCUS_01980 1276 1563 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088373.1 protein_id gnl|my_center|LOCUS_01980 2371 1568 gene locus_tag LOCUS_01990 2371 1568 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_01990 3362 2688 gene locus_tag LOCUS_02000 3362 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 4802 3390 gene locus_tag LOCUS_02010 4802 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 5913 4840 gene locus_tag LOCUS_02020 5913 4840 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_02020 6230 6562 gene locus_tag LOCUS_02030 6230 6562 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956716.1 protein_id gnl|my_center|LOCUS_02030 6584 7630 gene locus_tag LOCUS_02040 6584 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 8063 9037 gene locus_tag LOCUS_02050 8063 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 9090 9461 gene locus_tag LOCUS_02060 9090 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256894.1 protein_id gnl|my_center|LOCUS_02060 9589 11280 gene locus_tag LOCUS_02070 9589 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 11457 12350 gene locus_tag LOCUS_02080 11457 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 >Feature sequence012 2639 789 gene locus_tag LOCUS_02090 2639 789 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979926.1 protein_id gnl|my_center|LOCUS_02090 3794 2853 gene locus_tag LOCUS_02100 3794 2853 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_02100 4042 4776 gene locus_tag LOCUS_02110 4042 4776 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_02110 4799 6112 gene locus_tag LOCUS_02120 4799 6112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229016.1 protein_id gnl|my_center|LOCUS_02120 7352 6372 gene locus_tag LOCUS_02130 7352 6372 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_02130 8332 7349 gene locus_tag LOCUS_02140 8332 7349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_02140 9279 8329 gene locus_tag LOCUS_02150 9279 8329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226494.1 protein_id gnl|my_center|LOCUS_02150 10286 9276 gene locus_tag LOCUS_02160 10286 9276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_02160 12277 10619 gene locus_tag LOCUS_02170 12277 10619 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_02170 <13280 12479 gene locus_tag LOCUS_02180 <13280 12479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223881.1:creatininase family protein >Feature sequence013 1295 348 gene locus_tag LOCUS_02190 1295 348 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_02190 2306 1326 gene locus_tag LOCUS_02200 2306 1326 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_02200 3882 2422 gene locus_tag LOCUS_02210 3882 2422 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_02210 5180 3924 gene locus_tag LOCUS_02220 5180 3924 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_02220 6335 5202 gene locus_tag LOCUS_02230 6335 5202 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256417.1 protein_id gnl|my_center|LOCUS_02230 6717 6571 gene locus_tag LOCUS_02240 6717 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 7930 6866 gene locus_tag LOCUS_02250 7930 6866 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257187.1 protein_id gnl|my_center|LOCUS_02250 8629 7937 gene locus_tag LOCUS_02260 8629 7937 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_02260 10175 8655 gene locus_tag LOCUS_02270 10175 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257117.1 protein_id gnl|my_center|LOCUS_02270 11755 10172 gene locus_tag LOCUS_02280 11755 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence014 599 1201 gene locus_tag LOCUS_02290 599 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1211 2110 gene locus_tag LOCUS_02300 1211 2110 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_02300 2303 2812 gene locus_tag LOCUS_02310 2303 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 2998 3639 gene locus_tag LOCUS_02320 2998 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 3666 4556 gene locus_tag LOCUS_02330 3666 4556 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392587.1 protein_id gnl|my_center|LOCUS_02330 4795 6171 gene locus_tag LOCUS_02340 gene rimO 4795 6171 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257724.1 protein_id gnl|my_center|LOCUS_02340 6735 6391 gene locus_tag LOCUS_02350 6735 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 7187 8161 gene locus_tag LOCUS_02360 gene moaA 7187 8161 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931086.1 protein_id gnl|my_center|LOCUS_02360 8400 8645 gene locus_tag LOCUS_02370 8400 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256705.1 protein_id gnl|my_center|LOCUS_02370 8742 9482 gene locus_tag LOCUS_02380 8742 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02380 9443 9736 gene locus_tag LOCUS_02390 9443 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02390 9733 11094 gene locus_tag LOCUS_02400 9733 11094 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_02400 11091 11597 gene locus_tag LOCUS_02410 11091 11597 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259311.1 protein_id gnl|my_center|LOCUS_02410 >Feature sequence015 <1 895 gene locus_tag LOCUS_02420 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927834.1:DNA repair protein RadA 1436 2770 gene locus_tag LOCUS_02430 gene dnaA 1436 2770 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255915.1 protein_id gnl|my_center|LOCUS_02430 3498 2860 gene locus_tag LOCUS_02440 3498 2860 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_02440 3702 3532 gene locus_tag LOCUS_02450 3702 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 6192 3739 gene locus_tag LOCUS_02460 gene priA 6192 3739 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259672.1 protein_id gnl|my_center|LOCUS_02460 7523 6192 gene locus_tag LOCUS_02470 7523 6192 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888807.1 protein_id gnl|my_center|LOCUS_02470 8380 7526 gene locus_tag LOCUS_02480 gene amrB 8380 7526 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_02480 8666 9415 gene locus_tag LOCUS_02490 8666 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 9687 9932 gene locus_tag LOCUS_02500 9687 9932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 11002 9929 gene locus_tag LOCUS_02510 11002 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 11516 11007 gene locus_tag LOCUS_02520 11516 11007 CDS product DUF6391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 protein_id gnl|my_center|LOCUS_02520 >Feature sequence016 811 236 gene locus_tag LOCUS_02530 811 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 1806 808 gene locus_tag LOCUS_02540 1806 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 2793 2374 gene locus_tag LOCUS_02550 2793 2374 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388492.1 protein_id gnl|my_center|LOCUS_02550 3167 2790 gene locus_tag LOCUS_02560 3167 2790 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_02560 4483 3167 gene locus_tag LOCUS_02570 4483 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02570 5774 4476 gene locus_tag LOCUS_02580 5774 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02580 7126 5771 gene locus_tag LOCUS_02590 7126 5771 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_02590 7323 7760 gene locus_tag LOCUS_02600 7323 7760 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963442.1 protein_id gnl|my_center|LOCUS_02600 7955 8488 gene locus_tag LOCUS_02610 7955 8488 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461633.1 protein_id gnl|my_center|LOCUS_02610 8524 9120 gene locus_tag LOCUS_02620 8524 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 9113 10294 gene locus_tag LOCUS_02630 9113 10294 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259731.1 protein_id gnl|my_center|LOCUS_02630 10348 11535 gene locus_tag LOCUS_02640 gene hutI 10348 11535 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256863.1 protein_id gnl|my_center|LOCUS_02640 >Feature sequence017 1514 3997 gene locus_tag LOCUS_02650 1514 3997 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_02650 5335 4499 gene locus_tag LOCUS_02660 5335 4499 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_02660 5456 6781 gene locus_tag LOCUS_02670 5456 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 6811 7257 gene locus_tag LOCUS_02680 6811 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 7362 8015 gene locus_tag LOCUS_02690 7362 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 >Feature sequence018 677 1348 gene locus_tag LOCUS_02700 677 1348 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143772.1 protein_id gnl|my_center|LOCUS_02700 1520 2938 gene locus_tag LOCUS_02710 1520 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 2950 3471 gene locus_tag LOCUS_02720 2950 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02720 3387 3971 gene locus_tag LOCUS_02730 3387 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 3964 4779 gene locus_tag LOCUS_02740 3964 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 4776 6059 gene locus_tag LOCUS_02750 4776 6059 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_02750 6073 6843 gene locus_tag LOCUS_02760 6073 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 6989 8590 gene locus_tag LOCUS_02770 6989 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 8571 9638 gene locus_tag LOCUS_02780 8571 9638 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_02780 9700 9933 gene locus_tag LOCUS_02790 9700 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 9930 10889 gene locus_tag LOCUS_02800 9930 10889 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence019 <1 834 gene locus_tag LOCUS_02810 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256653.1:phospho-N-acetylmuramoyl-pentapeptide-transferase 882 1253 gene locus_tag LOCUS_02820 882 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 1263 2642 gene locus_tag LOCUS_02830 gene murD 1263 2642 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_02830 2639 3877 gene locus_tag LOCUS_02840 gene ftsW 2639 3877 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256650.1 protein_id gnl|my_center|LOCUS_02840 3879 4886 gene locus_tag LOCUS_02850 3879 4886 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_02850 4883 5416 gene locus_tag LOCUS_02860 4883 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 5455 6777 gene locus_tag LOCUS_02870 gene murC 5455 6777 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256647.1 protein_id gnl|my_center|LOCUS_02870 6779 6952 gene locus_tag LOCUS_02880 6779 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 6959 7897 gene locus_tag LOCUS_02890 gene murB 6959 7897 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256646.1 protein_id gnl|my_center|LOCUS_02890 7947 9140 gene locus_tag LOCUS_02900 7947 9140 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_02900 9137 10009 gene locus_tag LOCUS_02910 9137 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence020 1510 155 gene locus_tag LOCUS_02920 1510 155 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877655.1 protein_id gnl|my_center|LOCUS_02920 1998 1507 gene locus_tag LOCUS_02930 1998 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 2478 2005 gene locus_tag LOCUS_02940 2478 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 3245 2475 gene locus_tag LOCUS_02950 3245 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 3797 3411 gene locus_tag LOCUS_02960 3797 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 5638 3917 gene locus_tag LOCUS_02970 5638 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6344 5646 gene locus_tag LOCUS_02980 6344 5646 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_02980 6589 6365 gene locus_tag LOCUS_02990 6589 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 6837 6586 gene locus_tag LOCUS_03000 6837 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 7426 6749 gene locus_tag LOCUS_03010 7426 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 7576 8376 gene locus_tag LOCUS_03020 7576 8376 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119176.1 protein_id gnl|my_center|LOCUS_03020 9138 8410 gene locus_tag LOCUS_03030 9138 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 9772 9209 gene locus_tag LOCUS_03040 gene sigD 9772 9209 CDS product ECF RNA polymerase sigma factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418013.1 protein_id gnl|my_center|LOCUS_03040 >Feature sequence021 97 564 gene locus_tag LOCUS_03050 97 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 549 722 gene locus_tag LOCUS_03060 549 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 788 2131 gene locus_tag LOCUS_03070 788 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 2128 2832 gene locus_tag LOCUS_03080 2128 2832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_03080 2829 4052 gene locus_tag LOCUS_03090 2829 4052 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_03090 4183 5547 gene locus_tag LOCUS_03100 4183 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 8401 5528 gene locus_tag LOCUS_03110 gene uvrA 8401 5528 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_03110 9853 8579 gene locus_tag LOCUS_03120 9853 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence022 95 168 gene locus_tag LOCUS_t00040 95 168 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1971 622 gene locus_tag LOCUS_03130 1971 622 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_03130 2657 1971 gene locus_tag LOCUS_03140 2657 1971 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259684.1 protein_id gnl|my_center|LOCUS_03140 2965 2753 gene locus_tag LOCUS_03150 2965 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 3422 2865 gene locus_tag LOCUS_03160 3422 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 4387 3482 gene locus_tag LOCUS_03170 4387 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03170 4668 4369 gene locus_tag LOCUS_03180 4668 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03180 5432 4665 gene locus_tag LOCUS_03190 5432 4665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_03190 6917 5520 gene locus_tag LOCUS_03200 6917 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 7494 7051 gene locus_tag LOCUS_03210 7494 7051 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_03210 8677 7571 gene locus_tag LOCUS_03220 gene arsB 8677 7571 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_03220 9600 8998 gene locus_tag LOCUS_03230 9600 8998 CDS product protein-S-isoprenylcysteine O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328453.1 protein_id gnl|my_center|LOCUS_03230 10281 9682 gene locus_tag LOCUS_03240 10281 9682 CDS product protein-S-isoprenylcysteine O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969325.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence023 22 2418 gene locus_tag LOCUS_03250 22 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 3135 2815 gene locus_tag LOCUS_03260 3135 2815 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_03260 3397 3143 gene locus_tag LOCUS_03270 3397 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 4134 3409 gene locus_tag LOCUS_03280 4134 3409 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_03280 4924 4142 gene locus_tag LOCUS_03290 gene pgeF 4924 4142 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_03290 5918 4947 gene locus_tag LOCUS_03300 5918 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 6460 5915 gene locus_tag LOCUS_03310 6460 5915 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 protein_id gnl|my_center|LOCUS_03310 7216 6494 gene locus_tag LOCUS_03320 7216 6494 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_03320 8126 7221 gene locus_tag LOCUS_03330 8126 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 10626 8188 gene locus_tag LOCUS_03340 10626 8188 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_03340 >Feature sequence024 448 1275 gene locus_tag LOCUS_03350 448 1275 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_03350 1282 2688 gene locus_tag LOCUS_03360 1282 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 3021 3389 gene locus_tag LOCUS_03370 3021 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 3398 4183 gene locus_tag LOCUS_03380 3398 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 4183 5094 gene locus_tag LOCUS_03390 4183 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 5366 7594 gene locus_tag LOCUS_03400 gene xdh 5366 7594 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_03400 7602 8414 gene locus_tag LOCUS_03410 7602 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 8596 9918 gene locus_tag LOCUS_03420 gene mocA 8596 9918 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393499.1 protein_id gnl|my_center|LOCUS_03420 9915 10532 gene locus_tag LOCUS_03430 9915 10532 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940878.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence025 1734 952 gene locus_tag LOCUS_03440 gene cobB2 1734 952 CDS product NAD-dependent protein deacylase Cob2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_03440 2879 1731 gene locus_tag LOCUS_03450 2879 1731 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_03450 2996 6046 gene locus_tag LOCUS_03460 2996 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 >Feature sequence026 559 1554 gene locus_tag LOCUS_03470 559 1554 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_03470 1605 4697 gene locus_tag LOCUS_03480 1605 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 5700 4663 gene locus_tag LOCUS_03490 5700 4663 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_03490 8032 5936 gene locus_tag LOCUS_03500 8032 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 9438 8215 gene locus_tag LOCUS_03510 9438 8215 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909096.1 protein_id gnl|my_center|LOCUS_03510 9949 9485 gene locus_tag LOCUS_03520 9949 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 <10624 10041 gene locus_tag LOCUS_03530 <10624 10041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109460.1:TIGR00730 family Rossman fold protein >Feature sequence027 592 1767 gene locus_tag LOCUS_03540 592 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 1764 3002 gene locus_tag LOCUS_03550 1764 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3004 3723 gene locus_tag LOCUS_03560 3004 3723 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_03560 3829 4497 gene locus_tag LOCUS_03570 3829 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 4642 4986 gene locus_tag LOCUS_03580 4642 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 5049 5849 gene locus_tag LOCUS_03590 5049 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 5853 6272 gene locus_tag LOCUS_03600 5853 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 6899 6402 gene locus_tag LOCUS_03610 6899 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03610 7397 6957 gene locus_tag LOCUS_03620 7397 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 7577 8431 gene locus_tag LOCUS_03630 7577 8431 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_03630 8472 9182 gene locus_tag LOCUS_03640 8472 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 10179 9466 gene locus_tag LOCUS_03650 10179 9466 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence028 2324 417 gene locus_tag LOCUS_03660 2324 417 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258101.1 protein_id gnl|my_center|LOCUS_03660 3198 2434 gene locus_tag LOCUS_03670 gene trmD 3198 2434 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_03670 3894 3385 gene locus_tag LOCUS_03680 3894 3385 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872605.1 protein_id gnl|my_center|LOCUS_03680 4638 3940 gene locus_tag LOCUS_03690 4638 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 5306 4635 gene locus_tag LOCUS_03700 5306 4635 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_03700 5836 5417 gene locus_tag LOCUS_03710 5836 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 6194 5997 gene locus_tag LOCUS_03720 6194 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 6399 6202 gene locus_tag LOCUS_03730 6399 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 9139 6335 gene locus_tag LOCUS_03740 9139 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03740 9051 9314 gene locus_tag LOCUS_03750 9051 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 9756 9340 gene locus_tag LOCUS_03760 9756 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10273 9974 gene locus_tag LOCUS_03770 10273 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence029 1284 58 gene locus_tag LOCUS_03780 1284 58 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194502.1 protein_id gnl|my_center|LOCUS_03780 1729 1265 gene locus_tag LOCUS_03790 1729 1265 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_03790 2240 1986 gene locus_tag LOCUS_03800 2240 1986 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037729.1 protein_id gnl|my_center|LOCUS_03800 3542 2250 gene locus_tag LOCUS_03810 gene xseA 3542 2250 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259569.1 protein_id gnl|my_center|LOCUS_03810 3695 4174 gene locus_tag LOCUS_03820 3695 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 5385 4282 gene locus_tag LOCUS_03830 5385 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 6714 5536 gene locus_tag LOCUS_03840 gene rpoD 6714 5536 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_03840 7326 6781 gene locus_tag LOCUS_03850 7326 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 7500 8093 gene locus_tag LOCUS_03860 gene rdgB 7500 8093 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172548.1 protein_id gnl|my_center|LOCUS_03860 8233 9453 gene locus_tag LOCUS_03870 8233 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 9469 9972 gene locus_tag LOCUS_03880 9469 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence030 146 820 gene locus_tag LOCUS_03890 gene npdG 146 820 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_03890 828 1607 gene locus_tag LOCUS_03900 gene cofE 828 1607 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_03900 1623 1798 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cccaggcttcagcctgggtc 1841 2242 gene locus_tag LOCUS_03910 1841 2242 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_03910 2287 2847 gene locus_tag LOCUS_03920 2287 2847 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259451.1 protein_id gnl|my_center|LOCUS_03920 2838 3788 gene locus_tag LOCUS_03930 gene cofD 2838 3788 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_03930 3785 4396 gene locus_tag LOCUS_03940 gene cofC 3785 4396 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496647.1 protein_id gnl|my_center|LOCUS_03940 4409 5407 gene locus_tag LOCUS_03950 gene mer 4409 5407 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_03950 5419 5910 gene locus_tag LOCUS_03960 5419 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 6084 6860 gene locus_tag LOCUS_03970 6084 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 6860 9898 gene locus_tag LOCUS_03980 6860 9898 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_03980 9895 10275 gene locus_tag LOCUS_03990 9895 10275 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence031 3170 1992 gene locus_tag LOCUS_04000 3170 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 4052 3201 gene locus_tag LOCUS_04010 4052 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 6461 4215 gene locus_tag LOCUS_04020 6461 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 8230 6458 gene locus_tag LOCUS_04030 8230 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 9042 8230 gene locus_tag LOCUS_04040 9042 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 <10368 9068 gene locus_tag LOCUS_04050 <10368 9068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257624.1:amidohydrolase >Feature sequence032 238 2217 gene locus_tag LOCUS_04060 238 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2447 2866 gene locus_tag LOCUS_04070 2447 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 2863 4617 gene locus_tag LOCUS_04080 2863 4617 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_04080 4884 5936 gene locus_tag LOCUS_04090 4884 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 5976 6512 gene locus_tag LOCUS_04100 5976 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 6613 7623 gene locus_tag LOCUS_04110 6613 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 7598 7906 gene locus_tag LOCUS_04120 7598 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 9345 7867 gene locus_tag LOCUS_04130 9345 7867 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence033 2194 1067 gene locus_tag LOCUS_04140 2194 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 3070 2393 gene locus_tag LOCUS_04150 3070 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3735 2998 gene locus_tag LOCUS_04160 3735 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 4739 3747 gene locus_tag LOCUS_04170 4739 3747 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_04170 5103 4780 gene locus_tag LOCUS_04180 5103 4780 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174252.1 protein_id gnl|my_center|LOCUS_04180 6055 5165 gene locus_tag LOCUS_04190 6055 5165 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_04190 6131 6466 gene locus_tag LOCUS_04200 6131 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 6714 8525 gene locus_tag LOCUS_04210 6714 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 >Feature sequence034 1754 1260 gene locus_tag LOCUS_04220 1754 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 1944 3125 gene locus_tag LOCUS_04230 1944 3125 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_04230 3387 4169 gene locus_tag LOCUS_04240 3387 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04240 4429 5466 gene locus_tag LOCUS_04250 4429 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 5705 6661 gene locus_tag LOCUS_04260 5705 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 6786 8633 gene locus_tag LOCUS_04270 6786 8633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence035 767 474 gene locus_tag LOCUS_04280 767 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 993 1397 gene locus_tag LOCUS_04290 993 1397 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528902.1 protein_id gnl|my_center|LOCUS_04290 1560 2813 gene locus_tag LOCUS_04300 1560 2813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_04300 4098 2836 gene locus_tag LOCUS_04310 4098 2836 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_04310 4371 5351 gene locus_tag LOCUS_04320 4371 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 5709 5500 gene locus_tag LOCUS_04330 5709 5500 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_04330 6732 5941 gene locus_tag LOCUS_04340 6732 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 6989 7789 gene locus_tag LOCUS_04350 6989 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 7786 9003 gene locus_tag LOCUS_04360 7786 9003 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_04360 9045 9875 gene locus_tag LOCUS_04370 9045 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence036 582 253 gene locus_tag LOCUS_04380 gene trxA 582 253 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 protein_id gnl|my_center|LOCUS_04380 721 1005 gene locus_tag LOCUS_04390 721 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 1021 2091 gene locus_tag LOCUS_04400 gene hrcA 1021 2091 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_04400 2088 2732 gene locus_tag LOCUS_04410 gene grpE 2088 2732 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086446.1 protein_id gnl|my_center|LOCUS_04410 2744 4663 gene locus_tag LOCUS_04420 gene dnaK 2744 4663 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257940.1 protein_id gnl|my_center|LOCUS_04420 4958 6073 gene locus_tag LOCUS_04430 gene dnaJ 4958 6073 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_04430 6070 6981 gene locus_tag LOCUS_04440 6070 6981 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_04440 7528 7286 gene locus_tag LOCUS_04450 gene infA 7528 7286 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258253.1 protein_id gnl|my_center|LOCUS_04450 7780 7568 gene locus_tag LOCUS_04460 7780 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 8876 7800 gene locus_tag LOCUS_04470 8876 7800 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258702.1 protein_id gnl|my_center|LOCUS_04470 9908 9399 gene locus_tag LOCUS_04480 9908 9399 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228008.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence037 2036 1713 gene locus_tag LOCUS_04490 2036 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 2181 3116 gene locus_tag LOCUS_04500 gene fmt 2181 3116 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255944.1 protein_id gnl|my_center|LOCUS_04500 3338 3003 gene locus_tag LOCUS_04510 3338 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 3331 3987 gene locus_tag LOCUS_04520 3331 3987 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_04520 4003 5514 gene locus_tag LOCUS_04530 gene glpK 4003 5514 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_04530 5573 6001 gene locus_tag LOCUS_04540 5573 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 6177 7811 gene locus_tag LOCUS_04550 gene glpA 6177 7811 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259132.1 protein_id gnl|my_center|LOCUS_04550 7808 9037 gene locus_tag LOCUS_04560 gene glpB 7808 9037 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259131.1 protein_id gnl|my_center|LOCUS_04560 >Feature sequence038 153 1037 gene locus_tag LOCUS_04570 153 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 1470 1979 gene locus_tag LOCUS_04580 1470 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 2386 2189 gene locus_tag LOCUS_04590 2386 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 2430 4319 gene locus_tag LOCUS_04600 2430 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4316 5248 gene locus_tag LOCUS_04610 4316 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 6367 5513 gene locus_tag LOCUS_04620 6367 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 6557 8410 gene locus_tag LOCUS_04630 6557 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 8295 8639 gene locus_tag LOCUS_04640 8295 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 >Feature sequence039 288 28 gene locus_tag LOCUS_04650 288 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 876 610 gene locus_tag LOCUS_04660 876 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 1576 899 gene locus_tag LOCUS_04670 1576 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 1829 1590 gene locus_tag LOCUS_04680 1829 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04680 1765 2181 gene locus_tag LOCUS_04690 1765 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 2896 2246 gene locus_tag LOCUS_04700 2896 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04700 3956 2994 gene locus_tag LOCUS_04710 gene cdhD 3956 2994 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_04710 6540 4228 gene locus_tag LOCUS_04720 gene acsB 6540 4228 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418359.1 protein_id gnl|my_center|LOCUS_04720 8836 6824 gene locus_tag LOCUS_04730 gene cooS 8836 6824 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_04730 9215 8853 gene locus_tag LOCUS_04740 9215 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 <9891 9217 gene locus_tag LOCUS_04750 <9891 9217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061232.1:DUF166 family protein >Feature sequence040 1083 1793 gene locus_tag LOCUS_04760 1083 1793 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_04760 1786 2820 gene locus_tag LOCUS_04770 1786 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2817 3647 gene locus_tag LOCUS_04780 2817 3647 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392919.1 protein_id gnl|my_center|LOCUS_04780 3644 5095 gene locus_tag LOCUS_04790 3644 5095 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_04790 5834 6178 gene locus_tag LOCUS_04800 5834 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04800 6189 6809 gene locus_tag LOCUS_04810 6189 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04810 6830 7438 gene locus_tag LOCUS_04820 6830 7438 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_04820 8032 7508 gene locus_tag LOCUS_04830 8032 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 8457 8029 gene locus_tag LOCUS_04840 8457 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 9474 8530 gene locus_tag LOCUS_04850 9474 8530 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence041 <1 694 gene locus_tag LOCUS_04860 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257863.1:metal ABC transporter ATP-binding protein 779 1441 gene locus_tag LOCUS_04870 779 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 1644 3497 gene locus_tag LOCUS_04880 1644 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3519 5252 gene locus_tag LOCUS_04890 3519 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 5515 6138 gene locus_tag LOCUS_04900 5515 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 6193 6417 gene locus_tag LOCUS_04910 6193 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 6439 7362 gene locus_tag LOCUS_04920 gene trxB 6439 7362 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_04920 7365 8165 gene locus_tag LOCUS_04930 7365 8165 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259013.1 protein_id gnl|my_center|LOCUS_04930 8162 9865 gene locus_tag LOCUS_04940 8162 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence042 836 348 gene locus_tag LOCUS_04950 836 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 2542 932 gene locus_tag LOCUS_04960 2542 932 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_04960 3854 2817 gene locus_tag LOCUS_04970 3854 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4437 3847 gene locus_tag LOCUS_04980 gene pdxT 4437 3847 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258094.1 protein_id gnl|my_center|LOCUS_04980 4970 4434 gene locus_tag LOCUS_04990 4970 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 5873 4986 gene locus_tag LOCUS_05000 gene pdxS 5873 4986 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_05000 6051 6470 gene locus_tag LOCUS_05010 6051 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 6564 6770 gene locus_tag LOCUS_05020 6564 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 6767 7690 gene locus_tag LOCUS_05030 6767 7690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592685.1 protein_id gnl|my_center|LOCUS_05030 7691 8449 gene locus_tag LOCUS_05040 7691 8449 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731882.1 protein_id gnl|my_center|LOCUS_05040 8585 9379 gene locus_tag LOCUS_05050 8585 9379 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233198.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence043 782 1522 gene locus_tag LOCUS_05060 782 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 3004 1532 gene locus_tag LOCUS_05070 gene mazG 3004 1532 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014253.1 protein_id gnl|my_center|LOCUS_05070 3484 3092 gene locus_tag LOCUS_05080 gene rpsI 3484 3092 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083052.1 protein_id gnl|my_center|LOCUS_05080 3943 3512 gene locus_tag LOCUS_05090 gene rplM 3943 3512 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173515.1 protein_id gnl|my_center|LOCUS_05090 4743 3967 gene locus_tag LOCUS_05100 gene truA 4743 3967 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263419.1 protein_id gnl|my_center|LOCUS_05100 5274 4897 gene locus_tag LOCUS_05110 5274 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6279 5281 gene locus_tag LOCUS_05120 6279 5281 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_05120 6922 6305 gene locus_tag LOCUS_05130 gene rpsD 6922 6305 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_05130 7395 6994 gene locus_tag LOCUS_05140 gene rpsK 7395 6994 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040166.1 protein_id gnl|my_center|LOCUS_05140 7824 7435 gene locus_tag LOCUS_05150 gene rpsM 7824 7435 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_05150 8806 7940 gene locus_tag LOCUS_05160 gene map 8806 7940 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_05160 9465 8803 gene locus_tag LOCUS_05170 9465 8803 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393916.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence044 1456 470 gene locus_tag LOCUS_05180 1456 470 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077753831.1 protein_id gnl|my_center|LOCUS_05180 2931 1453 gene locus_tag LOCUS_05190 2931 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3904 2942 gene locus_tag LOCUS_05200 3904 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5050 4016 gene locus_tag LOCUS_05210 5050 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6030 5062 gene locus_tag LOCUS_05220 6030 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6822 6067 gene locus_tag LOCUS_05230 6822 6067 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_05230 7934 6819 gene locus_tag LOCUS_05240 7934 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 9004 7934 gene locus_tag LOCUS_05250 9004 7934 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015754.1 protein_id gnl|my_center|LOCUS_05250 <9637 9001 gene locus_tag LOCUS_05260 <9637 9001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015755.1:NAD(P)-dependent oxidoreductase >Feature sequence045 1512 574 gene locus_tag LOCUS_05270 1512 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1888 1538 gene locus_tag LOCUS_05280 1888 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2882 2244 gene locus_tag LOCUS_05290 2882 2244 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_05290 4467 2866 gene locus_tag LOCUS_05300 4467 2866 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391571.1 protein_id gnl|my_center|LOCUS_05300 5595 4666 gene locus_tag LOCUS_05310 5595 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 6469 5657 gene locus_tag LOCUS_05320 6469 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 7312 6479 gene locus_tag LOCUS_05330 7312 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 8899 7316 gene locus_tag LOCUS_05340 8899 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 9552 8911 gene locus_tag LOCUS_05350 9552 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence046 6462 7556 gene locus_tag LOCUS_05360 6462 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 7971 7675 gene locus_tag LOCUS_05370 7971 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 8343 8008 gene locus_tag LOCUS_05380 8343 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 8674 8378 gene locus_tag LOCUS_05390 8674 8378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 9041 8715 gene locus_tag LOCUS_05400 9041 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence047 1325 564 gene locus_tag LOCUS_05410 1325 564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970225.1 protein_id gnl|my_center|LOCUS_05410 2573 1398 gene locus_tag LOCUS_05420 2573 1398 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970226.1 protein_id gnl|my_center|LOCUS_05420 4069 3026 gene locus_tag LOCUS_05430 4069 3026 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817156.1 protein_id gnl|my_center|LOCUS_05430 4848 4069 gene locus_tag LOCUS_05440 4848 4069 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259383.1 protein_id gnl|my_center|LOCUS_05440 6096 4888 gene locus_tag LOCUS_05450 6096 4888 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_05450 6308 6730 gene locus_tag LOCUS_05460 6308 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 6850 7629 gene locus_tag LOCUS_05470 6850 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 7649 8320 gene locus_tag LOCUS_05480 7649 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 8517 8966 gene locus_tag LOCUS_05490 8517 8966 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence048 <1 539 gene locus_tag LOCUS_05500 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933215.1:SAM-dependent chlorinase/fluorinase 1876 536 gene locus_tag LOCUS_05510 1876 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3511 1919 gene locus_tag LOCUS_05520 3511 1919 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_05520 5117 3525 gene locus_tag LOCUS_05530 5117 3525 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_05530 6117 5383 gene locus_tag LOCUS_05540 gene mutM 6117 5383 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257743.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05540 >Feature sequence049 752 1867 gene locus_tag LOCUS_05550 752 1867 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257636.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05550 1949 2908 gene locus_tag LOCUS_05560 1949 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3725 3102 gene locus_tag LOCUS_05570 3725 3102 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_05570 4465 3722 gene locus_tag LOCUS_05580 4465 3722 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_05580 5121 4462 gene locus_tag LOCUS_05590 5121 4462 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546597.1 protein_id gnl|my_center|LOCUS_05590 6270 5386 gene locus_tag LOCUS_05600 6270 5386 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943338.1 protein_id gnl|my_center|LOCUS_05600 6432 7358 gene locus_tag LOCUS_05610 6432 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05610 7355 8269 gene locus_tag LOCUS_05620 7355 8269 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence050 225 722 gene locus_tag LOCUS_05630 225 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 724 1332 gene locus_tag LOCUS_05640 724 1332 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938891.1 protein_id gnl|my_center|LOCUS_05640 1329 2990 gene locus_tag LOCUS_05650 1329 2990 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_05650 3146 3703 gene locus_tag LOCUS_05660 3146 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3901 5580 gene locus_tag LOCUS_05670 3901 5580 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_05670 5889 5641 gene locus_tag LOCUS_05680 5889 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6480 8003 gene locus_tag LOCUS_05690 gene paaP 6480 8003 CDS product aminopeptidase PaaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101464.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence051 227 1414 gene locus_tag LOCUS_05700 227 1414 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036700.1 protein_id gnl|my_center|LOCUS_05700 1496 3430 gene locus_tag LOCUS_05710 1496 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 3559 4593 gene locus_tag LOCUS_05720 3559 4593 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_05720 4666 5028 gene locus_tag LOCUS_05730 4666 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 5021 6571 gene locus_tag LOCUS_05740 5021 6571 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_05740 6862 8370 gene locus_tag LOCUS_05750 6862 8370 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence052 1249 410 gene locus_tag LOCUS_05760 gene panC 1249 410 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258070.1 protein_id gnl|my_center|LOCUS_05760 2169 1246 gene locus_tag LOCUS_05770 2169 1246 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_05770 3056 2181 gene locus_tag LOCUS_05780 gene panB 3056 2181 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_05780 3337 3816 gene locus_tag LOCUS_05790 3337 3816 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803676.1 protein_id gnl|my_center|LOCUS_05790 4477 3854 gene locus_tag LOCUS_05800 4477 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 4712 4488 gene locus_tag LOCUS_05810 4712 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 5812 4721 gene locus_tag LOCUS_05820 5812 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05820 6914 5859 gene locus_tag LOCUS_05830 6914 5859 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392147.1 protein_id gnl|my_center|LOCUS_05830 7765 6911 gene locus_tag LOCUS_05840 gene rsmI 7765 6911 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_05840 8182 7850 gene locus_tag LOCUS_05850 8182 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence053 616 119 gene locus_tag LOCUS_05860 gene rimM 616 119 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_05860 959 732 gene locus_tag LOCUS_05870 959 732 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_05870 1407 991 gene locus_tag LOCUS_05880 1407 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 3106 1610 gene locus_tag LOCUS_05890 3106 1610 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392427.1 protein_id gnl|my_center|LOCUS_05890 3974 3084 gene locus_tag LOCUS_05900 gene mtnP 3974 3084 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_05900 4407 3943 gene locus_tag LOCUS_05910 4407 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 5229 4408 gene locus_tag LOCUS_05920 5229 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6103 5240 gene locus_tag LOCUS_05930 6103 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 6164 6571 gene locus_tag LOCUS_05940 6164 6571 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228886.1 protein_id gnl|my_center|LOCUS_05940 6617 7414 gene locus_tag LOCUS_05950 6617 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05950 7427 8185 gene locus_tag LOCUS_05960 7427 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05960 >Feature sequence054 879 1142 gene locus_tag LOCUS_05970 879 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 2172 1408 gene locus_tag LOCUS_05980 2172 1408 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_05980 3289 2189 gene locus_tag LOCUS_05990 gene hisC 3289 2189 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970110.1 protein_id gnl|my_center|LOCUS_05990 4394 3519 gene locus_tag LOCUS_06000 4394 3519 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_06000 5170 4391 gene locus_tag LOCUS_06010 5170 4391 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_06010 5295 5837 gene locus_tag LOCUS_06020 5295 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 6193 7896 gene locus_tag LOCUS_06030 6193 7896 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence055 688 1044 gene locus_tag LOCUS_06040 gene ndhC 688 1044 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_06040 1124 2314 gene locus_tag LOCUS_06050 gene nuoH 1124 2314 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_06050 2414 2962 gene locus_tag LOCUS_06060 2414 2962 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813221.1 protein_id gnl|my_center|LOCUS_06060 3003 3311 gene locus_tag LOCUS_06070 gene nuoK 3003 3311 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_06070 3322 5484 gene locus_tag LOCUS_06080 gene nuoL 3322 5484 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257848.1 protein_id gnl|my_center|LOCUS_06080 5487 7013 gene locus_tag LOCUS_06090 5487 7013 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258760.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence056 147 1454 gene locus_tag LOCUS_06100 147 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1451 3037 gene locus_tag LOCUS_06110 1451 3037 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_06110 3076 3750 gene locus_tag LOCUS_06120 3076 3750 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881332.1 protein_id gnl|my_center|LOCUS_06120 4895 4131 gene locus_tag LOCUS_06130 4895 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6089 4920 gene locus_tag LOCUS_06140 6089 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 7420 6095 gene locus_tag LOCUS_06150 7420 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence057 1731 361 gene locus_tag LOCUS_06160 1731 361 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_06160 2474 1728 gene locus_tag LOCUS_06170 2474 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 2653 3993 gene locus_tag LOCUS_06180 2653 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 5000 4017 gene locus_tag LOCUS_06190 5000 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 5051 6919 gene locus_tag LOCUS_06200 5051 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence058 627 385 gene locus_tag LOCUS_06210 627 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1568 624 gene locus_tag LOCUS_06220 1568 624 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258205.1 protein_id gnl|my_center|LOCUS_06220 2626 1577 gene locus_tag LOCUS_06230 2626 1577 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259411.1 protein_id gnl|my_center|LOCUS_06230 3647 2646 gene locus_tag LOCUS_06240 gene mvaD 3647 2646 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_06240 4433 3729 gene locus_tag LOCUS_06250 4433 3729 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_06250 4730 4657 gene locus_tag LOCUS_t00050 4730 4657 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6033 4750 gene locus_tag LOCUS_06260 gene hisS 6033 4750 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_06260 7737 6190 gene locus_tag LOCUS_06270 gene hutH 7737 6190 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925153.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence059 1559 138 gene locus_tag LOCUS_06280 gene miaB 1559 138 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583438.1 protein_id gnl|my_center|LOCUS_06280 1816 2517 gene locus_tag LOCUS_06290 1816 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 2717 3409 gene locus_tag LOCUS_06300 2717 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4647 3502 gene locus_tag LOCUS_06310 gene queG 4647 3502 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026363808.1 protein_id gnl|my_center|LOCUS_06310 6306 4924 gene locus_tag LOCUS_06320 gene gltA 6306 4924 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_06320 6539 7105 gene locus_tag LOCUS_06330 6539 7105 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_06330 7086 7559 gene locus_tag LOCUS_06340 7086 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence060 404 631 gene locus_tag LOCUS_06350 404 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 1330 872 gene locus_tag LOCUS_06360 1330 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 5179 1520 gene locus_tag LOCUS_06370 5179 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 6891 5677 gene locus_tag LOCUS_06380 6891 5677 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171267129.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence061 1854 514 gene locus_tag LOCUS_06390 1854 514 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257636.1 protein_id gnl|my_center|LOCUS_06390 2599 1943 gene locus_tag LOCUS_06400 2599 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 3882 2566 gene locus_tag LOCUS_06410 3882 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 3870 4268 gene locus_tag LOCUS_06420 3870 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 4265 5611 gene locus_tag LOCUS_06430 gene selA 4265 5611 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_06430 5915 7234 gene locus_tag LOCUS_06440 5915 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence062 2939 2274 gene locus_tag LOCUS_06450 2939 2274 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969534.1 protein_id gnl|my_center|LOCUS_06450 3069 2994 gene locus_tag LOCUS_t00060 3069 2994 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4213 3098 gene locus_tag LOCUS_06460 4213 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 4917 4216 gene locus_tag LOCUS_06470 4917 4216 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228693.1 protein_id gnl|my_center|LOCUS_06470 6860 5067 gene locus_tag LOCUS_06480 gene sdhA 6860 5067 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_06480 7163 7020 gene locus_tag LOCUS_06490 7163 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 7823 7413 gene locus_tag LOCUS_06500 gene sdhC 7823 7413 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776147.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence063 1888 476 gene locus_tag LOCUS_06510 1888 476 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_06510 2876 1863 gene locus_tag LOCUS_06520 gene exoA 2876 1863 CDS product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434899.1 protein_id gnl|my_center|LOCUS_06520 3157 2909 gene locus_tag LOCUS_06530 3157 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06530 4325 3105 gene locus_tag LOCUS_06540 4325 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06540 4699 5439 gene locus_tag LOCUS_06550 4699 5439 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060800.1 protein_id gnl|my_center|LOCUS_06550 5687 5511 gene locus_tag LOCUS_06560 5687 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 6580 5723 gene locus_tag LOCUS_06570 6580 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 7467 6580 gene locus_tag LOCUS_06580 7467 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence064 171 533 gene locus_tag LOCUS_06590 171 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 540 1298 gene locus_tag LOCUS_06600 540 1298 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259072.1 protein_id gnl|my_center|LOCUS_06600 1651 1262 gene locus_tag LOCUS_06610 1651 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 1702 3741 gene locus_tag LOCUS_06620 1702 3741 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_06620 5480 3921 gene locus_tag LOCUS_06630 gene glmS 5480 3921 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256373.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06630 6825 6097 gene locus_tag LOCUS_06640 6825 6097 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255947.1 protein_id gnl|my_center|LOCUS_06640 7506 6832 gene locus_tag LOCUS_06650 gene cmk 7506 6832 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence065 2034 349 gene locus_tag LOCUS_06660 2034 349 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_06660 2231 3553 gene locus_tag LOCUS_06670 2231 3553 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889289.1 protein_id gnl|my_center|LOCUS_06670 3665 5218 gene locus_tag LOCUS_06680 3665 5218 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257930.1 protein_id gnl|my_center|LOCUS_06680 5248 6621 gene locus_tag LOCUS_06690 5248 6621 CDS product CpXC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257830.1 protein_id gnl|my_center|LOCUS_06690 <7723 6698 gene locus_tag LOCUS_06700 <7723 6698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097247.1:23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI >Feature sequence066 1704 1060 gene locus_tag LOCUS_06710 1704 1060 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_06710 1857 3347 gene locus_tag LOCUS_06720 1857 3347 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_06720 3424 3870 gene locus_tag LOCUS_06730 3424 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 4181 3933 gene locus_tag LOCUS_06740 4181 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 4421 5212 gene locus_tag LOCUS_06750 4421 5212 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_06750 5409 5810 gene locus_tag LOCUS_06760 5409 5810 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259424.1 protein_id gnl|my_center|LOCUS_06760 5807 6613 gene locus_tag LOCUS_06770 5807 6613 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_06770 6713 7012 gene locus_tag LOCUS_06780 6713 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 6996 7535 gene locus_tag LOCUS_06790 6996 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence067 874 1434 gene locus_tag LOCUS_06800 874 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 1434 2402 gene locus_tag LOCUS_06810 1434 2402 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_06810 2404 4431 gene locus_tag LOCUS_06820 gene hdrA 2404 4431 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_06820 4437 4934 gene locus_tag LOCUS_06830 4437 4934 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_06830 4931 6013 gene locus_tag LOCUS_06840 4931 6013 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence068 136 612 gene locus_tag LOCUS_06850 gene bfr 136 612 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_06850 767 1279 gene locus_tag LOCUS_06860 767 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1395 1763 gene locus_tag LOCUS_06870 1395 1763 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 protein_id gnl|my_center|LOCUS_06870 1950 2267 gene locus_tag LOCUS_06880 1950 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2609 2268 gene locus_tag LOCUS_06890 2609 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2560 2853 gene locus_tag LOCUS_06900 2560 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3112 3390 gene locus_tag LOCUS_06910 3112 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3819 3493 gene locus_tag LOCUS_06920 3819 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5498 4032 gene locus_tag LOCUS_06930 5498 4032 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_06930 6481 5495 gene locus_tag LOCUS_06940 6481 5495 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_06940 7092 6478 gene locus_tag LOCUS_06950 7092 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06950 <7629 7093 gene locus_tag LOCUS_06960 <7629 7093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393494.1:threonine synthase note possible pseudo, internal stop codon >Feature sequence069 310 1101 gene locus_tag LOCUS_06970 310 1101 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889088.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06970 1132 1347 gene locus_tag LOCUS_06980 1132 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1425 2585 gene locus_tag LOCUS_06990 1425 2585 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_06990 2653 4146 gene locus_tag LOCUS_07000 gene gatB 2653 4146 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_07000 4255 5529 gene locus_tag LOCUS_07010 gene gluD 4255 5529 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420866.1 protein_id gnl|my_center|LOCUS_07010 5916 7223 gene locus_tag LOCUS_07020 5916 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 7415 7212 gene locus_tag LOCUS_07030 7415 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence070 324 1277 gene locus_tag LOCUS_07040 324 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3333 1348 gene locus_tag LOCUS_07050 3333 1348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257581.1 protein_id gnl|my_center|LOCUS_07050 5242 3335 gene locus_tag LOCUS_07060 5242 3335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_07060 5721 5239 gene locus_tag LOCUS_07070 5721 5239 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259210.1 protein_id gnl|my_center|LOCUS_07070 6480 5935 gene locus_tag LOCUS_07080 6480 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence071 2078 486 gene locus_tag LOCUS_07090 2078 486 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015845.1 protein_id gnl|my_center|LOCUS_07090 2191 2117 gene locus_tag LOCUS_t00070 2191 2117 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2407 3075 gene locus_tag LOCUS_07100 2407 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3079 3876 gene locus_tag LOCUS_07110 3079 3876 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929384.1 protein_id gnl|my_center|LOCUS_07110 3876 4430 gene locus_tag LOCUS_07120 gene dcd 3876 4430 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_07120 4427 5290 gene locus_tag LOCUS_07130 4427 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 5550 5858 gene locus_tag LOCUS_07140 5550 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 5864 7033 gene locus_tag LOCUS_07150 5864 7033 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337640.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence072 951 64 gene locus_tag LOCUS_07160 951 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1290 1012 gene locus_tag LOCUS_07170 1290 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1903 1301 gene locus_tag LOCUS_07180 1903 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 3526 1913 gene locus_tag LOCUS_07190 gene ctaD 3526 1913 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142160.1 protein_id gnl|my_center|LOCUS_07190 4541 3546 gene locus_tag LOCUS_07200 4541 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5621 4773 gene locus_tag LOCUS_07210 5621 4773 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_07210 5959 5708 gene locus_tag LOCUS_07220 5959 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 <7497 5884 gene locus_tag LOCUS_07230 <7497 5884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583948.1:DNA polymerase/3'-5' exonuclease PolX >Feature sequence073 2376 274 gene locus_tag LOCUS_07240 gene pnp 2376 274 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_07240 2858 2586 gene locus_tag LOCUS_07250 gene rpsO 2858 2586 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894036.1 protein_id gnl|my_center|LOCUS_07250 3779 2955 gene locus_tag LOCUS_07260 3779 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4150 3821 gene locus_tag LOCUS_07270 4150 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5596 4163 gene locus_tag LOCUS_07280 gene proS 5596 4163 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257194.1 protein_id gnl|my_center|LOCUS_07280 6742 5669 gene locus_tag LOCUS_07290 6742 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 7109 6795 gene locus_tag LOCUS_07300 7109 6795 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259720.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence074 762 559 gene locus_tag LOCUS_07310 762 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 999 1610 gene locus_tag LOCUS_07320 gene sodA 999 1610 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052031.1 protein_id gnl|my_center|LOCUS_07320 1652 2065 gene locus_tag LOCUS_07330 1652 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2173 3630 gene locus_tag LOCUS_07340 2173 3630 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909061.1 protein_id gnl|my_center|LOCUS_07340 4625 3900 gene locus_tag LOCUS_07350 4625 3900 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230540.1 protein_id gnl|my_center|LOCUS_07350 4814 4881 gene locus_tag LOCUS_t00080 4814 4881 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4877 5290 gene locus_tag LOCUS_07360 4877 5290 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842896.1 protein_id gnl|my_center|LOCUS_07360 5329 6042 gene locus_tag LOCUS_07370 gene plsY 5329 6042 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 protein_id gnl|my_center|LOCUS_07370 6967 6146 gene locus_tag LOCUS_07380 6967 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence075 4578 568 gene locus_tag LOCUS_07390 4578 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 4721 5221 gene locus_tag LOCUS_07400 4721 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 5367 5450 gene locus_tag LOCUS_t00090 5367 5450 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5603 6520 gene locus_tag LOCUS_07410 5603 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 <7412 6618 gene locus_tag LOCUS_07420 <7412 6618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256114.1:tetratricopeptide repeat protein >Feature sequence076 773 24 gene locus_tag LOCUS_07430 773 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 910 1395 gene locus_tag LOCUS_07440 910 1395 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256064.1 protein_id gnl|my_center|LOCUS_07440 2120 1635 gene locus_tag LOCUS_07450 2120 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2791 2153 gene locus_tag LOCUS_07460 2791 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2928 2855 gene locus_tag LOCUS_t00100 2928 2855 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3099 3027 gene locus_tag LOCUS_t00110 3099 3027 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3641 3321 gene locus_tag LOCUS_07470 3641 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3750 3677 gene locus_tag LOCUS_t00120 3750 3677 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3798 4583 gene locus_tag LOCUS_07480 3798 4583 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_07480 5349 4690 gene locus_tag LOCUS_07490 gene lexA 5349 4690 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256381.1 protein_id gnl|my_center|LOCUS_07490 5790 6362 gene locus_tag LOCUS_07500 gene xpt 5790 6362 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888255.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence077 2622 115 gene locus_tag LOCUS_07510 2622 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 5468 2946 gene locus_tag LOCUS_07520 5468 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 6039 5653 gene locus_tag LOCUS_07530 6039 5653 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_07530 6380 6036 gene locus_tag LOCUS_07540 6380 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 6312 6569 gene locus_tag LOCUS_07550 6312 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 <7398 6488 gene locus_tag LOCUS_07560 <7398 6488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886570.1:cyclic-di-AMP phosphodiesterase PgpH >Feature sequence078 600 1868 gene locus_tag LOCUS_07570 gene mrfB 600 1868 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_07570 3038 2223 gene locus_tag LOCUS_07580 3038 2223 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_07580 3795 3022 gene locus_tag LOCUS_07590 3795 3022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261606.1 protein_id gnl|my_center|LOCUS_07590 4857 3817 gene locus_tag LOCUS_07600 4857 3817 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_07600 5778 4897 gene locus_tag LOCUS_07610 5778 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07610 6995 5883 gene locus_tag LOCUS_07620 6995 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07620 >Feature sequence079 1390 1154 gene locus_tag LOCUS_07630 1390 1154 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893644.1 protein_id gnl|my_center|LOCUS_07630 3730 1403 gene locus_tag LOCUS_07640 gene hypF 3730 1403 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225635.1 protein_id gnl|my_center|LOCUS_07640 4401 3727 gene locus_tag LOCUS_07650 gene hypB 4401 3727 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_07650 4823 4398 gene locus_tag LOCUS_07660 gene hypA 4823 4398 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869710.1 protein_id gnl|my_center|LOCUS_07660 5539 5207 gene locus_tag LOCUS_07670 5539 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 5690 5544 gene locus_tag LOCUS_07680 5690 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 6296 5952 gene locus_tag LOCUS_07690 6296 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 6449 6673 gene locus_tag LOCUS_07700 6449 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 <7277 6725 gene locus_tag LOCUS_07710 <7277 6725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012660626.1:endonuclease MutS2 >Feature sequence080 2405 2136 gene locus_tag LOCUS_07720 2405 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 2636 3022 gene locus_tag LOCUS_07730 2636 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 3230 3604 gene locus_tag LOCUS_07740 3230 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 3591 3998 gene locus_tag LOCUS_07750 3591 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 3934 5010 gene locus_tag LOCUS_07760 3934 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5279 4983 gene locus_tag LOCUS_07770 5279 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 5617 6843 gene locus_tag LOCUS_07780 5617 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence081 2085 94 gene locus_tag LOCUS_07790 2085 94 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_07790 4572 2110 gene locus_tag LOCUS_07800 4572 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5348 4569 gene locus_tag LOCUS_07810 5348 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 6175 5480 gene locus_tag LOCUS_07820 6175 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 6782 6222 gene locus_tag LOCUS_07830 6782 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence082 687 217 gene locus_tag LOCUS_07840 687 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07840 1964 741 gene locus_tag LOCUS_07850 gene coaBC 1964 741 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259488.1 protein_id gnl|my_center|LOCUS_07850 2451 2032 gene locus_tag LOCUS_07860 2451 2032 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530810.1 protein_id gnl|my_center|LOCUS_07860 3710 2451 gene locus_tag LOCUS_07870 3710 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 3942 5519 gene locus_tag LOCUS_07880 3942 5519 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_07880 6528 5572 gene locus_tag LOCUS_07890 gene yedA 6528 5572 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 protein_id gnl|my_center|LOCUS_07890 <7206 6664 gene locus_tag LOCUS_07900 <7206 6664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391693.1:type III pantothenate kinase >Feature sequence083 425 892 gene locus_tag LOCUS_07910 gene greA 425 892 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_07910 985 2487 gene locus_tag LOCUS_07920 gene lysS 985 2487 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_07920 3221 2541 gene locus_tag LOCUS_07930 3221 2541 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_07930 4524 3325 gene locus_tag LOCUS_07940 4524 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4593 5036 gene locus_tag LOCUS_07950 4593 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 5047 5259 gene locus_tag LOCUS_07960 5047 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 5388 6032 gene locus_tag LOCUS_07970 5388 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence084 1479 940 gene locus_tag LOCUS_07980 1479 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2343 1648 gene locus_tag LOCUS_07990 2343 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 3195 2356 gene locus_tag LOCUS_08000 3195 2356 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_08000 4049 3192 gene locus_tag LOCUS_08010 gene xerD 4049 3192 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_08010 5287 4310 gene locus_tag LOCUS_08020 5287 4310 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 protein_id gnl|my_center|LOCUS_08020 5352 5954 gene locus_tag LOCUS_08030 5352 5954 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256707.1 protein_id gnl|my_center|LOCUS_08030 6049 7002 gene locus_tag LOCUS_08040 6049 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence085 1207 1998 gene locus_tag LOCUS_08050 gene recO 1207 1998 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_08050 2067 5102 gene locus_tag LOCUS_08060 2067 5102 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725349.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence086 437 189 gene locus_tag LOCUS_08070 437 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 917 2071 gene locus_tag LOCUS_08080 917 2071 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404146.1 protein_id gnl|my_center|LOCUS_08080 2068 2679 gene locus_tag LOCUS_08090 2068 2679 CDS product HAS-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256340.1 protein_id gnl|my_center|LOCUS_08090 2726 4408 gene locus_tag LOCUS_08100 2726 4408 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144388.1 protein_id gnl|my_center|LOCUS_08100 4550 5422 gene locus_tag LOCUS_08110 4550 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 5663 6769 gene locus_tag LOCUS_08120 5663 6769 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence087 471 67 gene locus_tag LOCUS_08130 471 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1979 645 gene locus_tag LOCUS_08140 1979 645 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986859.1 protein_id gnl|my_center|LOCUS_08140 2079 2912 gene locus_tag LOCUS_08150 2079 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 2923 3648 gene locus_tag LOCUS_08160 2923 3648 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_08160 3683 4318 gene locus_tag LOCUS_08170 3683 4318 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219685422.1 protein_id gnl|my_center|LOCUS_08170 6775 4502 gene locus_tag LOCUS_08180 6775 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence088 1757 294 gene locus_tag LOCUS_08190 gene hflX 1757 294 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_08190 2636 1881 gene locus_tag LOCUS_08200 2636 1881 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_08200 3922 2807 gene locus_tag LOCUS_08210 gene trmFO 3922 2807 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392541.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08210 4270 5685 gene locus_tag LOCUS_08220 gene rpoN 4270 5685 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391805.1 protein_id gnl|my_center|LOCUS_08220 4982 4908 gene locus_tag LOCUS_t00130 4982 4908 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5689 6564 gene locus_tag LOCUS_08230 5689 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence089 1388 84 gene locus_tag LOCUS_08240 1388 84 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_08240 2194 1385 gene locus_tag LOCUS_08250 2194 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08250 3058 2825 gene locus_tag LOCUS_08260 3058 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 3828 3037 gene locus_tag LOCUS_08270 3828 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5495 3831 gene locus_tag LOCUS_08280 5495 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 <6954 5496 gene locus_tag LOCUS_08290 <6954 5496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161536185.1:response regulator >Feature sequence090 4028 3330 gene locus_tag LOCUS_08300 gene rncS 4028 3330 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_08300 5673 4432 gene locus_tag LOCUS_08310 gene fabF 5673 4432 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_08310 6818 5682 gene locus_tag LOCUS_08320 6818 5682 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence091 1199 432 gene locus_tag LOCUS_08330 1199 432 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_08330 2232 1240 gene locus_tag LOCUS_08340 2232 1240 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_08340 3352 2261 gene locus_tag LOCUS_08350 3352 2261 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_08350 3431 4723 gene locus_tag LOCUS_08360 3431 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 4830 4907 gene locus_tag LOCUS_t00140 4830 4907 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5149 6804 gene locus_tag LOCUS_08370 gene hutU 5149 6804 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256864.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence092 <1 648 gene locus_tag LOCUS_08380 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014832758.1:NADH-quinone oxidoreductase subunit L 650 841 gene locus_tag LOCUS_08390 650 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 790 2034 gene locus_tag LOCUS_08400 790 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2290 2619 gene locus_tag LOCUS_08410 2290 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2631 3257 gene locus_tag LOCUS_08420 2631 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 3254 3742 gene locus_tag LOCUS_08430 3254 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08430 3753 4949 gene locus_tag LOCUS_08440 3753 4949 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939566.1 protein_id gnl|my_center|LOCUS_08440 4933 5856 gene locus_tag LOCUS_08450 4933 5856 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939562.1 protein_id gnl|my_center|LOCUS_08450 5853 6317 gene locus_tag LOCUS_08460 5853 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence093 2159 3451 gene locus_tag LOCUS_08470 2159 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 5481 3652 gene locus_tag LOCUS_08480 5481 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence094 <1 508 gene locus_tag LOCUS_08490 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016327774.1:NAD(P)H-dependent oxidoreductase subunit E 505 1335 gene locus_tag LOCUS_08500 505 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1325 2050 gene locus_tag LOCUS_08510 1325 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08510 2037 4112 gene locus_tag LOCUS_08520 2037 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:2454..2456,aa:Sec) note codon on position 140 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_08520 4915 4109 gene locus_tag LOCUS_08530 gene surE 4915 4109 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_08530 5064 6653 gene locus_tag LOCUS_08540 5064 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence095 400 807 gene locus_tag LOCUS_08550 400 807 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 protein_id gnl|my_center|LOCUS_08550 961 1815 gene locus_tag LOCUS_08560 961 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2009 1842 gene locus_tag LOCUS_08570 2009 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2124 3260 gene locus_tag LOCUS_08580 2124 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 3669 4298 gene locus_tag LOCUS_08590 3669 4298 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229674.1 protein_id gnl|my_center|LOCUS_08590 4525 6426 gene locus_tag LOCUS_08600 4525 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence096 3 251 gene locus_tag LOCUS_08610 3 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 337 1068 gene locus_tag LOCUS_08620 337 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1332 2033 gene locus_tag LOCUS_08630 1332 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 2115 2525 gene locus_tag LOCUS_08640 2115 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 2726 5254 gene locus_tag LOCUS_08650 2726 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 <6721 5456 gene locus_tag LOCUS_08660 <6721 5456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943516.1:PKD domain-containing protein >Feature sequence097 104 604 gene locus_tag LOCUS_08670 104 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2326 806 gene locus_tag LOCUS_08680 2326 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2721 2323 gene locus_tag LOCUS_08690 2721 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3613 2741 gene locus_tag LOCUS_08700 gene sucD 3613 2741 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256597.1 protein_id gnl|my_center|LOCUS_08700 4680 3610 gene locus_tag LOCUS_08710 gene sucC 4680 3610 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_08710 5555 4752 gene locus_tag LOCUS_08720 5555 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6148 5555 gene locus_tag LOCUS_08730 gene scpB 6148 5555 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence098 <1 515 gene locus_tag LOCUS_08740 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056673.1:mechanosensitive ion channel 596 2524 gene locus_tag LOCUS_08750 596 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08750 2521 4335 gene locus_tag LOCUS_08760 2521 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08760 4332 6149 gene locus_tag LOCUS_08770 4332 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence099 673 1677 gene locus_tag LOCUS_08780 673 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2047 1787 gene locus_tag LOCUS_08790 2047 1787 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_08790 2838 2167 gene locus_tag LOCUS_08800 2838 2167 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_08800 3852 2860 gene locus_tag LOCUS_08810 3852 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 4493 3849 gene locus_tag LOCUS_08820 4493 3849 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_08820 5487 4666 gene locus_tag LOCUS_08830 5487 4666 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256753.1 protein_id gnl|my_center|LOCUS_08830 6323 5493 gene locus_tag LOCUS_08840 6323 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence100 2445 1279 gene locus_tag LOCUS_08850 2445 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2757 3875 gene locus_tag LOCUS_08860 2757 3875 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_08860 3953 5125 gene locus_tag LOCUS_08870 3953 5125 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259080.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence101 354 779 gene locus_tag LOCUS_08880 gene rplP 354 779 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_08880 742 1062 gene locus_tag LOCUS_08890 742 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1059 1373 gene locus_tag LOCUS_08900 1059 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1507 1878 gene locus_tag LOCUS_08910 gene rplN 1507 1878 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549034.1 protein_id gnl|my_center|LOCUS_08910 1904 2224 gene locus_tag LOCUS_08920 gene rplX 1904 2224 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_08920 2238 2786 gene locus_tag LOCUS_08930 gene rplE 2238 2786 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258243.1 protein_id gnl|my_center|LOCUS_08930 2788 2970 gene locus_tag LOCUS_08940 2788 2970 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557082.1 protein_id gnl|my_center|LOCUS_08940 2990 3403 gene locus_tag LOCUS_08950 gene rpsH 2990 3403 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258245.1 protein_id gnl|my_center|LOCUS_08950 3428 3973 gene locus_tag LOCUS_08960 gene rplF 3428 3973 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_08960 3977 4342 gene locus_tag LOCUS_08970 gene rplR 3977 4342 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987751.1 protein_id gnl|my_center|LOCUS_08970 4371 4907 gene locus_tag LOCUS_08980 gene rpsE 4371 4907 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_08980 4900 5091 gene locus_tag LOCUS_08990 gene rpmD 4900 5091 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_08990 5095 5544 gene locus_tag LOCUS_09000 gene rplO 5095 5544 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence102 4059 2191 gene locus_tag LOCUS_09010 4059 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 4469 4062 gene locus_tag LOCUS_09020 4469 4062 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603272.1 protein_id gnl|my_center|LOCUS_09020 4861 4466 gene locus_tag LOCUS_09030 4861 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 5198 5125 gene locus_tag LOCUS_t00150 5198 5125 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6430 5288 gene locus_tag LOCUS_09040 6430 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence103 <1 534 gene locus_tag LOCUS_09050 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545782.1:F420-non-reducing hydrogenase subunit A, selenocysteine-containing 710 1195 gene locus_tag LOCUS_09060 710 1195 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706346.1 protein_id gnl|my_center|LOCUS_09060 1192 1635 gene locus_tag LOCUS_09070 1192 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1989 2414 gene locus_tag LOCUS_09080 1989 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2579 3670 gene locus_tag LOCUS_09090 2579 3670 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929354.1 protein_id gnl|my_center|LOCUS_09090 3724 4722 gene locus_tag LOCUS_09100 gene pyrB 3724 4722 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251146.1 protein_id gnl|my_center|LOCUS_09100 4976 5914 gene locus_tag LOCUS_09110 gene pyrF 4976 5914 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839147.1 protein_id gnl|my_center|LOCUS_09110 5869 6252 gene locus_tag LOCUS_09120 5869 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence104 596 2536 gene locus_tag LOCUS_09130 596 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2661 3005 gene locus_tag LOCUS_09140 2661 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 3246 4451 gene locus_tag LOCUS_09150 3246 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4585 5520 gene locus_tag LOCUS_09160 4585 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence105 2090 930 gene locus_tag LOCUS_09170 2090 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3010 2087 gene locus_tag LOCUS_09180 gene speB 3010 2087 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224492.1 protein_id gnl|my_center|LOCUS_09180 4023 3316 gene locus_tag LOCUS_09190 4023 3316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_09190 4811 4026 gene locus_tag LOCUS_09200 gene cbiQ 4811 4026 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259516.1 protein_id gnl|my_center|LOCUS_09200 5727 4816 gene locus_tag LOCUS_09210 5727 4816 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259515.1 protein_id gnl|my_center|LOCUS_09210 6138 5740 gene locus_tag LOCUS_09220 6138 5740 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence106 142 1491 gene locus_tag LOCUS_09230 142 1491 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_09230 1502 1696 gene locus_tag LOCUS_09240 1502 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3833 1605 gene locus_tag LOCUS_09250 3833 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 3933 4658 gene locus_tag LOCUS_09260 gene lipB 3933 4658 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_09260 4692 5678 gene locus_tag LOCUS_09270 4692 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5735 6220 gene locus_tag LOCUS_09280 5735 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence107 955 80 gene locus_tag LOCUS_09290 955 80 CDS product TIGR03560 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225208.1 protein_id gnl|my_center|LOCUS_09290 1455 997 gene locus_tag LOCUS_09300 1455 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2336 1437 gene locus_tag LOCUS_09310 2336 1437 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528033.1 protein_id gnl|my_center|LOCUS_09310 3310 2414 gene locus_tag LOCUS_09320 3310 2414 CDS product choline kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400536.1 protein_id gnl|my_center|LOCUS_09320 5903 3471 gene locus_tag LOCUS_09330 5903 3471 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061787.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence108 2519 2013 gene locus_tag LOCUS_09340 2519 2013 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256024.1 protein_id gnl|my_center|LOCUS_09340 3360 2530 gene locus_tag LOCUS_09350 3360 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4514 3456 gene locus_tag LOCUS_09360 4514 3456 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_09360 4674 6035 gene locus_tag LOCUS_09370 gene tilS 4674 6035 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence109 <1 679 gene locus_tag LOCUS_09380 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258446.1:low-specificity L-threonine aldolase 1007 1081 gene locus_tag LOCUS_t00160 1007 1081 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1192 2307 gene locus_tag LOCUS_09390 gene dprA 1192 2307 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_09390 2304 3389 gene locus_tag LOCUS_09400 2304 3389 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_09400 3399 5744 gene locus_tag LOCUS_09410 gene topA 3399 5744 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813282.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence110 459 1475 gene locus_tag LOCUS_09420 459 1475 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242091.1 protein_id gnl|my_center|LOCUS_09420 1598 2533 gene locus_tag LOCUS_09430 1598 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09430 2430 3101 gene locus_tag LOCUS_09440 2430 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09440 3173 4186 gene locus_tag LOCUS_09450 3173 4186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_09450 4183 5769 gene locus_tag LOCUS_09460 4183 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence111 356 853 gene locus_tag LOCUS_09470 gene tsaE 356 853 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257860.1 protein_id gnl|my_center|LOCUS_09470 855 1517 gene locus_tag LOCUS_09480 gene tsaB 855 1517 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_09480 1514 2026 gene locus_tag LOCUS_09490 gene rimI 1514 2026 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_09490 2004 2630 gene locus_tag LOCUS_09500 2004 2630 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_09500 2657 3994 gene locus_tag LOCUS_09510 2657 3994 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257976.1 protein_id gnl|my_center|LOCUS_09510 3994 4971 gene locus_tag LOCUS_09520 3994 4971 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence112 106 2334 gene locus_tag LOCUS_09530 106 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 2466 3149 gene locus_tag LOCUS_09540 2466 3149 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230050.1 protein_id gnl|my_center|LOCUS_09540 3338 4276 gene locus_tag LOCUS_09550 3338 4276 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_09550 5234 4317 gene locus_tag LOCUS_09560 gene secF 5234 4317 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_09560 <6273 5242 gene locus_tag LOCUS_09570 <6273 5242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258879.1:protein translocase subunit SecD >Feature sequence113 551 1654 gene locus_tag LOCUS_09580 551 1654 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532862.1 protein_id gnl|my_center|LOCUS_09580 1833 1651 gene locus_tag LOCUS_09590 1833 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1751 2575 gene locus_tag LOCUS_09600 1751 2575 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532864.1 protein_id gnl|my_center|LOCUS_09600 2563 2982 gene locus_tag LOCUS_09610 2563 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09610 2958 3314 gene locus_tag LOCUS_09620 2958 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09620 3720 4070 gene locus_tag LOCUS_09630 3720 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4204 5187 gene locus_tag LOCUS_09640 4204 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 5136 5762 gene locus_tag LOCUS_09650 5136 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence114 575 1105 gene locus_tag LOCUS_09660 575 1105 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938796.1 protein_id gnl|my_center|LOCUS_09660 1102 2826 gene locus_tag LOCUS_09670 1102 2826 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336918.1 protein_id gnl|my_center|LOCUS_09670 2823 3050 gene locus_tag LOCUS_09680 2823 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 3047 5842 gene locus_tag LOCUS_09690 3047 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence115 1719 820 gene locus_tag LOCUS_09700 1719 820 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814758.1 protein_id gnl|my_center|LOCUS_09700 2784 1735 gene locus_tag LOCUS_09710 2784 1735 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_09710 4624 2786 gene locus_tag LOCUS_09720 4624 2786 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_09720 5331 4621 gene locus_tag LOCUS_09730 5331 4621 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027219.1 protein_id gnl|my_center|LOCUS_09730 5459 6058 gene locus_tag LOCUS_09740 5459 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence116 474 1 gene locus_tag LOCUS_09750 474 1 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880029.1 protein_id gnl|my_center|LOCUS_09750 1010 471 gene locus_tag LOCUS_09760 gene thpR 1010 471 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250689.1 protein_id gnl|my_center|LOCUS_09760 1228 1052 gene locus_tag LOCUS_09770 1228 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1523 1191 gene locus_tag LOCUS_09780 1523 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2076 3035 gene locus_tag LOCUS_09790 2076 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 4465 3176 gene locus_tag LOCUS_09800 4465 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 4601 5302 gene locus_tag LOCUS_09810 4601 5302 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909121.1 protein_id gnl|my_center|LOCUS_09810 5322 5717 gene locus_tag LOCUS_09820 5322 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence117 1213 290 gene locus_tag LOCUS_09830 1213 290 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_09830 2129 1362 gene locus_tag LOCUS_09840 2129 1362 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_09840 3157 2126 gene locus_tag LOCUS_09850 3157 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4110 3154 gene locus_tag LOCUS_09860 4110 3154 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583289.1 protein_id gnl|my_center|LOCUS_09860 6062 4107 gene locus_tag LOCUS_09870 6062 4107 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392714.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence118 <1 878 gene locus_tag LOCUS_09880 <1 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257972.1:ABC transporter permease 881 2149 gene locus_tag LOCUS_09890 881 2149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257973.1 protein_id gnl|my_center|LOCUS_09890 2149 3774 gene locus_tag LOCUS_09900 2149 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112147230.1 protein_id gnl|my_center|LOCUS_09900 3758 4681 gene locus_tag LOCUS_09910 3758 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4685 5683 gene locus_tag LOCUS_09920 gene pseB 4685 5683 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867763.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence119 20 1714 gene locus_tag LOCUS_09930 gene fdrA 20 1714 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_09930 1846 3093 gene locus_tag LOCUS_09940 1846 3093 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_09940 3360 4139 gene locus_tag LOCUS_09950 3360 4139 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_09950 4224 4712 gene locus_tag LOCUS_09960 4224 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence120 373 1182 gene locus_tag LOCUS_09970 373 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1257 2153 gene locus_tag LOCUS_09980 1257 2153 CDS product choline/ethanolamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336755.1 protein_id gnl|my_center|LOCUS_09980 2143 2397 gene locus_tag LOCUS_09990 2143 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09990 2388 4544 gene locus_tag LOCUS_10000 2388 4544 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_10000 <5969 4750 gene locus_tag LOCUS_10010 <5969 4750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928763.1:BTAD domain-containing putative transcriptional regulator >Feature sequence121 1573 65 gene locus_tag LOCUS_10020 1573 65 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075647.1 protein_id gnl|my_center|LOCUS_10020 1872 1573 gene locus_tag LOCUS_10030 1872 1573 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056789.1 protein_id gnl|my_center|LOCUS_10030 2244 1978 gene locus_tag LOCUS_10040 gene pduA 2244 1978 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183618.1 protein_id gnl|my_center|LOCUS_10040 2910 2272 gene locus_tag LOCUS_10050 2910 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_10050 3958 3098 gene locus_tag LOCUS_10060 gene deoC 3958 3098 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256596.1 protein_id gnl|my_center|LOCUS_10060 4212 3973 gene locus_tag LOCUS_10070 4212 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 5611 4814 gene locus_tag LOCUS_10080 gene phnF 5611 4814 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence122 130 1134 gene locus_tag LOCUS_10090 130 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1176 1249 gene locus_tag LOCUS_t00170 1176 1249 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1549 2898 gene locus_tag LOCUS_10100 gene glmU 1549 2898 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_10100 2895 4175 gene locus_tag LOCUS_10110 2895 4175 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_10110 4172 4585 gene locus_tag LOCUS_10120 gene cdd 4172 4585 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence123 <1 578 gene locus_tag LOCUS_10130 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705417.1:DUF72 domain-containing protein 858 1142 gene locus_tag LOCUS_10140 858 1142 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546546.1 protein_id gnl|my_center|LOCUS_10140 1180 1662 gene locus_tag LOCUS_10150 1180 1662 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528293.1 protein_id gnl|my_center|LOCUS_10150 1669 2052 gene locus_tag LOCUS_10160 1669 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2056 3078 gene locus_tag LOCUS_10170 2056 3078 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_10170 3078 3491 gene locus_tag LOCUS_10180 3078 3491 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909388.1 protein_id gnl|my_center|LOCUS_10180 4729 3926 gene locus_tag LOCUS_10190 4729 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5043 4726 gene locus_tag LOCUS_10200 5043 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 5190 5106 gene locus_tag LOCUS_t00180 5190 5106 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence124 452 183 gene locus_tag LOCUS_10210 452 183 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_10210 2029 713 gene locus_tag LOCUS_10220 2029 713 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_10220 2785 2291 gene locus_tag LOCUS_10230 gene mog 2785 2291 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_10230 3210 2782 gene locus_tag LOCUS_10240 3210 2782 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208525.1 protein_id gnl|my_center|LOCUS_10240 4946 3207 gene locus_tag LOCUS_10250 4946 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 5332 4943 gene locus_tag LOCUS_10260 5332 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 <5951 5335 gene locus_tag LOCUS_10270 <5951 5335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256692.1:endopeptidase La >Feature sequence125 451 1107 gene locus_tag LOCUS_10280 451 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1534 1268 gene locus_tag LOCUS_10290 1534 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2538 1531 gene locus_tag LOCUS_10300 2538 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391744.1 protein_id gnl|my_center|LOCUS_10300 3722 2541 gene locus_tag LOCUS_10310 3722 2541 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974562.1 protein_id gnl|my_center|LOCUS_10310 5140 3746 gene locus_tag LOCUS_10320 gene lpdA 5140 3746 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892330.1 protein_id gnl|my_center|LOCUS_10320 <5944 5398 gene locus_tag LOCUS_10330 <5944 5398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257562.1:dihydrolipoamide acetyltransferase family protein >Feature sequence126 1954 1088 gene locus_tag LOCUS_10340 1954 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3023 1980 gene locus_tag LOCUS_10350 3023 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4225 3098 gene locus_tag LOCUS_10360 gene wecB 4225 3098 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_10360 5537 4218 gene locus_tag LOCUS_10370 5537 4218 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869927.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence127 96 488 gene locus_tag LOCUS_10380 96 488 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_10380 508 855 gene locus_tag LOCUS_10390 508 855 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_10390 1416 4103 gene locus_tag LOCUS_10400 gene ppdK 1416 4103 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258815.1 protein_id gnl|my_center|LOCUS_10400 5420 4455 gene locus_tag LOCUS_10410 5420 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence128 1454 327 gene locus_tag LOCUS_10420 1454 327 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_10420 2710 1454 gene locus_tag LOCUS_10430 gene fabF 2710 1454 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_10430 2874 3824 gene locus_tag LOCUS_10440 2874 3824 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143624.1 protein_id gnl|my_center|LOCUS_10440 3817 4701 gene locus_tag LOCUS_10450 3817 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257044.1 protein_id gnl|my_center|LOCUS_10450 4698 5837 gene locus_tag LOCUS_10460 gene menC 4698 5837 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence129 <1 582 gene locus_tag LOCUS_10470 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222054.1:class I SAM-dependent methyltransferase 780 2138 gene locus_tag LOCUS_10480 780 2138 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_10480 2153 2935 gene locus_tag LOCUS_10490 2153 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 5052 3199 gene locus_tag LOCUS_10500 gene typA 5052 3199 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256721.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence130 1825 770 gene locus_tag LOCUS_10510 gene nadA 1825 770 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404647.1 protein_id gnl|my_center|LOCUS_10510 2795 1818 gene locus_tag LOCUS_10520 gene nadC 2795 1818 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_10520 3766 2954 gene locus_tag LOCUS_10530 gene pstB 3766 2954 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868848.1 protein_id gnl|my_center|LOCUS_10530 4637 3780 gene locus_tag LOCUS_10540 gene pstA 4637 3780 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788578.1 protein_id gnl|my_center|LOCUS_10540 5541 4651 gene locus_tag LOCUS_10550 gene pstC 5541 4651 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence131 2952 1171 gene locus_tag LOCUS_10560 gene nuoF 2952 1171 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_10560 3869 2949 gene locus_tag LOCUS_10570 3869 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 4363 3866 gene locus_tag LOCUS_10580 4363 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10580 4701 4357 gene locus_tag LOCUS_10590 4701 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10590 5132 4698 gene locus_tag LOCUS_10600 5132 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence132 113 550 gene locus_tag LOCUS_10610 gene mraZ 113 550 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256658.1 protein_id gnl|my_center|LOCUS_10610 554 1549 gene locus_tag LOCUS_10620 gene rsmH 554 1549 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_10620 1546 2001 gene locus_tag LOCUS_10630 1546 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 2001 3785 gene locus_tag LOCUS_10640 2001 3785 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_10640 3778 5217 gene locus_tag LOCUS_10650 3778 5217 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence133 1947 688 gene locus_tag LOCUS_10660 gene fabF 1947 688 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257800.1 protein_id gnl|my_center|LOCUS_10660 2292 2068 gene locus_tag LOCUS_10670 2292 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2477 4279 gene locus_tag LOCUS_10680 2477 4279 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142981.1 protein_id gnl|my_center|LOCUS_10680 4893 5120 gene locus_tag LOCUS_10690 4893 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10690 5136 5483 gene locus_tag LOCUS_10700 gene sdhC 5136 5483 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289306.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence134 914 189 gene locus_tag LOCUS_10710 914 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2175 958 gene locus_tag LOCUS_10720 2175 958 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318704.1 protein_id gnl|my_center|LOCUS_10720 2458 2282 gene locus_tag LOCUS_10730 2458 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2791 3795 gene locus_tag LOCUS_10740 2791 3795 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259152.1 protein_id gnl|my_center|LOCUS_10740 3795 4595 gene locus_tag LOCUS_10750 3795 4595 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259153.1 protein_id gnl|my_center|LOCUS_10750 4592 5377 gene locus_tag LOCUS_10760 4592 5377 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259154.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence135 2170 773 gene locus_tag LOCUS_10770 2170 773 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678842.1 protein_id gnl|my_center|LOCUS_10770 2676 2191 gene locus_tag LOCUS_10780 2676 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4095 3064 gene locus_tag LOCUS_10790 gene rlmN 4095 3064 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_10790 4581 4141 gene locus_tag LOCUS_10800 4581 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10800 <5732 4936 gene locus_tag LOCUS_10810 <5732 4936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228982.1:DUF1028 domain-containing protein >Feature sequence136 1777 512 gene locus_tag LOCUS_10820 1777 512 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259763.1 protein_id gnl|my_center|LOCUS_10820 3112 1781 gene locus_tag LOCUS_10830 3112 1781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_10830 4684 3125 gene locus_tag LOCUS_10840 4684 3125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_10840 <5702 5064 gene locus_tag LOCUS_10850 <5702 5064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776144.1:BMP family ABC transporter substrate-binding protein >Feature sequence137 1566 2351 gene locus_tag LOCUS_10860 1566 2351 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_10860 2362 3780 gene locus_tag LOCUS_10870 gene mtgB 2362 3780 CDS product glycine betaine--corrinoid protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816521.1 protein_id gnl|my_center|LOCUS_10870 3895 4761 gene locus_tag LOCUS_10880 3895 4761 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626499.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence138 567 127 gene locus_tag LOCUS_10890 567 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 983 4810 gene locus_tag LOCUS_10900 983 4810 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256934.1 protein_id gnl|my_center|LOCUS_10900 4846 5241 gene locus_tag LOCUS_10910 4846 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence139 265 858 gene locus_tag LOCUS_10920 265 858 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_10920 839 1375 gene locus_tag LOCUS_10930 839 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1372 2370 gene locus_tag LOCUS_10940 1372 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259759.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence140 4306 446 gene locus_tag LOCUS_10950 4306 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 5355 4471 gene locus_tag LOCUS_10960 5355 4471 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence141 250 1029 gene locus_tag LOCUS_10970 250 1029 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_10970 1081 2037 gene locus_tag LOCUS_10980 1081 2037 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256331.1 protein_id gnl|my_center|LOCUS_10980 2034 2879 gene locus_tag LOCUS_10990 2034 2879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256330.1 protein_id gnl|my_center|LOCUS_10990 2876 3379 gene locus_tag LOCUS_11000 2876 3379 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259248.1 protein_id gnl|my_center|LOCUS_11000 4045 3695 gene locus_tag LOCUS_11010 4045 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 4654 4079 gene locus_tag LOCUS_11020 4654 4079 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888997.1 protein_id gnl|my_center|LOCUS_11020 5492 4665 gene locus_tag LOCUS_11030 5492 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence142 <1 899 gene locus_tag LOCUS_11040 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257449.1:CdaR family protein 1160 1810 gene locus_tag LOCUS_11050 1160 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11050 1908 2492 gene locus_tag LOCUS_11060 1908 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11060 2789 3394 gene locus_tag LOCUS_11070 gene lepB 2789 3394 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257166.1 protein_id gnl|my_center|LOCUS_11070 3403 3726 gene locus_tag LOCUS_11080 3403 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3766 5391 gene locus_tag LOCUS_11090 3766 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence143 336 178 gene locus_tag LOCUS_11100 336 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 609 409 gene locus_tag LOCUS_11110 609 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11110 5365 602 gene locus_tag LOCUS_11120 5365 602 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392708.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence144 66 1007 gene locus_tag LOCUS_11130 gene arcC 66 1007 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 protein_id gnl|my_center|LOCUS_11130 1111 2382 gene locus_tag LOCUS_11140 1111 2382 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259703.1 protein_id gnl|my_center|LOCUS_11140 2434 3912 gene locus_tag LOCUS_11150 2434 3912 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259702.1 protein_id gnl|my_center|LOCUS_11150 3909 4964 gene locus_tag LOCUS_11160 3909 4964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259701.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence145 520 95 gene locus_tag LOCUS_11170 520 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2216 564 gene locus_tag LOCUS_11180 2216 564 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_11180 2684 3997 gene locus_tag LOCUS_11190 2684 3997 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256145.1 protein_id gnl|my_center|LOCUS_11190 3994 5070 gene locus_tag LOCUS_11200 3994 5070 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249136.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence146 346 1626 gene locus_tag LOCUS_11210 346 1626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986231.1 protein_id gnl|my_center|LOCUS_11210 4283 2088 gene locus_tag LOCUS_11220 4283 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4797 4285 gene locus_tag LOCUS_11230 4797 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080669.1 protein_id gnl|my_center|LOCUS_11230 <5576 4911 gene locus_tag LOCUS_11240 <5576 4911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227710.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence147 465 1676 gene locus_tag LOCUS_11250 465 1676 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880318.1 protein_id gnl|my_center|LOCUS_11250 2420 2004 gene locus_tag LOCUS_11260 2420 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3924 2302 gene locus_tag LOCUS_11270 3924 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 4144 4497 gene locus_tag LOCUS_11280 4144 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 5322 4513 gene locus_tag LOCUS_11290 5322 4513 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence148 730 1206 gene locus_tag LOCUS_11300 730 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 3467 1290 gene locus_tag LOCUS_11310 3467 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4920 3901 gene locus_tag LOCUS_11320 4920 3901 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887127.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence149 508 2391 gene locus_tag LOCUS_11330 508 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2460 2693 gene locus_tag LOCUS_11340 2460 2693 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869742.1 protein_id gnl|my_center|LOCUS_11340 2794 4587 gene locus_tag LOCUS_11350 2794 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4594 4953 gene locus_tag LOCUS_11360 gene rbfA 4594 4953 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095188.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence150 164 1198 gene locus_tag LOCUS_11370 164 1198 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257871.1 protein_id gnl|my_center|LOCUS_11370 1344 2090 gene locus_tag LOCUS_11380 gene fabG 1344 2090 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_11380 2107 2472 gene locus_tag LOCUS_11390 2107 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2524 2931 gene locus_tag LOCUS_11400 gene nusB 2524 2931 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_11400 2935 3300 gene locus_tag LOCUS_11410 2935 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3300 4157 gene locus_tag LOCUS_11420 3300 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4316 5437 gene locus_tag LOCUS_11430 4316 5437 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11430 >Feature sequence151 1401 139 gene locus_tag LOCUS_11440 1401 139 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259400.1 protein_id gnl|my_center|LOCUS_11440 2265 1432 gene locus_tag LOCUS_11450 2265 1432 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932247.1 protein_id gnl|my_center|LOCUS_11450 3122 2262 gene locus_tag LOCUS_11460 3122 2262 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_11460 3848 3126 gene locus_tag LOCUS_11470 3848 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 4294 5445 gene locus_tag LOCUS_11480 4294 5445 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence152 135 470 gene locus_tag LOCUS_11490 135 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence153 1221 2732 gene locus_tag LOCUS_11500 1221 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2776 3762 gene locus_tag LOCUS_11510 2776 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249783.1 protein_id gnl|my_center|LOCUS_11510 3752 4504 gene locus_tag LOCUS_11520 3752 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 <5508 4572 gene locus_tag LOCUS_11530 <5508 4572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258932.1:Ig-like domain-containing protein >Feature sequence154 134 1060 gene locus_tag LOCUS_11540 134 1060 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_11540 1272 2708 gene locus_tag LOCUS_11550 1272 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2829 3788 gene locus_tag LOCUS_11560 2829 3788 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_11560 3785 4540 gene locus_tag LOCUS_11570 3785 4540 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287754.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence155 <1 712 gene locus_tag LOCUS_11580 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029494947.1:S41 family peptidase 827 1975 gene locus_tag LOCUS_11590 827 1975 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258067.1 protein_id gnl|my_center|LOCUS_11590 2361 2585 gene locus_tag LOCUS_11600 2361 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2596 3957 gene locus_tag LOCUS_11610 gene mgtE 2596 3957 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_11610 3957 4847 gene locus_tag LOCUS_11620 3957 4847 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence156 920 135 gene locus_tag LOCUS_11630 920 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2025 958 gene locus_tag LOCUS_11640 2025 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3185 2046 gene locus_tag LOCUS_11650 3185 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3874 3182 gene locus_tag LOCUS_11660 3874 3182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_11660 4378 4305 gene locus_tag LOCUS_t00190 4378 4305 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4876 4436 gene locus_tag LOCUS_11670 4876 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 4995 4909 gene locus_tag LOCUS_t00200 4995 4909 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence157 1626 574 gene locus_tag LOCUS_11680 1626 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3173 1623 gene locus_tag LOCUS_11690 3173 1623 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113884.1 protein_id gnl|my_center|LOCUS_11690 4872 3214 gene locus_tag LOCUS_11700 4872 3214 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence158 204 1658 gene locus_tag LOCUS_11710 204 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1984 1625 gene locus_tag LOCUS_11720 1984 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2165 4552 gene locus_tag LOCUS_11730 2165 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 4587 5231 gene locus_tag LOCUS_11740 4587 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence159 3573 25 gene locus_tag LOCUS_11750 3573 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3496 3729 gene locus_tag LOCUS_11760 3496 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5162 3726 gene locus_tag LOCUS_11770 5162 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11770 >Feature sequence160 <1 1339 gene locus_tag LOCUS_11780 <1 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257853.1:NADH-quinone oxidoreductase subunit D 1389 2030 gene locus_tag LOCUS_11790 1389 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 2037 2411 gene locus_tag LOCUS_11800 2037 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 2408 3487 gene locus_tag LOCUS_11810 2408 3487 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_11810 3493 4422 gene locus_tag LOCUS_11820 3493 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4504 5226 gene locus_tag LOCUS_11830 4504 5226 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence161 185 973 gene locus_tag LOCUS_11840 gene lgt 185 973 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171692.1 protein_id gnl|my_center|LOCUS_11840 1111 1407 gene locus_tag LOCUS_11850 1111 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1510 1758 gene locus_tag LOCUS_11860 1510 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2635 1877 gene locus_tag LOCUS_11870 2635 1877 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258357.1 protein_id gnl|my_center|LOCUS_11870 3186 2635 gene locus_tag LOCUS_11880 3186 2635 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence162 898 2364 gene locus_tag LOCUS_11890 898 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5187 2548 gene locus_tag LOCUS_11900 gene gyrA 5187 2548 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence163 <1 639 gene locus_tag LOCUS_11910 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256516.1:redox-regulated ATPase YchF 652 2436 gene locus_tag LOCUS_11920 652 2436 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_11920 2657 2567 gene locus_tag LOCUS_t00210 2657 2567 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3637 2702 gene locus_tag LOCUS_11930 3637 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4849 3665 gene locus_tag LOCUS_11940 4849 3665 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228267.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence164 1670 471 gene locus_tag LOCUS_11950 1670 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2008 1667 gene locus_tag LOCUS_11960 2008 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2577 2020 gene locus_tag LOCUS_11970 gene efp 2577 2020 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_11970 <5316 2901 gene locus_tag LOCUS_11980 <5316 2901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257493.1:helicase C-terminal domain-containing protein >Feature sequence165 917 375 gene locus_tag LOCUS_11990 917 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3097 1370 gene locus_tag LOCUS_12000 3097 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3285 3644 gene locus_tag LOCUS_12010 3285 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence166 110 352 gene locus_tag LOCUS_12020 110 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1008 610 gene locus_tag LOCUS_12030 1008 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2844 1078 gene locus_tag LOCUS_12040 2844 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3679 2909 gene locus_tag LOCUS_12050 3679 2909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_12050 5098 3845 gene locus_tag LOCUS_12060 5098 3845 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12060 >Feature sequence167 1171 515 gene locus_tag LOCUS_12070 1171 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2594 1431 gene locus_tag LOCUS_12080 2594 1431 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258372.1 protein_id gnl|my_center|LOCUS_12080 3590 2631 gene locus_tag LOCUS_12090 3590 2631 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674004.1 protein_id gnl|my_center|LOCUS_12090 4848 3613 gene locus_tag LOCUS_12100 gene hppD 4848 3613 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence168 318 1250 gene locus_tag LOCUS_12110 318 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1256 2218 gene locus_tag LOCUS_12120 1256 2218 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046550460.1 protein_id gnl|my_center|LOCUS_12120 2215 2712 gene locus_tag LOCUS_12130 2215 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2724 3887 gene locus_tag LOCUS_12140 2724 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3903 5066 gene locus_tag LOCUS_12150 3903 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence169 2054 888 gene locus_tag LOCUS_12160 2054 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2905 2060 gene locus_tag LOCUS_12170 2905 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3740 2922 gene locus_tag LOCUS_12180 3740 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 4075 3764 gene locus_tag LOCUS_12190 4075 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 5003 4137 gene locus_tag LOCUS_12200 5003 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence170 224 1210 gene locus_tag LOCUS_12210 224 1210 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_12210 1378 1728 gene locus_tag LOCUS_12220 1378 1728 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_12220 1790 2272 gene locus_tag LOCUS_12230 1790 2272 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 protein_id gnl|my_center|LOCUS_12230 2330 2821 gene locus_tag LOCUS_12240 2330 2821 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141436.1 protein_id gnl|my_center|LOCUS_12240 2984 3532 gene locus_tag LOCUS_12250 2984 3532 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969534.1 protein_id gnl|my_center|LOCUS_12250 3653 3516 gene locus_tag LOCUS_12260 3653 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3944 5164 gene locus_tag LOCUS_12270 3944 5164 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence171 <1 1908 gene locus_tag LOCUS_12280 <1 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928763.1:BTAD domain-containing putative transcriptional regulator 1952 2815 gene locus_tag LOCUS_12290 1952 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 3828 2863 gene locus_tag LOCUS_12300 3828 2863 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680028.1 protein_id gnl|my_center|LOCUS_12300 4962 3829 gene locus_tag LOCUS_12310 4962 3829 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence172 126 845 gene locus_tag LOCUS_12320 gene pyrH 126 845 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_12320 1003 1560 gene locus_tag LOCUS_12330 gene frr 1003 1560 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259405.1 protein_id gnl|my_center|LOCUS_12330 1563 2303 gene locus_tag LOCUS_12340 1563 2303 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_12340 2532 3350 gene locus_tag LOCUS_12350 2532 3350 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259407.1 protein_id gnl|my_center|LOCUS_12350 3550 4830 gene locus_tag LOCUS_12360 gene rho 3550 4830 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence173 2662 1004 gene locus_tag LOCUS_12370 2662 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2857 4380 gene locus_tag LOCUS_12380 2857 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257117.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence174 <1 626 gene locus_tag LOCUS_12390 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256815.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD 2241 859 gene locus_tag LOCUS_12400 2241 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2857 2486 gene locus_tag LOCUS_12410 2857 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2997 3152 gene locus_tag LOCUS_12420 2997 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 3174 3722 gene locus_tag LOCUS_12430 3174 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 <5146 3929 gene locus_tag LOCUS_12440 <5146 3929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator >Feature sequence175 <1 584 gene locus_tag LOCUS_12450 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338170.1:ATP-binding cassette domain-containing protein 687 1682 gene locus_tag LOCUS_12460 687 1682 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_12460 1715 2524 gene locus_tag LOCUS_12470 1715 2524 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263894.1 protein_id gnl|my_center|LOCUS_12470 2561 2893 gene locus_tag LOCUS_12480 2561 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2976 3788 gene locus_tag LOCUS_12490 2976 3788 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461573.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence176 1642 740 gene locus_tag LOCUS_12500 1642 740 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_12500 2407 1790 gene locus_tag LOCUS_12510 2407 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3852 2536 gene locus_tag LOCUS_12520 3852 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3913 4626 gene locus_tag LOCUS_12530 3913 4626 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880279.1 protein_id gnl|my_center|LOCUS_12530 4648 4974 gene locus_tag LOCUS_12540 4648 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence177 1 495 gene locus_tag LOCUS_12550 1 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 488 1867 gene locus_tag LOCUS_12560 gene nrfD 488 1867 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228899.1 protein_id gnl|my_center|LOCUS_12560 1877 2419 gene locus_tag LOCUS_12570 1877 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2416 2904 gene locus_tag LOCUS_12580 2416 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2924 3352 gene locus_tag LOCUS_12590 2924 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3349 3720 gene locus_tag LOCUS_12600 3349 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3927 4940 gene locus_tag LOCUS_12610 3927 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence178 3499 128 gene locus_tag LOCUS_12620 gene ileS 3499 128 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_12620 4217 3507 gene locus_tag LOCUS_12630 gene alaXM 4217 3507 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence179 1326 445 gene locus_tag LOCUS_12640 1326 445 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_12640 3015 1330 gene locus_tag LOCUS_12650 3015 1330 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723060.1 protein_id gnl|my_center|LOCUS_12650 3415 3023 gene locus_tag LOCUS_12660 3415 3023 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583499.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence180 417 1205 gene locus_tag LOCUS_12670 417 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1202 2257 gene locus_tag LOCUS_12680 1202 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3453 2698 gene locus_tag LOCUS_12690 3453 2698 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404256.1 protein_id gnl|my_center|LOCUS_12690 4003 3641 gene locus_tag LOCUS_12700 4003 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 5078 4023 gene locus_tag LOCUS_12710 5078 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence181 <1 2737 gene locus_tag LOCUS_12720 <1 2737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256947.1:SpoIIE family protein phosphatase 2734 3513 gene locus_tag LOCUS_12730 2734 3513 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_12730 3482 4909 gene locus_tag LOCUS_12740 3482 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12740 >Feature sequence182 <1 1376 gene locus_tag LOCUS_12750 <1 1376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393945.1:DNA-directed RNA polymerase subunit beta 1833 2258 gene locus_tag LOCUS_12760 gene rpsL 1833 2258 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_12760 2285 2752 gene locus_tag LOCUS_12770 gene rpsG 2285 2752 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258227.1 protein_id gnl|my_center|LOCUS_12770 2788 4869 gene locus_tag LOCUS_12780 gene fusA 2788 4869 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence183 565 885 gene locus_tag LOCUS_12790 565 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1475 774 gene locus_tag LOCUS_12800 1475 774 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_12800 2997 1501 gene locus_tag LOCUS_12810 gene mttB 2997 1501 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_12810 3615 3097 gene locus_tag LOCUS_12820 3615 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4562 3684 gene locus_tag LOCUS_12830 4562 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence184 2 1054 gene locus_tag LOCUS_12840 2 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1174 2274 gene locus_tag LOCUS_12850 1174 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2456 2818 gene locus_tag LOCUS_12860 2456 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 3038 4927 gene locus_tag LOCUS_12870 3038 4927 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228453.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence185 <1 1155 gene locus_tag LOCUS_12880 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979130.1:CoA-acylating methylmalonate-semialdehyde dehydrogenase 1701 2924 gene locus_tag LOCUS_12890 1701 2924 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_12890 3993 2995 gene locus_tag LOCUS_12900 3993 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 4826 4143 gene locus_tag LOCUS_12910 4826 4143 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence186 1018 65 gene locus_tag LOCUS_12920 1018 65 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_12920 4661 1329 gene locus_tag LOCUS_12930 4661 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence187 28 987 gene locus_tag LOCUS_12940 28 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1009 2280 gene locus_tag LOCUS_12950 1009 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence188 <1 980 gene locus_tag LOCUS_12960 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257772.1:amidohydrolase family protein 2037 1096 gene locus_tag LOCUS_12970 2037 1096 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_12970 2544 2233 gene locus_tag LOCUS_12980 2544 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4462 2552 gene locus_tag LOCUS_12990 4462 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence189 423 136 gene locus_tag LOCUS_13000 423 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 803 528 gene locus_tag LOCUS_13010 803 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 956 2173 gene locus_tag LOCUS_13020 956 2173 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_13020 2164 3813 gene locus_tag LOCUS_13030 gene pckA 2164 3813 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence190 1362 64 gene locus_tag LOCUS_13040 1362 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13040 2508 1477 gene locus_tag LOCUS_13050 2508 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 3514 2537 gene locus_tag LOCUS_13060 gene galE 3514 2537 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_13060 <4919 3511 gene locus_tag LOCUS_13070 <4919 3511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257189.1:UvrD-helicase domain-containing protein >Feature sequence191 291 1286 gene locus_tag LOCUS_13080 291 1286 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_13080 1258 1956 gene locus_tag LOCUS_13090 1258 1956 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026199.1 protein_id gnl|my_center|LOCUS_13090 1956 3104 gene locus_tag LOCUS_13100 1956 3104 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256834.1 protein_id gnl|my_center|LOCUS_13100 3926 3183 gene locus_tag LOCUS_13110 3926 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4879 3944 gene locus_tag LOCUS_13120 4879 3944 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258764.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence192 650 231 gene locus_tag LOCUS_13130 650 231 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868242.1 protein_id gnl|my_center|LOCUS_13130 2035 647 gene locus_tag LOCUS_13140 2035 647 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_13140 2235 2032 gene locus_tag LOCUS_13150 2235 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 3620 2232 gene locus_tag LOCUS_13160 3620 2232 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13160 <4887 3833 gene locus_tag LOCUS_13170 <4887 3833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256005.1:1,4-dihydroxy-2-naphthoate polyprenyltransferase >Feature sequence193 989 180 gene locus_tag LOCUS_13180 989 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1792 986 gene locus_tag LOCUS_13190 1792 986 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480376.1 protein_id gnl|my_center|LOCUS_13190 2861 2088 gene locus_tag LOCUS_13200 2861 2088 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_13200 3424 2951 gene locus_tag LOCUS_13210 3424 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 4118 3444 gene locus_tag LOCUS_13220 4118 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4671 4258 gene locus_tag LOCUS_13230 4671 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence194 <1 706 gene locus_tag LOCUS_13240 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804410.1:GNAT family N-acetyltransferase 727 1323 gene locus_tag LOCUS_13250 727 1323 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_13250 2437 1454 gene locus_tag LOCUS_13260 2437 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 3197 4108 gene locus_tag LOCUS_13270 3197 4108 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence195 1236 34 gene locus_tag LOCUS_13280 1236 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2603 1236 gene locus_tag LOCUS_13290 2603 1236 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092177.1 protein_id gnl|my_center|LOCUS_13290 4099 2600 gene locus_tag LOCUS_13300 4099 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 <4871 4261 gene locus_tag LOCUS_13310 <4871 4261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929447.1:tetratricopeptide repeat protein >Feature sequence196 1384 437 gene locus_tag LOCUS_13320 1384 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 2385 1456 gene locus_tag LOCUS_13330 gene rsgA 2385 1456 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_13330 3511 2390 gene locus_tag LOCUS_13340 3511 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13340 4621 3524 gene locus_tag LOCUS_13350 4621 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13350 >Feature sequence197 402 178 gene locus_tag LOCUS_13360 402 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 663 412 gene locus_tag LOCUS_13370 663 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 806 2881 gene locus_tag LOCUS_13380 gene fusA 806 2881 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_13380 2986 3366 gene locus_tag LOCUS_13390 2986 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 4390 3428 gene locus_tag LOCUS_13400 4390 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence198 1729 131 gene locus_tag LOCUS_13410 gene gatA 1729 131 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_13410 2055 1729 gene locus_tag LOCUS_13420 2055 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2300 2665 gene locus_tag LOCUS_13430 2300 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2771 4348 gene locus_tag LOCUS_13440 2771 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence199 771 1 gene locus_tag LOCUS_13450 771 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 918 1775 gene locus_tag LOCUS_13460 918 1775 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_13460 1793 2785 gene locus_tag LOCUS_13470 1793 2785 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence200 <1 1235 gene locus_tag LOCUS_13480 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256820.1:branched-chain amino acid ABC transporter permease 1358 1942 gene locus_tag LOCUS_13490 1358 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1955 3712 gene locus_tag LOCUS_13500 1955 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3824 4606 gene locus_tag LOCUS_13510 3824 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence201 545 880 gene locus_tag LOCUS_13520 545 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13520 877 1878 gene locus_tag LOCUS_13530 877 1878 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_13530 2089 3255 gene locus_tag LOCUS_13540 2089 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 4293 3442 gene locus_tag LOCUS_13550 4293 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence202 1811 663 gene locus_tag LOCUS_13560 1811 663 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_13560 2004 1804 gene locus_tag LOCUS_13570 2004 1804 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909342.1 protein_id gnl|my_center|LOCUS_13570 2122 2745 gene locus_tag LOCUS_13580 2122 2745 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_13580 2771 3721 gene locus_tag LOCUS_13590 2771 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence203 4380 2998 gene locus_tag LOCUS_13600 4380 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13600 >Feature sequence204 571 1401 gene locus_tag LOCUS_13610 571 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13610 1365 2009 gene locus_tag LOCUS_13620 1365 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13620 2311 2087 gene locus_tag LOCUS_13630 2311 2087 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909119.1 protein_id gnl|my_center|LOCUS_13630 3795 2521 gene locus_tag LOCUS_13640 3795 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4328 3792 gene locus_tag LOCUS_13650 4328 3792 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258966.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence205 2452 806 gene locus_tag LOCUS_13660 2452 806 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_13660 2822 4546 gene locus_tag LOCUS_13670 2822 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence206 338 970 gene locus_tag LOCUS_13680 gene upp 338 970 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_13680 2173 1238 gene locus_tag LOCUS_13690 2173 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 2910 2098 gene locus_tag LOCUS_13700 2910 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13700 4288 3161 gene locus_tag LOCUS_13710 4288 3161 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence207 384 1490 gene locus_tag LOCUS_13720 gene ftsZ 384 1490 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_13720 2064 2513 gene locus_tag LOCUS_13730 gene nrdR 2064 2513 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259262.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence208 <1 862 gene locus_tag LOCUS_13740 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037441.1:DUF1684 domain-containing protein 876 1802 gene locus_tag LOCUS_13750 876 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1859 2500 gene locus_tag LOCUS_13760 1859 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2771 3364 gene locus_tag LOCUS_13770 2771 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 <4550 3365 gene locus_tag LOCUS_13780 <4550 3365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259717.1:HAMP domain-containing sensor histidine kinase >Feature sequence209 1411 44 gene locus_tag LOCUS_13790 1411 44 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288870.1 protein_id gnl|my_center|LOCUS_13790 1759 2481 gene locus_tag LOCUS_13800 1759 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2642 3688 gene locus_tag LOCUS_13810 gene nirK 2642 3688 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257443.1 protein_id gnl|my_center|LOCUS_13810 3819 4196 gene locus_tag LOCUS_13820 3819 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence210 72 740 gene locus_tag LOCUS_13830 72 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 737 1687 gene locus_tag LOCUS_13840 737 1687 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255957.1 protein_id gnl|my_center|LOCUS_13840 1821 2000 gene locus_tag LOCUS_13850 1821 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 3315 2110 gene locus_tag LOCUS_13860 3315 2110 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence211 158 487 gene locus_tag LOCUS_13870 158 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 510 1109 gene locus_tag LOCUS_13880 510 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1208 3178 gene locus_tag LOCUS_13890 1208 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence212 2 298 gene locus_tag LOCUS_13900 2 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 625 2916 gene locus_tag LOCUS_13910 625 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2942 3820 gene locus_tag LOCUS_13920 2942 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence213 178 684 gene locus_tag LOCUS_13930 178 684 CDS product hydrogenase 3 maturation endopeptidase HyCI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388075.1 protein_id gnl|my_center|LOCUS_13930 701 1105 gene locus_tag LOCUS_13940 701 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1205 3187 gene locus_tag LOCUS_13950 1205 3187 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941439.1 protein_id gnl|my_center|LOCUS_13950 3195 4367 gene locus_tag LOCUS_13960 3195 4367 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence214 2529 2113 gene locus_tag LOCUS_13970 2529 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 2878 2546 gene locus_tag LOCUS_13980 2878 2546 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257824.1 protein_id gnl|my_center|LOCUS_13980 3868 2897 gene locus_tag LOCUS_13990 3868 2897 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094763.1 protein_id gnl|my_center|LOCUS_13990 <4500 3840 gene locus_tag LOCUS_14000 <4500 3840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259435.1:TatD family hydrolase >Feature sequence215 500 940 gene locus_tag LOCUS_14010 500 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3570 1108 gene locus_tag LOCUS_14020 3570 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 <4494 3683 gene locus_tag LOCUS_14030 <4494 3683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940687.1:ATP-binding protein >Feature sequence216 1778 474 gene locus_tag LOCUS_14040 1778 474 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_14040 2211 1780 gene locus_tag LOCUS_14050 2211 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14050 2510 2217 gene locus_tag LOCUS_14060 2510 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14060 3451 2555 gene locus_tag LOCUS_14070 3451 2555 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_14070 <4479 3456 gene locus_tag LOCUS_14080 <4479 3456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546086.1:4Fe-4S dicluster domain-containing protein >Feature sequence217 3124 1565 gene locus_tag LOCUS_14090 3124 1565 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392806.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence218 1630 137 gene locus_tag LOCUS_14100 gene xylB 1630 137 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_14100 2524 1637 gene locus_tag LOCUS_14110 2524 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_14110 3720 2551 gene locus_tag LOCUS_14120 gene xylA 3720 2551 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_14120 <4472 3777 gene locus_tag LOCUS_14130 <4472 3777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583217.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence219 913 251 gene locus_tag LOCUS_14140 913 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1683 910 gene locus_tag LOCUS_14150 1683 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3031 1859 gene locus_tag LOCUS_14160 3031 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038521.1 protein_id gnl|my_center|LOCUS_14160 3094 3765 gene locus_tag LOCUS_14170 3094 3765 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_14170 4371 3826 gene locus_tag LOCUS_14180 4371 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence220 1402 413 gene locus_tag LOCUS_14190 gene trpS 1402 413 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_14190 1827 2054 gene locus_tag LOCUS_14200 1827 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 4416 2410 gene locus_tag LOCUS_14210 4416 2410 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257484.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence221 1308 244 gene locus_tag LOCUS_14220 1308 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2281 1295 gene locus_tag LOCUS_14230 2281 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 3096 2278 gene locus_tag LOCUS_14240 3096 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3444 3692 gene locus_tag LOCUS_14250 3444 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 3703 4296 gene locus_tag LOCUS_14260 3703 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence222 <1 1903 gene locus_tag LOCUS_14270 <1 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017124.1:AAA family ATPase 2218 2514 gene locus_tag LOCUS_14280 2218 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2511 3008 gene locus_tag LOCUS_14290 2511 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence223 417 1754 gene locus_tag LOCUS_14300 gene rpsA 417 1754 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence224 1312 449 gene locus_tag LOCUS_14310 1312 449 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_14310 1752 1576 gene locus_tag LOCUS_14320 1752 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2492 1761 gene locus_tag LOCUS_14330 2492 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 4304 2511 gene locus_tag LOCUS_14340 4304 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14340 >Feature sequence225 389 96 gene locus_tag LOCUS_14350 389 96 CDS product DUF5519 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010317.1 protein_id gnl|my_center|LOCUS_14350 1052 450 gene locus_tag LOCUS_14360 1052 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1960 1049 gene locus_tag LOCUS_14370 1960 1049 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143730.1 protein_id gnl|my_center|LOCUS_14370 2894 2286 gene locus_tag LOCUS_14380 2894 2286 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037326.1 protein_id gnl|my_center|LOCUS_14380 4296 2989 gene locus_tag LOCUS_14390 4296 2989 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence226 527 1786 gene locus_tag LOCUS_14400 527 1786 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_14400 1825 3210 gene locus_tag LOCUS_14410 gene argH 1825 3210 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259187.1 protein_id gnl|my_center|LOCUS_14410 3207 3377 gene locus_tag LOCUS_14420 gene lysW 3207 3377 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_14420 3448 4314 gene locus_tag LOCUS_14430 gene lysX 3448 4314 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence227 66 620 gene locus_tag LOCUS_14440 66 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 617 1564 gene locus_tag LOCUS_14450 617 1564 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942637.1 protein_id gnl|my_center|LOCUS_14450 1897 2388 gene locus_tag LOCUS_14460 1897 2388 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_14460 2391 2981 gene locus_tag LOCUS_14470 2391 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 3013 4317 gene locus_tag LOCUS_14480 3013 4317 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence228 1178 336 gene locus_tag LOCUS_14490 gene lgt 1178 336 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_14490 1858 1217 gene locus_tag LOCUS_14500 1858 1217 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057532.1 protein_id gnl|my_center|LOCUS_14500 4152 1924 gene locus_tag LOCUS_14510 4152 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence229 236 2887 gene locus_tag LOCUS_14520 236 2887 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938942.1 protein_id gnl|my_center|LOCUS_14520 2887 3402 gene locus_tag LOCUS_14530 2887 3402 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032714.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence230 705 277 gene locus_tag LOCUS_14540 705 277 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268622.1 protein_id gnl|my_center|LOCUS_14540 803 2218 gene locus_tag LOCUS_14550 803 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2215 2835 gene locus_tag LOCUS_14560 2215 2835 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257526.1 protein_id gnl|my_center|LOCUS_14560 2855 3382 gene locus_tag LOCUS_14570 2855 3382 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_14570 3274 4137 gene locus_tag LOCUS_14580 3274 4137 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence231 1413 1012 gene locus_tag LOCUS_14590 1413 1012 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_14590 1464 2081 gene locus_tag LOCUS_14600 1464 2081 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_14600 2078 2845 gene locus_tag LOCUS_14610 2078 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3091 3990 gene locus_tag LOCUS_14620 3091 3990 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847017.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence232 1902 676 gene locus_tag LOCUS_14630 1902 676 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_14630 2221 2036 gene locus_tag LOCUS_14640 2221 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 3103 2465 gene locus_tag LOCUS_14650 3103 2465 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 protein_id gnl|my_center|LOCUS_14650 3813 3100 gene locus_tag LOCUS_14660 3813 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence233 3035 1200 gene locus_tag LOCUS_14670 3035 1200 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257644.1 protein_id gnl|my_center|LOCUS_14670 <4314 3032 gene locus_tag LOCUS_14680 <4314 3032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257645.1:ABC transporter ATP-binding protein >Feature sequence234 1420 608 gene locus_tag LOCUS_14690 1420 608 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258763.1 protein_id gnl|my_center|LOCUS_14690 2094 1417 gene locus_tag LOCUS_14700 2094 1417 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356430.1 protein_id gnl|my_center|LOCUS_14700 3041 2103 gene locus_tag LOCUS_14710 3041 2103 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence235 1294 137 gene locus_tag LOCUS_14720 1294 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2410 1724 gene locus_tag LOCUS_14730 2410 1724 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_14730 3108 2407 gene locus_tag LOCUS_14740 gene phoU 3108 2407 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_14740 3924 3139 gene locus_tag LOCUS_14750 gene pstB 3924 3139 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence236 1314 829 gene locus_tag LOCUS_14760 1314 829 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921412.1 protein_id gnl|my_center|LOCUS_14760 2161 1253 gene locus_tag LOCUS_14770 2161 1253 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531167.1 protein_id gnl|my_center|LOCUS_14770 3147 2167 gene locus_tag LOCUS_14780 3147 2167 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530674.1 protein_id gnl|my_center|LOCUS_14780 3654 3154 gene locus_tag LOCUS_14790 3654 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4150 3851 gene locus_tag LOCUS_14800 4150 3851 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173512816.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence237 2069 1083 gene locus_tag LOCUS_14810 2069 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2573 4033 gene locus_tag LOCUS_14820 2573 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence238 353 937 gene locus_tag LOCUS_14830 353 937 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 protein_id gnl|my_center|LOCUS_14830 1067 1882 gene locus_tag LOCUS_14840 1067 1882 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225865.1 protein_id gnl|my_center|LOCUS_14840 2112 2441 gene locus_tag LOCUS_14850 2112 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3080 2583 gene locus_tag LOCUS_14860 3080 2583 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719580.1 protein_id gnl|my_center|LOCUS_14860 3481 4125 gene locus_tag LOCUS_14870 3481 4125 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495802.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence239 509 291 gene locus_tag LOCUS_14880 509 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2455 548 gene locus_tag LOCUS_14890 2455 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2777 2448 gene locus_tag LOCUS_14900 2777 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3713 2916 gene locus_tag LOCUS_14910 3713 2916 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence240 221 148 gene locus_tag LOCUS_t00220 221 148 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 399 316 gene locus_tag LOCUS_t00230 399 316 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 545 472 gene locus_tag LOCUS_t00240 545 472 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1441 611 gene locus_tag LOCUS_14920 gene rlmB 1441 611 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_14920 2835 1438 gene locus_tag LOCUS_14930 gene cysS 2835 1438 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257711.1 protein_id gnl|my_center|LOCUS_14930 3895 2846 gene locus_tag LOCUS_14940 3895 2846 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence241 <1 850 gene locus_tag LOCUS_14950 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393025.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD 1002 2381 gene locus_tag LOCUS_14960 1002 2381 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence242 288 1877 gene locus_tag LOCUS_14970 288 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2279 2932 gene locus_tag LOCUS_14980 2279 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 3937 3317 gene locus_tag LOCUS_14990 3937 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence243 1813 992 gene locus_tag LOCUS_15000 1813 992 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_15000 2164 2979 gene locus_tag LOCUS_15010 2164 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 3245 3811 gene locus_tag LOCUS_15020 3245 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence244 1 243 gene locus_tag LOCUS_15030 1 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 334 408 gene locus_tag LOCUS_t00250 334 408 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2551 605 gene locus_tag LOCUS_15040 2551 605 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082373898.1 protein_id gnl|my_center|LOCUS_15040 3215 3616 gene locus_tag LOCUS_15050 3215 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393488.1 protein_id gnl|my_center|LOCUS_15050 3617 4120 gene locus_tag LOCUS_15060 3617 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence245 3800 2271 gene locus_tag LOCUS_15070 3800 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15070 >Feature sequence246 1321 152 gene locus_tag LOCUS_15080 1321 152 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971276.1 protein_id gnl|my_center|LOCUS_15080 2251 1397 gene locus_tag LOCUS_15090 2251 1397 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_15090 2733 2248 gene locus_tag LOCUS_15100 2733 2248 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_15100 3653 2772 gene locus_tag LOCUS_15110 3653 2772 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence247 2242 980 gene locus_tag LOCUS_15120 2242 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2446 3447 gene locus_tag LOCUS_15130 2446 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3451 3948 gene locus_tag LOCUS_15140 3451 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence248 891 118 gene locus_tag LOCUS_15150 891 118 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15150 1326 2732 gene locus_tag LOCUS_15160 1326 2732 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421588.1 protein_id gnl|my_center|LOCUS_15160 2919 3761 gene locus_tag LOCUS_15170 gene sbnI 2919 3761 CDS product bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015549.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence249 2731 1007 gene locus_tag LOCUS_15180 gene recN 2731 1007 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_15180 3273 2740 gene locus_tag LOCUS_15190 3273 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3473 3270 gene locus_tag LOCUS_15200 3473 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 4108 3464 gene locus_tag LOCUS_15210 4108 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15210 >Feature sequence250 211 657 gene locus_tag LOCUS_15220 211 657 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114076.1 protein_id gnl|my_center|LOCUS_15220 661 1668 gene locus_tag LOCUS_15230 661 1668 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_15230 2413 1793 gene locus_tag LOCUS_15240 2413 1793 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_15240 2588 3841 gene locus_tag LOCUS_15250 gene obgE 2588 3841 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384537.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence251 3606 3019 gene locus_tag LOCUS_15260 gene pth 3606 3019 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence252 3578 759 gene locus_tag LOCUS_15270 3578 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence253 1554 256 gene locus_tag LOCUS_15280 gene clpX 1554 256 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532190.1 protein_id gnl|my_center|LOCUS_15280 2185 1568 gene locus_tag LOCUS_15290 gene clpP 2185 1568 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938630.1 protein_id gnl|my_center|LOCUS_15290 2916 2182 gene locus_tag LOCUS_15300 2916 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3735 3653 gene locus_tag LOCUS_t00260 3735 3653 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence254 1047 193 gene locus_tag LOCUS_15310 gene panB 1047 193 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_15310 2098 1310 gene locus_tag LOCUS_15320 2098 1310 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_15320 3033 2095 gene locus_tag LOCUS_15330 gene mvk 3033 2095 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_15330 3899 3030 gene locus_tag LOCUS_15340 3899 3030 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence255 <1 3440 gene locus_tag LOCUS_15350 <1 3440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001865532.1:type VII secretion protein EssC >Feature sequence256 1651 680 gene locus_tag LOCUS_15360 1651 680 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_15360 2369 1653 gene locus_tag LOCUS_15370 2369 1653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256708.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence257 756 1856 gene locus_tag LOCUS_15380 756 1856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_15380 2048 2959 gene locus_tag LOCUS_15390 2048 2959 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141403.1 protein_id gnl|my_center|LOCUS_15390 2956 3756 gene locus_tag LOCUS_15400 2956 3756 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141402.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence258 1681 2766 gene locus_tag LOCUS_15410 gene gmd 1681 2766 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546080.1 protein_id gnl|my_center|LOCUS_15410 2813 3763 gene locus_tag LOCUS_15420 2813 3763 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence259 728 1120 gene locus_tag LOCUS_15430 gene gcvH 728 1120 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_15430 1120 2463 gene locus_tag LOCUS_15440 gene gcvPA 1120 2463 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909428.1 protein_id gnl|my_center|LOCUS_15440 2456 3931 gene locus_tag LOCUS_15450 gene gcvPB 2456 3931 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259338.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence260 251 481 gene locus_tag LOCUS_15460 251 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 507 2186 gene locus_tag LOCUS_15470 507 2186 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_15470 2248 2961 gene locus_tag LOCUS_15480 2248 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15480 3276 3034 gene locus_tag LOCUS_15490 3276 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3753 3298 gene locus_tag LOCUS_15500 3753 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence261 160 768 gene locus_tag LOCUS_15510 160 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 924 1832 gene locus_tag LOCUS_15520 924 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1888 3378 gene locus_tag LOCUS_15530 1888 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 3479 3820 gene locus_tag LOCUS_15540 3479 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence262 649 1197 gene locus_tag LOCUS_15550 649 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1235 2062 gene locus_tag LOCUS_15560 gene mutM 1235 2062 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257743.1 protein_id gnl|my_center|LOCUS_15560 2375 2845 gene locus_tag LOCUS_15570 2375 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 3695 2805 gene locus_tag LOCUS_15580 3695 2805 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence263 660 2381 gene locus_tag LOCUS_15590 660 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2499 3431 gene locus_tag LOCUS_15600 gene lipA 2499 3431 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_15600 3519 3968 gene locus_tag LOCUS_15610 3519 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence264 426 1805 gene locus_tag LOCUS_15620 426 1805 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_15620 2816 2184 gene locus_tag LOCUS_15630 2816 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence265 559 711 gene locus_tag LOCUS_15640 559 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1643 708 gene locus_tag LOCUS_15650 1643 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1723 2931 gene locus_tag LOCUS_15660 gene hemW 1723 2931 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256118.1 protein_id gnl|my_center|LOCUS_15660 2959 3849 gene locus_tag LOCUS_15670 2959 3849 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence266 640 38 gene locus_tag LOCUS_15680 640 38 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_15680 1080 637 gene locus_tag LOCUS_15690 1080 637 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090019.1 protein_id gnl|my_center|LOCUS_15690 1379 2029 gene locus_tag LOCUS_15700 1379 2029 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022229.1 protein_id gnl|my_center|LOCUS_15700 2106 2303 gene locus_tag LOCUS_15710 2106 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2452 2775 gene locus_tag LOCUS_15720 2452 2775 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256234.1 protein_id gnl|my_center|LOCUS_15720 3901 2882 gene locus_tag LOCUS_15730 3901 2882 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence267 <1 892 gene locus_tag LOCUS_15740 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792452.1:selenide, water dikinase SelD 945 1868 gene locus_tag LOCUS_15750 gene mdh 945 1868 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_15750 3135 2002 gene locus_tag LOCUS_15760 3135 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3765 3154 gene locus_tag LOCUS_15770 3765 3154 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence268 2208 565 gene locus_tag LOCUS_15780 2208 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2812 3642 gene locus_tag LOCUS_15790 2812 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence269 2009 351 gene locus_tag LOCUS_15800 gene atpA 2009 351 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933688.1 protein_id gnl|my_center|LOCUS_15800 3032 2187 gene locus_tag LOCUS_15810 gene proC 3032 2187 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_15810 3757 3155 gene locus_tag LOCUS_15820 gene ruvA 3757 3155 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence270 2253 994 gene locus_tag LOCUS_15830 2253 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3425 2319 gene locus_tag LOCUS_15840 3425 2319 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence271 1306 224 gene locus_tag LOCUS_15850 gene prfB 1306 224 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_15850 1558 2127 gene locus_tag LOCUS_15860 1558 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2137 2946 gene locus_tag LOCUS_15870 2137 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3032 3682 gene locus_tag LOCUS_15880 3032 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence272 2682 2609 gene locus_tag LOCUS_t00270 2682 2609 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2759 2686 gene locus_tag LOCUS_t00280 2759 2686 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence273 1034 390 gene locus_tag LOCUS_15890 1034 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1336 1887 gene locus_tag LOCUS_15900 1336 1887 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259317.1 protein_id gnl|my_center|LOCUS_15900 1955 2398 gene locus_tag LOCUS_15910 gene erpA 1955 2398 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255939.1 protein_id gnl|my_center|LOCUS_15910 2457 2843 gene locus_tag LOCUS_15920 2457 2843 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_15920 3631 2978 gene locus_tag LOCUS_15930 3631 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence274 6 182 gene locus_tag LOCUS_15940 6 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 386 1228 gene locus_tag LOCUS_15950 386 1228 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_15950 1319 1762 gene locus_tag LOCUS_15960 1319 1762 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926892.1 protein_id gnl|my_center|LOCUS_15960 1931 2293 gene locus_tag LOCUS_15970 1931 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2304 2984 gene locus_tag LOCUS_15980 2304 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3164 3703 gene locus_tag LOCUS_15990 3164 3703 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence275 <1 934 gene locus_tag LOCUS_16000 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226657.1:sensor histidine kinase 1000 1620 gene locus_tag LOCUS_16010 1000 1620 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_16010 1651 2688 gene locus_tag LOCUS_16020 1651 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2685 3113 gene locus_tag LOCUS_16030 2685 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3654 3277 gene locus_tag LOCUS_16040 3654 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence276 1021 1731 gene locus_tag LOCUS_16050 1021 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1778 2770 gene locus_tag LOCUS_16060 1778 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 3623 2865 gene locus_tag LOCUS_16070 3623 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence277 2241 187 gene locus_tag LOCUS_16080 2241 187 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_16080 3094 2576 gene locus_tag LOCUS_16090 3094 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence278 540 1421 gene locus_tag LOCUS_16100 gene truB 540 1421 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_16100 1449 2516 gene locus_tag LOCUS_16110 1449 2516 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence279 2070 538 gene locus_tag LOCUS_16120 gene zwf 2070 538 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335201.1 protein_id gnl|my_center|LOCUS_16120 2184 3323 gene locus_tag LOCUS_16130 2184 3323 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900904.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence280 359 913 gene locus_tag LOCUS_16140 359 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16140 2341 1043 gene locus_tag LOCUS_16150 2341 1043 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259710.1 protein_id gnl|my_center|LOCUS_16150 2802 2347 gene locus_tag LOCUS_16160 2802 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3123 2875 gene locus_tag LOCUS_16170 3123 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence281 1707 472 gene locus_tag LOCUS_16180 1707 472 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257129.1 protein_id gnl|my_center|LOCUS_16180 2773 1778 gene locus_tag LOCUS_16190 gene gmd 2773 1778 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_16190 <3820 3283 gene locus_tag LOCUS_16200 <3820 3283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081188.1:glycosyltransferase >Feature sequence282 688 440 gene locus_tag LOCUS_16210 688 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2336 720 gene locus_tag LOCUS_16220 gene pruA 2336 720 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234655.1 protein_id gnl|my_center|LOCUS_16220 2470 2940 gene locus_tag LOCUS_16230 2470 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2937 3710 gene locus_tag LOCUS_16240 2937 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence283 210 1958 gene locus_tag LOCUS_16250 210 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2938 1955 gene locus_tag LOCUS_16260 2938 1955 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_16260 <3793 3230 gene locus_tag LOCUS_16270 <3793 3230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393885.1:peptidoglycan bridge formation glycyltransferase FemA/FemB family protein >Feature sequence284 <3787 2072 gene locus_tag LOCUS_16280 <3787 2072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257223.1:DUF2298 domain-containing protein >Feature sequence285 383 186 gene locus_tag LOCUS_16290 383 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 842 393 gene locus_tag LOCUS_16300 842 393 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259432.1 protein_id gnl|my_center|LOCUS_16300 954 1379 gene locus_tag LOCUS_16310 954 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence286 104 1078 gene locus_tag LOCUS_16320 104 1078 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_16320 1075 2439 gene locus_tag LOCUS_16330 1075 2439 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence287 240 19 gene locus_tag LOCUS_16340 240 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 227 655 gene locus_tag LOCUS_16350 227 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1309 827 gene locus_tag LOCUS_16360 1309 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 3273 1306 gene locus_tag LOCUS_16370 gene feoB 3273 1306 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence288 1497 121 gene locus_tag LOCUS_16380 1497 121 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349591.1 protein_id gnl|my_center|LOCUS_16380 1638 2483 gene locus_tag LOCUS_16390 1638 2483 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_16390 2480 2782 gene locus_tag LOCUS_16400 2480 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence289 <1 2864 gene locus_tag LOCUS_16410 <1 2864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392440.1:ATP-dependent DNA helicase RecG 3056 3532 gene locus_tag LOCUS_16420 3056 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence290 965 12 gene locus_tag LOCUS_16430 965 12 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584152.1 protein_id gnl|my_center|LOCUS_16430 2357 1092 gene locus_tag LOCUS_16440 2357 1092 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926040.1 protein_id gnl|my_center|LOCUS_16440 3704 2472 gene locus_tag LOCUS_16450 3704 2472 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence291 1879 77 gene locus_tag LOCUS_16460 gene gatA 1879 77 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_16460 2176 1886 gene locus_tag LOCUS_16470 gene gatC 2176 1886 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_16470 2556 2365 gene locus_tag LOCUS_16480 2556 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence292 1411 581 gene locus_tag LOCUS_16490 1411 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1362 1649 gene locus_tag LOCUS_16500 1362 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 <3688 1686 gene locus_tag LOCUS_16510 <3688 1686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928531.1:endonuclease/exonuclease/phosphatase family protein >Feature sequence293 131 523 gene locus_tag LOCUS_16520 131 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 520 882 gene locus_tag LOCUS_16530 gene tnpB 520 882 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070113393.1 protein_id gnl|my_center|LOCUS_16530 940 1830 gene locus_tag LOCUS_16540 940 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1827 3461 gene locus_tag LOCUS_16550 1827 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence294 1557 664 gene locus_tag LOCUS_16560 1557 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2249 1560 gene locus_tag LOCUS_16570 2249 1560 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719277.1 protein_id gnl|my_center|LOCUS_16570 <3669 2246 gene locus_tag LOCUS_16580 <3669 2246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531166.1:ASKHA domain-containing protein >Feature sequence295 1735 788 gene locus_tag LOCUS_16590 gene ilvA 1735 788 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_16590 2490 1732 gene locus_tag LOCUS_16600 2490 1732 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256704.1 protein_id gnl|my_center|LOCUS_16600 <3669 2620 gene locus_tag LOCUS_16610 <3669 2620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258274.1:AAA family ATPase >Feature sequence296 91 756 gene locus_tag LOCUS_16620 91 756 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211304.1 protein_id gnl|my_center|LOCUS_16620 1609 854 gene locus_tag LOCUS_16630 1609 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 2430 1606 gene locus_tag LOCUS_16640 2430 1606 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226473.1 protein_id gnl|my_center|LOCUS_16640 3548 2427 gene locus_tag LOCUS_16650 gene tgt 3548 2427 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence297 3079 2720 gene locus_tag LOCUS_16660 3079 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence298 1340 1002 gene locus_tag LOCUS_16670 1340 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2180 1758 gene locus_tag LOCUS_16680 2180 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2557 3426 gene locus_tag LOCUS_16690 2557 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence299 86 3 gene locus_tag LOCUS_t00290 86 3 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 177 1205 gene locus_tag LOCUS_16700 gene plsX 177 1205 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_16700 1246 1941 gene locus_tag LOCUS_16710 1246 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 3205 2180 gene locus_tag LOCUS_16720 3205 2180 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence300 332 1384 gene locus_tag LOCUS_16730 332 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1972 1469 gene locus_tag LOCUS_16740 1972 1469 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_16740 <3586 2130 gene locus_tag LOCUS_16750 <3586 2130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254058.1:phosphonate ABC transporter, permease protein PhnE >Feature sequence301 1598 444 gene locus_tag LOCUS_16760 1598 444 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_16760 1704 2066 gene locus_tag LOCUS_16770 1704 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence302 1028 612 gene locus_tag LOCUS_16780 1028 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 945 1172 gene locus_tag LOCUS_16790 945 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1391 2959 gene locus_tag LOCUS_16800 1391 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence303 <1 852 gene locus_tag LOCUS_16810 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460580.1:cytochrome c3 family protein 849 2066 gene locus_tag LOCUS_16820 849 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2217 3422 gene locus_tag LOCUS_16830 2217 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence304 2359 3312 gene locus_tag LOCUS_16840 2359 3312 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_16840 3309 3473 gene locus_tag LOCUS_16850 3309 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence305 3326 123 gene locus_tag LOCUS_16860 3326 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence306 <1 597 gene locus_tag LOCUS_16870 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389693.1:tyrosine recombinase XerC 1628 666 gene locus_tag LOCUS_16880 1628 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3200 1719 gene locus_tag LOCUS_16890 3200 1719 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037688.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence307 665 330 gene locus_tag LOCUS_16900 665 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1145 798 gene locus_tag LOCUS_16910 1145 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3430 1313 gene locus_tag LOCUS_16920 3430 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence308 1626 1012 gene locus_tag LOCUS_16930 1626 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16930 3107 2322 gene locus_tag LOCUS_16940 3107 2322 CDS product aromatic amino acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258653.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence309 556 1461 gene locus_tag LOCUS_16950 556 1461 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256264.1 protein_id gnl|my_center|LOCUS_16950 2819 1533 gene locus_tag LOCUS_16960 2819 1533 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence310 1558 224 gene locus_tag LOCUS_16970 1558 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2706 1555 gene locus_tag LOCUS_16980 2706 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence311 <1 535 gene locus_tag LOCUS_16990 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151612398.1:sugar ABC transporter ATP-binding protein 537 1574 gene locus_tag LOCUS_17000 537 1574 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315915.1 protein_id gnl|my_center|LOCUS_17000 1621 2688 gene locus_tag LOCUS_17010 1621 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence312 687 2546 gene locus_tag LOCUS_17020 gene uvrC 687 2546 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257899.1 protein_id gnl|my_center|LOCUS_17020 2555 2926 gene locus_tag LOCUS_17030 2555 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence313 1502 369 gene locus_tag LOCUS_17040 gene dnaN 1502 369 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_17040 1886 3139 gene locus_tag LOCUS_17050 1886 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 3400 3143 gene locus_tag LOCUS_17060 3400 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence314 1127 543 gene locus_tag LOCUS_17070 1127 543 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392092.1 protein_id gnl|my_center|LOCUS_17070 3214 1010 gene locus_tag LOCUS_17080 3214 1010 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542452.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence315 1402 989 gene locus_tag LOCUS_17090 gene ruvX 1402 989 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_17090 2877 1381 gene locus_tag LOCUS_17100 2877 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 <3474 2906 gene locus_tag LOCUS_17110 <3474 2906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259677.1:alanine--tRNA ligase >Feature sequence316 62 898 gene locus_tag LOCUS_17120 62 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444869.1 protein_id gnl|my_center|LOCUS_17120 895 2193 gene locus_tag LOCUS_17130 895 2193 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946110.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence317 242 730 gene locus_tag LOCUS_17140 242 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1312 734 gene locus_tag LOCUS_17150 1312 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1539 1321 gene locus_tag LOCUS_17160 1539 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 <3460 1820 gene locus_tag LOCUS_17170 <3460 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256943.1:VanW family protein >Feature sequence318 <1 625 gene locus_tag LOCUS_17180 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921669.1:SDR family oxidoreductase 589 2511 gene locus_tag LOCUS_17190 589 2511 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_17190 2787 3047 gene locus_tag LOCUS_17200 2787 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence319 >Feature sequence320 1499 2158 gene locus_tag LOCUS_17210 1499 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 2198 2764 gene locus_tag LOCUS_17220 2198 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence321 1217 1513 gene locus_tag LOCUS_17230 gene groES 1217 1513 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817319.1 protein_id gnl|my_center|LOCUS_17230 1565 3196 gene locus_tag LOCUS_17240 gene groL 1565 3196 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence322 970 170 gene locus_tag LOCUS_17250 970 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 <3404 967 gene locus_tag LOCUS_17260 <3404 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089497.1:bifunctional transaldolase/phosoglucose isomerase >Feature sequence323 450 2297 gene locus_tag LOCUS_17270 450 2297 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_17270 2660 3277 gene locus_tag LOCUS_17280 2660 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence324 118 651 gene locus_tag LOCUS_17290 118 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022298.1 protein_id gnl|my_center|LOCUS_17290 1696 728 gene locus_tag LOCUS_17300 1696 728 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259441.1 protein_id gnl|my_center|LOCUS_17300 2689 1751 gene locus_tag LOCUS_17310 gene meaB 2689 1751 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_17310 3107 2700 gene locus_tag LOCUS_17320 3107 2700 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence325 2602 1454 gene locus_tag LOCUS_17330 2602 1454 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence326 2911 1787 gene locus_tag LOCUS_17340 2911 1787 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence327 1128 565 gene locus_tag LOCUS_17350 1128 565 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199702189.1 protein_id gnl|my_center|LOCUS_17350 1621 1211 gene locus_tag LOCUS_17360 1621 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1814 1739 gene locus_tag LOCUS_t00300 1814 1739 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence328 2169 61 gene locus_tag LOCUS_17370 2169 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2831 2172 gene locus_tag LOCUS_17380 gene qcrB 2831 2172 CDS product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932700.1 protein_id gnl|my_center|LOCUS_17380 3336 2833 gene locus_tag LOCUS_17390 gene qcrA 3336 2833 CDS product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290423.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence329 1982 141 gene locus_tag LOCUS_17400 1982 141 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_17400 <3361 2011 gene locus_tag LOCUS_17410 <3361 2011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222688.1:GMC family oxidoreductase >Feature sequence330 1614 427 gene locus_tag LOCUS_17420 1614 427 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_17420 <3361 2195 gene locus_tag LOCUS_17430 <3361 2195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272544.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein >Feature sequence331 2210 393 gene locus_tag LOCUS_17440 2210 393 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776491.1 protein_id gnl|my_center|LOCUS_17440 <3350 2718 gene locus_tag LOCUS_17450 <3350 2718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256713.1:biotin/lipoyl-binding protein >Feature sequence332 92 1984 gene locus_tag LOCUS_17460 92 1984 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_17460 2034 3215 gene locus_tag LOCUS_17470 2034 3215 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence333 210 701 gene locus_tag LOCUS_17480 210 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 698 1762 gene locus_tag LOCUS_17490 698 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17490 1911 2207 gene locus_tag LOCUS_17500 1911 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17500 2407 3003 gene locus_tag LOCUS_17510 2407 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence334 278 1294 gene locus_tag LOCUS_17520 278 1294 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence335 344 2518 gene locus_tag LOCUS_17530 344 2518 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence336 1479 49 gene locus_tag LOCUS_17540 1479 49 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_17540 2018 2308 gene locus_tag LOCUS_17550 gene rpsF 2018 2308 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_17550 2332 2712 gene locus_tag LOCUS_17560 2332 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2752 3042 gene locus_tag LOCUS_17570 2752 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence337 <1 2900 gene locus_tag LOCUS_17580 <1 2900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945982.1:DUF2309 domain-containing protein >Feature sequence338 2232 313 gene locus_tag LOCUS_17590 2232 313 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257267.1 protein_id gnl|my_center|LOCUS_17590 <3292 2258 gene locus_tag LOCUS_17600 <3292 2258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator >Feature sequence339 1850 810 gene locus_tag LOCUS_17610 gene tdh 1850 810 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228031.1 protein_id gnl|my_center|LOCUS_17610 1979 2938 gene locus_tag LOCUS_17620 1979 2938 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888945.1 protein_id gnl|my_center|LOCUS_17620 2556 2628 gene locus_tag LOCUS_t00310 2556 2628 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence340 1 615 gene locus_tag LOCUS_17630 1 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 655 1851 gene locus_tag LOCUS_17640 655 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence341 244 1143 gene locus_tag LOCUS_17650 244 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173196.1 protein_id gnl|my_center|LOCUS_17650 1140 1529 gene locus_tag LOCUS_17660 1140 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1647 2426 gene locus_tag LOCUS_17670 1647 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2426 2905 gene locus_tag LOCUS_17680 2426 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence342 569 1630 gene locus_tag LOCUS_17690 569 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1780 2910 gene locus_tag LOCUS_17700 1780 2910 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence343 329 1663 gene locus_tag LOCUS_17710 gene glnA 329 1663 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_17710 2494 1784 gene locus_tag LOCUS_17720 2494 1784 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_17720 2927 2517 gene locus_tag LOCUS_17730 gene queF 2927 2517 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218613.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence344 >Feature sequence345 1340 393 gene locus_tag LOCUS_17740 1340 393 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088664.1 protein_id gnl|my_center|LOCUS_17740 1479 1404 gene locus_tag LOCUS_t00320 1479 1404 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2694 1558 gene locus_tag LOCUS_17750 2694 1558 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence346 2745 181 gene locus_tag LOCUS_17760 gene ligD 2745 181 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958551.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence347 1101 2405 gene locus_tag LOCUS_17770 gene eno 1101 2405 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_17770 2928 2440 gene locus_tag LOCUS_17780 2928 2440 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258099.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence348 137 721 gene locus_tag LOCUS_17790 137 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 740 1072 gene locus_tag LOCUS_17800 740 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1101 2087 gene locus_tag LOCUS_17810 gene corA 1101 2087 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821727.1 protein_id gnl|my_center|LOCUS_17810 2422 3135 gene locus_tag LOCUS_17820 2422 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence349 <1 638 gene locus_tag LOCUS_17830 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189567672.1:arylsulfatase 3120 895 gene locus_tag LOCUS_17840 3120 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17840 >Feature sequence350 <1 1042 gene locus_tag LOCUS_17850 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966270.1:G5 and 3D domain-containing protein 1027 2421 gene locus_tag LOCUS_17860 1027 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 <3214 2432 gene locus_tag LOCUS_17870 <3214 2432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101302.1:sugar transferase >Feature sequence351 1409 573 gene locus_tag LOCUS_17880 gene pstB 1409 573 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_17880 2638 1412 gene locus_tag LOCUS_17890 2638 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 <3211 2635 gene locus_tag LOCUS_17900 <3211 2635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256174.1:phosphate ABC transporter permease subunit PstC >Feature sequence352 1 723 gene locus_tag LOCUS_17910 1 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 809 1453 gene locus_tag LOCUS_17920 809 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17920 1414 2640 gene locus_tag LOCUS_17930 1414 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17930 >Feature sequence353 237 2327 gene locus_tag LOCUS_17940 237 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 >Feature sequence354 838 182 gene locus_tag LOCUS_17950 838 182 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_17950 2802 835 gene locus_tag LOCUS_17960 2802 835 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence355 <1 697 gene locus_tag LOCUS_17970 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258088.1:SpoIIE family protein phosphatase >Feature sequence356 627 385 gene locus_tag LOCUS_17980 627 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1504 641 gene locus_tag LOCUS_17990 1504 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2063 1689 gene locus_tag LOCUS_18000 2063 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2702 2079 gene locus_tag LOCUS_18010 gene folE 2702 2079 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258500.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence357 324 28 gene locus_tag LOCUS_18020 324 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1638 406 gene locus_tag LOCUS_18030 1638 406 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_18030 <3173 1532 gene locus_tag LOCUS_18040 <3173 1532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257846.1:NADH-quinone oxidoreductase subunit M >Feature sequence358 <1 647 gene locus_tag LOCUS_18050 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393490.1:heavy metal translocating P-type ATPase note possible pseudo, frameshifted 787 987 gene locus_tag LOCUS_18060 787 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1071 1745 gene locus_tag LOCUS_18070 1071 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1742 3109 gene locus_tag LOCUS_18080 1742 3109 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947654.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence359 2029 2475 gene locus_tag LOCUS_18090 2029 2475 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111846.1 protein_id gnl|my_center|LOCUS_18090 2550 2759 gene locus_tag LOCUS_18100 2550 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence360 696 1751 gene locus_tag LOCUS_18110 696 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence361 >Feature sequence362 797 1876 gene locus_tag LOCUS_18120 797 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1800 2297 gene locus_tag LOCUS_18130 1800 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2257 3036 gene locus_tag LOCUS_18140 gene istB 2257 3036 CDS product IS21-like element ISPsy4 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005741073.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence363 211 1053 gene locus_tag LOCUS_18150 211 1053 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_18150 1169 2968 gene locus_tag LOCUS_18160 gene lepA 1169 2968 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence364 <3143 2518 gene locus_tag LOCUS_18170 <3143 2518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969739.1:transketolase C-terminal domain-containing protein >Feature sequence365 227 517 gene locus_tag LOCUS_18180 227 517 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404796.1 protein_id gnl|my_center|LOCUS_18180 2131 557 gene locus_tag LOCUS_18190 2131 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2870 2139 gene locus_tag LOCUS_18200 gene radC 2870 2139 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence366 76 723 gene locus_tag LOCUS_18210 76 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 735 1499 gene locus_tag LOCUS_18220 735 1499 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_18220 2017 1631 gene locus_tag LOCUS_18230 2017 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence367 1 825 gene locus_tag LOCUS_18240 1 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 837 1328 gene locus_tag LOCUS_18250 837 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2627 1521 gene locus_tag LOCUS_18260 2627 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence368 2239 1502 gene locus_tag LOCUS_18270 2239 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2879 2250 gene locus_tag LOCUS_18280 2879 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18280 >Feature sequence369 872 315 gene locus_tag LOCUS_18290 872 315 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_18290 1650 877 gene locus_tag LOCUS_18300 1650 877 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_18300 2726 1647 gene locus_tag LOCUS_18310 2726 1647 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_18310 2982 2737 gene locus_tag LOCUS_18320 2982 2737 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence370 288 1544 gene locus_tag LOCUS_18330 288 1544 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229645.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence371 321 1715 gene locus_tag LOCUS_18340 321 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1744 2985 gene locus_tag LOCUS_18350 1744 2985 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence372 38 850 gene locus_tag LOCUS_18360 38 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2369 1071 gene locus_tag LOCUS_18370 gene rpoD 2369 1071 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258920.1 protein_id gnl|my_center|LOCUS_18370 3015 2461 gene locus_tag LOCUS_18380 3015 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence373 1752 982 gene locus_tag LOCUS_18390 1752 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2704 1742 gene locus_tag LOCUS_18400 2704 1742 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence374 171 1 gene locus_tag LOCUS_18410 171 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence375 243 614 gene locus_tag LOCUS_18420 243 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 812 1540 gene locus_tag LOCUS_18430 812 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1563 2246 gene locus_tag LOCUS_18440 1563 2246 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088543.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence376 1901 633 gene locus_tag LOCUS_18450 1901 633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257464.1 protein_id gnl|my_center|LOCUS_18450 2316 1918 gene locus_tag LOCUS_18460 2316 1918 CDS product TIGR03667 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230693.1 protein_id gnl|my_center|LOCUS_18460 2795 2382 gene locus_tag LOCUS_18470 2795 2382 CDS product TIGR03667 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230693.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence377 1026 2213 gene locus_tag LOCUS_18480 1026 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2576 2956 gene locus_tag LOCUS_18490 2576 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence378 <1 505 gene locus_tag LOCUS_18500 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259312.1:glycosyltransferase family 4 protein 502 1284 gene locus_tag LOCUS_18510 502 1284 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259313.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence379 2410 860 gene locus_tag LOCUS_18520 2410 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2565 2407 gene locus_tag LOCUS_18530 2565 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence380 287 1735 gene locus_tag LOCUS_18540 gene gatB 287 1735 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_18540 1746 2645 gene locus_tag LOCUS_18550 1746 2645 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257171.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence381 16 549 gene locus_tag LOCUS_18560 16 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 737 3001 gene locus_tag LOCUS_18570 737 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence382 1458 196 gene locus_tag LOCUS_18580 1458 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1891 2568 gene locus_tag LOCUS_18590 gene rpe 1891 2568 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_18590 2819 2640 gene locus_tag LOCUS_18600 2819 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence383 1062 1787 gene locus_tag LOCUS_18610 1062 1787 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258881.1 protein_id gnl|my_center|LOCUS_18610 2826 1975 gene locus_tag LOCUS_18620 2826 1975 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence384 <2991 208 gene locus_tag LOCUS_18630 <2991 208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940774.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence385 1818 583 gene locus_tag LOCUS_18640 1818 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2846 1914 gene locus_tag LOCUS_18650 2846 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence386 262 110 gene locus_tag LOCUS_18660 262 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1468 263 gene locus_tag LOCUS_18670 gene ssnA 1468 263 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_18670 <2979 1468 gene locus_tag LOCUS_18680 <2979 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223814.1:xanthine dehydrogenase subunit D >Feature sequence387 880 521 gene locus_tag LOCUS_18690 gene rplV 880 521 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_18690 1190 882 gene locus_tag LOCUS_18700 gene rpsS 1190 882 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_18700 2061 1219 gene locus_tag LOCUS_18710 gene rplB 2061 1219 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258234.1 protein_id gnl|my_center|LOCUS_18710 2363 2061 gene locus_tag LOCUS_18720 gene rplW 2363 2061 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879929.1 protein_id gnl|my_center|LOCUS_18720 <2975 2360 gene locus_tag LOCUS_18730 <2975 2360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869927.1:50S ribosomal protein L4 >Feature sequence388 <1 702 gene locus_tag LOCUS_18740 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257461.1:ABC transporter ATP-binding protein 699 2141 gene locus_tag LOCUS_18750 699 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2146 2901 gene locus_tag LOCUS_18760 2146 2901 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421595.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence389 1382 396 gene locus_tag LOCUS_18770 1382 396 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257563.1 protein_id gnl|my_center|LOCUS_18770 2358 1375 gene locus_tag LOCUS_18780 2358 1375 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257564.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence390 910 485 gene locus_tag LOCUS_18790 910 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1727 927 gene locus_tag LOCUS_18800 1727 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2532 1735 gene locus_tag LOCUS_18810 2532 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence391 >Feature sequence392 1941 379 gene locus_tag LOCUS_18820 gene murJ 1941 379 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258283.1 protein_id gnl|my_center|LOCUS_18820 2317 2613 gene locus_tag LOCUS_18830 2317 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence393 808 146 gene locus_tag LOCUS_18840 808 146 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_18840 954 1325 gene locus_tag LOCUS_18850 954 1325 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_18850 1342 1974 gene locus_tag LOCUS_18860 1342 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1997 2746 gene locus_tag LOCUS_18870 1997 2746 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence394 569 1279 gene locus_tag LOCUS_18880 569 1279 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719585.1 protein_id gnl|my_center|LOCUS_18880 1291 1989 gene locus_tag LOCUS_18890 1291 1989 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530175.1 protein_id gnl|my_center|LOCUS_18890 2323 2108 gene locus_tag LOCUS_18900 2323 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2947 2654 gene locus_tag LOCUS_18910 2947 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence395 214 1002 gene locus_tag LOCUS_18920 214 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 999 1301 gene locus_tag LOCUS_18930 999 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1788 2195 gene locus_tag LOCUS_18940 1788 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence396 1284 544 gene locus_tag LOCUS_18950 1284 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18950 1871 2422 gene locus_tag LOCUS_18960 1871 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18960 2349 2717 gene locus_tag LOCUS_18970 2349 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence397 1300 464 gene locus_tag LOCUS_18980 1300 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2683 1322 gene locus_tag LOCUS_18990 2683 1322 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763417.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence398 254 2407 gene locus_tag LOCUS_19000 gene glgP 254 2407 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_19000 2400 2927 gene locus_tag LOCUS_19010 2400 2927 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence399 1155 97 gene locus_tag LOCUS_19020 1155 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2106 1159 gene locus_tag LOCUS_19030 gene fabD 2106 1159 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392463.1 protein_id gnl|my_center|LOCUS_19030 2380 2195 gene locus_tag LOCUS_19040 gene rpmF 2380 2195 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence400 126 410 gene locus_tag LOCUS_19050 126 410 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_19050 1160 441 gene locus_tag LOCUS_19060 1160 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence401 1980 583 gene locus_tag LOCUS_19070 1980 583 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_19070 <2915 1977 gene locus_tag LOCUS_19080 <2915 1977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941112.1:ribonuclease D >Feature sequence402 753 58 gene locus_tag LOCUS_19090 753 58 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_19090 1990 767 gene locus_tag LOCUS_19100 1990 767 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021679.1 protein_id gnl|my_center|LOCUS_19100 <2907 1999 gene locus_tag LOCUS_19110 <2907 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876334.1:ABC transporter permease >Feature sequence403 571 338 gene locus_tag LOCUS_19120 571 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2511 613 gene locus_tag LOCUS_19130 2511 613 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence404 838 281 gene locus_tag LOCUS_19140 838 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2317 893 gene locus_tag LOCUS_19150 2317 893 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546190.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence405 2373 2846 gene locus_tag LOCUS_19160 2373 2846 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence406 107 358 gene locus_tag LOCUS_19170 107 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 2734 383 gene locus_tag LOCUS_19180 2734 383 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256869.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence407 >Feature sequence408 2515 197 gene locus_tag LOCUS_19190 2515 197 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085521.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence409 >Feature sequence410 783 436 gene locus_tag LOCUS_19200 783 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1205 843 gene locus_tag LOCUS_19210 1205 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence411 1023 169 gene locus_tag LOCUS_19220 1023 169 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_19220 2518 1061 gene locus_tag LOCUS_19230 2518 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence412 138 2807 gene locus_tag LOCUS_19240 138 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence413 870 154 gene locus_tag LOCUS_19250 870 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 889 2502 gene locus_tag LOCUS_19260 889 2502 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence414 1344 100 gene locus_tag LOCUS_19270 1344 100 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090946.1 protein_id gnl|my_center|LOCUS_19270 1639 1400 gene locus_tag LOCUS_19280 1639 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2439 1753 gene locus_tag LOCUS_19290 2439 1753 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257704.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence415 <1 2146 gene locus_tag LOCUS_19300 <1 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230735.1:ABC transporter ATP-binding protein 2133 2771 gene locus_tag LOCUS_19310 2133 2771 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence416 150 596 gene locus_tag LOCUS_19320 150 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 593 940 gene locus_tag LOCUS_19330 gene tnpB 593 940 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041414013.1 protein_id gnl|my_center|LOCUS_19330 1027 2622 gene locus_tag LOCUS_19340 1027 2622 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167540391.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence417 243 1448 gene locus_tag LOCUS_19350 243 1448 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_19350 1489 1875 gene locus_tag LOCUS_19360 1489 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 1944 2729 gene locus_tag LOCUS_19370 gene paaG 1944 2729 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence418 1986 883 gene locus_tag LOCUS_19380 1986 883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence419 1224 1721 gene locus_tag LOCUS_19390 1224 1721 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681538.1 protein_id gnl|my_center|LOCUS_19390 <2780 1937 gene locus_tag LOCUS_19400 <2780 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256947.1:SpoIIE family protein phosphatase >Feature sequence420 1578 1405 gene locus_tag LOCUS_19410 1578 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2300 1599 gene locus_tag LOCUS_19420 gene ccsA 2300 1599 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_19420 2775 2437 gene locus_tag LOCUS_19430 2775 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence421 171 980 gene locus_tag LOCUS_19440 171 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 <2765 1008 gene locus_tag LOCUS_19450 <2765 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258209.1:lamin tail domain-containing protein >Feature sequence422 230 670 gene locus_tag LOCUS_19460 230 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 667 1020 gene locus_tag LOCUS_19470 gene tnpB 667 1020 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084591.1 protein_id gnl|my_center|LOCUS_19470 1075 2655 gene locus_tag LOCUS_19480 1075 2655 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122406836.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence423 1491 382 gene locus_tag LOCUS_19490 1491 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2646 1504 gene locus_tag LOCUS_19500 gene dinB 2646 1504 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence424 >Feature sequence425 977 540 gene locus_tag LOCUS_19510 977 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1738 1067 gene locus_tag LOCUS_19520 gene pyrE 1738 1067 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083096.1 protein_id gnl|my_center|LOCUS_19520 2287 1766 gene locus_tag LOCUS_19530 2287 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071244.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence426 1995 535 gene locus_tag LOCUS_19540 gene hemY 1995 535 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_19540 <2732 1992 gene locus_tag LOCUS_19550 <2732 1992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887774.1:ferrochelatase >Feature sequence427 708 361 gene locus_tag LOCUS_19560 gene rplT 708 361 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138362.1 protein_id gnl|my_center|LOCUS_19560 1073 798 gene locus_tag LOCUS_19570 1073 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1570 1091 gene locus_tag LOCUS_19580 gene infC 1570 1091 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_19580 1908 2204 gene locus_tag LOCUS_19590 1908 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence428 1281 187 gene locus_tag LOCUS_19600 gene mutY 1281 187 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_19600 1979 1338 gene locus_tag LOCUS_19610 1979 1338 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258089.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence429 419 805 gene locus_tag LOCUS_19620 419 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19620 832 1227 gene locus_tag LOCUS_19630 832 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1267 2112 gene locus_tag LOCUS_19640 1267 2112 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729048.1 protein_id gnl|my_center|LOCUS_19640 2205 2675 gene locus_tag LOCUS_19650 2205 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence430 <1 539 gene locus_tag LOCUS_19660 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869241.1:peptidoglycan DD-metalloendopeptidase family protein 2122 740 gene locus_tag LOCUS_19670 gene noeA 2122 740 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127582344.1 protein_id gnl|my_center|LOCUS_19670 2312 2112 gene locus_tag LOCUS_19680 2312 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2463 2390 gene locus_tag LOCUS_t00330 2463 2390 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2586 2489 gene locus_tag LOCUS_t00340 2586 2489 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2685 2599 gene locus_tag LOCUS_t00350 2685 2599 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence431 162 1412 gene locus_tag LOCUS_19690 162 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1774 1469 gene locus_tag LOCUS_19700 1774 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence432 15 1235 gene locus_tag LOCUS_19710 15 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 1246 2361 gene locus_tag LOCUS_19720 gene ftsZ 1246 2361 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_19720 2363 2590 gene locus_tag LOCUS_19730 2363 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence433 846 1841 gene locus_tag LOCUS_19740 846 1841 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257087.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence434 757 1500 gene locus_tag LOCUS_19750 757 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2324 1404 gene locus_tag LOCUS_19760 gene rnz 2324 1404 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086661.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence435 1026 262 gene locus_tag LOCUS_19770 1026 262 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_19770 1556 1140 gene locus_tag LOCUS_19780 1556 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 <2688 1834 gene locus_tag LOCUS_19790 <2688 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942141.1:sigma-54 dependent transcriptional regulator >Feature sequence436 1158 127 gene locus_tag LOCUS_19800 gene gap 1158 127 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_19800 2583 1183 gene locus_tag LOCUS_19810 2583 1183 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920957.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence437 <1 1363 gene locus_tag LOCUS_19820 <1 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963042.1:S41 family peptidase 1469 2638 gene locus_tag LOCUS_19830 1469 2638 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence438 >Feature sequence439 267 1028 gene locus_tag LOCUS_19840 267 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1019 2176 gene locus_tag LOCUS_19850 1019 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence440 317 1384 gene locus_tag LOCUS_19860 317 1384 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887604.1 protein_id gnl|my_center|LOCUS_19860 1397 2389 gene locus_tag LOCUS_19870 1397 2389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence441 26 862 gene locus_tag LOCUS_19880 26 862 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256891.1 protein_id gnl|my_center|LOCUS_19880 1090 2448 gene locus_tag LOCUS_19890 1090 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence442 2041 848 gene locus_tag LOCUS_19900 2041 848 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_19900 2477 2052 gene locus_tag LOCUS_19910 gene arfB 2477 2052 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence443 2652 1228 gene locus_tag LOCUS_19920 2652 1228 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941769.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence444 625 870 gene locus_tag LOCUS_19930 625 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 863 1411 gene locus_tag LOCUS_19940 863 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 1412 2092 gene locus_tag LOCUS_19950 1412 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2107 2358 gene locus_tag LOCUS_19960 2107 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence445 206 1021 gene locus_tag LOCUS_19970 206 1021 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256562.1 protein_id gnl|my_center|LOCUS_19970 1227 1709 gene locus_tag LOCUS_19980 1227 1709 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256561.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence446 1 369 gene locus_tag LOCUS_19990 1 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 471 1373 gene locus_tag LOCUS_20000 471 1373 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210221.1 protein_id gnl|my_center|LOCUS_20000 1500 2444 gene locus_tag LOCUS_20010 gene rbsB 1500 2444 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242760.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence447 >Feature sequence448 316 2220 gene locus_tag LOCUS_20020 316 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence449 564 785 gene locus_tag LOCUS_20030 564 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2103 919 gene locus_tag LOCUS_20040 2103 919 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_20040 2372 2100 gene locus_tag LOCUS_20050 2372 2100 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence450 837 235 gene locus_tag LOCUS_20060 837 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20060 1364 834 gene locus_tag LOCUS_20070 1364 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2257 1361 gene locus_tag LOCUS_20080 gene paaA 2257 1361 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence451 947 378 gene locus_tag LOCUS_20090 947 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2071 944 gene locus_tag LOCUS_20100 2071 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence452 <1 985 gene locus_tag LOCUS_20110 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909458.1:aspartate aminotransferase family protein 978 2066 gene locus_tag LOCUS_20120 978 2066 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence453 274 1416 gene locus_tag LOCUS_20130 274 1416 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577656.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence454 1795 182 gene locus_tag LOCUS_20140 1795 182 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_20140 2289 2077 gene locus_tag LOCUS_20150 2289 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence455 1188 2315 gene locus_tag LOCUS_20160 1188 2315 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence456 875 522 gene locus_tag LOCUS_20170 875 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 907 1740 gene locus_tag LOCUS_20180 907 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2212 1742 gene locus_tag LOCUS_20190 2212 1742 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence457 191 772 gene locus_tag LOCUS_20200 191 772 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_20200 769 1809 gene locus_tag LOCUS_20210 769 1809 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence458 1949 627 gene locus_tag LOCUS_20220 1949 627 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_20220 <2501 1986 gene locus_tag LOCUS_20230 <2501 1986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867806.1:arginine--tRNA ligase