>Feature sequence01 1589 1023 gene locus_tag LOCUS_00010 1589 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1850 4240 gene locus_tag LOCUS_00020 1850 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4334 5029 gene locus_tag LOCUS_00030 4334 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5281 6339 gene locus_tag LOCUS_00040 gene recA 5281 6339 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_00040 6659 6486 gene locus_tag LOCUS_00050 6659 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7340 6915 gene locus_tag LOCUS_00060 7340 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9053 7350 gene locus_tag LOCUS_00070 9053 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9516 10940 gene locus_tag LOCUS_00080 9516 10940 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_00080 10942 11622 gene locus_tag LOCUS_00090 10942 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12336 13214 gene locus_tag LOCUS_00100 12336 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15002 13548 gene locus_tag LOCUS_00110 15002 13548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15513 15169 gene locus_tag LOCUS_00120 15513 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15714 15517 gene locus_tag LOCUS_00130 15714 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16688 15741 gene locus_tag LOCUS_00140 16688 15741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16806 16896 gene locus_tag LOCUS_t00010 16806 16896 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17638 16955 gene locus_tag LOCUS_00150 17638 16955 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_00150 18051 17683 gene locus_tag LOCUS_00160 18051 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19156 18110 gene locus_tag LOCUS_00170 gene rodA 19156 18110 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_00170 20194 19301 gene locus_tag LOCUS_00180 20194 19301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20512 22545 gene locus_tag LOCUS_00190 gene gyrB 20512 22545 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_00190 22677 22889 gene locus_tag LOCUS_00200 22677 22889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22894 23622 gene locus_tag LOCUS_00210 22894 23622 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_00210 23765 24547 gene locus_tag LOCUS_00220 23765 24547 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_00220 24607 25416 gene locus_tag LOCUS_00230 24607 25416 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518967.1 protein_id gnl|my_center|LOCUS_00230 25388 26068 gene locus_tag LOCUS_00240 25388 26068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26025 26843 gene locus_tag LOCUS_00250 26025 26843 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_00250 27173 26856 gene locus_tag LOCUS_00260 27173 26856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 27855 27193 gene locus_tag LOCUS_00270 27855 27193 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_00270 28088 28603 gene locus_tag LOCUS_00280 gene nth 28088 28603 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546206.1 protein_id gnl|my_center|LOCUS_00280 28731 29798 gene locus_tag LOCUS_00290 28731 29798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 29821 30801 gene locus_tag LOCUS_00300 29821 30801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 30856 32151 gene locus_tag LOCUS_00310 gene rlmD 30856 32151 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_00310 32217 32690 gene locus_tag LOCUS_00320 32217 32690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 32899 33855 gene locus_tag LOCUS_00330 32899 33855 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_00330 34760 33879 gene locus_tag LOCUS_00340 34760 33879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36287 34920 gene locus_tag LOCUS_00350 36287 34920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36938 37903 gene locus_tag LOCUS_00360 36938 37903 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_00360 37922 39352 gene locus_tag LOCUS_00370 gene ahcY 37922 39352 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_00370 39652 41541 gene locus_tag LOCUS_00380 39652 41541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 43726 41960 gene locus_tag LOCUS_00390 gene thrS 43726 41960 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080983.1 protein_id gnl|my_center|LOCUS_00390 45422 44283 gene locus_tag LOCUS_00400 45422 44283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 47321 45573 gene locus_tag LOCUS_00410 47321 45573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 48457 47462 gene locus_tag LOCUS_00420 48457 47462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 48609 48863 gene locus_tag LOCUS_00430 48609 48863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 49126 49485 gene locus_tag LOCUS_00440 49126 49485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49421 49798 gene locus_tag LOCUS_00450 49421 49798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 49799 50464 gene locus_tag LOCUS_00460 49799 50464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 >Feature sequence02 307 861 gene locus_tag LOCUS_00470 307 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 968 1348 gene locus_tag LOCUS_00480 968 1348 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933912.1 protein_id gnl|my_center|LOCUS_00480 1417 2595 gene locus_tag LOCUS_00490 1417 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 2685 3953 gene locus_tag LOCUS_00500 2685 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 4129 5313 gene locus_tag LOCUS_00510 gene nusA 4129 5313 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_00510 5594 6037 gene locus_tag LOCUS_00520 5594 6037 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545820.1 protein_id gnl|my_center|LOCUS_00520 5995 6327 gene locus_tag LOCUS_00530 5995 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 6562 7122 gene locus_tag LOCUS_00540 6562 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 7238 7672 gene locus_tag LOCUS_00550 7238 7672 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545820.1 protein_id gnl|my_center|LOCUS_00550 7639 7971 gene locus_tag LOCUS_00560 7639 7971 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811823.1 protein_id gnl|my_center|LOCUS_00560 8002 8274 gene locus_tag LOCUS_00570 8002 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 8256 8564 gene locus_tag LOCUS_00580 8256 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 8516 8740 gene locus_tag LOCUS_00590 8516 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 9192 16067 gene locus_tag LOCUS_00600 9192 16067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 16872 18290 gene locus_tag LOCUS_00610 16872 18290 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583255.1 protein_id gnl|my_center|LOCUS_00610 18358 18759 gene locus_tag LOCUS_00620 18358 18759 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_00620 18810 19934 gene locus_tag LOCUS_00630 18810 19934 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_00630 19964 21019 gene locus_tag LOCUS_00640 19964 21019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458925.1 protein_id gnl|my_center|LOCUS_00640 21099 21284 gene locus_tag LOCUS_00650 21099 21284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 21383 22987 gene locus_tag LOCUS_00660 21383 22987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 23024 23875 gene locus_tag LOCUS_00670 23024 23875 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_00670 24035 24556 gene locus_tag LOCUS_00680 24035 24556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 24646 25251 gene locus_tag LOCUS_00690 24646 25251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 25255 26580 gene locus_tag LOCUS_00700 25255 26580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 26577 27698 gene locus_tag LOCUS_00710 26577 27698 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_00710 27896 30400 gene locus_tag LOCUS_00720 27896 30400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 30424 32322 gene locus_tag LOCUS_00730 30424 32322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 32412 32972 gene locus_tag LOCUS_00740 32412 32972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 33375 33303 gene locus_tag LOCUS_t00020 33375 33303 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33574 33501 gene locus_tag LOCUS_t00030 33574 33501 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 34441 34097 gene locus_tag LOCUS_00750 34441 34097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 35209 34448 gene locus_tag LOCUS_00760 gene rnc 35209 34448 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287896.1 protein_id gnl|my_center|LOCUS_00760 35838 35389 gene locus_tag LOCUS_00770 gene nusB 35838 35389 CDS product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830247.1 protein_id gnl|my_center|LOCUS_00770 36142 35927 gene locus_tag LOCUS_00780 gene rpmF 36142 35927 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_00780 36391 37005 gene locus_tag LOCUS_00790 36391 37005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 37255 37527 gene locus_tag LOCUS_00800 37255 37527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 37520 38131 gene locus_tag LOCUS_00810 37520 38131 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140061.1 protein_id gnl|my_center|LOCUS_00810 38159 39424 gene locus_tag LOCUS_00820 38159 39424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 39538 40716 gene locus_tag LOCUS_00830 39538 40716 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence03 2481 199 gene locus_tag LOCUS_00840 gene tkt 2481 199 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858130.1 protein_id gnl|my_center|LOCUS_00840 3958 2522 gene locus_tag LOCUS_00850 3958 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 4138 3977 gene locus_tag LOCUS_00860 4138 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 5640 4609 gene locus_tag LOCUS_00870 gene secF 5640 4609 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_00870 7694 5652 gene locus_tag LOCUS_00880 7694 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 8239 7802 gene locus_tag LOCUS_00890 8239 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 8753 8328 gene locus_tag LOCUS_00900 8753 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 9298 8762 gene locus_tag LOCUS_00910 9298 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 12445 9557 gene locus_tag LOCUS_00920 gene secA 12445 9557 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545108.1 protein_id gnl|my_center|LOCUS_00920 12627 12974 gene locus_tag LOCUS_00930 12627 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 12964 13218 gene locus_tag LOCUS_00940 12964 13218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 13464 13282 gene locus_tag LOCUS_00950 13464 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 13909 13565 gene locus_tag LOCUS_00960 13909 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 14981 14031 gene locus_tag LOCUS_00970 gene murB 14981 14031 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_00970 15132 16403 gene locus_tag LOCUS_00980 15132 16403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 16485 17246 gene locus_tag LOCUS_00990 16485 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 17957 19087 gene locus_tag LOCUS_01000 gene mraY 17957 19087 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_01000 19190 19846 gene locus_tag LOCUS_01010 19190 19846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 19991 21343 gene locus_tag LOCUS_01020 19991 21343 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_01020 21401 21949 gene locus_tag LOCUS_01030 21401 21949 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_01030 21951 22559 gene locus_tag LOCUS_01040 21951 22559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 22732 22804 gene locus_tag LOCUS_t00040 22732 22804 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 23057 22893 gene locus_tag LOCUS_01050 23057 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 23199 24134 gene locus_tag LOCUS_01060 23199 24134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 24938 24210 gene locus_tag LOCUS_01070 24938 24210 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902573.1 protein_id gnl|my_center|LOCUS_01070 25057 26730 gene locus_tag LOCUS_01080 25057 26730 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061250.1 protein_id gnl|my_center|LOCUS_01080 27935 27099 gene locus_tag LOCUS_01090 27935 27099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 28075 28485 gene locus_tag LOCUS_01100 28075 28485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 28482 30092 gene locus_tag LOCUS_01110 28482 30092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 30191 31465 gene locus_tag LOCUS_01120 30191 31465 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880274.1 protein_id gnl|my_center|LOCUS_01120 31583 32815 gene locus_tag LOCUS_01130 31583 32815 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932205.1 protein_id gnl|my_center|LOCUS_01130 33164 32817 gene locus_tag LOCUS_01140 33164 32817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 34276 33212 gene locus_tag LOCUS_01150 34276 33212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 35578 34280 gene locus_tag LOCUS_01160 35578 34280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 37548 35587 gene locus_tag LOCUS_01170 37548 35587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 42030 37558 gene locus_tag LOCUS_01180 42030 37558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 42729 42292 gene locus_tag LOCUS_01190 42729 42292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 44103 42808 gene locus_tag LOCUS_01200 gene asnS 44103 42808 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_01200 >Feature sequence04 2021 4018 gene locus_tag LOCUS_01210 2021 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 4702 4774 gene locus_tag LOCUS_t00050 4702 4774 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5025 5315 gene locus_tag LOCUS_01220 5025 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 6067 5732 gene locus_tag LOCUS_01230 6067 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 6360 6043 gene locus_tag LOCUS_01240 6360 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 6613 6852 gene locus_tag LOCUS_01250 6613 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 6859 7086 gene locus_tag LOCUS_01260 6859 7086 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048105191.1 protein_id gnl|my_center|LOCUS_01260 7803 7168 gene locus_tag LOCUS_01270 7803 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 8239 9402 gene locus_tag LOCUS_01280 8239 9402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 9613 10719 gene locus_tag LOCUS_01290 9613 10719 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_01290 10712 12733 gene locus_tag LOCUS_01300 10712 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 12796 13026 gene locus_tag LOCUS_01310 12796 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01310 12980 13327 gene locus_tag LOCUS_01320 12980 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 14580 13393 gene locus_tag LOCUS_01330 14580 13393 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_01330 14938 15522 gene locus_tag LOCUS_01340 14938 15522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 15527 19735 gene locus_tag LOCUS_01350 15527 19735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 21470 20157 gene locus_tag LOCUS_01360 21470 20157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 21622 23661 gene locus_tag LOCUS_01370 21622 23661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 23878 24783 gene locus_tag LOCUS_01380 23878 24783 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_01380 25046 25705 gene locus_tag LOCUS_01390 25046 25705 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776105.1 protein_id gnl|my_center|LOCUS_01390 25818 26150 gene locus_tag LOCUS_01400 25818 26150 CDS product DUF2304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496980.1 protein_id gnl|my_center|LOCUS_01400 26248 27438 gene locus_tag LOCUS_01410 26248 27438 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879224.1 protein_id gnl|my_center|LOCUS_01410 27608 27913 gene locus_tag LOCUS_01420 27608 27913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 27961 28113 gene locus_tag LOCUS_01430 27961 28113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 28131 29228 gene locus_tag LOCUS_01440 28131 29228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 29477 29875 gene locus_tag LOCUS_01450 29477 29875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 30061 30621 gene locus_tag LOCUS_01460 30061 30621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 31718 30666 gene locus_tag LOCUS_01470 31718 30666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 31951 32985 gene locus_tag LOCUS_01480 31951 32985 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944641.1 protein_id gnl|my_center|LOCUS_01480 33086 34855 gene locus_tag LOCUS_01490 33086 34855 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811672.1 protein_id gnl|my_center|LOCUS_01490 35002 35074 gene locus_tag LOCUS_t00060 35002 35074 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 35171 35245 gene locus_tag LOCUS_t00070 35171 35245 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 35885 35376 gene locus_tag LOCUS_01500 35885 35376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 36501 39176 gene locus_tag LOCUS_01510 gene uvrA 36501 39176 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122979.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence05 34 109 gene locus_tag LOCUS_t00080 34 109 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 781 1854 gene locus_tag LOCUS_01520 781 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 1805 2218 gene locus_tag LOCUS_01530 1805 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 2246 2851 gene locus_tag LOCUS_01540 2246 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 2858 3595 gene locus_tag LOCUS_01550 2858 3595 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228741.1 protein_id gnl|my_center|LOCUS_01550 3905 5068 gene locus_tag LOCUS_01560 3905 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 5097 6605 gene locus_tag LOCUS_01570 5097 6605 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 protein_id gnl|my_center|LOCUS_01570 6861 7601 gene locus_tag LOCUS_01580 6861 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 7657 7824 gene locus_tag LOCUS_01590 7657 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 7914 7987 gene locus_tag LOCUS_t00090 7914 7987 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8151 8801 gene locus_tag LOCUS_01600 8151 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01600 8974 10182 gene locus_tag LOCUS_01610 8974 10182 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875977.1 protein_id gnl|my_center|LOCUS_01610 12171 10216 gene locus_tag LOCUS_01620 12171 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 12448 12164 gene locus_tag LOCUS_01630 12448 12164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 12568 13191 gene locus_tag LOCUS_01640 gene pgsA 12568 13191 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113615.1 protein_id gnl|my_center|LOCUS_01640 13301 14971 gene locus_tag LOCUS_01650 13301 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 15022 15516 gene locus_tag LOCUS_01660 15022 15516 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_01660 15523 15783 gene locus_tag LOCUS_01670 15523 15783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 15875 16411 gene locus_tag LOCUS_01680 15875 16411 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930239.1 protein_id gnl|my_center|LOCUS_01680 16529 17530 gene locus_tag LOCUS_01690 gene rfbB 16529 17530 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_01690 17601 17780 gene locus_tag LOCUS_01700 17601 17780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 17777 17977 gene locus_tag LOCUS_01710 17777 17977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 18011 18889 gene locus_tag LOCUS_01720 18011 18889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 19248 19589 gene locus_tag LOCUS_01730 19248 19589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 19591 20451 gene locus_tag LOCUS_01740 19591 20451 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202149.1 protein_id gnl|my_center|LOCUS_01740 20543 21661 gene locus_tag LOCUS_01750 20543 21661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 21798 22640 gene locus_tag LOCUS_01760 21798 22640 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_01760 22760 23863 gene locus_tag LOCUS_01770 22760 23863 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013568.1 protein_id gnl|my_center|LOCUS_01770 23867 24298 gene locus_tag LOCUS_01780 23867 24298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 24359 25444 gene locus_tag LOCUS_01790 24359 25444 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868292.1 protein_id gnl|my_center|LOCUS_01790 26953 25493 gene locus_tag LOCUS_01800 26953 25493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 26937 28238 gene locus_tag LOCUS_01810 26937 28238 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929956.1 protein_id gnl|my_center|LOCUS_01810 28340 29590 gene locus_tag LOCUS_01820 28340 29590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 29686 30030 gene locus_tag LOCUS_01830 29686 30030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 30889 30041 gene locus_tag LOCUS_01840 gene era 30889 30041 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_01840 31221 31667 gene locus_tag LOCUS_01850 gene rplI 31221 31667 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 protein_id gnl|my_center|LOCUS_01850 31933 32172 gene locus_tag LOCUS_01860 31933 32172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01860 >Feature sequence06 716 630 gene locus_tag LOCUS_t00100 716 630 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1646 1089 gene locus_tag LOCUS_01870 1646 1089 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_01870 1707 2396 gene locus_tag LOCUS_01880 gene uppS 1707 2396 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852565.1 protein_id gnl|my_center|LOCUS_01880 3086 2454 gene locus_tag LOCUS_01890 3086 2454 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_01890 6663 3160 gene locus_tag LOCUS_01900 6663 3160 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783498.1 protein_id gnl|my_center|LOCUS_01900 6889 7938 gene locus_tag LOCUS_01910 gene ruvB 6889 7938 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_01910 8322 8864 gene locus_tag LOCUS_01920 8322 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 8912 9208 gene locus_tag LOCUS_01930 8912 9208 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 protein_id gnl|my_center|LOCUS_01930 10334 9498 gene locus_tag LOCUS_01940 10334 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 10627 11244 gene locus_tag LOCUS_01950 10627 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 11569 11949 gene locus_tag LOCUS_01960 11569 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 12618 12100 gene locus_tag LOCUS_01970 12618 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 13596 12769 gene locus_tag LOCUS_01980 13596 12769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 14710 13607 gene locus_tag LOCUS_01990 gene ychF 14710 13607 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 protein_id gnl|my_center|LOCUS_01990 15408 15043 gene locus_tag LOCUS_02000 15408 15043 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_02000 15995 15492 gene locus_tag LOCUS_02010 15995 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 16554 15997 gene locus_tag LOCUS_02020 16554 15997 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_02020 17616 16648 gene locus_tag LOCUS_02030 17616 16648 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_02030 18485 17679 gene locus_tag LOCUS_02040 18485 17679 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_02040 19444 19121 gene locus_tag LOCUS_02050 19444 19121 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021618.1 protein_id gnl|my_center|LOCUS_02050 20326 20254 gene locus_tag LOCUS_t00110 20326 20254 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21104 20355 gene locus_tag LOCUS_02060 21104 20355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 21474 23477 gene locus_tag LOCUS_02070 21474 23477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 24133 23528 gene locus_tag LOCUS_02080 24133 23528 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_02080 24384 25538 gene locus_tag LOCUS_02090 24384 25538 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_02090 25694 25960 gene locus_tag LOCUS_02100 gene rpsT 25694 25960 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_02100 26018 26527 gene locus_tag LOCUS_02110 26018 26527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 27443 26535 gene locus_tag LOCUS_02120 gene holA 27443 26535 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258281.1 protein_id gnl|my_center|LOCUS_02120 27785 28084 gene locus_tag LOCUS_02130 27785 28084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 28087 29331 gene locus_tag LOCUS_02140 28087 29331 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930303.1 protein_id gnl|my_center|LOCUS_02140 30161 29400 gene locus_tag LOCUS_02150 30161 29400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 31303 30158 gene locus_tag LOCUS_02160 31303 30158 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_02160 31737 32087 gene locus_tag LOCUS_02170 31737 32087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence07 412 137 gene locus_tag LOCUS_02180 412 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 485 3154 gene locus_tag LOCUS_02190 485 3154 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073717.1 protein_id gnl|my_center|LOCUS_02190 3223 3795 gene locus_tag LOCUS_02200 3223 3795 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249858.1 protein_id gnl|my_center|LOCUS_02200 3815 4381 gene locus_tag LOCUS_02210 3815 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 4625 4789 gene locus_tag LOCUS_02220 4625 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 5115 6518 gene locus_tag LOCUS_02230 gene murE 5115 6518 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091880.1 protein_id gnl|my_center|LOCUS_02230 6802 7509 gene locus_tag LOCUS_02240 6802 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 8746 7481 gene locus_tag LOCUS_02250 8746 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 9797 8883 gene locus_tag LOCUS_02260 gene fmt 9797 8883 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546616.1 protein_id gnl|my_center|LOCUS_02260 10032 9805 gene locus_tag LOCUS_02270 10032 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 10466 10089 gene locus_tag LOCUS_02280 10466 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 11215 12216 gene locus_tag LOCUS_02290 11215 12216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 12260 13126 gene locus_tag LOCUS_02300 12260 13126 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379005.1 protein_id gnl|my_center|LOCUS_02300 13116 13763 gene locus_tag LOCUS_02310 13116 13763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 13797 15014 gene locus_tag LOCUS_02320 13797 15014 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_02320 15442 15795 gene locus_tag LOCUS_02330 15442 15795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 15885 16382 gene locus_tag LOCUS_02340 15885 16382 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583048.1 protein_id gnl|my_center|LOCUS_02340 16393 16761 gene locus_tag LOCUS_02350 16393 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 16825 17319 gene locus_tag LOCUS_02360 16825 17319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 17468 17537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17740 18324 gene locus_tag LOCUS_02370 17740 18324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 19565 18867 gene locus_tag LOCUS_02380 19565 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 19628 20014 gene locus_tag LOCUS_02390 19628 20014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 20019 21281 gene locus_tag LOCUS_02400 gene nifS 20019 21281 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_02400 21297 21977 gene locus_tag LOCUS_02410 21297 21977 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933650.1 protein_id gnl|my_center|LOCUS_02410 21964 22269 gene locus_tag LOCUS_02420 21964 22269 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081479.1 protein_id gnl|my_center|LOCUS_02420 22271 22570 gene locus_tag LOCUS_02430 22271 22570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 22631 22927 gene locus_tag LOCUS_02440 22631 22927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 26012 23367 gene locus_tag LOCUS_02450 gene clpB 26012 23367 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_02450 26222 26998 gene locus_tag LOCUS_02460 26222 26998 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583759.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence08 142 1515 gene locus_tag LOCUS_02470 142 1515 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_02470 1717 2145 gene locus_tag LOCUS_02480 gene mraZ 1717 2145 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 protein_id gnl|my_center|LOCUS_02480 2236 3198 gene locus_tag LOCUS_02490 gene rsmH 2236 3198 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_02490 3220 3564 gene locus_tag LOCUS_02500 3220 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 3737 4111 gene locus_tag LOCUS_02510 3737 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 4310 6955 gene locus_tag LOCUS_02520 4310 6955 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_02520 7128 7427 gene locus_tag LOCUS_02530 7128 7427 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_02530 7417 7743 gene locus_tag LOCUS_02540 7417 7743 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_02540 8087 7902 gene locus_tag LOCUS_02550 8087 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 8377 9438 gene locus_tag LOCUS_02560 8377 9438 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_02560 9585 10052 gene locus_tag LOCUS_02570 9585 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 10151 10465 gene locus_tag LOCUS_02580 gene rplU 10151 10465 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583641.1 protein_id gnl|my_center|LOCUS_02580 11231 10632 gene locus_tag LOCUS_02590 gene recR 11231 10632 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_02590 11625 11329 gene locus_tag LOCUS_02600 11625 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 13075 11645 gene locus_tag LOCUS_02610 gene dnaB 13075 11645 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_02610 13340 14662 gene locus_tag LOCUS_02620 13340 14662 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382922.1 protein_id gnl|my_center|LOCUS_02620 14911 16296 gene locus_tag LOCUS_02630 14911 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 16411 17322 gene locus_tag LOCUS_02640 16411 17322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 17319 18329 gene locus_tag LOCUS_02650 17319 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 18333 19532 gene locus_tag LOCUS_02660 18333 19532 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053677.1 protein_id gnl|my_center|LOCUS_02660 20117 21265 gene locus_tag LOCUS_02670 gene metK 20117 21265 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082170.1 protein_id gnl|my_center|LOCUS_02670 21907 22752 gene locus_tag LOCUS_02680 21907 22752 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_02680 22870 23880 gene locus_tag LOCUS_02690 gene gpsA 22870 23880 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161776.1 protein_id gnl|my_center|LOCUS_02690 24261 24500 gene locus_tag LOCUS_02700 24261 24500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 24598 26403 gene locus_tag LOCUS_02710 24598 26403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 >Feature sequence09 2543 2157 gene locus_tag LOCUS_02720 2543 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 2658 4640 gene locus_tag LOCUS_02730 2658 4640 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943902.1 protein_id gnl|my_center|LOCUS_02730 4835 6550 gene locus_tag LOCUS_02740 4835 6550 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582757.1 protein_id gnl|my_center|LOCUS_02740 6747 6819 gene locus_tag LOCUS_t00120 6747 6819 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 7374 8663 gene locus_tag LOCUS_02750 gene tig 7374 8663 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_02750 8788 9021 gene locus_tag LOCUS_02760 8788 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 9905 9654 gene locus_tag LOCUS_02770 9905 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 10341 9961 gene locus_tag LOCUS_02780 gene rnpA 10341 9961 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542420.1 protein_id gnl|my_center|LOCUS_02780 10655 10479 gene locus_tag LOCUS_02790 gene rpmH 10655 10479 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043551668.1 protein_id gnl|my_center|LOCUS_02790 10926 12311 gene locus_tag LOCUS_02800 gene dnaA 10926 12311 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_02800 12594 13721 gene locus_tag LOCUS_02810 gene dnaN 12594 13721 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143222.1 protein_id gnl|my_center|LOCUS_02810 13748 14299 gene locus_tag LOCUS_02820 13748 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 17185 14327 gene locus_tag LOCUS_02830 17185 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 17583 18068 gene locus_tag LOCUS_02840 17583 18068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 18334 18262 gene locus_tag LOCUS_t00130 18334 18262 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 18436 19824 gene locus_tag LOCUS_02850 18436 19824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 21430 19910 gene locus_tag LOCUS_02860 21430 19910 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_02860 22492 21503 gene locus_tag LOCUS_02870 gene rhuM 22492 21503 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957909.1 protein_id gnl|my_center|LOCUS_02870 23443 23039 gene locus_tag LOCUS_02880 23443 23039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 23939 23559 gene locus_tag LOCUS_02890 23939 23559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 >Feature sequence10 407 1099 gene locus_tag LOCUS_02900 gene pyrH 407 1099 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668261.1 protein_id gnl|my_center|LOCUS_02900 2400 1276 gene locus_tag LOCUS_02910 2400 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 3236 2463 gene locus_tag LOCUS_02920 gene rluF 3236 2463 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963354.1 protein_id gnl|my_center|LOCUS_02920 3339 5144 gene locus_tag LOCUS_02930 3339 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 5178 6581 gene locus_tag LOCUS_02940 gene rpoD 5178 6581 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_02940 6723 7469 gene locus_tag LOCUS_02950 6723 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 8193 7606 gene locus_tag LOCUS_02960 gene sodB 8193 7606 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007283.1 protein_id gnl|my_center|LOCUS_02960 8942 8358 gene locus_tag LOCUS_02970 gene ahpC 8942 8358 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810052.1 protein_id gnl|my_center|LOCUS_02970 9116 9934 gene locus_tag LOCUS_02980 9116 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 10086 11252 gene locus_tag LOCUS_02990 10086 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150048584.1 protein_id gnl|my_center|LOCUS_02990 11475 11493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11577 11834 gene locus_tag LOCUS_03000 11577 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 13096 11945 gene locus_tag LOCUS_03010 13096 11945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 15384 13402 gene locus_tag LOCUS_03020 15384 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 15542 15769 gene locus_tag LOCUS_03030 15542 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 16488 16264 gene locus_tag LOCUS_03040 16488 16264 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380890.1 protein_id gnl|my_center|LOCUS_03040 18067 16499 gene locus_tag LOCUS_03050 18067 16499 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024251.1 protein_id gnl|my_center|LOCUS_03050 19594 18152 gene locus_tag LOCUS_03060 gene hyfF 19594 18152 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122519.1 protein_id gnl|my_center|LOCUS_03060 20247 19600 gene locus_tag LOCUS_03070 20247 19600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 21176 20244 gene locus_tag LOCUS_03080 21176 20244 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_03080 22759 21179 gene locus_tag LOCUS_03090 gene hyfB 22759 21179 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03090 23698 23180 gene locus_tag LOCUS_03100 23698 23180 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024252.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence11 1944 493 gene locus_tag LOCUS_03110 1944 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 2111 2617 gene locus_tag LOCUS_03120 2111 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 2716 2788 gene locus_tag LOCUS_t00140 2716 2788 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4139 3540 gene locus_tag LOCUS_03130 gene clpP 4139 3540 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_03130 5194 4217 gene locus_tag LOCUS_03140 5194 4217 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583572.1 protein_id gnl|my_center|LOCUS_03140 5392 8466 gene locus_tag LOCUS_03150 5392 8466 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166660.1 protein_id gnl|my_center|LOCUS_03150 8985 9368 gene locus_tag LOCUS_03160 8985 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 9478 9861 gene locus_tag LOCUS_03170 9478 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 10061 9987 gene locus_tag LOCUS_t00150 10061 9987 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 12247 10625 gene locus_tag LOCUS_03180 12247 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 13449 12523 gene locus_tag LOCUS_03190 13449 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 13763 13461 gene locus_tag LOCUS_03200 13763 13461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 13877 15130 gene locus_tag LOCUS_03210 13877 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 15372 15662 gene locus_tag LOCUS_03220 15372 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 16366 15659 gene locus_tag LOCUS_03230 16366 15659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 16593 16369 gene locus_tag LOCUS_03240 16593 16369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 17309 17233 gene locus_tag LOCUS_t00160 17309 17233 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 17474 18130 gene locus_tag LOCUS_03250 17474 18130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 18151 19473 gene locus_tag LOCUS_03260 gene hisS 18151 19473 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140461.1 protein_id gnl|my_center|LOCUS_03260 19697 19578 gene locus_tag LOCUS_03270 19697 19578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 19862 20107 gene locus_tag LOCUS_03280 19862 20107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 20279 20722 gene locus_tag LOCUS_03290 20279 20722 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_03290 20771 23038 gene locus_tag LOCUS_03300 20771 23038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 >Feature sequence12 <1 1317 gene locus_tag LOCUS_03310 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583463.1:M23 family metallopeptidase 1327 1905 gene locus_tag LOCUS_03320 1327 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 3153 2116 gene locus_tag LOCUS_03330 3153 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4205 3171 gene locus_tag LOCUS_03340 4205 3171 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_03340 5203 4214 gene locus_tag LOCUS_03350 5203 4214 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_03350 6576 5260 gene locus_tag LOCUS_03360 gene rfbE 6576 5260 CDS product GDP-perosamine synthase RfbE/PerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875215.1 protein_id gnl|my_center|LOCUS_03360 8186 6582 gene locus_tag LOCUS_03370 8186 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 8965 8207 gene locus_tag LOCUS_03380 gene estV 8965 8207 CDS product lipase EstV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129409.1 protein_id gnl|my_center|LOCUS_03380 10236 8974 gene locus_tag LOCUS_03390 gene serS 10236 8974 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680220.1 protein_id gnl|my_center|LOCUS_03390 10737 10258 gene locus_tag LOCUS_03400 10737 10258 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230049.1 protein_id gnl|my_center|LOCUS_03400 12053 11016 gene locus_tag LOCUS_03410 12053 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 12412 12050 gene locus_tag LOCUS_03420 12412 12050 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_03420 13975 12497 gene locus_tag LOCUS_03430 gene lysS 13975 12497 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082221.1 protein_id gnl|my_center|LOCUS_03430 14557 14096 gene locus_tag LOCUS_03440 gene greA 14557 14096 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475971.1 protein_id gnl|my_center|LOCUS_03440 16770 14761 gene locus_tag LOCUS_03450 gene mrdA 16770 14761 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_03450 17271 16783 gene locus_tag LOCUS_03460 17271 16783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 18071 17274 gene locus_tag LOCUS_03470 18071 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 19240 18194 gene locus_tag LOCUS_03480 19240 18194 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545439.1 protein_id gnl|my_center|LOCUS_03480 19559 19272 gene locus_tag LOCUS_03490 19559 19272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 19768 19565 gene locus_tag LOCUS_03500 19768 19565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 21079 19802 gene locus_tag LOCUS_03510 21079 19802 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919797.1 protein_id gnl|my_center|LOCUS_03510 21849 21547 gene locus_tag LOCUS_03520 21849 21547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 >Feature sequence13 1610 339 gene locus_tag LOCUS_03530 gene secY 1610 339 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_03530 2205 1765 gene locus_tag LOCUS_03540 gene rplO 2205 1765 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356221.1 protein_id gnl|my_center|LOCUS_03540 2887 2228 gene locus_tag LOCUS_03550 2887 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3993 3454 gene locus_tag LOCUS_03560 gene rplF 3993 3454 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851302.1 protein_id gnl|my_center|LOCUS_03560 4490 4101 gene locus_tag LOCUS_03570 gene rpsH 4490 4101 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583359.1 protein_id gnl|my_center|LOCUS_03570 5261 4737 gene locus_tag LOCUS_03580 gene rplE 5261 4737 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021592.1 protein_id gnl|my_center|LOCUS_03580 5611 5291 gene locus_tag LOCUS_03590 gene rplX 5611 5291 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_03590 6097 5726 gene locus_tag LOCUS_03600 gene rplN 6097 5726 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081816.1 protein_id gnl|my_center|LOCUS_03600 6399 6151 gene locus_tag LOCUS_03610 gene rpsQ 6399 6151 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061104415.1 protein_id gnl|my_center|LOCUS_03610 6621 6424 gene locus_tag LOCUS_03620 6621 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 7276 6866 gene locus_tag LOCUS_03630 gene rplP 7276 6866 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_03630 7979 7296 gene locus_tag LOCUS_03640 gene rpsC 7979 7296 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_03640 8600 8184 gene locus_tag LOCUS_03650 gene rplV 8600 8184 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_03650 8930 8607 gene locus_tag LOCUS_03660 gene rpsS 8930 8607 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_03660 9897 9049 gene locus_tag LOCUS_03670 gene rplB 9897 9049 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_03670 10410 10003 gene locus_tag LOCUS_03680 10410 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 11058 10432 gene locus_tag LOCUS_03690 gene rplD 11058 10432 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_03690 12048 11221 gene locus_tag LOCUS_03700 12048 11221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 13085 12744 gene locus_tag LOCUS_03710 gene rpsJ 13085 12744 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118669.1 protein_id gnl|my_center|LOCUS_03710 14346 13156 gene locus_tag LOCUS_03720 gene tuf 14346 13156 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946066.1 protein_id gnl|my_center|LOCUS_03720 15619 14879 gene locus_tag LOCUS_03730 15619 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 16542 15718 gene locus_tag LOCUS_03740 16542 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 16715 17200 gene locus_tag LOCUS_03750 16715 17200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 18242 17457 gene locus_tag LOCUS_03760 18242 17457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 18473 18937 gene locus_tag LOCUS_03770 18473 18937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 19472 19972 gene locus_tag LOCUS_03780 19472 19972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 20260 21222 gene locus_tag LOCUS_03790 20260 21222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence14 1286 468 gene locus_tag LOCUS_03800 1286 468 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 protein_id gnl|my_center|LOCUS_03800 1786 1559 gene locus_tag LOCUS_03810 1786 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 1955 5104 gene locus_tag LOCUS_03820 1955 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 5502 5428 gene locus_tag LOCUS_t00170 5502 5428 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5790 5668 gene locus_tag LOCUS_03830 5790 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 6413 6069 gene locus_tag LOCUS_03840 gene rplT 6413 6069 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192938.1 protein_id gnl|my_center|LOCUS_03840 7573 7025 gene locus_tag LOCUS_03850 gene infC 7573 7025 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057459.1 protein_id gnl|my_center|LOCUS_03850 8740 8297 gene locus_tag LOCUS_03860 gene smpB 8740 8297 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_03860 9160 9597 gene locus_tag LOCUS_03870 9160 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 9702 10460 gene locus_tag LOCUS_03880 9702 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 10569 11624 gene locus_tag LOCUS_03890 10569 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 11647 12354 gene locus_tag LOCUS_03900 11647 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 12382 12594 gene locus_tag LOCUS_03910 12382 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 12597 13199 gene locus_tag LOCUS_03920 12597 13199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 13319 13648 gene locus_tag LOCUS_03930 13319 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 13926 14294 gene locus_tag LOCUS_03940 13926 14294 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029036.1 protein_id gnl|my_center|LOCUS_03940 14567 14776 gene locus_tag LOCUS_03950 14567 14776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 14782 20301 gene locus_tag LOCUS_03960 14782 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence15 1412 342 gene locus_tag LOCUS_03970 1412 342 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943378.1 protein_id gnl|my_center|LOCUS_03970 2112 2387 gene locus_tag LOCUS_03980 2112 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 2742 3062 gene locus_tag LOCUS_03990 2742 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 3038 3313 gene locus_tag LOCUS_04000 3038 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3396 3758 gene locus_tag LOCUS_04010 3396 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4323 3832 gene locus_tag LOCUS_04020 4323 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04020 4783 4307 gene locus_tag LOCUS_04030 4783 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 5285 4920 gene locus_tag LOCUS_04040 5285 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 5407 6132 gene locus_tag LOCUS_04050 5407 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 6143 6412 gene locus_tag LOCUS_04060 6143 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 6542 7411 gene locus_tag LOCUS_04070 gene fsa 6542 7411 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384540.1 protein_id gnl|my_center|LOCUS_04070 7681 7607 gene locus_tag LOCUS_t00180 7681 7607 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7851 7777 gene locus_tag LOCUS_t00190 7851 7777 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7976 7904 gene locus_tag LOCUS_t00200 7976 7904 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8080 9090 gene locus_tag LOCUS_04080 gene epmA 8080 9090 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175550.1 protein_id gnl|my_center|LOCUS_04080 9220 9786 gene locus_tag LOCUS_04090 gene efp 9220 9786 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626516.1 protein_id gnl|my_center|LOCUS_04090 11159 9894 gene locus_tag LOCUS_04100 11159 9894 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774553.1 protein_id gnl|my_center|LOCUS_04100 12709 11459 gene locus_tag LOCUS_04110 12709 11459 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868101.1 protein_id gnl|my_center|LOCUS_04110 13096 12713 gene locus_tag LOCUS_04120 13096 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 13628 13101 gene locus_tag LOCUS_04130 13628 13101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 14163 13636 gene locus_tag LOCUS_04140 14163 13636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 15266 14166 gene locus_tag LOCUS_04150 15266 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 16476 15274 gene locus_tag LOCUS_04160 16476 15274 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_04160 18355 16625 gene locus_tag LOCUS_04170 18355 16625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 18625 19248 gene locus_tag LOCUS_04180 18625 19248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 19400 19849 gene locus_tag LOCUS_04190 19400 19849 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_04190 19865 20089 gene locus_tag LOCUS_04200 gene rpsR 19865 20089 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence16 177 1625 gene locus_tag LOCUS_04210 177 1625 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170127867.1 protein_id gnl|my_center|LOCUS_04210 2047 1760 gene locus_tag LOCUS_04220 gene hupA 2047 1760 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305063.1 protein_id gnl|my_center|LOCUS_04220 3811 2282 gene locus_tag LOCUS_04230 gene rny 3811 2282 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_04230 5378 4644 gene locus_tag LOCUS_04240 5378 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 5932 5375 gene locus_tag LOCUS_04250 5932 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_04250 8698 5969 gene locus_tag LOCUS_04260 8698 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 9371 8679 gene locus_tag LOCUS_04270 9371 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 9739 10731 gene locus_tag LOCUS_04280 gene dusB 9739 10731 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_04280 11648 10947 gene locus_tag LOCUS_04290 11648 10947 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_04290 13081 11645 gene locus_tag LOCUS_04300 13081 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 13901 13059 gene locus_tag LOCUS_04310 gene folD 13901 13059 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_04310 14017 14514 gene locus_tag LOCUS_04320 gene greA 14017 14514 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_04320 15802 14621 gene locus_tag LOCUS_04330 15802 14621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 17206 15944 gene locus_tag LOCUS_04340 17206 15944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 17427 17356 gene locus_tag LOCUS_t00210 17427 17356 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 18509 17445 gene locus_tag LOCUS_04350 18509 17445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence17 1541 438 gene locus_tag LOCUS_04360 gene dnaJ 1541 438 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208006.1 protein_id gnl|my_center|LOCUS_04360 1940 1566 gene locus_tag LOCUS_04370 1940 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2268 1981 gene locus_tag LOCUS_04380 2268 1981 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791533.1 protein_id gnl|my_center|LOCUS_04380 2740 2327 gene locus_tag LOCUS_04390 2740 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 3204 2758 gene locus_tag LOCUS_04400 3204 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 5257 3314 gene locus_tag LOCUS_04410 gene dnaK 5257 3314 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_04410 6367 5324 gene locus_tag LOCUS_04420 6367 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 6903 6373 gene locus_tag LOCUS_04430 6903 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 7526 7092 gene locus_tag LOCUS_04440 7526 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8190 7741 gene locus_tag LOCUS_04450 8190 7741 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393982.1 protein_id gnl|my_center|LOCUS_04450 9165 8356 gene locus_tag LOCUS_04460 9165 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 10004 9321 gene locus_tag LOCUS_04470 10004 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 10392 10102 gene locus_tag LOCUS_04480 10392 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 10615 10397 gene locus_tag LOCUS_04490 10615 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 10902 10627 gene locus_tag LOCUS_04500 10902 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 11636 11037 gene locus_tag LOCUS_04510 11636 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 12390 11671 gene locus_tag LOCUS_04520 12390 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 14016 12850 gene locus_tag LOCUS_04530 14016 12850 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 protein_id gnl|my_center|LOCUS_04530 15455 14217 gene locus_tag LOCUS_04540 15455 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04540 16271 15543 gene locus_tag LOCUS_04550 16271 15543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_04550 18200 16731 gene locus_tag LOCUS_04560 18200 16731 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_04560 >Feature sequence18 508 113 gene locus_tag LOCUS_04570 508 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 2480 519 gene locus_tag LOCUS_04580 2480 519 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944118.1 protein_id gnl|my_center|LOCUS_04580 4807 2555 gene locus_tag LOCUS_04590 4807 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 4951 5559 gene locus_tag LOCUS_04600 4951 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 5630 6028 gene locus_tag LOCUS_04610 5630 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 6086 7525 gene locus_tag LOCUS_04620 6086 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7536 8444 gene locus_tag LOCUS_04630 7536 8444 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246287.1 protein_id gnl|my_center|LOCUS_04630 8709 9158 gene locus_tag LOCUS_04640 gene tnpA 8709 9158 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_04640 9219 10715 gene locus_tag LOCUS_04650 9219 10715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 10784 12265 gene locus_tag LOCUS_04660 10784 12265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 12323 13324 gene locus_tag LOCUS_04670 12323 13324 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_04670 13374 14543 gene locus_tag LOCUS_04680 13374 14543 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_04680 14546 15469 gene locus_tag LOCUS_04690 14546 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 >Feature sequence19 437 1204 gene locus_tag LOCUS_04700 gene rpsB 437 1204 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869490.1 protein_id gnl|my_center|LOCUS_04700 1321 1968 gene locus_tag LOCUS_04710 gene tsf 1321 1968 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_04710 2625 3659 gene locus_tag LOCUS_04720 2625 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 3860 4207 gene locus_tag LOCUS_04730 3860 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 4200 4745 gene locus_tag LOCUS_04740 4200 4745 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_04740 4948 7215 gene locus_tag LOCUS_04750 gene pnp 4948 7215 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 protein_id gnl|my_center|LOCUS_04750 8671 7412 gene locus_tag LOCUS_04760 8671 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 8908 9111 gene locus_tag LOCUS_04770 8908 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 9168 9250 gene locus_tag LOCUS_t00220 9168 9250 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10131 14196 gene locus_tag LOCUS_r00010 10131 14196 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 14398 14961 gene locus_tag LOCUS_04780 14398 14961 CDS product LAGLIDADG family homing endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957425.1 protein_id gnl|my_center|LOCUS_04780 15412 15489 gene locus_tag LOCUS_r00020 15412 15489 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 65 percent of the 5S ribosomal RNA >Feature sequence20 2007 1027 gene locus_tag LOCUS_04790 2007 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 3495 2167 gene locus_tag LOCUS_04800 3495 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4208 5494 gene locus_tag LOCUS_04810 gene miaB 4208 5494 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_04810 5796 6737 gene locus_tag LOCUS_04820 gene miaA 5796 6737 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_04820 6730 7473 gene locus_tag LOCUS_04830 6730 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 8105 7893 gene locus_tag LOCUS_04840 8105 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04840 8548 8216 gene locus_tag LOCUS_04850 8548 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04850 8731 8567 gene locus_tag LOCUS_04860 8731 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 9105 8752 gene locus_tag LOCUS_04870 gene speD 9105 8752 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583767.1 protein_id gnl|my_center|LOCUS_04870 9472 9215 gene locus_tag LOCUS_04880 9472 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 9651 9469 gene locus_tag LOCUS_04890 9651 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 12339 9880 gene locus_tag LOCUS_04900 12339 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 12549 12367 gene locus_tag LOCUS_04910 12549 12367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 13889 12612 gene locus_tag LOCUS_04920 gene purB 13889 12612 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460028.1 protein_id gnl|my_center|LOCUS_04920 <15177 13984 gene locus_tag LOCUS_04930 <15177 13984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966856.1:adenylosuccinate synthase >Feature sequence21 464 727 gene locus_tag LOCUS_04940 464 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 993 2834 gene locus_tag LOCUS_04950 993 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3214 4824 gene locus_tag LOCUS_04960 gene rnjA 3214 4824 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670368.1 protein_id gnl|my_center|LOCUS_04960 5394 4831 gene locus_tag LOCUS_04970 5394 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 8751 5479 gene locus_tag LOCUS_04980 8751 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 9199 9522 gene locus_tag LOCUS_04990 9199 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 9662 11023 gene locus_tag LOCUS_05000 gene trpE 9662 11023 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_05000 11134 11766 gene locus_tag LOCUS_05010 11134 11766 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861216.1 protein_id gnl|my_center|LOCUS_05010 12180 13157 gene locus_tag LOCUS_05020 gene trpD 12180 13157 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_05020 13173 14081 gene locus_tag LOCUS_05030 gene trpC 13173 14081 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_05030 14190 14804 gene locus_tag LOCUS_05040 14190 14804 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207615.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence22 362 1984 gene locus_tag LOCUS_05050 362 1984 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144228.1 protein_id gnl|my_center|LOCUS_05050 2366 2677 gene locus_tag LOCUS_05060 2366 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2772 3782 gene locus_tag LOCUS_05070 2772 3782 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_05070 3834 5120 gene locus_tag LOCUS_05080 3834 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 5670 5149 gene locus_tag LOCUS_05090 5670 5149 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021659.1 protein_id gnl|my_center|LOCUS_05090 6424 5774 gene locus_tag LOCUS_05100 6424 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 7323 6628 gene locus_tag LOCUS_05110 7323 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 7478 8230 gene locus_tag LOCUS_05120 7478 8230 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462332.1 protein_id gnl|my_center|LOCUS_05120 8336 8623 gene locus_tag LOCUS_05130 8336 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 8698 9636 gene locus_tag LOCUS_05140 8698 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 11885 12160 gene locus_tag LOCUS_05150 gene groES 11885 12160 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258595.1 protein_id gnl|my_center|LOCUS_05150 12335 13966 gene locus_tag LOCUS_05160 gene groL 12335 13966 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence23 1670 258 gene locus_tag LOCUS_05170 1670 258 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_05170 1962 2708 gene locus_tag LOCUS_05180 1962 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 2796 3041 gene locus_tag LOCUS_05190 2796 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3049 3675 gene locus_tag LOCUS_05200 3049 3675 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_05200 4385 5158 gene locus_tag LOCUS_05210 4385 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 5303 5548 gene locus_tag LOCUS_05220 5303 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 5612 6091 gene locus_tag LOCUS_05230 5612 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 6281 6670 gene locus_tag LOCUS_05240 6281 6670 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_05240 6917 8701 gene locus_tag LOCUS_05250 6917 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 8866 9489 gene locus_tag LOCUS_05260 8866 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 9538 9966 gene locus_tag LOCUS_05270 9538 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 10013 11434 gene locus_tag LOCUS_05280 10013 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 12053 11892 gene locus_tag LOCUS_05290 12053 11892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 12767 12063 gene locus_tag LOCUS_05300 12767 12063 CDS product transposase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376295.1 protein_id gnl|my_center|LOCUS_05300 13160 12882 gene locus_tag LOCUS_05310 13160 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 <13980 13296 gene locus_tag LOCUS_05320 <13980 13296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986377.1:transcriptional repressor LexA >Feature sequence24 4996 1163 gene locus_tag LOCUS_05330 4996 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 6752 5412 gene locus_tag LOCUS_05340 6752 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 7383 6820 gene locus_tag LOCUS_05350 7383 6820 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222410.1 protein_id gnl|my_center|LOCUS_05350 8321 8650 gene locus_tag LOCUS_05360 8321 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 8654 9112 gene locus_tag LOCUS_05370 8654 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 9094 9411 gene locus_tag LOCUS_05380 9094 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 10756 9725 gene locus_tag LOCUS_05390 gene pheS 10756 9725 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_05390 11091 10753 gene locus_tag LOCUS_05400 11091 10753 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_05400 11380 11081 gene locus_tag LOCUS_05410 11380 11081 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_05410 12124 12612 gene locus_tag LOCUS_05420 12124 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 12627 13154 gene locus_tag LOCUS_05430 12627 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 13167 13679 gene locus_tag LOCUS_05440 13167 13679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence25 2833 257 gene locus_tag LOCUS_05450 2833 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4825 2963 gene locus_tag LOCUS_05460 gene ftsH 4825 2963 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_05460 5224 6390 gene locus_tag LOCUS_05470 gene rpsA 5224 6390 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_05470 6896 6474 gene locus_tag LOCUS_05480 gene rplK 6896 6474 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_05480 7592 7047 gene locus_tag LOCUS_05490 gene nusG 7592 7047 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_05490 7866 7675 gene locus_tag LOCUS_05500 7866 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 8046 9170 gene locus_tag LOCUS_05510 8046 9170 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_05510 10225 9320 gene locus_tag LOCUS_05520 gene prmC 10225 9320 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267042.1 protein_id gnl|my_center|LOCUS_05520 10311 10523 gene locus_tag LOCUS_05530 10311 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 10920 10513 gene locus_tag LOCUS_05540 10920 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 12459 11398 gene locus_tag LOCUS_05550 gene prfA 12459 11398 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_05550 12944 12621 gene locus_tag LOCUS_05560 12944 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 >Feature sequence26 201 2333 gene locus_tag LOCUS_05570 gene recQ 201 2333 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555810.1 protein_id gnl|my_center|LOCUS_05570 2521 3135 gene locus_tag LOCUS_05580 2521 3135 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_05580 3183 3446 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cccacatagtttcgtaattt 3360 3375 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3488 4009 gene locus_tag LOCUS_05590 3488 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 4170 6674 gene locus_tag LOCUS_05600 gene gyrA 4170 6674 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_05600 6779 7075 gene locus_tag LOCUS_05610 6779 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 7090 7470 gene locus_tag LOCUS_05620 7090 7470 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118912.1 protein_id gnl|my_center|LOCUS_05620 8559 7546 gene locus_tag LOCUS_05630 8559 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584075.1 protein_id gnl|my_center|LOCUS_05630 9836 8571 gene locus_tag LOCUS_05640 9836 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 10970 9900 gene locus_tag LOCUS_05650 10970 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 11355 11008 gene locus_tag LOCUS_05660 11355 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 12023 11445 gene locus_tag LOCUS_05670 gene ruvA 12023 11445 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence27 67 531 gene locus_tag LOCUS_05680 67 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 561 788 gene locus_tag LOCUS_05690 561 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 1714 1541 gene locus_tag LOCUS_05700 1714 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3803 2216 gene locus_tag LOCUS_r00030 3803 2216 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4817 4272 gene locus_tag LOCUS_05710 4817 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5521 4826 gene locus_tag LOCUS_05720 gene trmD 5521 4826 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272440.1 protein_id gnl|my_center|LOCUS_05720 7809 5734 gene locus_tag LOCUS_05730 gene fusA 7809 5734 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_05730 8447 7968 gene locus_tag LOCUS_05740 gene rpsG 8447 7968 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417210.1 protein_id gnl|my_center|LOCUS_05740 9000 8575 gene locus_tag LOCUS_05750 gene rpsL 9000 8575 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_05750 9581 9246 gene locus_tag LOCUS_05760 9581 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 10696 10079 gene locus_tag LOCUS_05770 10696 10079 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_05770 12234 11140 gene locus_tag LOCUS_05780 12234 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence28 416 123 gene locus_tag LOCUS_05790 416 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 930 469 gene locus_tag LOCUS_05800 gene ribH 930 469 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687601.1 protein_id gnl|my_center|LOCUS_05800 1549 968 gene locus_tag LOCUS_05810 1549 968 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_05810 2242 1646 gene locus_tag LOCUS_05820 gene ribA 2242 1646 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629111.1 protein_id gnl|my_center|LOCUS_05820 3320 2223 gene locus_tag LOCUS_05830 gene ribD 3320 2223 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943609.1 protein_id gnl|my_center|LOCUS_05830 4851 3400 gene locus_tag LOCUS_05840 4851 3400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071967.1 protein_id gnl|my_center|LOCUS_05840 5614 5201 gene locus_tag LOCUS_05850 gene def 5614 5201 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287369.1 protein_id gnl|my_center|LOCUS_05850 6219 5800 gene locus_tag LOCUS_05860 6219 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 8143 6227 gene locus_tag LOCUS_05870 8143 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 8940 8146 gene locus_tag LOCUS_05880 8940 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 11233 8960 gene locus_tag LOCUS_05890 11233 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 11375 12046 gene locus_tag LOCUS_05900 gene rsmI 11375 12046 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534198.1 protein_id gnl|my_center|LOCUS_05900 12248 12907 gene locus_tag LOCUS_05910 12248 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence29 802 326 gene locus_tag LOCUS_05920 802 326 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_05920 2187 799 gene locus_tag LOCUS_05930 gene cysS 2187 799 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_05930 2510 3112 gene locus_tag LOCUS_05940 2510 3112 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206205.1 protein_id gnl|my_center|LOCUS_05940 3178 3516 gene locus_tag LOCUS_05950 3178 3516 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_05950 4170 5402 gene locus_tag LOCUS_05960 4170 5402 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986386.1 protein_id gnl|my_center|LOCUS_05960 5647 6066 gene locus_tag LOCUS_05970 5647 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 6071 7798 gene locus_tag LOCUS_05980 6071 7798 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186447661.1 protein_id gnl|my_center|LOCUS_05980 7831 8052 gene locus_tag LOCUS_05990 7831 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 8333 9616 gene locus_tag LOCUS_06000 8333 9616 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_06000 9729 10856 gene locus_tag LOCUS_06010 9729 10856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 10930 11502 gene locus_tag LOCUS_06020 10930 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 12631 11720 gene locus_tag LOCUS_06030 12631 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence30 74 340 gene locus_tag LOCUS_06040 74 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 505 1665 gene locus_tag LOCUS_06050 505 1665 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948234.1 protein_id gnl|my_center|LOCUS_06050 1773 2687 gene locus_tag LOCUS_06060 1773 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2762 3571 gene locus_tag LOCUS_06070 2762 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 3586 4290 gene locus_tag LOCUS_06080 3586 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4287 5303 gene locus_tag LOCUS_06090 gene trpS 4287 5303 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 protein_id gnl|my_center|LOCUS_06090 5548 7770 gene locus_tag LOCUS_06100 5548 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 8001 8300 gene locus_tag LOCUS_06110 8001 8300 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661705.1 protein_id gnl|my_center|LOCUS_06110 8420 9073 gene locus_tag LOCUS_06120 8420 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 9084 9554 gene locus_tag LOCUS_06130 9084 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 9850 10302 gene locus_tag LOCUS_06140 gene rpiB 9850 10302 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874952.1 protein_id gnl|my_center|LOCUS_06140 10448 11101 gene locus_tag LOCUS_06150 gene rpe 10448 11101 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_06150 11271 12242 gene locus_tag LOCUS_06160 gene trxB 11271 12242 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146639.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence31 404 688 gene locus_tag LOCUS_06170 404 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 746 1030 gene locus_tag LOCUS_06180 746 1030 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_06180 1017 1850 gene locus_tag LOCUS_06190 1017 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06190 2160 2477 gene locus_tag LOCUS_06200 2160 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2962 3639 gene locus_tag LOCUS_06210 2962 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3649 4605 gene locus_tag LOCUS_06220 3649 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 >Feature sequence32 276 827 gene locus_tag LOCUS_06230 276 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2225 861 gene locus_tag LOCUS_06240 2225 861 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_06240 2386 4905 gene locus_tag LOCUS_06250 2386 4905 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545172.1 protein_id gnl|my_center|LOCUS_06250 4902 5261 gene locus_tag LOCUS_06260 4902 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 5370 7175 gene locus_tag LOCUS_06270 5370 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 7226 8479 gene locus_tag LOCUS_06280 7226 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 8689 9333 gene locus_tag LOCUS_06290 8689 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 9336 10922 gene locus_tag LOCUS_06300 9336 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence33 4084 4470 gene locus_tag LOCUS_06310 4084 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 4645 5517 gene locus_tag LOCUS_06320 4645 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 5834 6997 gene locus_tag LOCUS_06330 5834 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 7009 7458 gene locus_tag LOCUS_06340 gene ybeY 7009 7458 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_06340 7657 8028 gene locus_tag LOCUS_06350 7657 8028 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715480.1 protein_id gnl|my_center|LOCUS_06350 8152 9408 gene locus_tag LOCUS_06360 gene ftsA 8152 9408 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_06360 9613 10848 gene locus_tag LOCUS_06370 gene ftsZ 9613 10848 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_06370 11040 11507 gene locus_tag LOCUS_06380 11040 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence34 283 570 gene locus_tag LOCUS_06390 283 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 586 1002 gene locus_tag LOCUS_06400 586 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 1039 1233 gene locus_tag LOCUS_06410 1039 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1230 1745 gene locus_tag LOCUS_06420 gene ruvC 1230 1745 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_06420 1799 2032 gene locus_tag LOCUS_06430 1799 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 2189 2392 gene locus_tag LOCUS_06440 2189 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06440 2408 2608 gene locus_tag LOCUS_06450 2408 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2644 3669 gene locus_tag LOCUS_06460 gene gap 2644 3669 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_06460 3735 4394 gene locus_tag LOCUS_06470 3735 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 4397 5617 gene locus_tag LOCUS_06480 4397 5617 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583493.1 protein_id gnl|my_center|LOCUS_06480 5862 6758 gene locus_tag LOCUS_06490 5862 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 6859 7077 gene locus_tag LOCUS_06500 6859 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 7074 7727 gene locus_tag LOCUS_06510 7074 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 7757 9010 gene locus_tag LOCUS_06520 gene eno 7757 9010 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_06520 9073 9324 gene locus_tag LOCUS_06530 9073 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 9537 11441 gene locus_tag LOCUS_06540 9537 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence35 228 647 gene locus_tag LOCUS_06550 228 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 1203 871 gene locus_tag LOCUS_06560 1203 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1500 1288 gene locus_tag LOCUS_06570 1500 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1788 1513 gene locus_tag LOCUS_06580 1788 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2265 2765 gene locus_tag LOCUS_06590 2265 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3067 3402 gene locus_tag LOCUS_06600 3067 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 4766 4551 gene locus_tag LOCUS_06610 4766 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 4938 4747 gene locus_tag LOCUS_06620 4938 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5170 4943 gene locus_tag LOCUS_06630 5170 4943 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392021.1 protein_id gnl|my_center|LOCUS_06630 5417 5172 gene locus_tag LOCUS_06640 5417 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6814 5606 gene locus_tag LOCUS_06650 gene rseP 6814 5606 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_06650 6932 7495 gene locus_tag LOCUS_06660 6932 7495 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_06660 7552 7956 gene locus_tag LOCUS_06670 7552 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 8018 8899 gene locus_tag LOCUS_06680 gene htpX 8018 8899 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583272.1 protein_id gnl|my_center|LOCUS_06680 9174 9389 gene locus_tag LOCUS_06690 9174 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 9408 9686 gene locus_tag LOCUS_06700 9408 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 9828 10541 gene locus_tag LOCUS_06710 gene exoX 9828 10541 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816504.1 protein_id gnl|my_center|LOCUS_06710 10556 11329 gene locus_tag LOCUS_06720 10556 11329 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence36 2422 497 gene locus_tag LOCUS_06730 2422 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3573 2797 gene locus_tag LOCUS_06740 3573 2797 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583263.1 protein_id gnl|my_center|LOCUS_06740 3963 3760 gene locus_tag LOCUS_06750 3963 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4869 4093 gene locus_tag LOCUS_06760 4869 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06760 5296 4832 gene locus_tag LOCUS_06770 5296 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06770 5744 5427 gene locus_tag LOCUS_06780 gene trxA 5744 5427 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_06780 6725 5784 gene locus_tag LOCUS_06790 6725 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 8819 6798 gene locus_tag LOCUS_06800 gene infB 8819 6798 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881330.1 protein_id gnl|my_center|LOCUS_06800 9056 9274 gene locus_tag LOCUS_06810 9056 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 9108 9118 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10814 9390 gene locus_tag LOCUS_06820 10814 9390 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence37 355 95 gene locus_tag LOCUS_06830 355 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 442 357 gene locus_tag LOCUS_t00230 442 357 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 594 522 gene locus_tag LOCUS_t00240 594 522 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 806 733 gene locus_tag LOCUS_t00250 806 733 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2594 897 gene locus_tag LOCUS_06840 2594 897 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399950.1 protein_id gnl|my_center|LOCUS_06840 6515 2745 gene locus_tag LOCUS_06850 6515 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7701 8093 gene locus_tag LOCUS_06860 7701 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 8103 8549 gene locus_tag LOCUS_06870 gene lspA 8103 8549 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358651.1 protein_id gnl|my_center|LOCUS_06870 8922 9110 gene locus_tag LOCUS_06880 8922 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06880 9070 9594 gene locus_tag LOCUS_06890 9070 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06890 >Feature sequence38 137 1504 gene locus_tag LOCUS_06900 gene atpD 137 1504 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_06900 1717 2133 gene locus_tag LOCUS_06910 gene atpC 1717 2133 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847211.1 protein_id gnl|my_center|LOCUS_06910 2210 2683 gene locus_tag LOCUS_06920 2210 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 2726 4000 gene locus_tag LOCUS_06930 2726 4000 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_06930 4072 5847 gene locus_tag LOCUS_06940 4072 5847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444571.1 protein_id gnl|my_center|LOCUS_06940 5956 8013 gene locus_tag LOCUS_06950 5956 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence39 552 316 gene locus_tag LOCUS_06960 552 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2434 1376 gene locus_tag LOCUS_06970 gene coxFIC1 2434 1376 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_06970 3437 2535 gene locus_tag LOCUS_06980 3437 2535 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_06980 5460 3463 gene locus_tag LOCUS_06990 5460 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 6826 5465 gene locus_tag LOCUS_07000 6826 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 7556 6828 gene locus_tag LOCUS_07010 7556 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 8099 7563 gene locus_tag LOCUS_07020 8099 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 8613 8209 gene locus_tag LOCUS_07030 8613 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 <9415 8623 gene locus_tag LOCUS_07040 <9415 8623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930950.1:methionine--tRNA ligase >Feature sequence40 50 3505 gene locus_tag LOCUS_07050 gene rpoB 50 3505 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776389.1 protein_id gnl|my_center|LOCUS_07050 3707 7648 gene locus_tag LOCUS_07060 gene rpoC 3707 7648 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256762.1 protein_id gnl|my_center|LOCUS_07060 8178 8909 gene locus_tag LOCUS_07070 8178 8909 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256931.1 protein_id gnl|my_center|LOCUS_07070 8971 9270 gene locus_tag LOCUS_07080 8971 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence41 1105 425 gene locus_tag LOCUS_07090 1105 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1212 1249 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2169 1489 gene locus_tag LOCUS_07100 2169 1489 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947925.1 protein_id gnl|my_center|LOCUS_07100 2758 2285 gene locus_tag LOCUS_07110 2758 2285 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962499.1 protein_id gnl|my_center|LOCUS_07110 3767 2895 gene locus_tag LOCUS_07120 gene thyA 3767 2895 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208311.1 protein_id gnl|my_center|LOCUS_07120 4737 3877 gene locus_tag LOCUS_07130 4737 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 5320 4745 gene locus_tag LOCUS_07140 5320 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 5798 5322 gene locus_tag LOCUS_07150 5798 5322 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_07150 6653 5976 gene locus_tag LOCUS_07160 gene rplA 6653 5976 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294587.1 protein_id gnl|my_center|LOCUS_07160 7188 6916 gene locus_tag LOCUS_07170 7188 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 7403 7573 gene locus_tag LOCUS_07180 7403 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 7709 7637 gene locus_tag LOCUS_t00260 7709 7637 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8859 7834 gene locus_tag LOCUS_07190 gene xerD 8859 7834 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932289.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence42 58 1329 gene locus_tag LOCUS_07200 58 1329 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209743.1 protein_id gnl|my_center|LOCUS_07200 1281 2888 gene locus_tag LOCUS_07210 gene gpmI 1281 2888 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964031.1 protein_id gnl|my_center|LOCUS_07210 3010 4587 gene locus_tag LOCUS_07220 gene gpmI 3010 4587 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_07220 5997 4849 gene locus_tag LOCUS_07230 5997 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 6223 5978 gene locus_tag LOCUS_07240 6223 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 6237 6485 gene locus_tag LOCUS_07250 6237 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 6532 9222 gene locus_tag LOCUS_07260 6532 9222 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258507.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence43 1 432 gene locus_tag LOCUS_07270 1 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 395 898 gene locus_tag LOCUS_07280 395 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07280 1125 1961 gene locus_tag LOCUS_07290 1125 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3065 2562 gene locus_tag LOCUS_07300 3065 2562 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_07300 4169 3132 gene locus_tag LOCUS_07310 4169 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4771 4241 gene locus_tag LOCUS_07320 gene scpB 4771 4241 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_07320 5629 4928 gene locus_tag LOCUS_07330 5629 4928 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_07330 6359 5622 gene locus_tag LOCUS_07340 6359 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 8273 6495 gene locus_tag LOCUS_07350 8273 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence44 1293 142 gene locus_tag LOCUS_07360 1293 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 2468 1461 gene locus_tag LOCUS_07370 2468 1461 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880437.1 protein_id gnl|my_center|LOCUS_07370 2911 2672 gene locus_tag LOCUS_07380 2911 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 2816 3562 gene locus_tag LOCUS_07390 2816 3562 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404464.1 protein_id gnl|my_center|LOCUS_07390 3926 3854 gene locus_tag LOCUS_t00270 3926 3854 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4714 3980 gene locus_tag LOCUS_07400 4714 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 5344 4730 gene locus_tag LOCUS_07410 5344 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 5892 5464 gene locus_tag LOCUS_07420 5892 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 6345 5950 gene locus_tag LOCUS_07430 6345 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 6841 6479 gene locus_tag LOCUS_07440 6841 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 7620 6862 gene locus_tag LOCUS_07450 7620 6862 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_07450 8362 7676 gene locus_tag LOCUS_07460 8362 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 8989 8507 gene locus_tag LOCUS_07470 8989 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence45 432 359 gene locus_tag LOCUS_t00280 432 359 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 859 527 gene locus_tag LOCUS_07480 859 527 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963786.1 protein_id gnl|my_center|LOCUS_07480 1094 870 gene locus_tag LOCUS_07490 1094 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 1649 1425 gene locus_tag LOCUS_07500 1649 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 2334 1639 gene locus_tag LOCUS_07510 2334 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2476 2404 gene locus_tag LOCUS_t00290 2476 2404 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3702 2575 gene locus_tag LOCUS_07520 3702 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4139 3723 gene locus_tag LOCUS_07530 4139 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4828 4214 gene locus_tag LOCUS_07540 4828 4214 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105355.1 protein_id gnl|my_center|LOCUS_07540 5547 4930 gene locus_tag LOCUS_07550 5547 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 5957 5619 gene locus_tag LOCUS_07560 5957 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 7249 6110 gene locus_tag LOCUS_07570 7249 6110 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030386.1 protein_id gnl|my_center|LOCUS_07570 8725 7292 gene locus_tag LOCUS_07580 8725 7292 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence46 3268 314 gene locus_tag LOCUS_07590 3268 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 5379 3481 gene locus_tag LOCUS_07600 5379 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 6569 5517 gene locus_tag LOCUS_07610 6569 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 6998 6573 gene locus_tag LOCUS_07620 6998 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 8358 7306 gene locus_tag LOCUS_07630 8358 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence47 413 1600 gene locus_tag LOCUS_07640 413 1600 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707887.1 protein_id gnl|my_center|LOCUS_07640 1603 2256 gene locus_tag LOCUS_07650 1603 2256 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905540.1 protein_id gnl|my_center|LOCUS_07650 2370 4217 gene locus_tag LOCUS_07660 gene glmS 2370 4217 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228994.1 protein_id gnl|my_center|LOCUS_07660 4265 4654 gene locus_tag LOCUS_07670 4265 4654 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_07670 4683 5336 gene locus_tag LOCUS_07680 4683 5336 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_07680 5412 6374 gene locus_tag LOCUS_07690 5412 6374 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082225.1 protein_id gnl|my_center|LOCUS_07690 6378 6716 gene locus_tag LOCUS_07700 6378 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 6992 7780 gene locus_tag LOCUS_07710 6992 7780 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence48 937 569 gene locus_tag LOCUS_07720 937 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 3344 897 gene locus_tag LOCUS_07730 3344 897 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144184.1 protein_id gnl|my_center|LOCUS_07730 5573 3492 gene locus_tag LOCUS_07740 5573 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 7880 5643 gene locus_tag LOCUS_07750 7880 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence49 <1 1257 gene locus_tag LOCUS_07760 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038837.1:DNA topoisomerase I 3295 1259 gene locus_tag LOCUS_07770 3295 1259 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256943.1 protein_id gnl|my_center|LOCUS_07770 3919 3455 gene locus_tag LOCUS_07780 3919 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4280 4369 gene locus_tag LOCUS_t00300 4280 4369 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4430 4518 gene locus_tag LOCUS_t00310 4430 4518 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4745 4834 gene locus_tag LOCUS_t00320 4745 4834 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4953 5108 gene locus_tag LOCUS_07790 4953 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 5485 5240 gene locus_tag LOCUS_07800 5485 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5740 5498 gene locus_tag LOCUS_07810 5740 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 6548 5820 gene locus_tag LOCUS_07820 6548 5820 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_07820 7113 6526 gene locus_tag LOCUS_07830 7113 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 7947 7312 gene locus_tag LOCUS_07840 7947 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence50 304 504 gene locus_tag LOCUS_07850 304 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1193 2128 gene locus_tag LOCUS_07860 1193 2128 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946960.1 protein_id gnl|my_center|LOCUS_07860 2161 2703 gene locus_tag LOCUS_07870 2161 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2777 3349 gene locus_tag LOCUS_07880 2777 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3569 4639 gene locus_tag LOCUS_07890 3569 4639 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_07890 4666 5172 gene locus_tag LOCUS_07900 4666 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 5165 5545 gene locus_tag LOCUS_07910 5165 5545 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_07910 6021 6503 gene locus_tag LOCUS_07920 6021 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 7524 6721 gene locus_tag LOCUS_07930 7524 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence51 1795 2745 gene locus_tag LOCUS_07940 1795 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 3013 4500 gene locus_tag LOCUS_07950 3013 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4960 4592 gene locus_tag LOCUS_07960 4960 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 6095 5232 gene locus_tag LOCUS_07970 6095 5232 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_07970 7088 6321 gene locus_tag LOCUS_07980 7088 6321 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_07980 7250 7334 gene locus_tag LOCUS_t00330 7250 7334 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence52 1 282 gene locus_tag LOCUS_07990 1 282 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_07990 298 600 gene locus_tag LOCUS_08000 298 600 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_08000 2240 639 gene locus_tag LOCUS_08010 gene murJ 2240 639 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_08010 3177 2257 gene locus_tag LOCUS_08020 gene corA 3177 2257 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821727.1 protein_id gnl|my_center|LOCUS_08020 3858 3184 gene locus_tag LOCUS_08030 3858 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 4253 5605 gene locus_tag LOCUS_08040 4253 5605 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_08040 5700 6452 gene locus_tag LOCUS_08050 5700 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence53 329 1414 gene locus_tag LOCUS_08060 329 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1362 1649 gene locus_tag LOCUS_08070 1362 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1950 2399 gene locus_tag LOCUS_08080 gene tnpA 1950 2399 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_08080 2607 5753 gene locus_tag LOCUS_08090 gene ppsA 2607 5753 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_08090 5992 6101 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6180 6560 gene locus_tag LOCUS_08100 6180 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 <7469 6859 gene locus_tag LOCUS_08110 <7469 6859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232221.1:patatin family protein >Feature sequence54 383 311 gene locus_tag LOCUS_t00340 383 311 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 948 565 gene locus_tag LOCUS_08120 948 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1090 1007 gene locus_tag LOCUS_t00350 1090 1007 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1955 1194 gene locus_tag LOCUS_08130 1955 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 2451 1978 gene locus_tag LOCUS_08140 2451 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4313 2604 gene locus_tag LOCUS_08150 gene argS 4313 2604 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682282.1 protein_id gnl|my_center|LOCUS_08150 5579 4395 gene locus_tag LOCUS_08160 gene tyrS 5579 4395 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_08160 6589 5591 gene locus_tag LOCUS_08170 6589 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 7123 6596 gene locus_tag LOCUS_08180 7123 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence55 598 2 gene locus_tag LOCUS_08190 598 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1688 744 gene locus_tag LOCUS_08200 1688 744 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_08200 2516 1770 gene locus_tag LOCUS_08210 2516 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 4095 2602 gene locus_tag LOCUS_08220 gene atpA 4095 2602 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_08220 4536 4150 gene locus_tag LOCUS_08230 4536 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 5080 4541 gene locus_tag LOCUS_08240 5080 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5316 5089 gene locus_tag LOCUS_08250 5316 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 6250 5459 gene locus_tag LOCUS_08260 gene atpB 6250 5459 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768272.1 protein_id gnl|my_center|LOCUS_08260 6548 6267 gene locus_tag LOCUS_08270 6548 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence56 258 728 gene locus_tag LOCUS_08280 gene bcp 258 728 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_08280 1317 799 gene locus_tag LOCUS_08290 1317 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061380.1 protein_id gnl|my_center|LOCUS_08290 1756 1322 gene locus_tag LOCUS_08300 1756 1322 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432567.1 protein_id gnl|my_center|LOCUS_08300 1938 1855 gene locus_tag LOCUS_t00360 1938 1855 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2362 1991 gene locus_tag LOCUS_08310 2362 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2553 2480 gene locus_tag LOCUS_t00370 2553 2480 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3548 2652 gene locus_tag LOCUS_08320 3548 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 4287 3541 gene locus_tag LOCUS_08330 gene tpiA 4287 3541 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019651.1 protein_id gnl|my_center|LOCUS_08330 5810 4551 gene locus_tag LOCUS_08340 5810 4551 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_08340 7046 6024 gene locus_tag LOCUS_08350 7046 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence57 289 1362 gene locus_tag LOCUS_08360 289 1362 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 protein_id gnl|my_center|LOCUS_08360 1510 3477 gene locus_tag LOCUS_08370 1510 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 3556 4623 gene locus_tag LOCUS_08380 3556 4623 CDS product DUF4325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682079.1 protein_id gnl|my_center|LOCUS_08380 4708 5505 gene locus_tag LOCUS_08390 4708 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5613 6671 gene locus_tag LOCUS_08400 5613 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence58 534 130 gene locus_tag LOCUS_08410 gene rpsI 534 130 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723652.1 protein_id gnl|my_center|LOCUS_08410 903 544 gene locus_tag LOCUS_08420 gene rplM 903 544 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_08420 1295 945 gene locus_tag LOCUS_08430 1295 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2038 1310 gene locus_tag LOCUS_08440 2038 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2665 2042 gene locus_tag LOCUS_08450 gene rpsD 2665 2042 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258257.1 protein_id gnl|my_center|LOCUS_08450 3138 2743 gene locus_tag LOCUS_08460 gene rpsK 3138 2743 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923548.1 protein_id gnl|my_center|LOCUS_08460 3643 3257 gene locus_tag LOCUS_08470 gene rpsM 3643 3257 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090769.1 protein_id gnl|my_center|LOCUS_08470 4204 3986 gene locus_tag LOCUS_08480 gene infA 4204 3986 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781436.1 protein_id gnl|my_center|LOCUS_08480 4932 4462 gene locus_tag LOCUS_08490 4932 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5781 4948 gene locus_tag LOCUS_08500 5781 4948 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_08500 6229 5786 gene locus_tag LOCUS_08510 6229 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence59 2552 405 gene locus_tag LOCUS_08520 2552 405 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583112.1 protein_id gnl|my_center|LOCUS_08520 3609 2797 gene locus_tag LOCUS_08530 3609 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 4305 3646 gene locus_tag LOCUS_08540 4305 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 4865 4317 gene locus_tag LOCUS_08550 4865 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4996 6117 gene locus_tag LOCUS_08560 gene tgt 4996 6117 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08560 >Feature sequence60 222 1349 gene locus_tag LOCUS_08570 222 1349 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_08570 1471 3237 gene locus_tag LOCUS_08580 gene aspS 1471 3237 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932992.1 protein_id gnl|my_center|LOCUS_08580 3334 4440 gene locus_tag LOCUS_08590 3334 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 4546 6306 gene locus_tag LOCUS_08600 4546 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence61 358 2238 gene locus_tag LOCUS_08610 gene lepA 358 2238 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056160.1 protein_id gnl|my_center|LOCUS_08610 2456 3049 gene locus_tag LOCUS_08620 2456 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3101 5326 gene locus_tag LOCUS_08630 gene recJ 3101 5326 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861665.1 protein_id gnl|my_center|LOCUS_08630 5391 5789 gene locus_tag LOCUS_08640 5391 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 5779 6213 gene locus_tag LOCUS_08650 5779 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence62 200 274 gene locus_tag LOCUS_t00380 200 274 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1101 1820 gene locus_tag LOCUS_08660 1101 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3441 2191 gene locus_tag LOCUS_08670 3441 2191 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545257.1 protein_id gnl|my_center|LOCUS_08670 3700 3536 gene locus_tag LOCUS_08680 3700 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4464 3727 gene locus_tag LOCUS_08690 4464 3727 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061323.1 protein_id gnl|my_center|LOCUS_08690 4776 4471 gene locus_tag LOCUS_08700 4776 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 5045 4791 gene locus_tag LOCUS_08710 5045 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5973 5077 gene locus_tag LOCUS_08720 5973 5077 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812971.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence63 <1 968 gene locus_tag LOCUS_08730 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108005.1:IS4 family transposase 1161 976 gene locus_tag LOCUS_08740 1161 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1973 1509 gene locus_tag LOCUS_08750 1973 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2088 2375 gene locus_tag LOCUS_08760 2088 2375 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140080.1 protein_id gnl|my_center|LOCUS_08760 2327 3178 gene locus_tag LOCUS_08770 2327 3178 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004846.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08770 3475 3741 gene locus_tag LOCUS_08780 3475 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3786 4604 gene locus_tag LOCUS_08790 3786 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 4644 4722 gene locus_tag LOCUS_t00390 4644 4722 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4920 6167 gene locus_tag LOCUS_08800 4920 6167 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021591.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence64 267 94 gene locus_tag LOCUS_08810 267 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 379 4428 gene locus_tag LOCUS_08820 379 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence65 295 915 gene locus_tag LOCUS_08830 295 915 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_08830 1164 2120 gene locus_tag LOCUS_08840 1164 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2117 2407 gene locus_tag LOCUS_08850 2117 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2623 3333 gene locus_tag LOCUS_08860 2623 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3698 3886 gene locus_tag LOCUS_08870 3698 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 4188 5618 gene locus_tag LOCUS_08880 gene guaB 4188 5618 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence66 1557 1195 gene locus_tag LOCUS_08890 1557 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1870 2157 gene locus_tag LOCUS_08900 gene rpmA 1870 2157 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081742.1 protein_id gnl|my_center|LOCUS_08900 2239 3060 gene locus_tag LOCUS_08910 2239 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424517.1 protein_id gnl|my_center|LOCUS_08910 3782 3474 gene locus_tag LOCUS_08920 3782 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 4573 3779 gene locus_tag LOCUS_08930 4573 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 5051 4578 gene locus_tag LOCUS_08940 5051 4578 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_08940 5576 5154 gene locus_tag LOCUS_08950 5576 5154 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553163.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence67 <1 3099 gene locus_tag LOCUS_08960 <1 3099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002379127.1:excinuclease ABC subunit UvrB 3432 4106 gene locus_tag LOCUS_08970 3432 4106 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_08970 4293 4616 gene locus_tag LOCUS_08980 4293 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 4886 5467 gene locus_tag LOCUS_08990 4886 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence68 1148 120 gene locus_tag LOCUS_09000 1148 120 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530444.1 protein_id gnl|my_center|LOCUS_09000 1334 2077 gene locus_tag LOCUS_09010 1334 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3274 2180 gene locus_tag LOCUS_09020 3274 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3314 3529 gene locus_tag LOCUS_09030 3314 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 4257 3592 gene locus_tag LOCUS_09040 4257 3592 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_09040 4842 4534 gene locus_tag LOCUS_09050 4842 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 5228 4884 gene locus_tag LOCUS_09060 5228 4884 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence69 <1 1320 gene locus_tag LOCUS_09070 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151756788.1:type IV secretion system DNA-binding domain-containing protein 1546 2220 gene locus_tag LOCUS_09080 1546 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3023 2796 gene locus_tag LOCUS_09090 3023 2796 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545805.1 protein_id gnl|my_center|LOCUS_09090 3267 3025 gene locus_tag LOCUS_09100 3267 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3752 3480 gene locus_tag LOCUS_09110 3752 3480 CDS product SWIB complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871818.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence70 3240 4520 gene locus_tag LOCUS_09120 3240 4520 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_09120 4524 4997 gene locus_tag LOCUS_09130 4524 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence71 1436 498 gene locus_tag LOCUS_09140 1436 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2504 1887 gene locus_tag LOCUS_09150 2504 1887 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_09150 3956 2547 gene locus_tag LOCUS_09160 3956 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 4391 4792 gene locus_tag LOCUS_09170 4391 4792 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789793.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence72 160 744 gene locus_tag LOCUS_09180 160 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 847 1128 gene locus_tag LOCUS_09190 847 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1218 2231 gene locus_tag LOCUS_09200 1218 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2678 3100 gene locus_tag LOCUS_09210 2678 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 3466 4620 gene locus_tag LOCUS_09220 3466 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence73 <1 4063 gene locus_tag LOCUS_09230 <1 4063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258712.1:SBBP repeat-containing protein 4683 4489 gene locus_tag LOCUS_09240 4683 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence74 <1 1057 gene locus_tag LOCUS_09250 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254303.1:ribosome biogenesis GTPase Der 1062 1607 gene locus_tag LOCUS_09260 gene pth 1062 1607 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907627.1 protein_id gnl|my_center|LOCUS_09260 1708 2787 gene locus_tag LOCUS_09270 gene dprA 1708 2787 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_09270 3007 4197 gene locus_tag LOCUS_09280 3007 4197 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_09280 4215 4790 gene locus_tag LOCUS_09290 4215 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence75 826 1776 gene locus_tag LOCUS_09300 826 1776 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_09300 1869 3134 gene locus_tag LOCUS_09310 1869 3134 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021591.1 protein_id gnl|my_center|LOCUS_09310 3127 3780 gene locus_tag LOCUS_09320 3127 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3884 4516 gene locus_tag LOCUS_09330 3884 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence76 <4823 2666 gene locus_tag LOCUS_09340 <4823 2666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258712.1:SBBP repeat-containing protein >Feature sequence77 206 3253 gene locus_tag LOCUS_09350 gene ileS 206 3253 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_09350 3557 4645 gene locus_tag LOCUS_09360 3557 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence78 <1 839 gene locus_tag LOCUS_09370 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965345.1:3D domain-containing protein 920 2350 gene locus_tag LOCUS_09380 gene radA 920 2350 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_09380 2433 2981 gene locus_tag LOCUS_09390 2433 2981 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_09390 <4612 3093 gene locus_tag LOCUS_09400 <4612 3093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256170.1:ATP-dependent DNA helicase RecG >Feature sequence79 <1 2147 gene locus_tag LOCUS_09410 <1 2147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256205.1:right-handed parallel beta-helix repeat-containing protein 2280 4304 gene locus_tag LOCUS_09420 2280 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence80 144 920 gene locus_tag LOCUS_09430 144 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1072 1518 gene locus_tag LOCUS_09440 gene dtd 1072 1518 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_09440 1632 2183 gene locus_tag LOCUS_09450 1632 2183 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_09450 2801 3649 gene locus_tag LOCUS_09460 2801 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence81 2104 1646 gene locus_tag LOCUS_09470 2104 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 3542 2109 gene locus_tag LOCUS_09480 3542 2109 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871161.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence82 712 1365 gene locus_tag LOCUS_09490 712 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1358 2095 gene locus_tag LOCUS_09500 1358 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2230 3402 gene locus_tag LOCUS_09510 gene tdh 2230 3402 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 protein_id gnl|my_center|LOCUS_09510 3595 3729 gene locus_tag LOCUS_09520 3595 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 3839 3964 gene locus_tag LOCUS_09530 3839 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence83 1081 755 gene locus_tag LOCUS_09540 1081 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1452 1051 gene locus_tag LOCUS_09550 1452 1051 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545820.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence84 1030 1287 gene locus_tag LOCUS_09560 1030 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 <3960 1359 gene locus_tag LOCUS_09570 <3960 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461874.1:heavy metal translocating P-type ATPase >Feature sequence85 1513 1082 gene locus_tag LOCUS_09580 1513 1082 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250661.1 protein_id gnl|my_center|LOCUS_09580 1910 1497 gene locus_tag LOCUS_09590 1910 1497 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020231.1 protein_id gnl|my_center|LOCUS_09590 2641 2994 gene locus_tag LOCUS_09600 2641 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence86 1289 990 gene locus_tag LOCUS_09610 1289 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1416 1331 gene locus_tag LOCUS_t00400 1416 1331 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2858 1446 gene locus_tag LOCUS_09620 2858 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3363 2872 gene locus_tag LOCUS_09630 3363 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence87 202 654 gene locus_tag LOCUS_09640 gene tsaE 202 654 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_09640 1995 727 gene locus_tag LOCUS_09650 1995 727 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963649.1 protein_id gnl|my_center|LOCUS_09650 3203 2109 gene locus_tag LOCUS_09660 3203 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence88 633 1049 gene locus_tag LOCUS_09670 gene arfB 633 1049 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_09670 1274 2074 gene locus_tag LOCUS_09680 1274 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2184 2945 gene locus_tag LOCUS_09690 2184 2945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008122.1 protein_id gnl|my_center|LOCUS_09690 3070 3315 gene locus_tag LOCUS_09700 3070 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence89 729 40 gene locus_tag LOCUS_09710 729 40 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_09710 1254 817 gene locus_tag LOCUS_09720 1254 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1686 1309 gene locus_tag LOCUS_09730 1686 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2931 1786 gene locus_tag LOCUS_09740 2931 1786 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070653.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence90 >Feature sequence91 547 1068 gene locus_tag LOCUS_09750 gene rplJ 547 1068 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_09750 1250 1657 gene locus_tag LOCUS_09760 gene rplL 1250 1657 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_09760 2147 2842 gene locus_tag LOCUS_09770 2147 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09770 >Feature sequence92 <3025 347 gene locus_tag LOCUS_09780 <3025 347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000045572.1:excinuclease ABC subunit UvrA >Feature sequence93 1158 523 gene locus_tag LOCUS_09790 1158 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1697 1401 gene locus_tag LOCUS_09800 1697 1401 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_09800 <2937 1850 gene locus_tag LOCUS_09810 <2937 1850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005172221.1:NAD-dependent DNA ligase LigA >Feature sequence94 <1 690 gene locus_tag LOCUS_09820 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002859745.1:translational GTPase TypA 2101 821 gene locus_tag LOCUS_09830 2101 821 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_09830 2597 2328 gene locus_tag LOCUS_09840 2597 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2689 2616 gene locus_tag LOCUS_t00410 2689 2616 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence95 1876 410 gene locus_tag LOCUS_09850 gene gltX 1876 410 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435581.1 protein_id gnl|my_center|LOCUS_09850 <2639 1994 gene locus_tag LOCUS_09860 <2639 1994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481810.1:RNA methyltransferase >Feature sequence96 460 80 gene locus_tag LOCUS_09870 460 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2415 484 gene locus_tag LOCUS_09880 2415 484 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence97 697 894 gene locus_tag LOCUS_09890 697 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence98 <1 1953 gene locus_tag LOCUS_09900 <1 1953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_204874017.1:helicase-related protein 1958 2194 gene locus_tag LOCUS_09910 1958 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence99 215 568 gene locus_tag LOCUS_09920 215 568 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869618.1 protein_id gnl|my_center|LOCUS_09920 699 1703 gene locus_tag LOCUS_09930 699 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930