>Feature sequence001 1145 255 gene locus_tag LOCUS_00010 gene cutB 1145 255 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_00010 1733 1158 gene locus_tag LOCUS_00020 1733 1158 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_00020 4026 1747 gene locus_tag LOCUS_00030 4026 1747 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_00030 4272 4580 gene locus_tag LOCUS_00040 4272 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4577 4900 gene locus_tag LOCUS_00050 4577 4900 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174252.1 protein_id gnl|my_center|LOCUS_00050 4913 5344 gene locus_tag LOCUS_00060 4913 5344 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 protein_id gnl|my_center|LOCUS_00060 5928 5419 gene locus_tag LOCUS_00070 5928 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6122 5925 gene locus_tag LOCUS_00080 6122 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6128 7648 gene locus_tag LOCUS_00090 6128 7648 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589538.1 protein_id gnl|my_center|LOCUS_00090 7597 9030 gene locus_tag LOCUS_00100 7597 9030 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589538.1 protein_id gnl|my_center|LOCUS_00100 9118 9906 gene locus_tag LOCUS_00110 9118 9906 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_00110 9999 10487 gene locus_tag LOCUS_00120 gene nuoE 9999 10487 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_00120 10484 11773 gene locus_tag LOCUS_00130 10484 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11798 14521 gene locus_tag LOCUS_00140 gene fdhF 11798 14521 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_00140 14631 16220 gene locus_tag LOCUS_00150 gene ggt 14631 16220 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808651.1 protein_id gnl|my_center|LOCUS_00150 16270 17586 gene locus_tag LOCUS_00160 16270 17586 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936956.1 protein_id gnl|my_center|LOCUS_00160 17583 17912 gene locus_tag LOCUS_00170 17583 17912 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461381.1 protein_id gnl|my_center|LOCUS_00170 17927 19267 gene locus_tag LOCUS_00180 17927 19267 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246425.1 protein_id gnl|my_center|LOCUS_00180 19355 20467 gene locus_tag LOCUS_00190 19355 20467 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_00190 20590 21309 gene locus_tag LOCUS_00200 20590 21309 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249420.1 protein_id gnl|my_center|LOCUS_00200 21332 22726 gene locus_tag LOCUS_00210 21332 22726 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_00210 22870 23145 gene locus_tag LOCUS_00220 22870 23145 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_00220 23135 24073 gene locus_tag LOCUS_00230 23135 24073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23925 24000 gene locus_tag LOCUS_t00010 23925 24000 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25428 24070 gene locus_tag LOCUS_00240 25428 24070 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 protein_id gnl|my_center|LOCUS_00240 27112 25436 gene locus_tag LOCUS_00250 27112 25436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28231 27194 gene locus_tag LOCUS_00260 28231 27194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 28396 28854 gene locus_tag LOCUS_00270 28396 28854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29090 30838 gene locus_tag LOCUS_00280 gene shc 29090 30838 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00280 30769 31056 gene locus_tag LOCUS_00290 30769 31056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00290 31053 32078 gene locus_tag LOCUS_00300 31053 32078 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_00300 32057 32893 gene locus_tag LOCUS_00310 32057 32893 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942543.1 protein_id gnl|my_center|LOCUS_00310 32915 33916 gene locus_tag LOCUS_00320 gene hpnH 32915 33916 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_00320 33937 34707 gene locus_tag LOCUS_00330 33937 34707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 34826 35269 gene locus_tag LOCUS_00340 34826 35269 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023127.1 protein_id gnl|my_center|LOCUS_00340 35418 36278 gene locus_tag LOCUS_00350 gene hpnD 35418 36278 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225224.1 protein_id gnl|my_center|LOCUS_00350 36291 37682 gene locus_tag LOCUS_00360 36291 37682 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_00360 37703 38731 gene locus_tag LOCUS_00370 37703 38731 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626531.1 protein_id gnl|my_center|LOCUS_00370 38759 40471 gene locus_tag LOCUS_00380 38759 40471 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930994.1 protein_id gnl|my_center|LOCUS_00380 40491 41570 gene locus_tag LOCUS_00390 40491 41570 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812767.1 protein_id gnl|my_center|LOCUS_00390 41907 42608 gene locus_tag LOCUS_00400 41907 42608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42787 44175 gene locus_tag LOCUS_00410 42787 44175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 46051 44345 gene locus_tag LOCUS_00420 46051 44345 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_00420 46274 47095 gene locus_tag LOCUS_00430 46274 47095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 47229 48365 gene locus_tag LOCUS_00440 47229 48365 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545576.1 protein_id gnl|my_center|LOCUS_00440 48362 49945 gene locus_tag LOCUS_00450 gene serA 48362 49945 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_00450 49969 51276 gene locus_tag LOCUS_00460 49969 51276 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943919.1 protein_id gnl|my_center|LOCUS_00460 51258 52553 gene locus_tag LOCUS_00470 51258 52553 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_00470 52550 53992 gene locus_tag LOCUS_00480 52550 53992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 54686 54003 gene locus_tag LOCUS_00490 54686 54003 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_00490 58551 54709 gene locus_tag LOCUS_00500 58551 54709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 58848 59831 gene locus_tag LOCUS_00510 58848 59831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 60084 59875 gene locus_tag LOCUS_00520 60084 59875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 60645 60127 gene locus_tag LOCUS_00530 60645 60127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 60664 60676 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence002 319 8 gene locus_tag LOCUS_00540 319 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 492 295 gene locus_tag LOCUS_00550 492 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 1426 611 gene locus_tag LOCUS_00560 1426 611 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966265.1 protein_id gnl|my_center|LOCUS_00560 1906 1538 gene locus_tag LOCUS_00570 1906 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 2546 2103 gene locus_tag LOCUS_00580 2546 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 2864 2562 gene locus_tag LOCUS_00590 2864 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 3123 2836 gene locus_tag LOCUS_00600 3123 2836 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_00600 3581 3291 gene locus_tag LOCUS_00610 3581 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 3811 3578 gene locus_tag LOCUS_00620 3811 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 4183 3980 gene locus_tag LOCUS_00630 4183 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 5325 4309 gene locus_tag LOCUS_00640 5325 4309 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529865.1 protein_id gnl|my_center|LOCUS_00640 6404 5370 gene locus_tag LOCUS_00650 6404 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064160.1 protein_id gnl|my_center|LOCUS_00650 7587 6541 gene locus_tag LOCUS_00660 7587 6541 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965994.1 protein_id gnl|my_center|LOCUS_00660 8375 7680 gene locus_tag LOCUS_00670 8375 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 8480 8719 gene locus_tag LOCUS_00680 8480 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 9393 8701 gene locus_tag LOCUS_00690 9393 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 10476 9517 gene locus_tag LOCUS_00700 10476 9517 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807628.1 protein_id gnl|my_center|LOCUS_00700 11266 10487 gene locus_tag LOCUS_00710 11266 10487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_00710 11584 11390 gene locus_tag LOCUS_00720 11584 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 12725 11739 gene locus_tag LOCUS_00730 12725 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 13866 12748 gene locus_tag LOCUS_00740 13866 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 16164 13894 gene locus_tag LOCUS_00750 16164 13894 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_00750 16642 16169 gene locus_tag LOCUS_00760 16642 16169 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_00760 17529 16645 gene locus_tag LOCUS_00770 17529 16645 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_00770 19874 17526 gene locus_tag LOCUS_00780 19874 17526 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_00780 21073 19892 gene locus_tag LOCUS_00790 21073 19892 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064221.1 protein_id gnl|my_center|LOCUS_00790 21864 21160 gene locus_tag LOCUS_00800 21864 21160 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_00800 22636 21851 gene locus_tag LOCUS_00810 22636 21851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064072.1 protein_id gnl|my_center|LOCUS_00810 23582 22623 gene locus_tag LOCUS_00820 23582 22623 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086139.1 protein_id gnl|my_center|LOCUS_00820 24465 23593 gene locus_tag LOCUS_00830 24465 23593 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965993.1 protein_id gnl|my_center|LOCUS_00830 25227 24520 gene locus_tag LOCUS_00840 25227 24520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_00840 26135 25221 gene locus_tag LOCUS_00850 26135 25221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965992.1 protein_id gnl|my_center|LOCUS_00850 26834 26364 gene locus_tag LOCUS_00860 26834 26364 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_00860 27757 26837 gene locus_tag LOCUS_00870 27757 26837 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_00870 30088 27812 gene locus_tag LOCUS_00880 30088 27812 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_00880 31484 30078 gene locus_tag LOCUS_00890 31484 30078 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926605.1 protein_id gnl|my_center|LOCUS_00890 31796 34387 gene locus_tag LOCUS_00900 31796 34387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 35226 34360 gene locus_tag LOCUS_00910 35226 34360 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_00910 36275 35292 gene locus_tag LOCUS_00920 36275 35292 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_00920 36988 36275 gene locus_tag LOCUS_00930 gene rfbF 36988 36275 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_00930 37974 36985 gene locus_tag LOCUS_00940 37974 36985 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_00940 38438 37971 gene locus_tag LOCUS_00950 38438 37971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 38981 39643 gene locus_tag LOCUS_00960 38981 39643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 39609 40055 gene locus_tag LOCUS_00970 39609 40055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 40358 40705 gene locus_tag LOCUS_00980 40358 40705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 40842 41564 gene locus_tag LOCUS_00990 40842 41564 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_00990 42706 41597 gene locus_tag LOCUS_01000 42706 41597 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684567.1 protein_id gnl|my_center|LOCUS_01000 42792 42959 gene locus_tag LOCUS_01010 42792 42959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 43149 42982 gene locus_tag LOCUS_01020 43149 42982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 43387 43187 gene locus_tag LOCUS_01030 43387 43187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 44884 43403 gene locus_tag LOCUS_01040 gene gcvPB 44884 43403 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_01040 46254 44899 gene locus_tag LOCUS_01050 gene gcvPA 46254 44899 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_01050 46640 46251 gene locus_tag LOCUS_01060 gene gcvH 46640 46251 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 protein_id gnl|my_center|LOCUS_01060 47751 46648 gene locus_tag LOCUS_01070 gene gcvT 47751 46648 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_01070 48623 47751 gene locus_tag LOCUS_01080 48623 47751 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_01080 49477 48620 gene locus_tag LOCUS_01090 gene folD 49477 48620 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_01090 49738 50487 gene locus_tag LOCUS_01100 gene fabG 49738 50487 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_01100 50875 50564 gene locus_tag LOCUS_01110 50875 50564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 51251 50955 gene locus_tag LOCUS_01120 51251 50955 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_01120 51590 51288 gene locus_tag LOCUS_01130 51590 51288 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_01130 51770 52600 gene locus_tag LOCUS_01140 gene proC 51770 52600 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_01140 54973 52640 gene locus_tag LOCUS_01150 54973 52640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 >Feature sequence003 3103 338 gene locus_tag LOCUS_01160 3103 338 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528450.1 protein_id gnl|my_center|LOCUS_01160 4182 3634 gene locus_tag LOCUS_01170 4182 3634 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_01170 4671 4198 gene locus_tag LOCUS_01180 4671 4198 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_01180 5757 4831 gene locus_tag LOCUS_01190 5757 4831 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_01190 6036 5869 gene locus_tag LOCUS_01200 6036 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 6268 7302 gene locus_tag LOCUS_01210 gene amrS 6268 7302 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052453.1 protein_id gnl|my_center|LOCUS_01210 7772 7341 gene locus_tag LOCUS_01220 7772 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 8936 7824 gene locus_tag LOCUS_01230 8936 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 9687 9217 gene locus_tag LOCUS_01240 9687 9217 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_01240 10598 9810 gene locus_tag LOCUS_01250 10598 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 11058 12197 gene locus_tag LOCUS_01260 11058 12197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 12386 12850 gene locus_tag LOCUS_01270 12386 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 12853 13329 gene locus_tag LOCUS_01280 12853 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 15799 13415 gene locus_tag LOCUS_01290 15799 13415 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021816.1 protein_id gnl|my_center|LOCUS_01290 16745 15747 gene locus_tag LOCUS_01300 16745 15747 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224439.1 protein_id gnl|my_center|LOCUS_01300 17190 16729 gene locus_tag LOCUS_01310 17190 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01310 17343 17353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18952 17723 gene locus_tag LOCUS_01320 18952 17723 CDS product pyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393422.1 protein_id gnl|my_center|LOCUS_01320 19842 18940 gene locus_tag LOCUS_01330 19842 18940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 20115 21206 gene locus_tag LOCUS_01340 gene rtcA 20115 21206 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_01340 21745 21281 gene locus_tag LOCUS_01350 21745 21281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 22490 21894 gene locus_tag LOCUS_01360 22490 21894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 24249 22726 gene locus_tag LOCUS_01370 24249 22726 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839915.1 protein_id gnl|my_center|LOCUS_01370 25576 24242 gene locus_tag LOCUS_01380 25576 24242 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941139.1 protein_id gnl|my_center|LOCUS_01380 27021 25621 gene locus_tag LOCUS_01390 27021 25621 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_01390 27548 27874 gene locus_tag LOCUS_01400 27548 27874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 27939 31046 gene locus_tag LOCUS_01410 gene fdnG 27939 31046 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 transl_except (pos:28497..28499,aa:Sec) note codon on position 187 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01410 31048 31842 gene locus_tag LOCUS_01420 gene fdxH 31048 31842 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070510.1 protein_id gnl|my_center|LOCUS_01420 31844 32518 gene locus_tag LOCUS_01430 31844 32518 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391990.1 protein_id gnl|my_center|LOCUS_01430 32518 33369 gene locus_tag LOCUS_01440 32518 33369 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937880.1 protein_id gnl|my_center|LOCUS_01440 34543 33419 gene locus_tag LOCUS_01450 34543 33419 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_01450 34630 35352 gene locus_tag LOCUS_01460 34630 35352 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_01460 35953 35327 gene locus_tag LOCUS_01470 gene atpD 35953 35327 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173332.1 protein_id gnl|my_center|LOCUS_01470 37334 35904 gene locus_tag LOCUS_01480 37334 35904 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173333.1 protein_id gnl|my_center|LOCUS_01480 39080 37338 gene locus_tag LOCUS_01490 39080 37338 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496424.1 protein_id gnl|my_center|LOCUS_01490 39419 39087 gene locus_tag LOCUS_01500 39419 39087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 40457 39420 gene locus_tag LOCUS_01510 40457 39420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 41040 40444 gene locus_tag LOCUS_01520 41040 40444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 41261 41043 gene locus_tag LOCUS_01530 41261 41043 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289441.1 protein_id gnl|my_center|LOCUS_01530 43177 41279 gene locus_tag LOCUS_01540 43177 41279 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060932.1 protein_id gnl|my_center|LOCUS_01540 43518 43174 gene locus_tag LOCUS_01550 43518 43174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 44054 43869 gene locus_tag LOCUS_01560 44054 43869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 44600 44082 gene locus_tag LOCUS_01570 gene raiA 44600 44082 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957331.1 protein_id gnl|my_center|LOCUS_01570 45546 44569 gene locus_tag LOCUS_01580 45546 44569 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582674.1 protein_id gnl|my_center|LOCUS_01580 46736 45555 gene locus_tag LOCUS_01590 46736 45555 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_01590 47050 46733 gene locus_tag LOCUS_01600 47050 46733 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_01600 47627 47037 gene locus_tag LOCUS_01610 47627 47037 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545865.1 protein_id gnl|my_center|LOCUS_01610 48492 47641 gene locus_tag LOCUS_01620 48492 47641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 49035 48781 gene locus_tag LOCUS_01630 49035 48781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 50042 49344 gene locus_tag LOCUS_01640 50042 49344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 50537 50046 gene locus_tag LOCUS_01650 50537 50046 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201132289.1 protein_id gnl|my_center|LOCUS_01650 51300 50794 gene locus_tag LOCUS_01660 51300 50794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 51374 51964 gene locus_tag LOCUS_01670 51374 51964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 <52813 51980 gene locus_tag LOCUS_01680 <52813 51980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546507.1:cation-transporting P-type ATPase >Feature sequence004 838 1089 gene locus_tag LOCUS_01690 838 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 1397 2608 gene locus_tag LOCUS_01700 1397 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 2846 3112 gene locus_tag LOCUS_01710 2846 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 3192 4634 gene locus_tag LOCUS_01720 3192 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 6907 4646 gene locus_tag LOCUS_01730 6907 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 7728 6964 gene locus_tag LOCUS_01740 7728 6964 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_01740 8600 7725 gene locus_tag LOCUS_01750 8600 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 8745 8602 gene locus_tag LOCUS_01760 8745 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 9803 8745 gene locus_tag LOCUS_01770 gene thrC 9803 8745 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_01770 11111 9807 gene locus_tag LOCUS_01780 11111 9807 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_01780 11836 11108 gene locus_tag LOCUS_01790 11836 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01790 12320 11727 gene locus_tag LOCUS_01800 12320 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01800 12793 12329 gene locus_tag LOCUS_01810 12793 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01810 13245 12730 gene locus_tag LOCUS_01820 13245 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01820 15449 13347 gene locus_tag LOCUS_01830 gene recG 15449 13347 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_01830 15988 15512 gene locus_tag LOCUS_01840 gene greA 15988 15512 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941932.1 protein_id gnl|my_center|LOCUS_01840 19251 15985 gene locus_tag LOCUS_01850 gene carB 19251 15985 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_01850 20423 19254 gene locus_tag LOCUS_01860 gene carA 20423 19254 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_01860 21688 20420 gene locus_tag LOCUS_01870 gene pyrB 21688 20420 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_01870 22456 21776 gene locus_tag LOCUS_01880 gene lepB 22456 21776 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_01880 24264 22465 gene locus_tag LOCUS_01890 gene lepA 24264 22465 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_01890 25345 24383 gene locus_tag LOCUS_01900 25345 24383 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_01900 26254 25349 gene locus_tag LOCUS_01910 26254 25349 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_01910 27527 26424 gene locus_tag LOCUS_01920 gene fbp 27527 26424 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228346.1 protein_id gnl|my_center|LOCUS_01920 29723 27636 gene locus_tag LOCUS_01930 gene lptD 29723 27636 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_01930 31021 29720 gene locus_tag LOCUS_01940 31021 29720 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_01940 31790 31026 gene locus_tag LOCUS_01950 31790 31026 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_01950 31927 31787 gene locus_tag LOCUS_01960 31927 31787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 32205 32290 gene locus_tag LOCUS_t00020 32205 32290 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 34061 32826 gene locus_tag LOCUS_01970 gene trpB 34061 32826 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083569.1 protein_id gnl|my_center|LOCUS_01970 34684 34058 gene locus_tag LOCUS_01980 34684 34058 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_01980 35460 34684 gene locus_tag LOCUS_01990 gene trpC 35460 34684 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_01990 36583 35537 gene locus_tag LOCUS_02000 gene trpD 36583 35537 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_02000 37091 36603 gene locus_tag LOCUS_02010 37091 36603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 38161 37151 gene locus_tag LOCUS_02020 38161 37151 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_02020 38843 38217 gene locus_tag LOCUS_02030 gene rpsD 38843 38217 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_02030 39266 38874 gene locus_tag LOCUS_02040 gene rpsK 39266 38874 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_02040 39672 39286 gene locus_tag LOCUS_02050 gene rpsM 39672 39286 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_02050 40081 39863 gene locus_tag LOCUS_02060 gene infA 40081 39863 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_02060 40854 40105 gene locus_tag LOCUS_02070 gene map 40854 40105 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943464.1 protein_id gnl|my_center|LOCUS_02070 41510 40851 gene locus_tag LOCUS_02080 41510 40851 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_02080 42817 41507 gene locus_tag LOCUS_02090 gene secY 42817 41507 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_02090 43261 42821 gene locus_tag LOCUS_02100 gene rplO 43261 42821 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_02100 43443 43261 gene locus_tag LOCUS_02110 gene rpmD 43443 43261 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720933.1 protein_id gnl|my_center|LOCUS_02110 43974 43477 gene locus_tag LOCUS_02120 gene rpsE 43974 43477 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_02120 44365 43988 gene locus_tag LOCUS_02130 gene rplR 44365 43988 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_02130 44924 44385 gene locus_tag LOCUS_02140 gene rplF 44924 44385 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_02140 45358 44960 gene locus_tag LOCUS_02150 gene rpsH 45358 44960 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925182.1 protein_id gnl|my_center|LOCUS_02150 45554 45369 gene locus_tag LOCUS_02160 45554 45369 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938611.1 protein_id gnl|my_center|LOCUS_02160 46219 45569 gene locus_tag LOCUS_02170 gene rplE 46219 45569 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_02170 46564 46232 gene locus_tag LOCUS_02180 gene rplX 46564 46232 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_02180 46947 46579 gene locus_tag LOCUS_02190 gene rplN 46947 46579 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_02190 47234 46977 gene locus_tag LOCUS_02200 gene rpsQ 47234 46977 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_02200 47436 47239 gene locus_tag LOCUS_02210 gene rpmC 47436 47239 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_02210 47849 47433 gene locus_tag LOCUS_02220 gene rplP 47849 47433 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_02220 48515 47853 gene locus_tag LOCUS_02230 gene rpsC 48515 47853 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_02230 48857 48525 gene locus_tag LOCUS_02240 gene rplV 48857 48525 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148025.1 protein_id gnl|my_center|LOCUS_02240 49195 48902 gene locus_tag LOCUS_02250 gene rpsS 49195 48902 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_02250 50032 49208 gene locus_tag LOCUS_02260 gene rplB 50032 49208 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_02260 50324 50034 gene locus_tag LOCUS_02270 gene rplW 50324 50034 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_02270 50944 50321 gene locus_tag LOCUS_02280 gene rplD 50944 50321 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_02280 51611 50958 gene locus_tag LOCUS_02290 gene rplC 51611 50958 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_02290 51963 51646 gene locus_tag LOCUS_02300 gene rpsJ 51963 51646 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence005 1083 472 gene locus_tag LOCUS_02310 gene pgsA 1083 472 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_02310 1723 1058 gene locus_tag LOCUS_02320 1723 1058 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_02320 3128 1731 gene locus_tag LOCUS_02330 gene purF 3128 1731 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_02330 5328 3121 gene locus_tag LOCUS_02340 gene purL 5328 3121 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_02340 6056 5334 gene locus_tag LOCUS_02350 gene purQ 6056 5334 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_02350 6304 6053 gene locus_tag LOCUS_02360 gene purS 6304 6053 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722248.1 protein_id gnl|my_center|LOCUS_02360 7075 6365 gene locus_tag LOCUS_02370 7075 6365 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932640.1 protein_id gnl|my_center|LOCUS_02370 8408 7107 gene locus_tag LOCUS_02380 gene purB 8408 7107 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_02380 9720 8464 gene locus_tag LOCUS_02390 9720 8464 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_02390 11857 9755 gene locus_tag LOCUS_02400 gene pnp 11857 9755 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_02400 12150 11881 gene locus_tag LOCUS_02410 gene rpsO 12150 11881 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_02410 13105 12173 gene locus_tag LOCUS_02420 gene truB 13105 12173 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_02420 14095 13121 gene locus_tag LOCUS_02430 14095 13121 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_02430 14451 14092 gene locus_tag LOCUS_02440 gene rbfA 14451 14092 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_02440 14753 14466 gene locus_tag LOCUS_02450 14753 14466 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_02450 17097 14761 gene locus_tag LOCUS_02460 17097 14761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02460 18435 17128 gene locus_tag LOCUS_02470 gene nusA 18435 17128 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_02470 18934 18467 gene locus_tag LOCUS_02480 gene rimP 18934 18467 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_02480 19579 19061 gene locus_tag LOCUS_02490 gene rimI 19579 19061 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_02490 20777 19617 gene locus_tag LOCUS_02500 20777 19617 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868844.1 protein_id gnl|my_center|LOCUS_02500 21468 20797 gene locus_tag LOCUS_02510 21468 20797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 30928 22199 gene locus_tag LOCUS_02520 30928 22199 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963929.1 protein_id gnl|my_center|LOCUS_02520 31614 31312 gene locus_tag LOCUS_02530 31614 31312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 32864 32247 gene locus_tag LOCUS_02540 32864 32247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02540 33886 32966 gene locus_tag LOCUS_02550 gene secF 33886 32966 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943254.1 protein_id gnl|my_center|LOCUS_02550 35499 33901 gene locus_tag LOCUS_02560 gene secD 35499 33901 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_02560 35833 35507 gene locus_tag LOCUS_02570 gene yajC 35833 35507 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_02570 36963 35821 gene locus_tag LOCUS_02580 gene tgt 36963 35821 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_02580 38008 36977 gene locus_tag LOCUS_02590 gene queA 38008 36977 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943258.1 protein_id gnl|my_center|LOCUS_02590 39179 38022 gene locus_tag LOCUS_02600 39179 38022 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_02600 40026 39274 gene locus_tag LOCUS_02610 40026 39274 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_02610 41363 40035 gene locus_tag LOCUS_02620 41363 40035 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_02620 42028 41369 gene locus_tag LOCUS_02630 42028 41369 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_02630 43239 42025 gene locus_tag LOCUS_02640 gene coaBC 43239 42025 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_02640 44590 43220 gene locus_tag LOCUS_02650 44590 43220 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_02650 45256 44768 gene locus_tag LOCUS_02660 gene coaD 45256 44768 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_02660 45822 45253 gene locus_tag LOCUS_02670 gene rsmD 45822 45253 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_02670 46502 45819 gene locus_tag LOCUS_02680 46502 45819 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_02680 46986 46450 gene locus_tag LOCUS_02690 46986 46450 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545624.1 protein_id gnl|my_center|LOCUS_02690 47333 46983 gene locus_tag LOCUS_02700 47333 46983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 47738 47364 gene locus_tag LOCUS_02710 gene queD 47738 47364 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_02710 48580 47726 gene locus_tag LOCUS_02720 48580 47726 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460507.1 protein_id gnl|my_center|LOCUS_02720 49955 48666 gene locus_tag LOCUS_02730 49955 48666 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_02730 >Feature sequence006 879 1688 gene locus_tag LOCUS_02740 879 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 1729 2283 gene locus_tag LOCUS_02750 1729 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2535 3104 gene locus_tag LOCUS_02760 2535 3104 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_02760 4090 3164 gene locus_tag LOCUS_02770 4090 3164 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 protein_id gnl|my_center|LOCUS_02770 4603 4097 gene locus_tag LOCUS_02780 4603 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 5974 5246 gene locus_tag LOCUS_02790 5974 5246 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_02790 6870 5959 gene locus_tag LOCUS_02800 gene prmA 6870 5959 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_02800 7064 7741 gene locus_tag LOCUS_02810 7064 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 8702 7899 gene locus_tag LOCUS_02820 gene uppP 8702 7899 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_02820 8821 9855 gene locus_tag LOCUS_02830 8821 9855 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229618.1 protein_id gnl|my_center|LOCUS_02830 10525 9830 gene locus_tag LOCUS_02840 10525 9830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142892.1 protein_id gnl|my_center|LOCUS_02840 11252 10542 gene locus_tag LOCUS_02850 11252 10542 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227934.1 protein_id gnl|my_center|LOCUS_02850 12173 11253 gene locus_tag LOCUS_02860 12173 11253 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727510.1 protein_id gnl|my_center|LOCUS_02860 13045 12170 gene locus_tag LOCUS_02870 13045 12170 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_02870 14337 13129 gene locus_tag LOCUS_02880 14337 13129 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_02880 14798 14598 gene locus_tag LOCUS_02890 14798 14598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02890 15553 14723 gene locus_tag LOCUS_02900 15553 14723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02900 14827 14858 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15862 16353 gene locus_tag LOCUS_02910 15862 16353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 16971 17174 gene locus_tag LOCUS_02920 16971 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 17224 18324 gene locus_tag LOCUS_02930 gene fni 17224 18324 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_02930 18321 18716 gene locus_tag LOCUS_02940 18321 18716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 18739 19437 gene locus_tag LOCUS_02950 18739 19437 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688188.1 protein_id gnl|my_center|LOCUS_02950 19437 24248 gene locus_tag LOCUS_02960 19437 24248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 24258 24539 gene locus_tag LOCUS_02970 24258 24539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 24536 25384 gene locus_tag LOCUS_02980 24536 25384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 26053 25373 gene locus_tag LOCUS_02990 26053 25373 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_02990 26442 27842 gene locus_tag LOCUS_03000 26442 27842 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_03000 29925 27847 gene locus_tag LOCUS_03010 29925 27847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 31103 29922 gene locus_tag LOCUS_03020 31103 29922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 32037 31111 gene locus_tag LOCUS_03030 32037 31111 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582473.1 protein_id gnl|my_center|LOCUS_03030 32500 32084 gene locus_tag LOCUS_03040 32500 32084 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_03040 32643 33371 gene locus_tag LOCUS_03050 32643 33371 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_03050 33382 35556 gene locus_tag LOCUS_03060 33382 35556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 35553 36260 gene locus_tag LOCUS_03070 gene lolA 35553 36260 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767395.1 protein_id gnl|my_center|LOCUS_03070 36419 36847 gene locus_tag LOCUS_03080 36419 36847 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943824.1 protein_id gnl|my_center|LOCUS_03080 37774 36860 gene locus_tag LOCUS_03090 gene speE 37774 36860 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_03090 38255 37833 gene locus_tag LOCUS_03100 gene speD 38255 37833 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545906.1 protein_id gnl|my_center|LOCUS_03100 39415 38396 gene locus_tag LOCUS_03110 gene mltG 39415 38396 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_03110 39834 39412 gene locus_tag LOCUS_03120 gene ruvX 39834 39412 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_03120 40031 40600 gene locus_tag LOCUS_03130 40031 40600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 41958 40615 gene locus_tag LOCUS_03140 41958 40615 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940959.1 protein_id gnl|my_center|LOCUS_03140 43748 42006 gene locus_tag LOCUS_03150 43748 42006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 43964 45331 gene locus_tag LOCUS_03160 gene radA 43964 45331 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_03160 45331 46605 gene locus_tag LOCUS_03170 gene serS 45331 46605 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_03170 46757 47668 gene locus_tag LOCUS_03180 46757 47668 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_03180 47730 47803 gene locus_tag LOCUS_t00030 47730 47803 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 48529 48562 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48583 49299 gene locus_tag LOCUS_03190 48583 49299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03190 >Feature sequence007 803 1435 gene locus_tag LOCUS_03200 803 1435 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_03200 2241 1432 gene locus_tag LOCUS_03210 2241 1432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_03210 3046 2273 gene locus_tag LOCUS_03220 3046 2273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927109.1 protein_id gnl|my_center|LOCUS_03220 4130 3126 gene locus_tag LOCUS_03230 4130 3126 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_03230 4378 4590 gene locus_tag LOCUS_03240 4378 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 6481 4640 gene locus_tag LOCUS_03250 6481 4640 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_03250 8263 6485 gene locus_tag LOCUS_03260 8263 6485 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_03260 8441 8818 gene locus_tag LOCUS_03270 8441 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 8799 9584 gene locus_tag LOCUS_03280 8799 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03280 10420 9719 gene locus_tag LOCUS_03290 gene nfi 10420 9719 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_03290 10779 12767 gene locus_tag LOCUS_03300 10779 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 13918 12764 gene locus_tag LOCUS_03310 gene dnaJ 13918 12764 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_03310 14612 13929 gene locus_tag LOCUS_03320 14612 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 15784 14732 gene locus_tag LOCUS_03330 gene hrcA 15784 14732 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_03330 15950 18316 gene locus_tag LOCUS_03340 15950 18316 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_03340 20044 18380 gene locus_tag LOCUS_03350 20044 18380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 20832 20098 gene locus_tag LOCUS_03360 20832 20098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_03360 21613 20846 gene locus_tag LOCUS_03370 21613 20846 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_03370 22125 21616 gene locus_tag LOCUS_03380 22125 21616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 22790 22401 gene locus_tag LOCUS_03390 22790 22401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 23142 23378 gene locus_tag LOCUS_03400 23142 23378 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_03400 24070 23411 gene locus_tag LOCUS_03410 24070 23411 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_03410 25859 24099 gene locus_tag LOCUS_03420 25859 24099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 26630 25884 gene locus_tag LOCUS_03430 26630 25884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_03430 27405 26635 gene locus_tag LOCUS_03440 27405 26635 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_03440 28511 27525 gene locus_tag LOCUS_03450 28511 27525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 29644 28508 gene locus_tag LOCUS_03460 gene citZ 29644 28508 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903548.1 protein_id gnl|my_center|LOCUS_03460 31121 29748 gene locus_tag LOCUS_03470 31121 29748 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459135.1 protein_id gnl|my_center|LOCUS_03470 32812 31160 gene locus_tag LOCUS_03480 32812 31160 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941262.1 protein_id gnl|my_center|LOCUS_03480 33158 33532 gene locus_tag LOCUS_03490 33158 33532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 33715 34443 gene locus_tag LOCUS_03500 33715 34443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 34458 35423 gene locus_tag LOCUS_03510 34458 35423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 35504 35983 gene locus_tag LOCUS_03520 35504 35983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 35992 38970 gene locus_tag LOCUS_03530 35992 38970 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_03530 38994 40316 gene locus_tag LOCUS_03540 gene nrfD 38994 40316 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_03540 40313 40828 gene locus_tag LOCUS_03550 40313 40828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 40815 41336 gene locus_tag LOCUS_03560 40815 41336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 41333 42580 gene locus_tag LOCUS_03570 gene nrfD 41333 42580 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03570 42909 42658 gene locus_tag LOCUS_03580 42909 42658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 43308 42955 gene locus_tag LOCUS_03590 43308 42955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 43796 43431 gene locus_tag LOCUS_03600 43796 43431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 44108 45040 gene locus_tag LOCUS_03610 44108 45040 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966164.1 protein_id gnl|my_center|LOCUS_03610 45088 45498 gene locus_tag LOCUS_03620 45088 45498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 >Feature sequence008 1442 885 gene locus_tag LOCUS_03630 1442 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 2329 1439 gene locus_tag LOCUS_03640 2329 1439 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_03640 3384 2326 gene locus_tag LOCUS_03650 3384 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 5050 3446 gene locus_tag LOCUS_03660 5050 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 5826 5047 gene locus_tag LOCUS_03670 5826 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 6829 5846 gene locus_tag LOCUS_03680 6829 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 8754 6826 gene locus_tag LOCUS_03690 8754 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 10748 8856 gene locus_tag LOCUS_03700 10748 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 12285 10816 gene locus_tag LOCUS_03710 12285 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 12232 12552 gene locus_tag LOCUS_03720 12232 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 13578 12742 gene locus_tag LOCUS_03730 13578 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 14194 13604 gene locus_tag LOCUS_03740 14194 13604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 15710 14313 gene locus_tag LOCUS_03750 15710 14313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 15838 16140 gene locus_tag LOCUS_03760 15838 16140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 16415 16083 gene locus_tag LOCUS_03770 16415 16083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03770 17404 16400 gene locus_tag LOCUS_03780 17404 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03780 18926 17391 gene locus_tag LOCUS_03790 18926 17391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 17635 17652 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19330 19926 gene locus_tag LOCUS_03800 19330 19926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 21020 19986 gene locus_tag LOCUS_03810 21020 19986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 21590 21024 gene locus_tag LOCUS_03820 21590 21024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 22690 21560 gene locus_tag LOCUS_03830 22690 21560 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_03830 25784 22914 gene locus_tag LOCUS_03840 25784 22914 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528450.1 protein_id gnl|my_center|LOCUS_03840 26375 25797 gene locus_tag LOCUS_03850 26375 25797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 26599 26462 gene locus_tag LOCUS_03860 26599 26462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 27425 26604 gene locus_tag LOCUS_03870 27425 26604 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_03870 28701 27430 gene locus_tag LOCUS_03880 28701 27430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 29870 28713 gene locus_tag LOCUS_03890 gene hadC 29870 28713 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_03890 31209 30478 gene locus_tag LOCUS_03900 31209 30478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 32630 31371 gene locus_tag LOCUS_03910 32630 31371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 33808 32627 gene locus_tag LOCUS_03920 33808 32627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 34287 33805 gene locus_tag LOCUS_03930 34287 33805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 35062 34280 gene locus_tag LOCUS_03940 35062 34280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 36399 35059 gene locus_tag LOCUS_03950 gene nrfD 36399 35059 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_03950 39344 36396 gene locus_tag LOCUS_03960 39344 36396 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_03960 39948 39355 gene locus_tag LOCUS_03970 39948 39355 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_03970 40396 39968 gene locus_tag LOCUS_03980 40396 39968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 <41054 40480 gene locus_tag LOCUS_03990 <41054 40480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066275.1:PKD domain-containing protein >Feature sequence009 341 1168 gene locus_tag LOCUS_04000 341 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 1217 1456 gene locus_tag LOCUS_04010 1217 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04010 1475 2140 gene locus_tag LOCUS_04020 1475 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04020 2162 2422 gene locus_tag LOCUS_04030 2162 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04030 2452 3261 gene locus_tag LOCUS_04040 2452 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 3266 4414 gene locus_tag LOCUS_04050 3266 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 4490 6043 gene locus_tag LOCUS_04060 4490 6043 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_04060 6050 6775 gene locus_tag LOCUS_04070 6050 6775 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979688.1 protein_id gnl|my_center|LOCUS_04070 6777 7421 gene locus_tag LOCUS_04080 6777 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 7425 7850 gene locus_tag LOCUS_04090 7425 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 7861 8637 gene locus_tag LOCUS_04100 7861 8637 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_04100 8692 9348 gene locus_tag LOCUS_04110 8692 9348 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 protein_id gnl|my_center|LOCUS_04110 9335 9565 gene locus_tag LOCUS_04120 9335 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 9582 10136 gene locus_tag LOCUS_04130 9582 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 10151 11122 gene locus_tag LOCUS_04140 10151 11122 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104885.1 protein_id gnl|my_center|LOCUS_04140 11245 12036 gene locus_tag LOCUS_04150 11245 12036 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085172.1 protein_id gnl|my_center|LOCUS_04150 12580 12101 gene locus_tag LOCUS_04160 12580 12101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 12666 13028 gene locus_tag LOCUS_04170 12666 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 13044 14465 gene locus_tag LOCUS_04180 13044 14465 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_04180 14521 15300 gene locus_tag LOCUS_04190 14521 15300 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173656.1 protein_id gnl|my_center|LOCUS_04190 15308 16144 gene locus_tag LOCUS_04200 15308 16144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878142.1 protein_id gnl|my_center|LOCUS_04200 16218 17519 gene locus_tag LOCUS_04210 16218 17519 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_04210 17516 17923 gene locus_tag LOCUS_04220 17516 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 17991 18749 gene locus_tag LOCUS_04230 17991 18749 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405712.1 protein_id gnl|my_center|LOCUS_04230 19204 19917 gene locus_tag LOCUS_04240 19204 19917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04240 20930 19914 gene locus_tag LOCUS_04250 20930 19914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 21290 20934 gene locus_tag LOCUS_04260 21290 20934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 23074 21311 gene locus_tag LOCUS_04270 23074 21311 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_04270 24330 23110 gene locus_tag LOCUS_04280 24330 23110 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393460.1 protein_id gnl|my_center|LOCUS_04280 25494 24334 gene locus_tag LOCUS_04290 25494 24334 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887889.1 protein_id gnl|my_center|LOCUS_04290 26228 25491 gene locus_tag LOCUS_04300 26228 25491 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582866.1 protein_id gnl|my_center|LOCUS_04300 27221 26424 gene locus_tag LOCUS_04310 27221 26424 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208036286.1 protein_id gnl|my_center|LOCUS_04310 28437 27259 gene locus_tag LOCUS_04320 28437 27259 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_04320 28494 28727 gene locus_tag LOCUS_04330 28494 28727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 28729 29133 gene locus_tag LOCUS_04340 28729 29133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 29144 29845 gene locus_tag LOCUS_04350 29144 29845 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_04350 29842 30537 gene locus_tag LOCUS_04360 29842 30537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 30563 30886 gene locus_tag LOCUS_04370 30563 30886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 30956 31657 gene locus_tag LOCUS_04380 30956 31657 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_04380 31657 32568 gene locus_tag LOCUS_04390 31657 32568 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532114.1 protein_id gnl|my_center|LOCUS_04390 32579 33790 gene locus_tag LOCUS_04400 32579 33790 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_04400 33903 34145 gene locus_tag LOCUS_04410 33903 34145 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_04410 34139 34495 gene locus_tag LOCUS_04420 gene mazF 34139 34495 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_04420 34492 34743 gene locus_tag LOCUS_04430 34492 34743 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986881.1 protein_id gnl|my_center|LOCUS_04430 34880 35101 gene locus_tag LOCUS_04440 34880 35101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 35297 35524 gene locus_tag LOCUS_04450 35297 35524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 35684 35514 gene locus_tag LOCUS_04460 35684 35514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 36145 35927 gene locus_tag LOCUS_04470 36145 35927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 37539 36184 gene locus_tag LOCUS_04480 37539 36184 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879505.1 protein_id gnl|my_center|LOCUS_04480 38559 37663 gene locus_tag LOCUS_04490 38559 37663 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389792.1 protein_id gnl|my_center|LOCUS_04490 38708 39736 gene locus_tag LOCUS_04500 38708 39736 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence010 1586 840 gene locus_tag LOCUS_04510 1586 840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_04510 3129 1588 gene locus_tag LOCUS_04520 3129 1588 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_04520 3726 3247 gene locus_tag LOCUS_04530 3726 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4274 3723 gene locus_tag LOCUS_04540 4274 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 4804 4274 gene locus_tag LOCUS_04550 4804 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 5134 6291 gene locus_tag LOCUS_04560 5134 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 5814 5887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6317 6703 gene locus_tag LOCUS_04570 6317 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 7985 6750 gene locus_tag LOCUS_04580 7985 6750 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941036.1 protein_id gnl|my_center|LOCUS_04580 8103 9104 gene locus_tag LOCUS_04590 8103 9104 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_04590 9212 10525 gene locus_tag LOCUS_04600 9212 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 10522 11244 gene locus_tag LOCUS_04610 10522 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 11244 11954 gene locus_tag LOCUS_04620 11244 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 11951 12769 gene locus_tag LOCUS_04630 11951 12769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 12766 14112 gene locus_tag LOCUS_04640 12766 14112 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_04640 14317 14961 gene locus_tag LOCUS_04650 14317 14961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 14967 16190 gene locus_tag LOCUS_04660 14967 16190 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_04660 16203 17702 gene locus_tag LOCUS_04670 16203 17702 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530900.1 protein_id gnl|my_center|LOCUS_04670 17695 18570 gene locus_tag LOCUS_04680 17695 18570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 18584 19795 gene locus_tag LOCUS_04690 18584 19795 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_04690 19795 20604 gene locus_tag LOCUS_04700 gene mpgP 19795 20604 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228324.1 protein_id gnl|my_center|LOCUS_04700 20601 21911 gene locus_tag LOCUS_04710 20601 21911 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_04710 21908 22615 gene locus_tag LOCUS_04720 21908 22615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 23110 22652 gene locus_tag LOCUS_04730 23110 22652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04730 23667 23125 gene locus_tag LOCUS_04740 23667 23125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04740 23135 23139 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24513 23677 gene locus_tag LOCUS_04750 24513 23677 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969445.1 protein_id gnl|my_center|LOCUS_04750 25391 24510 gene locus_tag LOCUS_04760 25391 24510 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_04760 26635 25388 gene locus_tag LOCUS_04770 26635 25388 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173996.1 protein_id gnl|my_center|LOCUS_04770 26767 27150 gene locus_tag LOCUS_04780 26767 27150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 27485 28159 gene locus_tag LOCUS_04790 27485 28159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 28173 29381 gene locus_tag LOCUS_04800 28173 29381 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_04800 29378 30190 gene locus_tag LOCUS_04810 gene mpgP 29378 30190 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228324.1 protein_id gnl|my_center|LOCUS_04810 30187 31581 gene locus_tag LOCUS_04820 30187 31581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 31906 32064 gene locus_tag LOCUS_04830 31906 32064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 32113 32511 gene locus_tag LOCUS_04840 32113 32511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 33448 32639 gene locus_tag LOCUS_04850 33448 32639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 33377 33841 gene locus_tag LOCUS_04860 33377 33841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 33953 34954 gene locus_tag LOCUS_04870 33953 34954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 35059 36141 gene locus_tag LOCUS_04880 35059 36141 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_04880 36312 36554 gene locus_tag LOCUS_04890 36312 36554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 >Feature sequence011 1041 1397 gene locus_tag LOCUS_04900 1041 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 1881 3404 gene locus_tag LOCUS_04910 1881 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 3817 3401 gene locus_tag LOCUS_04920 3817 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3792 4700 gene locus_tag LOCUS_04930 3792 4700 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_04930 4697 5446 gene locus_tag LOCUS_04940 gene pgeF 4697 5446 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_04940 5450 6118 gene locus_tag LOCUS_04950 gene coaE 5450 6118 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_04950 6411 7697 gene locus_tag LOCUS_04960 gene rho 6411 7697 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_04960 7777 7986 gene locus_tag LOCUS_04970 gene rpmE 7777 7986 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_04970 8118 9182 gene locus_tag LOCUS_04980 gene prfA 8118 9182 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_04980 9192 10085 gene locus_tag LOCUS_04990 gene prmC 9192 10085 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_04990 10089 11339 gene locus_tag LOCUS_05000 gene murA 10089 11339 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_05000 11374 12036 gene locus_tag LOCUS_05010 gene hisG 11374 12036 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_05010 12033 13358 gene locus_tag LOCUS_05020 gene hisD 12033 13358 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_05020 13394 13987 gene locus_tag LOCUS_05030 gene hisB 13394 13987 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_05030 14051 14671 gene locus_tag LOCUS_05040 gene hisH 14051 14671 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_05040 14650 15372 gene locus_tag LOCUS_05050 gene hisA 14650 15372 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_05050 15374 16129 gene locus_tag LOCUS_05060 gene hisF 15374 16129 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_05060 16139 16834 gene locus_tag LOCUS_05070 gene hisIE 16139 16834 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041244947.1 protein_id gnl|my_center|LOCUS_05070 16930 17133 gene locus_tag LOCUS_05080 16930 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 17162 17602 gene locus_tag LOCUS_05090 17162 17602 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943713.1 protein_id gnl|my_center|LOCUS_05090 17763 19541 gene locus_tag LOCUS_05100 gene dnaG 17763 19541 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_05100 19556 20782 gene locus_tag LOCUS_05110 19556 20782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 20683 21129 gene locus_tag LOCUS_05120 20683 21129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 21196 21271 gene locus_tag LOCUS_t00040 21196 21271 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21362 22093 gene locus_tag LOCUS_05130 21362 22093 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_05130 22259 22663 gene locus_tag LOCUS_05140 22259 22663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 22979 23575 gene locus_tag LOCUS_05150 22979 23575 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_05150 23572 24738 gene locus_tag LOCUS_05160 23572 24738 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_05160 24844 25338 gene locus_tag LOCUS_05170 24844 25338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 25319 26167 gene locus_tag LOCUS_05180 25319 26167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 26718 27050 gene locus_tag LOCUS_05190 26718 27050 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391971.1 protein_id gnl|my_center|LOCUS_05190 27055 27444 gene locus_tag LOCUS_05200 27055 27444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 27455 27709 gene locus_tag LOCUS_05210 27455 27709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 29150 27696 gene locus_tag LOCUS_05220 29150 27696 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_05220 29532 29143 gene locus_tag LOCUS_05230 29532 29143 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233882.1 protein_id gnl|my_center|LOCUS_05230 29682 29882 gene locus_tag LOCUS_05240 29682 29882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 29908 30672 gene locus_tag LOCUS_05250 29908 30672 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 protein_id gnl|my_center|LOCUS_05250 31542 30679 gene locus_tag LOCUS_05260 31542 30679 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557414.1 protein_id gnl|my_center|LOCUS_05260 32967 31546 gene locus_tag LOCUS_05270 32967 31546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 33157 33339 gene locus_tag LOCUS_05280 33157 33339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 33556 34947 gene locus_tag LOCUS_05290 33556 34947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 34967 35251 gene locus_tag LOCUS_05300 34967 35251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 36528 35335 gene locus_tag LOCUS_05310 36528 35335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 36780 37007 gene locus_tag LOCUS_05320 36780 37007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 37086 37388 gene locus_tag LOCUS_05330 37086 37388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 37381 37590 gene locus_tag LOCUS_05340 37381 37590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 <38378 37587 gene locus_tag LOCUS_05350 <38378 37587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941358.1:bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI >Feature sequence012 199 465 gene locus_tag LOCUS_05360 199 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 571 828 gene locus_tag LOCUS_05370 571 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 932 1753 gene locus_tag LOCUS_05380 932 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 1769 2806 gene locus_tag LOCUS_05390 1769 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 2857 3165 gene locus_tag LOCUS_05400 2857 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 3230 3613 gene locus_tag LOCUS_05410 3230 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 3644 4183 gene locus_tag LOCUS_05420 3644 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 4365 4715 gene locus_tag LOCUS_05430 4365 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4733 5107 gene locus_tag LOCUS_05440 4733 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 5459 5659 gene locus_tag LOCUS_05450 5459 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 5727 6191 gene locus_tag LOCUS_05460 5727 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 6231 6401 gene locus_tag LOCUS_05470 6231 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 6445 6930 gene locus_tag LOCUS_05480 6445 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05480 7205 8611 gene locus_tag LOCUS_05490 7205 8611 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_05490 9233 9688 gene locus_tag LOCUS_05500 9233 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 9709 10554 gene locus_tag LOCUS_05510 9709 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 10695 10910 gene locus_tag LOCUS_05520 10695 10910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 11062 12762 gene locus_tag LOCUS_05530 11062 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 12826 13479 gene locus_tag LOCUS_05540 12826 13479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 13702 14916 gene locus_tag LOCUS_05550 13702 14916 CDS product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977998.1 protein_id gnl|my_center|LOCUS_05550 14920 15570 gene locus_tag LOCUS_05560 14920 15570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 15732 16601 gene locus_tag LOCUS_05570 gene cutB 15732 16601 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_05570 16639 18972 gene locus_tag LOCUS_05580 16639 18972 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_05580 18969 19442 gene locus_tag LOCUS_05590 gene cutC 18969 19442 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_05590 19439 19891 gene locus_tag LOCUS_05600 19439 19891 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528005.1 protein_id gnl|my_center|LOCUS_05600 19911 20942 gene locus_tag LOCUS_05610 19911 20942 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_05610 21000 22037 gene locus_tag LOCUS_05620 gene pdhA 21000 22037 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980946.1 protein_id gnl|my_center|LOCUS_05620 22050 23030 gene locus_tag LOCUS_05630 22050 23030 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_05630 23063 24331 gene locus_tag LOCUS_05640 23063 24331 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_05640 24356 25747 gene locus_tag LOCUS_05650 gene lpdA 24356 25747 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383235.1 protein_id gnl|my_center|LOCUS_05650 25767 26879 gene locus_tag LOCUS_05660 gene gcvT 25767 26879 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056592.1 protein_id gnl|my_center|LOCUS_05660 26977 28713 gene locus_tag LOCUS_05670 26977 28713 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_05670 28706 29554 gene locus_tag LOCUS_05680 28706 29554 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_05680 30465 29569 gene locus_tag LOCUS_05690 30465 29569 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_05690 30677 31396 gene locus_tag LOCUS_05700 30677 31396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 31469 31828 gene locus_tag LOCUS_05710 31469 31828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 32347 32087 gene locus_tag LOCUS_05720 32347 32087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 32315 32500 gene locus_tag LOCUS_05730 32315 32500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 32503 32874 gene locus_tag LOCUS_05740 32503 32874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 32826 33134 gene locus_tag LOCUS_05750 32826 33134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 33247 33323 gene locus_tag LOCUS_t00050 33247 33323 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence013 2869 1997 gene locus_tag LOCUS_05760 gene cutB 2869 1997 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_05760 3078 2899 gene locus_tag LOCUS_05770 3078 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 4628 3093 gene locus_tag LOCUS_05780 gene ubiD 4628 3093 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768425.1 protein_id gnl|my_center|LOCUS_05780 5592 4759 gene locus_tag LOCUS_05790 5592 4759 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748363.1 protein_id gnl|my_center|LOCUS_05790 6359 5589 gene locus_tag LOCUS_05800 6359 5589 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102304.1 protein_id gnl|my_center|LOCUS_05800 7162 6356 gene locus_tag LOCUS_05810 7162 6356 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188215.1 protein_id gnl|my_center|LOCUS_05810 8573 7182 gene locus_tag LOCUS_05820 8573 7182 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_05820 9577 8591 gene locus_tag LOCUS_05830 9577 8591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174451.1 protein_id gnl|my_center|LOCUS_05830 10422 9619 gene locus_tag LOCUS_05840 10422 9619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_05840 11416 10427 gene locus_tag LOCUS_05850 11416 10427 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393479.1 protein_id gnl|my_center|LOCUS_05850 12437 11493 gene locus_tag LOCUS_05860 12437 11493 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661512.1 protein_id gnl|my_center|LOCUS_05860 13484 12558 gene locus_tag LOCUS_05870 13484 12558 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210221.1 protein_id gnl|my_center|LOCUS_05870 14989 13481 gene locus_tag LOCUS_05880 14989 13481 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_05880 16201 15155 gene locus_tag LOCUS_05890 gene cysK 16201 15155 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937966.1 protein_id gnl|my_center|LOCUS_05890 16723 16511 gene locus_tag LOCUS_05900 16723 16511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 16888 18003 gene locus_tag LOCUS_05910 16888 18003 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 protein_id gnl|my_center|LOCUS_05910 18854 18561 gene locus_tag LOCUS_05920 18854 18561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 19132 18851 gene locus_tag LOCUS_05930 19132 18851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 20096 19485 gene locus_tag LOCUS_05940 20096 19485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 20544 20089 gene locus_tag LOCUS_05950 20544 20089 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_05950 22859 20541 gene locus_tag LOCUS_05960 22859 20541 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_05960 23743 22856 gene locus_tag LOCUS_05970 gene cutB 23743 22856 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_05970 24086 25309 gene locus_tag LOCUS_05980 24086 25309 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086133.1 protein_id gnl|my_center|LOCUS_05980 25974 25324 gene locus_tag LOCUS_05990 25974 25324 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384250.1 protein_id gnl|my_center|LOCUS_05990 26438 25974 gene locus_tag LOCUS_06000 26438 25974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 27541 26534 gene locus_tag LOCUS_06010 27541 26534 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_06010 29372 27669 gene locus_tag LOCUS_06020 gene ilvB 29372 27669 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880257.1 protein_id gnl|my_center|LOCUS_06020 30382 29369 gene locus_tag LOCUS_06030 30382 29369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 31337 30444 gene locus_tag LOCUS_06040 31337 30444 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969452.1 protein_id gnl|my_center|LOCUS_06040 32116 31319 gene locus_tag LOCUS_06050 32116 31319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_06050 32983 32120 gene locus_tag LOCUS_06060 32983 32120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460561.1 protein_id gnl|my_center|LOCUS_06060 33369 32980 gene locus_tag LOCUS_06070 33369 32980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06070 33338 33886 gene locus_tag LOCUS_06080 33338 33886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 33401 33429 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence014 1008 604 gene locus_tag LOCUS_06090 1008 604 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973660.1 protein_id gnl|my_center|LOCUS_06090 1376 1005 gene locus_tag LOCUS_06100 1376 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1609 1535 gene locus_tag LOCUS_t00060 1609 1535 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2516 1698 gene locus_tag LOCUS_06110 2516 1698 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_06110 3173 2610 gene locus_tag LOCUS_06120 gene efp 3173 2610 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_06120 3672 3211 gene locus_tag LOCUS_06130 gene aroQ 3672 3211 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942665.1 protein_id gnl|my_center|LOCUS_06130 4766 3681 gene locus_tag LOCUS_06140 gene aroB 4766 3681 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_06140 5280 4747 gene locus_tag LOCUS_06150 5280 4747 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393065.1 protein_id gnl|my_center|LOCUS_06150 6452 5292 gene locus_tag LOCUS_06160 gene aroC 6452 5292 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_06160 9267 6547 gene locus_tag LOCUS_06170 9267 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 10181 9279 gene locus_tag LOCUS_06180 10181 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 10821 10207 gene locus_tag LOCUS_06190 10821 10207 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_06190 11412 10825 gene locus_tag LOCUS_06200 11412 10825 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_06200 11729 11409 gene locus_tag LOCUS_06210 11729 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06210 12435 11626 gene locus_tag LOCUS_06220 12435 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06220 11883 11891 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12679 13851 gene locus_tag LOCUS_06230 gene lptF 12679 13851 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_06230 13855 14931 gene locus_tag LOCUS_06240 gene lptG 13855 14931 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_06240 16230 14974 gene locus_tag LOCUS_06250 gene ahcY 16230 14974 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_06250 17654 16449 gene locus_tag LOCUS_06260 gene metK 17654 16449 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_06260 19501 17723 gene locus_tag LOCUS_06270 gene ptsP 19501 17723 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_06270 19786 19505 gene locus_tag LOCUS_06280 19786 19505 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_06280 20196 19783 gene locus_tag LOCUS_06290 20196 19783 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_06290 21085 20204 gene locus_tag LOCUS_06300 gene rapZ 21085 20204 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_06300 22026 21082 gene locus_tag LOCUS_06310 gene hprK 22026 21082 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_06310 22509 22048 gene locus_tag LOCUS_06320 22509 22048 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_06320 24061 22511 gene locus_tag LOCUS_06330 gene rpoN 24061 22511 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_06330 24805 24071 gene locus_tag LOCUS_06340 gene lptB 24805 24071 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_06340 25323 24802 gene locus_tag LOCUS_06350 gene lptA 25323 24802 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942534.1 protein_id gnl|my_center|LOCUS_06350 25538 25320 gene locus_tag LOCUS_06360 25538 25320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 25866 25456 gene locus_tag LOCUS_06370 25866 25456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 26488 25988 gene locus_tag LOCUS_06380 26488 25988 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_06380 27477 26512 gene locus_tag LOCUS_06390 27477 26512 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_06390 28330 27557 gene locus_tag LOCUS_06400 28330 27557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06400 29972 28377 gene locus_tag LOCUS_06410 29972 28377 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_06410 30772 29969 gene locus_tag LOCUS_06420 gene kdsB 30772 29969 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_06420 31880 30837 gene locus_tag LOCUS_06430 gene argC 31880 30837 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_06430 32361 31966 gene locus_tag LOCUS_06440 gene rpsI 32361 31966 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_06440 32806 32378 gene locus_tag LOCUS_06450 gene rplM 32806 32378 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_06450 33003 34010 gene locus_tag LOCUS_06460 gene gap 33003 34010 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence015 1499 327 gene locus_tag LOCUS_06470 1499 327 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_06470 2285 1500 gene locus_tag LOCUS_06480 gene dapB 2285 1500 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_06480 3285 2398 gene locus_tag LOCUS_06490 gene dapA 3285 2398 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_06490 4492 3323 gene locus_tag LOCUS_06500 gene lysA 4492 3323 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_06500 6182 4632 gene locus_tag LOCUS_06510 gene argH 6182 4632 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_06510 7390 6179 gene locus_tag LOCUS_06520 7390 6179 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_06520 8313 7387 gene locus_tag LOCUS_06530 gene argF 8313 7387 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_06530 9615 8353 gene locus_tag LOCUS_06540 9615 8353 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_06540 10498 9617 gene locus_tag LOCUS_06550 gene argB 10498 9617 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_06550 11895 10516 gene locus_tag LOCUS_06560 gene hslU 11895 10516 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_06560 12497 11892 gene locus_tag LOCUS_06570 gene hslV 12497 11892 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_06570 13432 12494 gene locus_tag LOCUS_06580 gene xerC 13432 12494 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_06580 14856 13507 gene locus_tag LOCUS_06590 gene trmFO 14856 13507 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_06590 15266 15511 gene locus_tag LOCUS_06600 15266 15511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 18014 15816 gene locus_tag LOCUS_06610 gene topA 18014 15816 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_06610 18675 18199 gene locus_tag LOCUS_06620 18675 18199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 19805 18684 gene locus_tag LOCUS_06630 gene dprA 19805 18684 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_06630 20695 19802 gene locus_tag LOCUS_06640 20695 19802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 21115 20777 gene locus_tag LOCUS_06650 21115 20777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 21391 23412 gene locus_tag LOCUS_06660 gene ligA 21391 23412 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_06660 23477 23794 gene locus_tag LOCUS_06670 23477 23794 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_06670 24661 23816 gene locus_tag LOCUS_06680 gene rsmI 24661 23816 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_06680 25443 24685 gene locus_tag LOCUS_06690 25443 24685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 25455 25637 gene locus_tag LOCUS_06700 25455 25637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 27850 25751 gene locus_tag LOCUS_06710 27850 25751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 28654 28142 gene locus_tag LOCUS_06720 28654 28142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 28972 29172 gene locus_tag LOCUS_06730 28972 29172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 29571 29981 gene locus_tag LOCUS_06740 29571 29981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 32309 30441 gene locus_tag LOCUS_06750 32309 30441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence016 <1 2217 gene locus_tag LOCUS_06760 <1 2217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224019328.1:molybdopterin-dependent oxidoreductase 3014 2478 gene locus_tag LOCUS_06770 3014 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 3093 3347 gene locus_tag LOCUS_06780 3093 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3412 4446 gene locus_tag LOCUS_06790 3412 4446 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_06790 6006 4504 gene locus_tag LOCUS_06800 6006 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 6997 6017 gene locus_tag LOCUS_06810 6997 6017 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195809.1 protein_id gnl|my_center|LOCUS_06810 7863 6997 gene locus_tag LOCUS_06820 7863 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06820 9262 8015 gene locus_tag LOCUS_06830 9262 8015 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388321.1 protein_id gnl|my_center|LOCUS_06830 9575 9856 gene locus_tag LOCUS_06840 9575 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 9849 10127 gene locus_tag LOCUS_06850 9849 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 11511 10150 gene locus_tag LOCUS_06860 11511 10150 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_06860 12956 11520 gene locus_tag LOCUS_06870 12956 11520 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846143.1 protein_id gnl|my_center|LOCUS_06870 13230 14402 gene locus_tag LOCUS_06880 13230 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 15305 14406 gene locus_tag LOCUS_06890 15305 14406 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_06890 15760 15311 gene locus_tag LOCUS_06900 gene dtd 15760 15311 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 protein_id gnl|my_center|LOCUS_06900 16232 15819 gene locus_tag LOCUS_06910 16232 15819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 16733 16332 gene locus_tag LOCUS_06920 16733 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 17239 19830 gene locus_tag LOCUS_06930 17239 19830 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 protein_id gnl|my_center|LOCUS_06930 19827 20516 gene locus_tag LOCUS_06940 19827 20516 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393990.1 protein_id gnl|my_center|LOCUS_06940 20527 21189 gene locus_tag LOCUS_06950 20527 21189 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439746.1 protein_id gnl|my_center|LOCUS_06950 21179 21886 gene locus_tag LOCUS_06960 21179 21886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 22142 22002 gene locus_tag LOCUS_06970 22142 22002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 23158 22175 gene locus_tag LOCUS_06980 23158 22175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 23490 23128 gene locus_tag LOCUS_06990 23490 23128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 24176 23808 gene locus_tag LOCUS_07000 24176 23808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 24463 24314 gene locus_tag LOCUS_07010 24463 24314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 25263 24517 gene locus_tag LOCUS_07020 25263 24517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 25956 25345 gene locus_tag LOCUS_07030 25956 25345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 26525 27100 gene locus_tag LOCUS_07040 26525 27100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 27109 28839 gene locus_tag LOCUS_07050 27109 28839 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence017 147 1715 gene locus_tag LOCUS_07060 147 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1928 3604 gene locus_tag LOCUS_07070 1928 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 4791 3793 gene locus_tag LOCUS_07080 4791 3793 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297008.1 protein_id gnl|my_center|LOCUS_07080 5470 4868 gene locus_tag LOCUS_07090 5470 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07090 6282 5491 gene locus_tag LOCUS_07100 6282 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07100 5496 5508 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6713 6321 gene locus_tag LOCUS_07110 6713 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 8979 7222 gene locus_tag LOCUS_07120 8979 7222 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980494.1 protein_id gnl|my_center|LOCUS_07120 9317 10180 gene locus_tag LOCUS_07130 gene mscS 9317 10180 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_07130 10630 10340 gene locus_tag LOCUS_07140 10630 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 11712 10666 gene locus_tag LOCUS_07150 11712 10666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 13490 11712 gene locus_tag LOCUS_07160 gene polX 13490 11712 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_07160 14348 13584 gene locus_tag LOCUS_07170 14348 13584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_07170 15454 14468 gene locus_tag LOCUS_07180 15454 14468 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728489.1 protein_id gnl|my_center|LOCUS_07180 16316 15513 gene locus_tag LOCUS_07190 16316 15513 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085620.1 protein_id gnl|my_center|LOCUS_07190 17464 16427 gene locus_tag LOCUS_07200 17464 16427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 18562 17543 gene locus_tag LOCUS_07210 18562 17543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 18792 18962 gene locus_tag LOCUS_07220 18792 18962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 18959 19762 gene locus_tag LOCUS_07230 18959 19762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 19850 19996 gene locus_tag LOCUS_07240 19850 19996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 20055 20600 gene locus_tag LOCUS_07250 20055 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 20121 20148 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20612 21424 gene locus_tag LOCUS_07260 20612 21424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 21677 22135 gene locus_tag LOCUS_07270 21677 22135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 22235 22582 gene locus_tag LOCUS_07280 22235 22582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 23478 22759 gene locus_tag LOCUS_07290 23478 22759 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_07290 24938 23622 gene locus_tag LOCUS_07300 24938 23622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 25204 26319 gene locus_tag LOCUS_07310 25204 26319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529859.1 protein_id gnl|my_center|LOCUS_07310 26341 27360 gene locus_tag LOCUS_07320 26341 27360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 27568 28236 gene locus_tag LOCUS_07330 27568 28236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07330 28233 28664 gene locus_tag LOCUS_07340 gene mutT 28233 28664 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence018 1182 553 gene locus_tag LOCUS_07350 gene thiE 1182 553 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_07350 2675 1233 gene locus_tag LOCUS_07360 gene gnfM 2675 1233 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_07360 2983 3423 gene locus_tag LOCUS_07370 gene mraZ 2983 3423 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_07370 3435 4421 gene locus_tag LOCUS_07380 gene rsmH 3435 4421 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_07380 4414 4761 gene locus_tag LOCUS_07390 4414 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 4758 6908 gene locus_tag LOCUS_07400 4758 6908 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_07400 6913 8436 gene locus_tag LOCUS_07410 6913 8436 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_07410 8433 9845 gene locus_tag LOCUS_07420 8433 9845 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_07420 9856 10932 gene locus_tag LOCUS_07430 gene mraY 9856 10932 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_07430 10947 12281 gene locus_tag LOCUS_07440 gene murD 10947 12281 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_07440 12291 13385 gene locus_tag LOCUS_07450 gene ftsW 12291 13385 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_07450 13392 14495 gene locus_tag LOCUS_07460 gene murG 13392 14495 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931728.1 protein_id gnl|my_center|LOCUS_07460 14488 15885 gene locus_tag LOCUS_07470 gene murC 14488 15885 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_07470 15875 16795 gene locus_tag LOCUS_07480 gene murB 15875 16795 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_07480 16806 17630 gene locus_tag LOCUS_07490 16806 17630 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943690.1 protein_id gnl|my_center|LOCUS_07490 17614 18843 gene locus_tag LOCUS_07500 gene ftsA 17614 18843 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_07500 18916 20073 gene locus_tag LOCUS_07510 gene ftsZ 18916 20073 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_07510 20099 21598 gene locus_tag LOCUS_07520 20099 21598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 21977 23011 gene locus_tag LOCUS_07530 21977 23011 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_07530 23189 24520 gene locus_tag LOCUS_07540 23189 24520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 24614 24973 gene locus_tag LOCUS_07550 24614 24973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 26255 25020 gene locus_tag LOCUS_07560 26255 25020 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530301.1 protein_id gnl|my_center|LOCUS_07560 26533 26847 gene locus_tag LOCUS_07570 26533 26847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 27635 26832 gene locus_tag LOCUS_07580 27635 26832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 27468 27478 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence019 1547 705 gene locus_tag LOCUS_07590 1547 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 2395 1679 gene locus_tag LOCUS_07600 2395 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07600 3090 2392 gene locus_tag LOCUS_07610 3090 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07610 3876 3094 gene locus_tag LOCUS_07620 3876 3094 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762998.1 protein_id gnl|my_center|LOCUS_07620 4636 3878 gene locus_tag LOCUS_07630 4636 3878 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393480.1 protein_id gnl|my_center|LOCUS_07630 5520 4636 gene locus_tag LOCUS_07640 5520 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 7040 5610 gene locus_tag LOCUS_07650 gene ubiD 7040 5610 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339760.1 protein_id gnl|my_center|LOCUS_07650 7288 8223 gene locus_tag LOCUS_07660 7288 8223 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227264.1 protein_id gnl|my_center|LOCUS_07660 8292 10094 gene locus_tag LOCUS_07670 8292 10094 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399880.1 protein_id gnl|my_center|LOCUS_07670 10108 10995 gene locus_tag LOCUS_07680 10108 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 11776 11006 gene locus_tag LOCUS_07690 11776 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07690 11784 11802 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13259 12348 gene locus_tag LOCUS_07700 13259 12348 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229949.1 protein_id gnl|my_center|LOCUS_07700 13547 13762 gene locus_tag LOCUS_07710 13547 13762 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755892.1 protein_id gnl|my_center|LOCUS_07710 14197 13970 gene locus_tag LOCUS_07720 14197 13970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 15893 14298 gene locus_tag LOCUS_07730 15893 14298 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142798.1 protein_id gnl|my_center|LOCUS_07730 16524 15988 gene locus_tag LOCUS_07740 16524 15988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 18760 16436 gene locus_tag LOCUS_07750 18760 16436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07750 20483 18867 gene locus_tag LOCUS_07760 20483 18867 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_07760 21471 20554 gene locus_tag LOCUS_07770 21471 20554 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_07770 22418 21468 gene locus_tag LOCUS_07780 22418 21468 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_07780 22742 22446 gene locus_tag LOCUS_07790 22742 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 23742 22756 gene locus_tag LOCUS_07800 23742 22756 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_07800 23969 25396 gene locus_tag LOCUS_07810 23969 25396 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_07810 26480 25464 gene locus_tag LOCUS_07820 26480 25464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence020 <1 693 gene locus_tag LOCUS_07830 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958271.1:heavy metal translocating P-type ATPase 695 1192 gene locus_tag LOCUS_07840 695 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1195 1593 gene locus_tag LOCUS_07850 1195 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1675 2064 gene locus_tag LOCUS_07860 1675 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2124 3002 gene locus_tag LOCUS_07870 2124 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 3024 3152 gene locus_tag LOCUS_07880 3024 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3174 3542 gene locus_tag LOCUS_07890 3174 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07890 3580 3882 gene locus_tag LOCUS_07900 3580 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3970 4866 gene locus_tag LOCUS_07910 gene garR 3970 4866 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566608.1 protein_id gnl|my_center|LOCUS_07910 4922 5314 gene locus_tag LOCUS_07920 4922 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 5498 6715 gene locus_tag LOCUS_07930 5498 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 7997 6834 gene locus_tag LOCUS_07940 7997 6834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 protein_id gnl|my_center|LOCUS_07940 9220 8228 gene locus_tag LOCUS_07950 9220 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 14054 9429 gene locus_tag LOCUS_07960 gene gltB 14054 9429 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_07960 15051 14359 gene locus_tag LOCUS_07970 15051 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 16121 15246 gene locus_tag LOCUS_07980 16121 15246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 16438 16160 gene locus_tag LOCUS_07990 16438 16160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 16569 16919 gene locus_tag LOCUS_08000 16569 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 16947 17753 gene locus_tag LOCUS_08010 16947 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 17892 19004 gene locus_tag LOCUS_08020 17892 19004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 19073 19213 gene locus_tag LOCUS_08030 19073 19213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 19223 19531 gene locus_tag LOCUS_08040 19223 19531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08040 19607 21448 gene locus_tag LOCUS_08050 19607 21448 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_08050 21613 21804 gene locus_tag LOCUS_08060 21613 21804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 22902 21868 gene locus_tag LOCUS_08070 22902 21868 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_08070 23829 22972 gene locus_tag LOCUS_08080 23829 22972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 24961 23942 gene locus_tag LOCUS_08090 24961 23942 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383350.1 protein_id gnl|my_center|LOCUS_08090 25677 24991 gene locus_tag LOCUS_08100 25677 24991 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248985.1 protein_id gnl|my_center|LOCUS_08100 26243 25872 gene locus_tag LOCUS_08110 26243 25872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 26212 27099 gene locus_tag LOCUS_08120 26212 27099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence021 1141 353 gene locus_tag LOCUS_08130 1141 353 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_08130 1992 1144 gene locus_tag LOCUS_08140 gene dat 1992 1144 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233305.1 protein_id gnl|my_center|LOCUS_08140 2533 2120 gene locus_tag LOCUS_08150 2533 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544938.1 protein_id gnl|my_center|LOCUS_08150 3274 2639 gene locus_tag LOCUS_08160 3274 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4140 3271 gene locus_tag LOCUS_08170 4140 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 5130 4153 gene locus_tag LOCUS_08180 5130 4153 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_08180 5415 5161 gene locus_tag LOCUS_08190 5415 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08190 6515 5421 gene locus_tag LOCUS_08200 6515 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08200 7766 9133 gene locus_tag LOCUS_08210 7766 9133 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_08210 9224 9592 gene locus_tag LOCUS_08220 9224 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 9594 11012 gene locus_tag LOCUS_08230 9594 11012 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_08230 11021 12097 gene locus_tag LOCUS_08240 11021 12097 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_08240 14537 12117 gene locus_tag LOCUS_08250 gene gyrB 14537 12117 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072078.1 protein_id gnl|my_center|LOCUS_08250 15815 14694 gene locus_tag LOCUS_08260 gene dnaN 15815 14694 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_08260 16484 16041 gene locus_tag LOCUS_08270 16484 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08270 17346 16486 gene locus_tag LOCUS_08280 17346 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08280 17900 18256 gene locus_tag LOCUS_08290 17900 18256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 18283 18537 gene locus_tag LOCUS_08300 gene yidD 18283 18537 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141911.1 protein_id gnl|my_center|LOCUS_08300 18810 20231 gene locus_tag LOCUS_08310 gene yidC 18810 20231 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938376.1 protein_id gnl|my_center|LOCUS_08310 20624 21880 gene locus_tag LOCUS_08320 20624 21880 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943097.1 protein_id gnl|my_center|LOCUS_08320 21991 22620 gene locus_tag LOCUS_08330 gene rsmG 21991 22620 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258170.1 protein_id gnl|my_center|LOCUS_08330 22627 23397 gene locus_tag LOCUS_08340 22627 23397 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_08340 23390 24238 gene locus_tag LOCUS_08350 23390 24238 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_08350 24411 24839 gene locus_tag LOCUS_08360 24411 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 24836 25492 gene locus_tag LOCUS_08370 24836 25492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 25489 26037 gene locus_tag LOCUS_08380 gene atpH 25489 26037 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence022 2946 1582 gene locus_tag LOCUS_08390 2946 1582 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_08390 4400 2943 gene locus_tag LOCUS_08400 4400 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5118 4711 gene locus_tag LOCUS_08410 5118 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 6243 5269 gene locus_tag LOCUS_08420 6243 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 8255 6339 gene locus_tag LOCUS_08430 gene selB 8255 6339 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_08430 8329 8556 gene locus_tag LOCUS_08440 8329 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 8653 9141 gene locus_tag LOCUS_08450 8653 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 9152 10108 gene locus_tag LOCUS_08460 9152 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 10161 11048 gene locus_tag LOCUS_08470 10161 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 11045 12652 gene locus_tag LOCUS_08480 11045 12652 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_08480 13531 12656 gene locus_tag LOCUS_08490 13531 12656 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064396.1 protein_id gnl|my_center|LOCUS_08490 15420 13528 gene locus_tag LOCUS_08500 15420 13528 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_08500 16183 15458 gene locus_tag LOCUS_08510 16183 15458 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064245.1 protein_id gnl|my_center|LOCUS_08510 17315 16200 gene locus_tag LOCUS_08520 17315 16200 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_08520 18271 17489 gene locus_tag LOCUS_08530 18271 17489 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_08530 19135 18773 gene locus_tag LOCUS_08540 19135 18773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 19808 19143 gene locus_tag LOCUS_08550 gene tenA 19808 19143 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144491.1 protein_id gnl|my_center|LOCUS_08550 20057 22726 gene locus_tag LOCUS_08560 gene ppdK 20057 22726 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546740.1 protein_id gnl|my_center|LOCUS_08560 23207 22857 gene locus_tag LOCUS_08570 23207 22857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 23472 24356 gene locus_tag LOCUS_08580 23472 24356 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175706.1 protein_id gnl|my_center|LOCUS_08580 <26091 24992 gene locus_tag LOCUS_08590 <26091 24992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407690.1:zinc-binding dehydrogenase >Feature sequence023 2508 2203 gene locus_tag LOCUS_08600 2508 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3029 2565 gene locus_tag LOCUS_08610 3029 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08610 3409 3801 gene locus_tag LOCUS_08620 3409 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3798 4775 gene locus_tag LOCUS_08630 3798 4775 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_08630 4757 5953 gene locus_tag LOCUS_08640 4757 5953 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869485.1 protein_id gnl|my_center|LOCUS_08640 5962 6600 gene locus_tag LOCUS_08650 5962 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 6572 8275 gene locus_tag LOCUS_08660 gene ade 6572 8275 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_08660 9797 8334 gene locus_tag LOCUS_08670 9797 8334 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403007.1 protein_id gnl|my_center|LOCUS_08670 9933 10427 gene locus_tag LOCUS_08680 9933 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 10372 11055 gene locus_tag LOCUS_08690 10372 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 11587 11114 gene locus_tag LOCUS_08700 11587 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 13881 11719 gene locus_tag LOCUS_08710 13881 11719 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_08710 14575 13883 gene locus_tag LOCUS_08720 14575 13883 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_08720 15877 14876 gene locus_tag LOCUS_08730 15877 14876 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_08730 16117 16305 gene locus_tag LOCUS_08740 16117 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 16919 16347 gene locus_tag LOCUS_08750 16919 16347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 18289 16964 gene locus_tag LOCUS_08760 18289 16964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_08760 18519 18286 gene locus_tag LOCUS_08770 18519 18286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 19080 18538 gene locus_tag LOCUS_08780 19080 18538 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979109.1 protein_id gnl|my_center|LOCUS_08780 19802 19077 gene locus_tag LOCUS_08790 19802 19077 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545422.1 protein_id gnl|my_center|LOCUS_08790 20296 19799 gene locus_tag LOCUS_08800 20296 19799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 21985 20333 gene locus_tag LOCUS_08810 21985 20333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 22862 22059 gene locus_tag LOCUS_08820 22862 22059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 24150 22870 gene locus_tag LOCUS_08830 24150 22870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 24425 24156 gene locus_tag LOCUS_08840 24425 24156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence024 1 327 gene locus_tag LOCUS_08850 1 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 634 1464 gene locus_tag LOCUS_08860 634 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1526 3874 gene locus_tag LOCUS_08870 1526 3874 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869170.1 protein_id gnl|my_center|LOCUS_08870 3885 4373 gene locus_tag LOCUS_08880 3885 4373 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_08880 4466 5359 gene locus_tag LOCUS_08890 4466 5359 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_08890 5356 7773 gene locus_tag LOCUS_08900 5356 7773 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_08900 7770 8321 gene locus_tag LOCUS_08910 7770 8321 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530702.1 protein_id gnl|my_center|LOCUS_08910 8318 8608 gene locus_tag LOCUS_08920 8318 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 8663 8866 gene locus_tag LOCUS_08930 8663 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 8866 9930 gene locus_tag LOCUS_08940 8866 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_08940 10014 11702 gene locus_tag LOCUS_08950 10014 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 11715 12590 gene locus_tag LOCUS_08960 11715 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 12899 13495 gene locus_tag LOCUS_08970 12899 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 13541 14035 gene locus_tag LOCUS_08980 13541 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 13983 14309 gene locus_tag LOCUS_08990 13983 14309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 14296 14300 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14483 14977 gene locus_tag LOCUS_09000 14483 14977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544938.1 protein_id gnl|my_center|LOCUS_09000 15605 15096 gene locus_tag LOCUS_09010 15605 15096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 18341 15897 gene locus_tag LOCUS_09020 18341 15897 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_09020 18878 18387 gene locus_tag LOCUS_09030 18878 18387 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_09030 19764 18871 gene locus_tag LOCUS_09040 gene cutB 19764 18871 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_09040 20044 19778 gene locus_tag LOCUS_09050 20044 19778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 20031 21476 gene locus_tag LOCUS_09060 20031 21476 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_09060 21499 22542 gene locus_tag LOCUS_09070 21499 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 22687 23760 gene locus_tag LOCUS_09080 22687 23760 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence025 584 357 gene locus_tag LOCUS_09090 584 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1764 811 gene locus_tag LOCUS_09100 1764 811 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_09100 2046 1831 gene locus_tag LOCUS_09110 2046 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2082 2267 gene locus_tag LOCUS_09120 2082 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2617 2396 gene locus_tag LOCUS_09130 2617 2396 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391770.1 protein_id gnl|my_center|LOCUS_09130 5111 2790 gene locus_tag LOCUS_09140 5111 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09140 6529 6212 gene locus_tag LOCUS_09150 6529 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 7442 6543 gene locus_tag LOCUS_09160 7442 6543 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_09160 8700 7468 gene locus_tag LOCUS_09170 gene norA 8700 7468 CDS product multidrug efflux MFS transporter NorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041274.1 protein_id gnl|my_center|LOCUS_09170 8797 9561 gene locus_tag LOCUS_09180 8797 9561 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932478.1 protein_id gnl|my_center|LOCUS_09180 10436 9600 gene locus_tag LOCUS_09190 10436 9600 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_09190 11449 10433 gene locus_tag LOCUS_09200 11449 10433 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 protein_id gnl|my_center|LOCUS_09200 13147 11510 gene locus_tag LOCUS_09210 13147 11510 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_09210 13272 13502 gene locus_tag LOCUS_09220 13272 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 13514 13738 gene locus_tag LOCUS_09230 13514 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 13781 14356 gene locus_tag LOCUS_09240 13781 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 15682 14378 gene locus_tag LOCUS_09250 15682 14378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 16693 15719 gene locus_tag LOCUS_09260 16693 15719 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_09260 16814 16686 gene locus_tag LOCUS_09270 16814 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 17687 16830 gene locus_tag LOCUS_09280 17687 16830 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09280 17935 18519 gene locus_tag LOCUS_09290 17935 18519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 18605 18901 gene locus_tag LOCUS_09300 18605 18901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 19022 20407 gene locus_tag LOCUS_09310 gene grdC 19022 20407 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681153.1 protein_id gnl|my_center|LOCUS_09310 20455 20919 gene locus_tag LOCUS_09320 gene grdA 20455 20919 CDS product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869884.1 transl_except (pos:20578..20580,aa:Sec) note codon on position 42 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_09320 20971 21177 gene locus_tag LOCUS_09330 20971 21177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 21181 22329 gene locus_tag LOCUS_09340 21181 22329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 23766 22552 gene locus_tag LOCUS_09350 23766 22552 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_09350 24054 23839 gene locus_tag LOCUS_09360 24054 23839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence026 1580 282 gene locus_tag LOCUS_09370 1580 282 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_09370 2985 1621 gene locus_tag LOCUS_09380 2985 1621 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_09380 4422 2992 gene locus_tag LOCUS_09390 4422 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 5150 4371 gene locus_tag LOCUS_09400 5150 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 6286 5375 gene locus_tag LOCUS_09410 gene lpxC 6286 5375 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_09410 6751 6536 gene locus_tag LOCUS_09420 6751 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 7531 6761 gene locus_tag LOCUS_09430 7531 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09430 8337 7732 gene locus_tag LOCUS_09440 gene ruvA 8337 7732 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_09440 8828 8334 gene locus_tag LOCUS_09450 gene ruvC 8828 8334 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_09450 9599 8847 gene locus_tag LOCUS_09460 9599 8847 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_09460 9949 9710 gene locus_tag LOCUS_09470 9949 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 11001 10018 gene locus_tag LOCUS_09480 11001 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 12226 11111 gene locus_tag LOCUS_09490 12226 11111 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_09490 12472 14001 gene locus_tag LOCUS_09500 gene nrfD 12472 14001 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_09500 14020 16851 gene locus_tag LOCUS_09510 14020 16851 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_09510 17828 16833 gene locus_tag LOCUS_09520 17828 16833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 18917 17919 gene locus_tag LOCUS_09530 18917 17919 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803989.1 protein_id gnl|my_center|LOCUS_09530 19175 20005 gene locus_tag LOCUS_09540 19175 20005 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225798.1 protein_id gnl|my_center|LOCUS_09540 21039 20038 gene locus_tag LOCUS_09550 21039 20038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 22070 21084 gene locus_tag LOCUS_09560 22070 21084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 22722 22192 gene locus_tag LOCUS_09570 22722 22192 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975078.1 protein_id gnl|my_center|LOCUS_09570 23234 22791 gene locus_tag LOCUS_09580 23234 22791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence027 287 964 gene locus_tag LOCUS_09590 287 964 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930032.1 protein_id gnl|my_center|LOCUS_09590 964 1134 gene locus_tag LOCUS_09600 964 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1159 1848 gene locus_tag LOCUS_09610 1159 1848 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_09610 1918 2472 gene locus_tag LOCUS_09620 1918 2472 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224486.1 protein_id gnl|my_center|LOCUS_09620 3517 2576 gene locus_tag LOCUS_09630 3517 2576 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385788.1 protein_id gnl|my_center|LOCUS_09630 4499 3528 gene locus_tag LOCUS_09640 4499 3528 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385787.1 protein_id gnl|my_center|LOCUS_09640 4387 4659 gene locus_tag LOCUS_09650 4387 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4771 5772 gene locus_tag LOCUS_09660 4771 5772 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_09660 6020 6259 gene locus_tag LOCUS_09670 6020 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 6259 6672 gene locus_tag LOCUS_09680 6259 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6950 6579 gene locus_tag LOCUS_09690 6950 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 7270 6947 gene locus_tag LOCUS_09700 7270 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8416 7349 gene locus_tag LOCUS_09710 8416 7349 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_09710 9190 8540 gene locus_tag LOCUS_09720 9190 8540 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_09720 10286 9243 gene locus_tag LOCUS_09730 gene moaA 10286 9243 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950828.1 protein_id gnl|my_center|LOCUS_09730 11138 10365 gene locus_tag LOCUS_09740 11138 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 12919 11276 gene locus_tag LOCUS_09750 12919 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09750 14206 12920 gene locus_tag LOCUS_09760 gene nuoF 14206 12920 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396808.1 protein_id gnl|my_center|LOCUS_09760 14619 14203 gene locus_tag LOCUS_09770 14619 14203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09770 15892 14516 gene locus_tag LOCUS_09780 15892 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09780 14795 14799 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16380 15889 gene locus_tag LOCUS_09790 gene nuoI 16380 15889 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258756.1 protein_id gnl|my_center|LOCUS_09790 17012 16377 gene locus_tag LOCUS_09800 17012 16377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 18087 17068 gene locus_tag LOCUS_09810 18087 17068 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_09810 19237 18287 gene locus_tag LOCUS_09820 19237 18287 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529865.1 protein_id gnl|my_center|LOCUS_09820 21716 19539 gene locus_tag LOCUS_09830 21716 19539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 23542 21713 gene locus_tag LOCUS_09840 23542 21713 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583579.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence028 18 995 gene locus_tag LOCUS_09850 18 995 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224591.1 protein_id gnl|my_center|LOCUS_09850 1048 2283 gene locus_tag LOCUS_09860 1048 2283 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391998.1 protein_id gnl|my_center|LOCUS_09860 2840 2352 gene locus_tag LOCUS_09870 2840 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 3840 2875 gene locus_tag LOCUS_09880 3840 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4915 3950 gene locus_tag LOCUS_09890 4915 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 5911 5042 gene locus_tag LOCUS_09900 5911 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 6710 5949 gene locus_tag LOCUS_09910 6710 5949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878142.1 protein_id gnl|my_center|LOCUS_09910 7524 6730 gene locus_tag LOCUS_09920 7524 6730 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460561.1 protein_id gnl|my_center|LOCUS_09920 8755 7571 gene locus_tag LOCUS_09930 8755 7571 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 protein_id gnl|my_center|LOCUS_09930 8815 9168 gene locus_tag LOCUS_09940 8815 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 10051 9197 gene locus_tag LOCUS_09950 10051 9197 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813277.1 protein_id gnl|my_center|LOCUS_09950 10182 11960 gene locus_tag LOCUS_09960 10182 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09960 11857 12672 gene locus_tag LOCUS_09970 gene ligD 11857 12672 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393573.1 protein_id gnl|my_center|LOCUS_09970 13383 12673 gene locus_tag LOCUS_09980 13383 12673 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_09980 14627 13422 gene locus_tag LOCUS_09990 14627 13422 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228032.1 protein_id gnl|my_center|LOCUS_09990 16112 14733 gene locus_tag LOCUS_10000 16112 14733 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_10000 17374 16157 gene locus_tag LOCUS_10010 17374 16157 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_10010 18535 17510 gene locus_tag LOCUS_10020 18535 17510 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082945.1 protein_id gnl|my_center|LOCUS_10020 20323 18611 gene locus_tag LOCUS_10030 20323 18611 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994177.1 protein_id gnl|my_center|LOCUS_10030 20979 20713 gene locus_tag LOCUS_10040 20979 20713 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_10040 21231 20980 gene locus_tag LOCUS_10050 21231 20980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 22538 21336 gene locus_tag LOCUS_10060 22538 21336 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405030.1 protein_id gnl|my_center|LOCUS_10060 22973 22620 gene locus_tag LOCUS_10070 22973 22620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10070 23317 23039 gene locus_tag LOCUS_10080 23317 23039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence029 1191 1712 gene locus_tag LOCUS_10090 1191 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1717 2595 gene locus_tag LOCUS_10100 1717 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2797 4434 gene locus_tag LOCUS_10110 2797 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4676 4921 gene locus_tag LOCUS_10120 4676 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5011 5508 gene locus_tag LOCUS_10130 5011 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5574 6677 gene locus_tag LOCUS_10140 5574 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 6674 7309 gene locus_tag LOCUS_10150 6674 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 7284 8000 gene locus_tag LOCUS_10160 7284 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7997 8176 gene locus_tag LOCUS_10170 7997 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 8204 9061 gene locus_tag LOCUS_10180 gene cpaB 8204 9061 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939395.1 protein_id gnl|my_center|LOCUS_10180 9030 10154 gene locus_tag LOCUS_10190 9030 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 9814 9838 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10037 10498 gene locus_tag LOCUS_10200 10037 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 10512 12164 gene locus_tag LOCUS_10210 10512 12164 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064053.1 protein_id gnl|my_center|LOCUS_10210 12217 13017 gene locus_tag LOCUS_10220 12217 13017 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812713.1 protein_id gnl|my_center|LOCUS_10220 13026 13883 gene locus_tag LOCUS_10230 13026 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 13887 14222 gene locus_tag LOCUS_10240 13887 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 14219 14758 gene locus_tag LOCUS_10250 14219 14758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 14764 15615 gene locus_tag LOCUS_10260 14764 15615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 17665 15575 gene locus_tag LOCUS_10270 17665 15575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 18623 17733 gene locus_tag LOCUS_10280 18623 17733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 18840 20567 gene locus_tag LOCUS_10290 18840 20567 CDS product 1,4-alpha-glucan branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250387.1 protein_id gnl|my_center|LOCUS_10290 20736 21218 gene locus_tag LOCUS_10300 gene comD 20736 21218 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496437.1 protein_id gnl|my_center|LOCUS_10300 21248 21841 gene locus_tag LOCUS_10310 21248 21841 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040168.1 protein_id gnl|my_center|LOCUS_10310 22222 21890 gene locus_tag LOCUS_10320 22222 21890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence030 1613 213 gene locus_tag LOCUS_10330 1613 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1525 1953 gene locus_tag LOCUS_10340 1525 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3658 2003 gene locus_tag LOCUS_10350 gene groL 3658 2003 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_10350 4053 3781 gene locus_tag LOCUS_10360 4053 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 4320 4069 gene locus_tag LOCUS_10370 4320 4069 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013194.1 protein_id gnl|my_center|LOCUS_10370 4538 5263 gene locus_tag LOCUS_10380 4538 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5476 6339 gene locus_tag LOCUS_10390 gene galU 5476 6339 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_10390 6372 7379 gene locus_tag LOCUS_10400 gene thiL 6372 7379 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_10400 7616 8260 gene locus_tag LOCUS_10410 7616 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10410 8257 9450 gene locus_tag LOCUS_10420 gene larC 8257 9450 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_10420 9555 10592 gene locus_tag LOCUS_10430 9555 10592 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_10430 10599 11447 gene locus_tag LOCUS_10440 gene mreC 10599 11447 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_10440 11487 11987 gene locus_tag LOCUS_10450 11487 11987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 12006 13826 gene locus_tag LOCUS_10460 gene mrdA 12006 13826 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_10460 13823 14923 gene locus_tag LOCUS_10470 gene rodA 13823 14923 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_10470 15276 14944 gene locus_tag LOCUS_10480 gene trxA 15276 14944 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_10480 16163 16936 gene locus_tag LOCUS_10490 16163 16936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_10490 16933 17463 gene locus_tag LOCUS_10500 16933 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 17480 18283 gene locus_tag LOCUS_10510 gene ccsB 17480 18283 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_10510 18290 19618 gene locus_tag LOCUS_10520 gene hemA 18290 19618 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_10520 19621 20553 gene locus_tag LOCUS_10530 gene hemC 19621 20553 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392763.1 protein_id gnl|my_center|LOCUS_10530 20558 21388 gene locus_tag LOCUS_10540 20558 21388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 21424 22398 gene locus_tag LOCUS_10550 gene hemB 21424 22398 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence031 2927 195 gene locus_tag LOCUS_10560 2927 195 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879871.1 protein_id gnl|my_center|LOCUS_10560 3953 3018 gene locus_tag LOCUS_10570 gene nrfD 3953 3018 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879873.1 protein_id gnl|my_center|LOCUS_10570 4586 3981 gene locus_tag LOCUS_10580 4586 3981 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320694.1 protein_id gnl|my_center|LOCUS_10580 7168 4622 gene locus_tag LOCUS_10590 7168 4622 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 protein_id gnl|my_center|LOCUS_10590 7379 7134 gene locus_tag LOCUS_10600 7379 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 9966 7396 gene locus_tag LOCUS_10610 9966 7396 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 protein_id gnl|my_center|LOCUS_10610 11008 9989 gene locus_tag LOCUS_10620 11008 9989 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807628.1 protein_id gnl|my_center|LOCUS_10620 11382 11416 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11495 12343 gene locus_tag LOCUS_10630 11495 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 12399 12653 gene locus_tag LOCUS_10640 12399 12653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 13380 12607 gene locus_tag LOCUS_10650 13380 12607 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_10650 15406 13352 gene locus_tag LOCUS_10660 15406 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 15406 15891 gene locus_tag LOCUS_10670 15406 15891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 15979 16986 gene locus_tag LOCUS_10680 gene mtrA 15979 16986 CDS product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_10680 17074 19266 gene locus_tag LOCUS_10690 17074 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 19582 19962 gene locus_tag LOCUS_10700 19582 19962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 20011 21204 gene locus_tag LOCUS_10710 20011 21204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence032 1098 1310 gene locus_tag LOCUS_10720 1098 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1310 1555 gene locus_tag LOCUS_10730 1310 1555 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392234.1 protein_id gnl|my_center|LOCUS_10730 1660 2790 gene locus_tag LOCUS_10740 1660 2790 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_10740 3335 2880 gene locus_tag LOCUS_10750 3335 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 4864 3332 gene locus_tag LOCUS_10760 4864 3332 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_10760 6155 4857 gene locus_tag LOCUS_10770 6155 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 6745 6209 gene locus_tag LOCUS_10780 gene mobB 6745 6209 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_10780 7859 6768 gene locus_tag LOCUS_10790 7859 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 8539 7928 gene locus_tag LOCUS_10800 8539 7928 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533080.1 protein_id gnl|my_center|LOCUS_10800 9559 8798 gene locus_tag LOCUS_10810 9559 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 10293 9559 gene locus_tag LOCUS_10820 10293 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 10437 11075 gene locus_tag LOCUS_10830 10437 11075 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_10830 12286 11117 gene locus_tag LOCUS_10840 12286 11117 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_10840 12861 12319 gene locus_tag LOCUS_10850 12861 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 13299 14156 gene locus_tag LOCUS_10860 13299 14156 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272323.1 protein_id gnl|my_center|LOCUS_10860 14159 14962 gene locus_tag LOCUS_10870 14159 14962 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_10870 14974 15825 gene locus_tag LOCUS_10880 14974 15825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 16538 15891 gene locus_tag LOCUS_10890 16538 15891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 17075 16707 gene locus_tag LOCUS_10900 17075 16707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 17694 17368 gene locus_tag LOCUS_10910 17694 17368 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_10910 17848 18006 gene locus_tag LOCUS_10920 17848 18006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 18111 18614 gene locus_tag LOCUS_10930 18111 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 21206 18624 gene locus_tag LOCUS_10940 21206 18624 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 protein_id gnl|my_center|LOCUS_10940 21506 21213 gene locus_tag LOCUS_10950 21506 21213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 21958 21575 gene locus_tag LOCUS_10960 21958 21575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence033 1230 619 gene locus_tag LOCUS_10970 gene clpP 1230 619 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_10970 2533 1259 gene locus_tag LOCUS_10980 gene tig 2533 1259 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_10980 2708 4735 gene locus_tag LOCUS_10990 2708 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 4830 4743 gene locus_tag LOCUS_t00070 4830 4743 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6819 4957 gene locus_tag LOCUS_11000 6819 4957 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390754.1 protein_id gnl|my_center|LOCUS_11000 7903 6866 gene locus_tag LOCUS_11010 7903 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 9474 7921 gene locus_tag LOCUS_11020 9474 7921 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250573.1 protein_id gnl|my_center|LOCUS_11020 10589 9525 gene locus_tag LOCUS_11030 10589 9525 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259270.1 protein_id gnl|my_center|LOCUS_11030 10738 10589 gene locus_tag LOCUS_11040 10738 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 10950 10735 gene locus_tag LOCUS_11050 10950 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 11829 11035 gene locus_tag LOCUS_11060 11829 11035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_11060 12632 11820 gene locus_tag LOCUS_11070 gene ssuC 12632 11820 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_11070 13689 12655 gene locus_tag LOCUS_11080 13689 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 15958 13820 gene locus_tag LOCUS_11090 15958 13820 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_11090 18240 15961 gene locus_tag LOCUS_11100 18240 15961 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_11100 19246 18269 gene locus_tag LOCUS_11110 19246 18269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 20665 19271 gene locus_tag LOCUS_11120 20665 19271 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_11120 21944 20691 gene locus_tag LOCUS_11130 21944 20691 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545255.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence034 395 643 gene locus_tag LOCUS_11140 395 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1514 675 gene locus_tag LOCUS_11150 1514 675 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_11150 1985 1551 gene locus_tag LOCUS_11160 1985 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2403 2164 gene locus_tag LOCUS_11170 2403 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3145 2480 gene locus_tag LOCUS_11180 3145 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 3734 3180 gene locus_tag LOCUS_11190 3734 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 4156 3797 gene locus_tag LOCUS_11200 4156 3797 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440098.1 protein_id gnl|my_center|LOCUS_11200 4544 4149 gene locus_tag LOCUS_11210 4544 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4802 5140 gene locus_tag LOCUS_11220 4802 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5283 5585 gene locus_tag LOCUS_11230 5283 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 5586 5891 gene locus_tag LOCUS_11240 5586 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 5909 7480 gene locus_tag LOCUS_11250 5909 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 7590 9191 gene locus_tag LOCUS_11260 7590 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 9176 9853 gene locus_tag LOCUS_11270 9176 9853 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_11270 9934 10563 gene locus_tag LOCUS_11280 gene sigR 9934 10563 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_11280 10568 11380 gene locus_tag LOCUS_11290 10568 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 11383 12045 gene locus_tag LOCUS_11300 11383 12045 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_11300 12050 12607 gene locus_tag LOCUS_11310 12050 12607 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869771.1 protein_id gnl|my_center|LOCUS_11310 12677 13681 gene locus_tag LOCUS_11320 gene mftC 12677 13681 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112050.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11320 13710 14447 gene locus_tag LOCUS_11330 13710 14447 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_11330 14452 15480 gene locus_tag LOCUS_11340 14452 15480 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868082.1 protein_id gnl|my_center|LOCUS_11340 15572 16084 gene locus_tag LOCUS_11350 15572 16084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 16097 17446 gene locus_tag LOCUS_11360 16097 17446 CDS product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 protein_id gnl|my_center|LOCUS_11360 17470 19020 gene locus_tag LOCUS_11370 17470 19020 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530067.1 protein_id gnl|my_center|LOCUS_11370 19600 19034 gene locus_tag LOCUS_11380 19600 19034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 21082 19790 gene locus_tag LOCUS_11390 21082 19790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 21513 21100 gene locus_tag LOCUS_11400 21513 21100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence035 2348 1677 gene locus_tag LOCUS_11410 2348 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11410 2257 2266 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2308 2790 gene locus_tag LOCUS_11420 2308 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5411 2787 gene locus_tag LOCUS_11430 gene mutS 5411 2787 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_11430 5754 5404 gene locus_tag LOCUS_11440 5754 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 7452 5767 gene locus_tag LOCUS_11450 7452 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 9205 7460 gene locus_tag LOCUS_11460 9205 7460 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_11460 10123 9317 gene locus_tag LOCUS_11470 gene cmk 10123 9317 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_11470 11432 10113 gene locus_tag LOCUS_11480 gene aroA 11432 10113 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_11480 12289 11438 gene locus_tag LOCUS_11490 12289 11438 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_11490 13319 12306 gene locus_tag LOCUS_11500 gene aroF 13319 12306 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_11500 14472 13333 gene locus_tag LOCUS_11510 gene hisC 14472 13333 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_11510 15623 14544 gene locus_tag LOCUS_11520 gene pheA 15623 14544 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_11520 19205 15720 gene locus_tag LOCUS_11530 gene dnaE 19205 15720 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_11530 19643 19248 gene locus_tag LOCUS_11540 19643 19248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 19965 19630 gene locus_tag LOCUS_11550 19965 19630 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_11550 20351 19980 gene locus_tag LOCUS_11560 20351 19980 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632023.1 protein_id gnl|my_center|LOCUS_11560 <21888 20386 gene locus_tag LOCUS_11570 <21888 20386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545424.1:glutamine-hydrolyzing GMP synthase >Feature sequence036 1344 253 gene locus_tag LOCUS_11580 1344 253 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_11580 3218 1491 gene locus_tag LOCUS_11590 3218 1491 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_11590 4835 3423 gene locus_tag LOCUS_11600 gene glnA 4835 3423 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_11600 5370 4945 gene locus_tag LOCUS_11610 5370 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 5330 5965 gene locus_tag LOCUS_11620 5330 5965 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_11620 6990 5962 gene locus_tag LOCUS_11630 6990 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 7645 7028 gene locus_tag LOCUS_11640 7645 7028 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_11640 7841 8155 gene locus_tag LOCUS_11650 7841 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 10490 8241 gene locus_tag LOCUS_11660 10490 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018183745.1 protein_id gnl|my_center|LOCUS_11660 11293 10487 gene locus_tag LOCUS_11670 11293 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 13391 11301 gene locus_tag LOCUS_11680 13391 11301 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839782.1 protein_id gnl|my_center|LOCUS_11680 14270 13392 gene locus_tag LOCUS_11690 14270 13392 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_11690 15839 14808 gene locus_tag LOCUS_11700 15839 14808 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_11700 15403 15473 gene locus_tag LOCUS_t00080 15403 15473 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17426 15864 gene locus_tag LOCUS_11710 17426 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 20690 17445 gene locus_tag LOCUS_11720 20690 17445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 21050 20694 gene locus_tag LOCUS_11730 21050 20694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence037 386 895 gene locus_tag LOCUS_11740 386 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1053 1583 gene locus_tag LOCUS_11750 1053 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1583 2152 gene locus_tag LOCUS_11760 1583 2152 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_11760 3150 2182 gene locus_tag LOCUS_11770 3150 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 3899 3510 gene locus_tag LOCUS_11780 3899 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11780 4340 4008 gene locus_tag LOCUS_11790 4340 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 4577 4341 gene locus_tag LOCUS_11800 4577 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5312 4614 gene locus_tag LOCUS_11810 5312 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 5735 5466 gene locus_tag LOCUS_11820 5735 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6800 5754 gene locus_tag LOCUS_11830 gene apbC 6800 5754 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_11830 7031 7699 gene locus_tag LOCUS_11840 7031 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 7721 8809 gene locus_tag LOCUS_11850 7721 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 9045 8806 gene locus_tag LOCUS_11860 9045 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 9689 10858 gene locus_tag LOCUS_11870 9689 10858 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942893.1 protein_id gnl|my_center|LOCUS_11870 10855 11610 gene locus_tag LOCUS_11880 10855 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 12300 11719 gene locus_tag LOCUS_11890 12300 11719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 13423 12608 gene locus_tag LOCUS_11900 13423 12608 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_11900 14348 13554 gene locus_tag LOCUS_11910 14348 13554 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095630.1 protein_id gnl|my_center|LOCUS_11910 15347 14373 gene locus_tag LOCUS_11920 15347 14373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878797.1 protein_id gnl|my_center|LOCUS_11920 15906 15328 gene locus_tag LOCUS_11930 15906 15328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 16786 16373 gene locus_tag LOCUS_11940 16786 16373 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_11940 16785 17105 gene locus_tag LOCUS_11950 16785 17105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 17338 17012 gene locus_tag LOCUS_11960 gene erpA 17338 17012 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_11960 17879 18640 gene locus_tag LOCUS_11970 17879 18640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 18704 18925 gene locus_tag LOCUS_11980 18704 18925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 19315 18929 gene locus_tag LOCUS_11990 19315 18929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 19454 19942 gene locus_tag LOCUS_12000 19454 19942 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_12000 20425 20012 gene locus_tag LOCUS_12010 20425 20012 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942308.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence038 1240 620 gene locus_tag LOCUS_12020 1240 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1209 2378 gene locus_tag LOCUS_12030 1209 2378 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865500.1 protein_id gnl|my_center|LOCUS_12030 2359 3786 gene locus_tag LOCUS_12040 2359 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4615 3812 gene locus_tag LOCUS_12050 4615 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 6436 4628 gene locus_tag LOCUS_12060 6436 4628 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892409.1 protein_id gnl|my_center|LOCUS_12060 6491 6516 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6920 6567 gene locus_tag LOCUS_12070 6920 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 7284 7045 gene locus_tag LOCUS_12080 7284 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12080 7994 7197 gene locus_tag LOCUS_12090 7994 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12090 9564 8104 gene locus_tag LOCUS_12100 9564 8104 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_12100 11029 9812 gene locus_tag LOCUS_12110 11029 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 11251 12234 gene locus_tag LOCUS_12120 11251 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 12239 13459 gene locus_tag LOCUS_12130 gene pucG 12239 13459 CDS product (S)-ureidoglycine--glyoxylate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244520.1 protein_id gnl|my_center|LOCUS_12130 13468 14946 gene locus_tag LOCUS_12140 13468 14946 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_12140 14981 16042 gene locus_tag LOCUS_12150 14981 16042 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966817.1 protein_id gnl|my_center|LOCUS_12150 16480 16058 gene locus_tag LOCUS_12160 16480 16058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 17568 16477 gene locus_tag LOCUS_12170 17568 16477 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_12170 18058 17573 gene locus_tag LOCUS_12180 18058 17573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 18452 18069 gene locus_tag LOCUS_12190 18452 18069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12190 19201 18365 gene locus_tag LOCUS_12200 19201 18365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12200 18518 18522 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence039 <1 912 gene locus_tag LOCUS_12210 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467730.1:4-hydroxy-3-methylbut-2-enyl diphosphate reductase 934 1524 gene locus_tag LOCUS_12220 gene amrA 934 1524 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_12220 1652 3058 gene locus_tag LOCUS_12230 1652 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 3182 3259 gene locus_tag LOCUS_t00090 3182 3259 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3441 3971 gene locus_tag LOCUS_12240 3441 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 3928 4509 gene locus_tag LOCUS_12250 3928 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 5246 4605 gene locus_tag LOCUS_12260 5246 4605 CDS product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_12260 5438 5698 gene locus_tag LOCUS_12270 5438 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 5763 5963 gene locus_tag LOCUS_12280 5763 5963 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082425.1 protein_id gnl|my_center|LOCUS_12280 6346 6032 gene locus_tag LOCUS_12290 6346 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12290 6939 6346 gene locus_tag LOCUS_12300 6939 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7458 7000 gene locus_tag LOCUS_12310 7458 7000 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879802.1 protein_id gnl|my_center|LOCUS_12310 7572 8375 gene locus_tag LOCUS_12320 7572 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 8583 8825 gene locus_tag LOCUS_12330 8583 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 9987 8980 gene locus_tag LOCUS_12340 9987 8980 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_12340 10185 10925 gene locus_tag LOCUS_12350 10185 10925 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140961.1 protein_id gnl|my_center|LOCUS_12350 10812 10847 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10922 11371 gene locus_tag LOCUS_12360 10922 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 12238 11405 gene locus_tag LOCUS_12370 12238 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 12416 12458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12532 13329 gene locus_tag LOCUS_12380 12532 13329 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393334.1 protein_id gnl|my_center|LOCUS_12380 13335 14312 gene locus_tag LOCUS_12390 13335 14312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 14309 16351 gene locus_tag LOCUS_12400 14309 16351 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_12400 16355 18115 gene locus_tag LOCUS_12410 16355 18115 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_12410 18138 19625 gene locus_tag LOCUS_12420 18138 19625 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence040 1278 100 gene locus_tag LOCUS_12430 gene nifS 1278 100 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_12430 3808 1514 gene locus_tag LOCUS_12440 3808 1514 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_12440 4389 3844 gene locus_tag LOCUS_12450 4389 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 4952 4419 gene locus_tag LOCUS_12460 4952 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 5312 5040 gene locus_tag LOCUS_12470 5312 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12470 6465 5290 gene locus_tag LOCUS_12480 6465 5290 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12480 7278 6499 gene locus_tag LOCUS_12490 7278 6499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395917.1 protein_id gnl|my_center|LOCUS_12490 8132 7275 gene locus_tag LOCUS_12500 gene ssuC 8132 7275 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_12500 8922 8119 gene locus_tag LOCUS_12510 8922 8119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_12510 9989 8964 gene locus_tag LOCUS_12520 9989 8964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887573.1 protein_id gnl|my_center|LOCUS_12520 10426 10091 gene locus_tag LOCUS_12530 10426 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 11771 10437 gene locus_tag LOCUS_12540 11771 10437 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064536.1 protein_id gnl|my_center|LOCUS_12540 12613 11786 gene locus_tag LOCUS_12550 12613 11786 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230331.1 protein_id gnl|my_center|LOCUS_12550 13902 12619 gene locus_tag LOCUS_12560 13902 12619 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_12560 14594 13914 gene locus_tag LOCUS_12570 14594 13914 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_12570 15396 14587 gene locus_tag LOCUS_12580 15396 14587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028630.1 protein_id gnl|my_center|LOCUS_12580 16455 15421 gene locus_tag LOCUS_12590 16455 15421 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384202.1 protein_id gnl|my_center|LOCUS_12590 16824 17657 gene locus_tag LOCUS_12600 16824 17657 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803988.1 protein_id gnl|my_center|LOCUS_12600 17771 18190 gene locus_tag LOCUS_12610 17771 18190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 18214 18954 gene locus_tag LOCUS_12620 18214 18954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 18951 19577 gene locus_tag LOCUS_12630 18951 19577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence041 188 1036 gene locus_tag LOCUS_12640 188 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1098 2099 gene locus_tag LOCUS_12650 1098 2099 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031181.1 protein_id gnl|my_center|LOCUS_12650 2255 3343 gene locus_tag LOCUS_12660 gene pepQ 2255 3343 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249918.1 protein_id gnl|my_center|LOCUS_12660 3455 4459 gene locus_tag LOCUS_12670 3455 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 4456 5487 gene locus_tag LOCUS_12680 4456 5487 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530818.1 protein_id gnl|my_center|LOCUS_12680 5508 6419 gene locus_tag LOCUS_12690 5508 6419 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_12690 6419 8302 gene locus_tag LOCUS_12700 gene asnB 6419 8302 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_12700 8312 9430 gene locus_tag LOCUS_12710 8312 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 10179 9427 gene locus_tag LOCUS_12720 10179 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 10640 10176 gene locus_tag LOCUS_12730 10640 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 11782 10613 gene locus_tag LOCUS_12740 11782 10613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 12937 11795 gene locus_tag LOCUS_12750 12937 11795 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_12750 13792 12950 gene locus_tag LOCUS_12760 13792 12950 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_12760 13997 14800 gene locus_tag LOCUS_12770 13997 14800 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_12770 15040 16287 gene locus_tag LOCUS_12780 15040 16287 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256710.1 protein_id gnl|my_center|LOCUS_12780 16317 16934 gene locus_tag LOCUS_12790 16317 16934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256711.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence042 932 219 gene locus_tag LOCUS_12800 932 219 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395936.1 protein_id gnl|my_center|LOCUS_12800 1201 1004 gene locus_tag LOCUS_12810 1201 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 2217 1225 gene locus_tag LOCUS_12820 2217 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3194 2283 gene locus_tag LOCUS_12830 gene puuE 3194 2283 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267253.1 protein_id gnl|my_center|LOCUS_12830 3291 3321 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3479 3637 gene locus_tag LOCUS_12840 3479 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 3678 4868 gene locus_tag LOCUS_12850 gene ispG 3678 4868 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887031.1 protein_id gnl|my_center|LOCUS_12850 7478 5004 gene locus_tag LOCUS_12860 7478 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 8393 7485 gene locus_tag LOCUS_12870 8393 7485 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931471.1 protein_id gnl|my_center|LOCUS_12870 9615 8398 gene locus_tag LOCUS_12880 9615 8398 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384689.1 protein_id gnl|my_center|LOCUS_12880 10416 9649 gene locus_tag LOCUS_12890 10416 9649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_12890 11170 10436 gene locus_tag LOCUS_12900 11170 10436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921642.1 protein_id gnl|my_center|LOCUS_12900 11429 11914 gene locus_tag LOCUS_12910 11429 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 11964 13061 gene locus_tag LOCUS_12920 11964 13061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 13058 13534 gene locus_tag LOCUS_12930 13058 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 13588 13887 gene locus_tag LOCUS_12940 13588 13887 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141375.1 protein_id gnl|my_center|LOCUS_12940 13962 14975 gene locus_tag LOCUS_12950 13962 14975 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529865.1 protein_id gnl|my_center|LOCUS_12950 16153 15035 gene locus_tag LOCUS_12960 16153 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 17151 16162 gene locus_tag LOCUS_12970 17151 16162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 18275 17181 gene locus_tag LOCUS_12980 18275 17181 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_12980 <19369 18312 gene locus_tag LOCUS_12990 <19369 18312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814134.1:NAD-dependent epimerase/dehydratase >Feature sequence043 137 1114 gene locus_tag LOCUS_13000 137 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1245 2345 gene locus_tag LOCUS_13010 1245 2345 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191120.1 protein_id gnl|my_center|LOCUS_13010 3416 2388 gene locus_tag LOCUS_13020 gene dapA 3416 2388 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_13020 4470 3478 gene locus_tag LOCUS_13030 4470 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 5400 4675 gene locus_tag LOCUS_13040 5400 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 5526 5571 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6644 5805 gene locus_tag LOCUS_13050 6644 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 8984 6675 gene locus_tag LOCUS_13060 8984 6675 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_13060 10179 9181 gene locus_tag LOCUS_13070 10179 9181 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_13070 10449 10964 gene locus_tag LOCUS_13080 10449 10964 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964325.1 protein_id gnl|my_center|LOCUS_13080 11450 11013 gene locus_tag LOCUS_13090 11450 11013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 12012 11410 gene locus_tag LOCUS_13100 12012 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 13821 12085 gene locus_tag LOCUS_13110 13821 12085 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_13110 15926 13818 gene locus_tag LOCUS_13120 15926 13818 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_13120 15682 15718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16692 15934 gene locus_tag LOCUS_13130 16692 15934 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384206.1 protein_id gnl|my_center|LOCUS_13130 17459 16689 gene locus_tag LOCUS_13140 17459 16689 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094604.1 protein_id gnl|my_center|LOCUS_13140 18227 17463 gene locus_tag LOCUS_13150 18227 17463 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973603.1 protein_id gnl|my_center|LOCUS_13150 19224 18250 gene locus_tag LOCUS_13160 19224 18250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence044 2666 2379 gene locus_tag LOCUS_13170 2666 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3265 2753 gene locus_tag LOCUS_13180 3265 2753 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320694.1 protein_id gnl|my_center|LOCUS_13180 4206 3313 gene locus_tag LOCUS_13190 gene nrfD 4206 3313 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879873.1 protein_id gnl|my_center|LOCUS_13190 4699 5988 gene locus_tag LOCUS_13200 4699 5988 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869885.1 protein_id gnl|my_center|LOCUS_13200 6021 7346 gene locus_tag LOCUS_13210 gene grdB 6021 7346 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011345263.1 transl_except (pos:7071..7073,aa:Sec) note codon on position 351 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_13210 7377 8474 gene locus_tag LOCUS_13220 7377 8474 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965491.1 protein_id gnl|my_center|LOCUS_13220 8450 9373 gene locus_tag LOCUS_13230 8450 9373 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086028.1 protein_id gnl|my_center|LOCUS_13230 9370 10191 gene locus_tag LOCUS_13240 9370 10191 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209786.1 protein_id gnl|my_center|LOCUS_13240 10221 11321 gene locus_tag LOCUS_13250 10221 11321 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_13250 11318 12358 gene locus_tag LOCUS_13260 11318 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 12443 13474 gene locus_tag LOCUS_13270 12443 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 13510 14589 gene locus_tag LOCUS_13280 13510 14589 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859505.1 protein_id gnl|my_center|LOCUS_13280 14628 15077 gene locus_tag LOCUS_13290 14628 15077 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_13290 15276 15860 gene locus_tag LOCUS_13300 15276 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 18245 16020 gene locus_tag LOCUS_13310 18245 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence045 751 197 gene locus_tag LOCUS_13320 751 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13320 1069 1197 gene locus_tag LOCUS_13330 1069 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1810 2022 gene locus_tag LOCUS_13340 1810 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2522 3529 gene locus_tag LOCUS_13350 gene pdxA 2522 3529 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_13350 5127 3538 gene locus_tag LOCUS_13360 5127 3538 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_13360 5524 5904 gene locus_tag LOCUS_13370 5524 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13370 6035 6688 gene locus_tag LOCUS_13380 6035 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 6718 7512 gene locus_tag LOCUS_13390 6718 7512 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_13390 8766 7654 gene locus_tag LOCUS_13400 8766 7654 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_13400 9677 8763 gene locus_tag LOCUS_13410 9677 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 10202 9702 gene locus_tag LOCUS_13420 10202 9702 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528818.1 protein_id gnl|my_center|LOCUS_13420 10855 10169 gene locus_tag LOCUS_13430 10855 10169 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444597.1 protein_id gnl|my_center|LOCUS_13430 11534 10821 gene locus_tag LOCUS_13440 11534 10821 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_13440 11938 11525 gene locus_tag LOCUS_13450 11938 11525 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546746.1 protein_id gnl|my_center|LOCUS_13450 12398 12216 gene locus_tag LOCUS_13460 12398 12216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 13137 12442 gene locus_tag LOCUS_13470 gene radC 13137 12442 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_13470 14309 13161 gene locus_tag LOCUS_13480 14309 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 15810 14539 gene locus_tag LOCUS_13490 15810 14539 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931016.1 protein_id gnl|my_center|LOCUS_13490 17993 15807 gene locus_tag LOCUS_13500 17993 15807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 <19001 18280 gene locus_tag LOCUS_13510 <19001 18280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958086.1:DNA recombination protein RmuC >Feature sequence046 1254 205 gene locus_tag LOCUS_13520 1254 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2572 1244 gene locus_tag LOCUS_13530 2572 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 3707 2829 gene locus_tag LOCUS_13540 3707 2829 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869118.1 protein_id gnl|my_center|LOCUS_13540 5044 3854 gene locus_tag LOCUS_13550 5044 3854 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459196.1 protein_id gnl|my_center|LOCUS_13550 5904 5041 gene locus_tag LOCUS_13560 5904 5041 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460375.1 protein_id gnl|my_center|LOCUS_13560 6012 6362 gene locus_tag LOCUS_13570 gene nirD 6012 6362 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_13570 7237 6449 gene locus_tag LOCUS_13580 7237 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 6702 6762 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7902 7234 gene locus_tag LOCUS_13590 7902 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 9124 8405 gene locus_tag LOCUS_13600 9124 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 10688 9423 gene locus_tag LOCUS_13610 10688 9423 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975162.1 protein_id gnl|my_center|LOCUS_13610 11388 10756 gene locus_tag LOCUS_13620 11388 10756 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939613.1 protein_id gnl|my_center|LOCUS_13620 12227 11487 gene locus_tag LOCUS_13630 12227 11487 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082767.1 protein_id gnl|my_center|LOCUS_13630 13093 12299 gene locus_tag LOCUS_13640 13093 12299 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939615.1 protein_id gnl|my_center|LOCUS_13640 14014 13166 gene locus_tag LOCUS_13650 14014 13166 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031213610.1 protein_id gnl|my_center|LOCUS_13650 15131 14109 gene locus_tag LOCUS_13660 15131 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 16089 15202 gene locus_tag LOCUS_13670 16089 15202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 16574 16041 gene locus_tag LOCUS_13680 16574 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13680 16097 16116 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17316 16651 gene locus_tag LOCUS_13690 17316 16651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13690 16786 16791 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18266 17331 gene locus_tag LOCUS_13700 gene pstA 18266 17331 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140014.1 protein_id gnl|my_center|LOCUS_13700 <18888 18268 gene locus_tag LOCUS_13710 <18888 18268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140013.1:phosphate ABC transporter permease subunit PstC >Feature sequence047 312 31 gene locus_tag LOCUS_13720 312 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 721 350 gene locus_tag LOCUS_13730 721 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 983 702 gene locus_tag LOCUS_13740 983 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4775 1236 gene locus_tag LOCUS_13750 gene smc 4775 1236 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_13750 5959 4931 gene locus_tag LOCUS_13760 5959 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13760 6951 5965 gene locus_tag LOCUS_13770 6951 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13770 7848 6976 gene locus_tag LOCUS_13780 gene glyQ 7848 6976 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_13780 8573 7845 gene locus_tag LOCUS_13790 8573 7845 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256367.1 protein_id gnl|my_center|LOCUS_13790 9322 8561 gene locus_tag LOCUS_13800 gene recO 9322 8561 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861552.1 protein_id gnl|my_center|LOCUS_13800 10689 9331 gene locus_tag LOCUS_13810 gene mgtE 10689 9331 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_13810 11742 10843 gene locus_tag LOCUS_13820 11742 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 12583 11771 gene locus_tag LOCUS_13830 12583 11771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 13493 12585 gene locus_tag LOCUS_13840 13493 12585 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_13840 13998 13510 gene locus_tag LOCUS_13850 13998 13510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13850 14036 14049 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14159 14380 gene locus_tag LOCUS_13860 14159 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 15402 14332 gene locus_tag LOCUS_13870 gene rlmN 15402 14332 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_13870 15841 15410 gene locus_tag LOCUS_13880 gene ndk 15841 15410 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545240.1 protein_id gnl|my_center|LOCUS_13880 16726 15851 gene locus_tag LOCUS_13890 gene sucD 16726 15851 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_13890 17604 16723 gene locus_tag LOCUS_13900 17604 16723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 18624 17875 gene locus_tag LOCUS_13910 gene sdhB 18624 17875 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808702.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence048 1363 575 gene locus_tag LOCUS_13920 1363 575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_13920 2166 1360 gene locus_tag LOCUS_13930 2166 1360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665694.1 protein_id gnl|my_center|LOCUS_13930 3221 2247 gene locus_tag LOCUS_13940 3221 2247 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808964.1 protein_id gnl|my_center|LOCUS_13940 3237 3512 gene locus_tag LOCUS_13950 3237 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3691 4560 gene locus_tag LOCUS_13960 3691 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13960 4573 4875 gene locus_tag LOCUS_13970 4573 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4900 5349 gene locus_tag LOCUS_13980 4900 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 5432 5962 gene locus_tag LOCUS_13990 5432 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 7355 6033 gene locus_tag LOCUS_14000 7355 6033 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339250.1 protein_id gnl|my_center|LOCUS_14000 7858 7352 gene locus_tag LOCUS_14010 7858 7352 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339251.1 protein_id gnl|my_center|LOCUS_14010 9108 7948 gene locus_tag LOCUS_14020 9108 7948 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810994.1 protein_id gnl|my_center|LOCUS_14020 11873 9372 gene locus_tag LOCUS_14030 11873 9372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942827.1 protein_id gnl|my_center|LOCUS_14030 12733 11912 gene locus_tag LOCUS_14040 12733 11912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_14040 14651 12735 gene locus_tag LOCUS_14050 14651 12735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 14851 15498 gene locus_tag LOCUS_14060 14851 15498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 15607 16014 gene locus_tag LOCUS_14070 15607 16014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 16014 17558 gene locus_tag LOCUS_14080 16014 17558 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083773.1 protein_id gnl|my_center|LOCUS_14080 17737 17976 gene locus_tag LOCUS_14090 17737 17976 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence049 351 1187 gene locus_tag LOCUS_14100 351 1187 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315998.1 protein_id gnl|my_center|LOCUS_14100 1211 2266 gene locus_tag LOCUS_14110 1211 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2278 3669 gene locus_tag LOCUS_14120 2278 3669 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_14120 3700 3939 gene locus_tag LOCUS_14130 3700 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 3936 4175 gene locus_tag LOCUS_14140 3936 4175 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229010.1 protein_id gnl|my_center|LOCUS_14140 4303 5655 gene locus_tag LOCUS_14150 gene allB 4303 5655 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399799.1 protein_id gnl|my_center|LOCUS_14150 5776 6975 gene locus_tag LOCUS_14160 5776 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 7802 7014 gene locus_tag LOCUS_14170 gene yqeB 7802 7014 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_14170 8442 7831 gene locus_tag LOCUS_14180 8442 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14180 9055 8435 gene locus_tag LOCUS_14190 gene yqeC 9055 8435 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_14190 10437 9247 gene locus_tag LOCUS_14200 10437 9247 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040674.1 protein_id gnl|my_center|LOCUS_14200 11931 10438 gene locus_tag LOCUS_14210 11931 10438 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_14210 13753 13004 gene locus_tag LOCUS_14220 gene bshB1 13753 13004 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_14220 13943 13755 gene locus_tag LOCUS_14230 13943 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 15058 14030 gene locus_tag LOCUS_14240 15058 14030 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 protein_id gnl|my_center|LOCUS_14240 15102 15123 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15161 15454 gene locus_tag LOCUS_14250 15161 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 15451 15921 gene locus_tag LOCUS_14260 15451 15921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 15927 16235 gene locus_tag LOCUS_14270 15927 16235 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256599.1 protein_id gnl|my_center|LOCUS_14270 16532 17524 gene locus_tag LOCUS_14280 16532 17524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_14280 17521 18552 gene locus_tag LOCUS_14290 17521 18552 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence050 202 771 gene locus_tag LOCUS_14300 202 771 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039645658.1 protein_id gnl|my_center|LOCUS_14300 1498 707 gene locus_tag LOCUS_14310 1498 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1045 1102 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1797 2762 gene locus_tag LOCUS_14320 1797 2762 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_14320 2759 3205 gene locus_tag LOCUS_14330 gene ybeY 2759 3205 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942921.1 protein_id gnl|my_center|LOCUS_14330 3222 3599 gene locus_tag LOCUS_14340 3222 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14340 3566 4018 gene locus_tag LOCUS_14350 3566 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14350 4050 5555 gene locus_tag LOCUS_14360 gene lnt 4050 5555 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_14360 5748 6662 gene locus_tag LOCUS_14370 gene prfB 5748 6662 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14370 6785 8263 gene locus_tag LOCUS_14380 gene lysS 6785 8263 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_14380 8267 9499 gene locus_tag LOCUS_14390 8267 9499 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_14390 9502 10218 gene locus_tag LOCUS_14400 9502 10218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_14400 10296 12512 gene locus_tag LOCUS_14410 gene bamA 10296 12512 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_14410 12532 13074 gene locus_tag LOCUS_14420 12532 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 13093 14133 gene locus_tag LOCUS_14430 gene lpxD 13093 14133 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_14430 14133 14606 gene locus_tag LOCUS_14440 14133 14606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 14606 15529 gene locus_tag LOCUS_14450 14606 15529 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_14450 15526 16632 gene locus_tag LOCUS_14460 15526 16632 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 protein_id gnl|my_center|LOCUS_14460 16626 17783 gene locus_tag LOCUS_14470 gene lpxB 16626 17783 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence051 1247 573 gene locus_tag LOCUS_14480 gene thiE 1247 573 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_14480 2057 1254 gene locus_tag LOCUS_14490 2057 1254 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_14490 2263 2063 gene locus_tag LOCUS_14500 gene thiS 2263 2063 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546191.1 protein_id gnl|my_center|LOCUS_14500 2576 4804 gene locus_tag LOCUS_14510 2576 4804 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_14510 3406 3445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4997 7450 gene locus_tag LOCUS_14520 4997 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 7461 9155 gene locus_tag LOCUS_14530 7461 9155 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537808.1 protein_id gnl|my_center|LOCUS_14530 9314 11098 gene locus_tag LOCUS_14540 9314 11098 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537808.1 protein_id gnl|my_center|LOCUS_14540 11479 13038 gene locus_tag LOCUS_14550 gene purH 11479 13038 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_14550 13134 14432 gene locus_tag LOCUS_14560 gene purD 13134 14432 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_14560 14480 14989 gene locus_tag LOCUS_14570 gene purE 14480 14989 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_14570 14992 15630 gene locus_tag LOCUS_14580 14992 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 15644 16594 gene locus_tag LOCUS_14590 15644 16594 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_14590 16643 17221 gene locus_tag LOCUS_14600 16643 17221 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_14600 17218 17760 gene locus_tag LOCUS_14610 17218 17760 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_14610 17763 18389 gene locus_tag LOCUS_14620 17763 18389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence052 1867 116 gene locus_tag LOCUS_14630 gene sdhA 1867 116 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808703.1 protein_id gnl|my_center|LOCUS_14630 2603 1875 gene locus_tag LOCUS_14640 2603 1875 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976288.1 protein_id gnl|my_center|LOCUS_14640 3553 2636 gene locus_tag LOCUS_14650 3553 2636 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_14650 5461 4295 gene locus_tag LOCUS_14660 5461 4295 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_14660 5687 6829 gene locus_tag LOCUS_14670 gene solA 5687 6829 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_14670 8045 6951 gene locus_tag LOCUS_14680 8045 6951 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583578.1 protein_id gnl|my_center|LOCUS_14680 8956 8306 gene locus_tag LOCUS_14690 8956 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 9351 10163 gene locus_tag LOCUS_14700 9351 10163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530817.1 protein_id gnl|my_center|LOCUS_14700 10210 10962 gene locus_tag LOCUS_14710 10210 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 10959 11783 gene locus_tag LOCUS_14720 gene ssuC 10959 11783 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191980.1 protein_id gnl|my_center|LOCUS_14720 11964 14075 gene locus_tag LOCUS_14730 11964 14075 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827278.1 protein_id gnl|my_center|LOCUS_14730 14087 16411 gene locus_tag LOCUS_14740 14087 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 16411 17199 gene locus_tag LOCUS_14750 16411 17199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_14750 17272 18075 gene locus_tag LOCUS_14760 17272 18075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085620.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence053 436 1518 gene locus_tag LOCUS_14770 436 1518 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930756.1 protein_id gnl|my_center|LOCUS_14770 1534 2544 gene locus_tag LOCUS_14780 1534 2544 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_14780 2599 4014 gene locus_tag LOCUS_14790 2599 4014 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_14790 4011 4982 gene locus_tag LOCUS_14800 4011 4982 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_14800 4994 5335 gene locus_tag LOCUS_14810 4994 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 5347 5763 gene locus_tag LOCUS_14820 5347 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 6798 5815 gene locus_tag LOCUS_14830 6798 5815 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393479.1 protein_id gnl|my_center|LOCUS_14830 7438 6818 gene locus_tag LOCUS_14840 7438 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 7961 7455 gene locus_tag LOCUS_14850 gene comD 7961 7455 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496437.1 protein_id gnl|my_center|LOCUS_14850 8264 9721 gene locus_tag LOCUS_14860 8264 9721 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925697.1 protein_id gnl|my_center|LOCUS_14860 9884 10129 gene locus_tag LOCUS_14870 9884 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 10160 10477 gene locus_tag LOCUS_14880 10160 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 12471 10480 gene locus_tag LOCUS_14890 12471 10480 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_14890 13615 12614 gene locus_tag LOCUS_14900 13615 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 14550 13651 gene locus_tag LOCUS_14910 14550 13651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 14732 15268 gene locus_tag LOCUS_14920 14732 15268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 15346 16458 gene locus_tag LOCUS_14930 15346 16458 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_14930 16578 17576 gene locus_tag LOCUS_14940 16578 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence054 362 1141 gene locus_tag LOCUS_14950 362 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1189 1265 gene locus_tag LOCUS_t00100 1189 1265 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1591 2640 gene locus_tag LOCUS_14960 1591 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2651 3661 gene locus_tag LOCUS_14970 2651 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 3808 4668 gene locus_tag LOCUS_14980 3808 4668 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176150.1 protein_id gnl|my_center|LOCUS_14980 4916 5566 gene locus_tag LOCUS_14990 4916 5566 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140612.1 protein_id gnl|my_center|LOCUS_14990 5685 6794 gene locus_tag LOCUS_15000 5685 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 7117 6782 gene locus_tag LOCUS_15010 7117 6782 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190354.1 protein_id gnl|my_center|LOCUS_15010 8415 7231 gene locus_tag LOCUS_15020 8415 7231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_15020 8856 8488 gene locus_tag LOCUS_15030 8856 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 9422 8868 gene locus_tag LOCUS_15040 9422 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 10439 9432 gene locus_tag LOCUS_15050 10439 9432 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176672.1 protein_id gnl|my_center|LOCUS_15050 10693 10917 gene locus_tag LOCUS_15060 10693 10917 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250645.1 protein_id gnl|my_center|LOCUS_15060 11766 11176 gene locus_tag LOCUS_15070 11766 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 12087 12245 gene locus_tag LOCUS_15080 12087 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 12255 12479 gene locus_tag LOCUS_15090 12255 12479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 12547 13149 gene locus_tag LOCUS_15100 12547 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 14270 15559 gene locus_tag LOCUS_15110 14270 15559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15110 15562 16509 gene locus_tag LOCUS_15120 15562 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence055 477 4 gene locus_tag LOCUS_15130 477 4 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_15130 2229 532 gene locus_tag LOCUS_15140 2229 532 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229601.1 protein_id gnl|my_center|LOCUS_15140 4326 2245 gene locus_tag LOCUS_15150 4326 2245 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_15150 4490 5344 gene locus_tag LOCUS_15160 gene hpaD 4490 5344 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194590.1 protein_id gnl|my_center|LOCUS_15160 5350 6144 gene locus_tag LOCUS_15170 5350 6144 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729455.1 protein_id gnl|my_center|LOCUS_15170 7302 6508 gene locus_tag LOCUS_15180 gene mhpB 7302 6508 CDS product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 protein_id gnl|my_center|LOCUS_15180 8238 7321 gene locus_tag LOCUS_15190 gene thrB 8238 7321 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 protein_id gnl|my_center|LOCUS_15190 9650 8268 gene locus_tag LOCUS_15200 9650 8268 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_15200 10103 9705 gene locus_tag LOCUS_15210 10103 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 11713 10271 gene locus_tag LOCUS_15220 11713 10271 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399863.1 protein_id gnl|my_center|LOCUS_15220 12649 11762 gene locus_tag LOCUS_15230 12649 11762 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_15230 15100 12695 gene locus_tag LOCUS_15240 15100 12695 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921440.1 protein_id gnl|my_center|LOCUS_15240 15603 15103 gene locus_tag LOCUS_15250 gene cutC 15603 15103 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_15250 16703 15588 gene locus_tag LOCUS_15260 16703 15588 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986686.1 protein_id gnl|my_center|LOCUS_15260 16894 16679 gene locus_tag LOCUS_15270 16894 16679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence056 2306 1095 gene locus_tag LOCUS_15280 2306 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_15280 3058 2291 gene locus_tag LOCUS_15290 3058 2291 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787370.1 protein_id gnl|my_center|LOCUS_15290 5398 3074 gene locus_tag LOCUS_15300 5398 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 5743 5549 gene locus_tag LOCUS_15310 5743 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 8024 5778 gene locus_tag LOCUS_15320 8024 5778 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_15320 8338 8102 gene locus_tag LOCUS_15330 8338 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 8528 8773 gene locus_tag LOCUS_15340 8528 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 8764 9228 gene locus_tag LOCUS_15350 8764 9228 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392208.1 protein_id gnl|my_center|LOCUS_15350 9280 10050 gene locus_tag LOCUS_15360 9280 10050 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392230.1 protein_id gnl|my_center|LOCUS_15360 10055 11788 gene locus_tag LOCUS_15370 10055 11788 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_15370 11764 12564 gene locus_tag LOCUS_15380 11764 12564 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392229.1 protein_id gnl|my_center|LOCUS_15380 13507 12734 gene locus_tag LOCUS_15390 13507 12734 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_15390 14415 13507 gene locus_tag LOCUS_15400 14415 13507 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978819.1 protein_id gnl|my_center|LOCUS_15400 14572 15585 gene locus_tag LOCUS_15410 14572 15585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 16445 15669 gene locus_tag LOCUS_15420 16445 15669 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748363.1 protein_id gnl|my_center|LOCUS_15420 17230 16445 gene locus_tag LOCUS_15430 17230 16445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748363.1 protein_id gnl|my_center|LOCUS_15430 <17980 17238 gene locus_tag LOCUS_15440 <17980 17238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090280.1:4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase >Feature sequence057 <1 1581 gene locus_tag LOCUS_15450 <1 1581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545409.1:molecular chaperone DnaK 1703 2821 gene locus_tag LOCUS_15460 gene dnaJ 1703 2821 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_15460 2850 3713 gene locus_tag LOCUS_15470 gene htpX 2850 3713 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_15470 3778 4008 gene locus_tag LOCUS_15480 3778 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3947 5923 gene locus_tag LOCUS_15490 3947 5923 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_15490 5940 6581 gene locus_tag LOCUS_15500 5940 6581 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064451.1 protein_id gnl|my_center|LOCUS_15500 6679 7182 gene locus_tag LOCUS_15510 6679 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 7217 8698 gene locus_tag LOCUS_15520 7217 8698 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_15520 8707 9630 gene locus_tag LOCUS_15530 gene ispE 8707 9630 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_15530 8827 8860 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9570 9839 gene locus_tag LOCUS_15540 gene spoVG 9570 9839 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_15540 10006 10941 gene locus_tag LOCUS_15550 10006 10941 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195243.1 protein_id gnl|my_center|LOCUS_15550 10973 11647 gene locus_tag LOCUS_15560 10973 11647 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082103.1 protein_id gnl|my_center|LOCUS_15560 11648 12205 gene locus_tag LOCUS_15570 gene pth 11648 12205 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_15570 12211 13302 gene locus_tag LOCUS_15580 gene ychF 12211 13302 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_15580 13318 13749 gene locus_tag LOCUS_15590 13318 13749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 14102 13875 gene locus_tag LOCUS_15600 14102 13875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 14062 15003 gene locus_tag LOCUS_15610 14062 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 15030 15485 gene locus_tag LOCUS_15620 gene rplI 15030 15485 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_15620 15946 17325 gene locus_tag LOCUS_15630 gene dnaB 15946 17325 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_15630 17322 17579 gene locus_tag LOCUS_15640 17322 17579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 17657 17938 gene locus_tag LOCUS_15650 17657 17938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence058 1676 825 gene locus_tag LOCUS_15660 gene pssA 1676 825 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_15660 2335 1673 gene locus_tag LOCUS_15670 2335 1673 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_15670 2808 2332 gene locus_tag LOCUS_15680 gene ilvN 2808 2332 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_15680 4564 2816 gene locus_tag LOCUS_15690 gene ilvB 4564 2816 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_15690 4876 4634 gene locus_tag LOCUS_15700 4876 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5737 4982 gene locus_tag LOCUS_15710 gene tsaB 5737 4982 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_15710 6838 5747 gene locus_tag LOCUS_15720 gene rseP 6838 5747 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_15720 8062 6890 gene locus_tag LOCUS_15730 8062 6890 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_15730 8866 8075 gene locus_tag LOCUS_15740 8866 8075 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_15740 9639 8866 gene locus_tag LOCUS_15750 9639 8866 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_15750 10322 9708 gene locus_tag LOCUS_15760 10322 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 11028 10471 gene locus_tag LOCUS_15770 gene frr 11028 10471 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_15770 11763 11047 gene locus_tag LOCUS_15780 gene pyrH 11763 11047 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_15780 12398 11799 gene locus_tag LOCUS_15790 gene tsf 12398 11799 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_15790 13243 12428 gene locus_tag LOCUS_15800 gene rpsB 13243 12428 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_15800 13716 13411 gene locus_tag LOCUS_15810 13716 13411 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_15810 13947 13741 gene locus_tag LOCUS_15820 13947 13741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 14228 13929 gene locus_tag LOCUS_15830 14228 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 15651 14401 gene locus_tag LOCUS_15840 15651 14401 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396729.1 protein_id gnl|my_center|LOCUS_15840 16903 15659 gene locus_tag LOCUS_15850 16903 15659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 <17941 16911 gene locus_tag LOCUS_15860 <17941 16911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256149.1:aminopeptidase P family protein >Feature sequence059 237 1040 gene locus_tag LOCUS_15870 237 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1059 2024 gene locus_tag LOCUS_15880 gene tsuA 1059 2024 CDS product thiosulfate utilization transporter TsuA/YeeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492339.1 protein_id gnl|my_center|LOCUS_15880 2033 2263 gene locus_tag LOCUS_15890 2033 2263 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080581.1 protein_id gnl|my_center|LOCUS_15890 2273 3211 gene locus_tag LOCUS_15900 gene rhdA 2273 3211 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_15900 3228 3473 gene locus_tag LOCUS_15910 3228 3473 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015106.1 protein_id gnl|my_center|LOCUS_15910 3470 4213 gene locus_tag LOCUS_15920 gene thiF 3470 4213 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_15920 4227 5183 gene locus_tag LOCUS_15930 4227 5183 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_15930 5229 5660 gene locus_tag LOCUS_15940 5229 5660 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_15940 5647 7059 gene locus_tag LOCUS_15950 gene sat 5647 7059 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_15950 8086 9099 gene locus_tag LOCUS_15960 8086 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15960 9490 11289 gene locus_tag LOCUS_15970 9490 11289 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_15970 11307 12140 gene locus_tag LOCUS_15980 11307 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 12231 12935 gene locus_tag LOCUS_15990 12231 12935 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943893.1 protein_id gnl|my_center|LOCUS_15990 12932 13852 gene locus_tag LOCUS_16000 12932 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 13857 14567 gene locus_tag LOCUS_16010 13857 14567 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_16010 14564 15778 gene locus_tag LOCUS_16020 gene sat 14564 15778 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_16020 16732 15884 gene locus_tag LOCUS_16030 gene puuE 16732 15884 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267253.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence060 1125 208 gene locus_tag LOCUS_16040 1125 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1860 1150 gene locus_tag LOCUS_16050 gene ubiE 1860 1150 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_16050 2115 3101 gene locus_tag LOCUS_16060 2115 3101 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803989.1 protein_id gnl|my_center|LOCUS_16060 3133 4209 gene locus_tag LOCUS_16070 gene ala 3133 4209 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_16070 4271 5029 gene locus_tag LOCUS_16080 4271 5029 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_16080 5690 5007 gene locus_tag LOCUS_16090 5690 5007 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_16090 6957 5707 gene locus_tag LOCUS_16100 6957 5707 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_16100 7955 6954 gene locus_tag LOCUS_16110 7955 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 8553 7978 gene locus_tag LOCUS_16120 8553 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 8830 10524 gene locus_tag LOCUS_16130 8830 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 10521 11960 gene locus_tag LOCUS_16140 10521 11960 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_16140 12010 12261 gene locus_tag LOCUS_16150 12010 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 12299 12568 gene locus_tag LOCUS_16160 12299 12568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 13173 13796 gene locus_tag LOCUS_16170 13173 13796 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_16170 13793 15220 gene locus_tag LOCUS_16180 gene rny 13793 15220 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_16180 15236 16024 gene locus_tag LOCUS_16190 15236 16024 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_16190 16300 17289 gene locus_tag LOCUS_16200 gene tyrS 16300 17289 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16200 >Feature sequence061 1404 508 gene locus_tag LOCUS_16210 1404 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2181 1417 gene locus_tag LOCUS_16220 2181 1417 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_16220 4633 2183 gene locus_tag LOCUS_16230 gene fdnG 4633 2183 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546362.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16230 5244 4630 gene locus_tag LOCUS_16240 5244 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16240 5624 5301 gene locus_tag LOCUS_16250 5624 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 5878 6051 gene locus_tag LOCUS_16260 5878 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 6066 7364 gene locus_tag LOCUS_16270 6066 7364 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941517.1 protein_id gnl|my_center|LOCUS_16270 7364 9883 gene locus_tag LOCUS_16280 7364 9883 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_16280 9902 11431 gene locus_tag LOCUS_16290 gene rng 9902 11431 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_16290 12956 11439 gene locus_tag LOCUS_16300 12956 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 13811 13089 gene locus_tag LOCUS_16310 13811 13089 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943095.1 protein_id gnl|my_center|LOCUS_16310 14547 13813 gene locus_tag LOCUS_16320 gene truA 14547 13813 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_16320 14641 15651 gene locus_tag LOCUS_16330 14641 15651 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_16330 16453 15692 gene locus_tag LOCUS_16340 16453 15692 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_16340 <17340 16633 gene locus_tag LOCUS_16350 <17340 16633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087565.1:substrate-binding domain-containing protein >Feature sequence062 512 793 gene locus_tag LOCUS_16360 512 793 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_16360 949 2409 gene locus_tag LOCUS_16370 949 2409 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_16370 2428 3036 gene locus_tag LOCUS_16380 gene dcd 2428 3036 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_16380 3051 4058 gene locus_tag LOCUS_16390 3051 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4172 5653 gene locus_tag LOCUS_16400 4172 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 5665 6237 gene locus_tag LOCUS_16410 5665 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 6251 6961 gene locus_tag LOCUS_16420 6251 6961 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_16420 6958 7203 gene locus_tag LOCUS_16430 6958 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 7239 7472 gene locus_tag LOCUS_16440 7239 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 7490 9004 gene locus_tag LOCUS_16450 7490 9004 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_16450 9001 9978 gene locus_tag LOCUS_16460 9001 9978 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_16460 9975 10934 gene locus_tag LOCUS_16470 gene rbsK 9975 10934 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 protein_id gnl|my_center|LOCUS_16470 10931 11413 gene locus_tag LOCUS_16480 10931 11413 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928893.1 protein_id gnl|my_center|LOCUS_16480 11504 11806 gene locus_tag LOCUS_16490 11504 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 11820 12383 gene locus_tag LOCUS_16500 11820 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 12383 13468 gene locus_tag LOCUS_16510 12383 13468 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_16510 13481 14044 gene locus_tag LOCUS_16520 13481 14044 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_16520 14066 14374 gene locus_tag LOCUS_16530 14066 14374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 14383 14625 gene locus_tag LOCUS_16540 14383 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 14607 15521 gene locus_tag LOCUS_16550 14607 15521 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410917.1 protein_id gnl|my_center|LOCUS_16550 15537 16271 gene locus_tag LOCUS_16560 15537 16271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 <17195 16375 gene locus_tag LOCUS_16570 <17195 16375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045029.1:heavy metal translocating P-type ATPase >Feature sequence063 285 1682 gene locus_tag LOCUS_16580 285 1682 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296871.1 protein_id gnl|my_center|LOCUS_16580 2535 1966 gene locus_tag LOCUS_16590 2535 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2971 2654 gene locus_tag LOCUS_16600 2971 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3397 4581 gene locus_tag LOCUS_16610 3397 4581 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064155.1 protein_id gnl|my_center|LOCUS_16610 4584 5723 gene locus_tag LOCUS_16620 4584 5723 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_16620 5737 6192 gene locus_tag LOCUS_16630 5737 6192 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_16630 6222 6965 gene locus_tag LOCUS_16640 gene fabG 6222 6965 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392772.1 protein_id gnl|my_center|LOCUS_16640 6968 7402 gene locus_tag LOCUS_16650 6968 7402 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_16650 7446 9059 gene locus_tag LOCUS_16660 7446 9059 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_16660 9068 10255 gene locus_tag LOCUS_16670 9068 10255 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_16670 10292 12403 gene locus_tag LOCUS_16680 10292 12403 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_16680 12400 14127 gene locus_tag LOCUS_16690 12400 14127 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_16690 14127 14867 gene locus_tag LOCUS_16700 14127 14867 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064245.1 protein_id gnl|my_center|LOCUS_16700 14867 15592 gene locus_tag LOCUS_16710 14867 15592 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 protein_id gnl|my_center|LOCUS_16710 15639 16634 gene locus_tag LOCUS_16720 15639 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence064 1328 414 gene locus_tag LOCUS_16730 1328 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2022 1414 gene locus_tag LOCUS_16740 2022 1414 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320694.1 protein_id gnl|my_center|LOCUS_16740 4601 2019 gene locus_tag LOCUS_16750 gene sreA 4601 2019 CDS product sulfur reductase subunit SreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880782.1 protein_id gnl|my_center|LOCUS_16750 4967 4653 gene locus_tag LOCUS_16760 4967 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 7010 5418 gene locus_tag LOCUS_16770 gene rpoD 7010 5418 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_16770 7246 8787 gene locus_tag LOCUS_16780 7246 8787 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_16780 8895 9416 gene locus_tag LOCUS_16790 8895 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 9427 10101 gene locus_tag LOCUS_16800 9427 10101 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035829.1 protein_id gnl|my_center|LOCUS_16800 10169 11206 gene locus_tag LOCUS_16810 10169 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 12058 11273 gene locus_tag LOCUS_16820 gene lgt 12058 11273 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171692.1 protein_id gnl|my_center|LOCUS_16820 12241 13344 gene locus_tag LOCUS_16830 12241 13344 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_16830 13360 15084 gene locus_tag LOCUS_16840 13360 15084 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_16840 15215 15403 gene locus_tag LOCUS_16850 15215 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 15412 16425 gene locus_tag LOCUS_16860 15412 16425 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence065 633 277 gene locus_tag LOCUS_16870 633 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 548 778 gene locus_tag LOCUS_16880 548 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1493 825 gene locus_tag LOCUS_16890 1493 825 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_16890 2684 1638 gene locus_tag LOCUS_16900 2684 1638 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383350.1 protein_id gnl|my_center|LOCUS_16900 3699 2710 gene locus_tag LOCUS_16910 3699 2710 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296290.1 protein_id gnl|my_center|LOCUS_16910 3987 3808 gene locus_tag LOCUS_16920 3987 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 5282 4500 gene locus_tag LOCUS_16930 5282 4500 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_16930 6105 5293 gene locus_tag LOCUS_16940 6105 5293 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_16940 7101 6202 gene locus_tag LOCUS_16950 7101 6202 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639891.1 protein_id gnl|my_center|LOCUS_16950 7300 8850 gene locus_tag LOCUS_16960 7300 8850 CDS product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065212.1 protein_id gnl|my_center|LOCUS_16960 8869 9795 gene locus_tag LOCUS_16970 8869 9795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_16970 9808 10689 gene locus_tag LOCUS_16980 9808 10689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_16980 10736 11353 gene locus_tag LOCUS_16990 10736 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 11368 12834 gene locus_tag LOCUS_17000 11368 12834 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_17000 12834 13814 gene locus_tag LOCUS_17010 gene floA 12834 13814 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_17010 13830 14588 gene locus_tag LOCUS_17020 13830 14588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 15147 16004 gene locus_tag LOCUS_17030 15147 16004 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015241729.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence066 24 476 gene locus_tag LOCUS_17040 24 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2013 481 gene locus_tag LOCUS_17050 2013 481 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_17050 2797 2048 gene locus_tag LOCUS_17060 2797 2048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 protein_id gnl|my_center|LOCUS_17060 3577 2804 gene locus_tag LOCUS_17070 3577 2804 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173656.1 protein_id gnl|my_center|LOCUS_17070 4905 3574 gene locus_tag LOCUS_17080 4905 3574 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143837.1 protein_id gnl|my_center|LOCUS_17080 5622 4921 gene locus_tag LOCUS_17090 5622 4921 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809371.1 protein_id gnl|my_center|LOCUS_17090 5651 5674 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7402 5795 gene locus_tag LOCUS_17100 7402 5795 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399863.1 protein_id gnl|my_center|LOCUS_17100 8204 7407 gene locus_tag LOCUS_17110 8204 7407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_17110 9019 8108 gene locus_tag LOCUS_17120 9019 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 9666 9085 gene locus_tag LOCUS_17130 9666 9085 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389806.1 protein_id gnl|my_center|LOCUS_17130 9626 9790 gene locus_tag LOCUS_17140 9626 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 9975 9844 gene locus_tag LOCUS_17150 9975 9844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 10771 10004 gene locus_tag LOCUS_17160 10771 10004 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_17160 11597 10776 gene locus_tag LOCUS_17170 11597 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 12424 11840 gene locus_tag LOCUS_17180 12424 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 12423 13388 gene locus_tag LOCUS_17190 12423 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 13419 15869 gene locus_tag LOCUS_17200 13419 15869 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921440.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17200 15866 16318 gene locus_tag LOCUS_17210 15866 16318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17210 >Feature sequence067 1254 232 gene locus_tag LOCUS_17220 1254 232 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987008.1 protein_id gnl|my_center|LOCUS_17220 3017 1299 gene locus_tag LOCUS_17230 3017 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 4078 3014 gene locus_tag LOCUS_17240 4078 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 5127 4075 gene locus_tag LOCUS_17250 5127 4075 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_17250 5713 5255 gene locus_tag LOCUS_17260 gene fliW 5713 5255 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510650.1 protein_id gnl|my_center|LOCUS_17260 5970 5710 gene locus_tag LOCUS_17270 5970 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 6906 6022 gene locus_tag LOCUS_17280 gene flgL 6906 6022 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_17280 8640 6919 gene locus_tag LOCUS_17290 8640 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 9144 8650 gene locus_tag LOCUS_17300 9144 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 9487 9170 gene locus_tag LOCUS_17310 9487 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 9891 9484 gene locus_tag LOCUS_17320 9891 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 10991 9891 gene locus_tag LOCUS_17330 10991 9891 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_17330 11700 11002 gene locus_tag LOCUS_17340 11700 11002 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_17340 12670 11711 gene locus_tag LOCUS_17350 12670 11711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 13462 12674 gene locus_tag LOCUS_17360 gene flgG 13462 12674 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_17360 14173 13481 gene locus_tag LOCUS_17370 gene flgF 14173 13481 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_17370 14410 14817 gene locus_tag LOCUS_17380 14410 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 16427 14871 gene locus_tag LOCUS_17390 16427 14871 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257549.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence068 3047 1098 gene locus_tag LOCUS_17400 gene nuoL 3047 1098 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_17400 3363 3058 gene locus_tag LOCUS_17410 gene nuoK 3363 3058 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_17410 3880 3374 gene locus_tag LOCUS_17420 3880 3374 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_17420 4869 3886 gene locus_tag LOCUS_17430 gene nuoH 4869 3886 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_17430 5393 4884 gene locus_tag LOCUS_17440 5393 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 5827 5384 gene locus_tag LOCUS_17450 5827 5384 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_17450 6019 7311 gene locus_tag LOCUS_17460 gene hemL 6019 7311 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_17460 7341 7604 gene locus_tag LOCUS_17470 7341 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 7579 7977 gene locus_tag LOCUS_17480 7579 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 7926 8642 gene locus_tag LOCUS_17490 7926 8642 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_17490 8674 8985 gene locus_tag LOCUS_17500 gene atpE 8674 8985 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_17500 9780 9037 gene locus_tag LOCUS_17510 9780 9037 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_17510 9954 10688 gene locus_tag LOCUS_17520 9954 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 10758 12071 gene locus_tag LOCUS_17530 gene apgM2 10758 12071 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase ApgM2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869503.1 protein_id gnl|my_center|LOCUS_17530 12098 12490 gene locus_tag LOCUS_17540 12098 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 12615 13214 gene locus_tag LOCUS_17550 12615 13214 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_17550 13303 14331 gene locus_tag LOCUS_17560 13303 14331 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_17560 14331 14798 gene locus_tag LOCUS_17570 14331 14798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 15183 14818 gene locus_tag LOCUS_17580 15183 14818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 15764 15303 gene locus_tag LOCUS_17590 15764 15303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 16125 15766 gene locus_tag LOCUS_17600 16125 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 16440 16243 gene locus_tag LOCUS_17610 16440 16243 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence069 2 193 gene locus_tag LOCUS_17620 2 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1265 297 gene locus_tag LOCUS_17630 1265 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1392 2165 gene locus_tag LOCUS_17640 1392 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2188 2742 gene locus_tag LOCUS_17650 2188 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2788 4128 gene locus_tag LOCUS_17660 2788 4128 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229915.1 protein_id gnl|my_center|LOCUS_17660 4168 5541 gene locus_tag LOCUS_17670 4168 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5609 6415 gene locus_tag LOCUS_17680 5609 6415 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_17680 6483 9125 gene locus_tag LOCUS_17690 6483 9125 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_17690 9141 11135 gene locus_tag LOCUS_17700 9141 11135 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_17700 11132 11842 gene locus_tag LOCUS_17710 11132 11842 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_17710 11839 12807 gene locus_tag LOCUS_17720 gene gnd 11839 12807 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392797.1 protein_id gnl|my_center|LOCUS_17720 13511 13029 gene locus_tag LOCUS_17730 gene zntR 13511 13029 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309469.1 protein_id gnl|my_center|LOCUS_17730 13671 14171 gene locus_tag LOCUS_17740 13671 14171 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_17740 14316 14594 gene locus_tag LOCUS_17750 14316 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 14707 15252 gene locus_tag LOCUS_17760 14707 15252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 15269 15640 gene locus_tag LOCUS_17770 15269 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence070 216 779 gene locus_tag LOCUS_17780 216 779 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_17780 1426 830 gene locus_tag LOCUS_17790 1426 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2538 1420 gene locus_tag LOCUS_17800 2538 1420 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_17800 2740 3348 gene locus_tag LOCUS_17810 2740 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 4455 3379 gene locus_tag LOCUS_17820 4455 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 5597 4494 gene locus_tag LOCUS_17830 5597 4494 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_17830 6735 5638 gene locus_tag LOCUS_17840 6735 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 6989 7183 gene locus_tag LOCUS_17850 6989 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 7270 7467 gene locus_tag LOCUS_17860 7270 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 7822 9087 gene locus_tag LOCUS_17870 7822 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 9038 9973 gene locus_tag LOCUS_17880 9038 9973 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582648.1 protein_id gnl|my_center|LOCUS_17880 9970 15648 gene locus_tag LOCUS_17890 9970 15648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence071 75 1 gene locus_tag LOCUS_t00110 75 1 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 475 221 gene locus_tag LOCUS_17900 475 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1022 444 gene locus_tag LOCUS_17910 1022 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1920 1138 gene locus_tag LOCUS_17920 1920 1138 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894626.1 protein_id gnl|my_center|LOCUS_17920 2587 1925 gene locus_tag LOCUS_17930 2587 1925 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 protein_id gnl|my_center|LOCUS_17930 3335 2694 gene locus_tag LOCUS_17940 3335 2694 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919694.1 protein_id gnl|my_center|LOCUS_17940 4052 3579 gene locus_tag LOCUS_17950 4052 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4891 4049 gene locus_tag LOCUS_17960 4891 4049 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257001.1 protein_id gnl|my_center|LOCUS_17960 5885 4902 gene locus_tag LOCUS_17970 5885 4902 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088662.1 protein_id gnl|my_center|LOCUS_17970 7287 6046 gene locus_tag LOCUS_17980 gene dinB 7287 6046 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 protein_id gnl|my_center|LOCUS_17980 7539 7291 gene locus_tag LOCUS_17990 7539 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940719.1 protein_id gnl|my_center|LOCUS_17990 8177 7551 gene locus_tag LOCUS_18000 gene lexA 8177 7551 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_18000 8826 8287 gene locus_tag LOCUS_18010 8826 8287 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942173.1 protein_id gnl|my_center|LOCUS_18010 9325 8846 gene locus_tag LOCUS_18020 9325 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 9816 9343 gene locus_tag LOCUS_18030 9816 9343 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_18030 10765 9929 gene locus_tag LOCUS_18040 gene surE 10765 9929 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_18040 11433 10762 gene locus_tag LOCUS_18050 11433 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229430.1 protein_id gnl|my_center|LOCUS_18050 12341 11559 gene locus_tag LOCUS_18060 12341 11559 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582685.1 protein_id gnl|my_center|LOCUS_18060 12707 12426 gene locus_tag LOCUS_18070 12707 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 15214 12710 gene locus_tag LOCUS_18080 15214 12710 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence072 216 548 gene locus_tag LOCUS_18090 216 548 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_18090 601 741 gene locus_tag LOCUS_18100 601 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 731 1888 gene locus_tag LOCUS_18110 731 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1872 2222 gene locus_tag LOCUS_18120 1872 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2320 2613 gene locus_tag LOCUS_18130 2320 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2610 2810 gene locus_tag LOCUS_18140 2610 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 2867 3751 gene locus_tag LOCUS_18150 2867 3751 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_18150 4995 3790 gene locus_tag LOCUS_18160 4995 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18160 6089 5049 gene locus_tag LOCUS_18170 6089 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18170 8041 6095 gene locus_tag LOCUS_18180 gene uvrC 8041 6095 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_18180 8503 8144 gene locus_tag LOCUS_18190 8503 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 9174 8551 gene locus_tag LOCUS_18200 9174 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 9431 10426 gene locus_tag LOCUS_18210 9431 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 12045 10450 gene locus_tag LOCUS_18220 gene cysS 12045 10450 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_18220 12545 12042 gene locus_tag LOCUS_18230 gene ispF 12545 12042 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_18230 12691 12542 gene locus_tag LOCUS_18240 12691 12542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18240 14394 13321 gene locus_tag LOCUS_18250 14394 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 14885 14391 gene locus_tag LOCUS_18260 14885 14391 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_18260 <15607 15061 gene locus_tag LOCUS_18270 <15607 15061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392134.1:DUF502 domain-containing protein >Feature sequence073 944 348 gene locus_tag LOCUS_18280 944 348 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_18280 1044 1141 gene locus_tag LOCUS_t00120 1044 1141 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1412 1167 gene locus_tag LOCUS_18290 1412 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1645 3714 gene locus_tag LOCUS_18300 1645 3714 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_18300 3862 4317 gene locus_tag LOCUS_18310 3862 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 4651 4298 gene locus_tag LOCUS_18320 4651 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 4833 5318 gene locus_tag LOCUS_18330 4833 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5346 6158 gene locus_tag LOCUS_18340 5346 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 6264 6461 gene locus_tag LOCUS_18350 6264 6461 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_18350 7761 6484 gene locus_tag LOCUS_18360 7761 6484 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_18360 8288 7950 gene locus_tag LOCUS_18370 8288 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 9130 8387 gene locus_tag LOCUS_18380 9130 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 9149 9442 gene locus_tag LOCUS_18390 9149 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 10160 10393 gene locus_tag LOCUS_18400 10160 10393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 11364 12080 gene locus_tag LOCUS_18410 gene tolQ 11364 12080 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_18410 12106 12525 gene locus_tag LOCUS_18420 gene tolR 12106 12525 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_18420 12522 13751 gene locus_tag LOCUS_18430 12522 13751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 13748 15070 gene locus_tag LOCUS_18440 gene tolB 13748 15070 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence074 3064 257 gene locus_tag LOCUS_18450 3064 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 4661 3420 gene locus_tag LOCUS_18460 gene argJ 4661 3420 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_18460 8080 4640 gene locus_tag LOCUS_18470 8080 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 8822 8100 gene locus_tag LOCUS_18480 8822 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 10571 8853 gene locus_tag LOCUS_18490 gene recN 10571 8853 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_18490 11318 10581 gene locus_tag LOCUS_18500 11318 10581 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_18500 11220 11510 gene locus_tag LOCUS_18510 11220 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 12359 11697 gene locus_tag LOCUS_18520 12359 11697 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618925.1 protein_id gnl|my_center|LOCUS_18520 12488 12688 gene locus_tag LOCUS_18530 12488 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 12685 13230 gene locus_tag LOCUS_18540 12685 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 13755 13306 gene locus_tag LOCUS_18550 13755 13306 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405616.1 protein_id gnl|my_center|LOCUS_18550 14441 14229 gene locus_tag LOCUS_18560 14441 14229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence075 1788 148 gene locus_tag LOCUS_18570 1788 148 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399863.1 protein_id gnl|my_center|LOCUS_18570 2881 1919 gene locus_tag LOCUS_18580 2881 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 3488 2763 gene locus_tag LOCUS_18590 3488 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 3997 3479 gene locus_tag LOCUS_18600 3997 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 5588 4011 gene locus_tag LOCUS_18610 5588 4011 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_18610 5854 5606 gene locus_tag LOCUS_18620 5854 5606 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_18620 7028 5871 gene locus_tag LOCUS_18630 gene ahbD 7028 5871 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_18630 8185 7031 gene locus_tag LOCUS_18640 8185 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 8568 8176 gene locus_tag LOCUS_18650 8568 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 9491 8907 gene locus_tag LOCUS_18660 gene comE 9491 8907 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_18660 10012 9491 gene locus_tag LOCUS_18670 10012 9491 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813525.1 protein_id gnl|my_center|LOCUS_18670 10262 11188 gene locus_tag LOCUS_18680 10262 11188 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532067.1 protein_id gnl|my_center|LOCUS_18680 11231 12400 gene locus_tag LOCUS_18690 11231 12400 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 protein_id gnl|my_center|LOCUS_18690 12435 13421 gene locus_tag LOCUS_18700 12435 13421 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_18700 13503 14030 gene locus_tag LOCUS_18710 13503 14030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 13994 15271 gene locus_tag LOCUS_18720 13994 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence076 <1 555 gene locus_tag LOCUS_18730 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940947.1:cytochrome c3 family protein 548 1363 gene locus_tag LOCUS_18740 548 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1372 2910 gene locus_tag LOCUS_18750 1372 2910 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_18750 2953 5454 gene locus_tag LOCUS_18760 2953 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 5648 6208 gene locus_tag LOCUS_18770 5648 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18770 6144 6920 gene locus_tag LOCUS_18780 6144 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18780 7281 8225 gene locus_tag LOCUS_18790 gene mtrA 7281 8225 CDS product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_18790 8238 10418 gene locus_tag LOCUS_18800 8238 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 10802 11692 gene locus_tag LOCUS_18810 10802 11692 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807629.1 protein_id gnl|my_center|LOCUS_18810 11682 12161 gene locus_tag LOCUS_18820 11682 12161 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_18820 12164 14449 gene locus_tag LOCUS_18830 12164 14449 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869170.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence077 96 506 gene locus_tag LOCUS_18840 96 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 966 1190 gene locus_tag LOCUS_18850 966 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1206 1526 gene locus_tag LOCUS_18860 1206 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1634 2056 gene locus_tag LOCUS_18870 1634 2056 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926524.1 protein_id gnl|my_center|LOCUS_18870 4205 2223 gene locus_tag LOCUS_18880 4205 2223 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538267.1 protein_id gnl|my_center|LOCUS_18880 6256 4208 gene locus_tag LOCUS_18890 6256 4208 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926970.1 protein_id gnl|my_center|LOCUS_18890 7639 6362 gene locus_tag LOCUS_18900 7639 6362 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937320.1 protein_id gnl|my_center|LOCUS_18900 8132 7617 gene locus_tag LOCUS_18910 8132 7617 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810020.1 protein_id gnl|my_center|LOCUS_18910 9125 8139 gene locus_tag LOCUS_18920 9125 8139 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930890.1 protein_id gnl|my_center|LOCUS_18920 9865 9161 gene locus_tag LOCUS_18930 9865 9161 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 protein_id gnl|my_center|LOCUS_18930 10659 9865 gene locus_tag LOCUS_18940 10659 9865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094604.1 protein_id gnl|my_center|LOCUS_18940 11347 10652 gene locus_tag LOCUS_18950 11347 10652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086076.1 protein_id gnl|my_center|LOCUS_18950 12459 11419 gene locus_tag LOCUS_18960 12459 11419 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_18960 14136 12664 gene locus_tag LOCUS_18970 14136 12664 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_18970 <15117 14237 gene locus_tag LOCUS_18980 <15117 14237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383350.1:ABC transporter substrate-binding protein >Feature sequence078 235 1134 gene locus_tag LOCUS_18990 235 1134 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937854.1 protein_id gnl|my_center|LOCUS_18990 1136 2308 gene locus_tag LOCUS_19000 gene livM 1136 2308 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937855.1 protein_id gnl|my_center|LOCUS_19000 2295 3071 gene locus_tag LOCUS_19010 2295 3071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937856.1 protein_id gnl|my_center|LOCUS_19010 3079 3810 gene locus_tag LOCUS_19020 3079 3810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_19020 3813 4220 gene locus_tag LOCUS_19030 3813 4220 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013947.1 protein_id gnl|my_center|LOCUS_19030 4979 4278 gene locus_tag LOCUS_19040 4979 4278 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862963.1 protein_id gnl|my_center|LOCUS_19040 5988 4999 gene locus_tag LOCUS_19050 5988 4999 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807628.1 protein_id gnl|my_center|LOCUS_19050 7900 6038 gene locus_tag LOCUS_19060 7900 6038 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_19060 8090 8968 gene locus_tag LOCUS_19070 8090 8968 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_19070 9063 10397 gene locus_tag LOCUS_19080 9063 10397 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728152.1 protein_id gnl|my_center|LOCUS_19080 10394 11398 gene locus_tag LOCUS_19090 10394 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 11404 11562 gene locus_tag LOCUS_19100 11404 11562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 11717 13123 gene locus_tag LOCUS_19110 11717 13123 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_19110 13136 14572 gene locus_tag LOCUS_19120 13136 14572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence079 1204 2307 gene locus_tag LOCUS_19130 gene dinB 1204 2307 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810865.1 protein_id gnl|my_center|LOCUS_19130 3980 2334 gene locus_tag LOCUS_19140 3980 2334 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_19140 4422 5354 gene locus_tag LOCUS_19150 4422 5354 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_19150 5332 6576 gene locus_tag LOCUS_19160 5332 6576 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_19160 6582 7316 gene locus_tag LOCUS_19170 6582 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 7366 8361 gene locus_tag LOCUS_19180 7366 8361 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213298.1 protein_id gnl|my_center|LOCUS_19180 8358 9533 gene locus_tag LOCUS_19190 8358 9533 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 protein_id gnl|my_center|LOCUS_19190 9560 10495 gene locus_tag LOCUS_19200 9560 10495 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_19200 10603 11025 gene locus_tag LOCUS_19210 10603 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 11099 11503 gene locus_tag LOCUS_19220 11099 11503 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811574.1 protein_id gnl|my_center|LOCUS_19220 11558 12574 gene locus_tag LOCUS_19230 11558 12574 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715571.1 protein_id gnl|my_center|LOCUS_19230 12659 13450 gene locus_tag LOCUS_19240 12659 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 13437 13667 gene locus_tag LOCUS_19250 13437 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 14627 13782 gene locus_tag LOCUS_19260 14627 13782 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090280.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence080 488 1399 gene locus_tag LOCUS_19270 488 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1539 2498 gene locus_tag LOCUS_19280 1539 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2688 3920 gene locus_tag LOCUS_19290 2688 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3928 4419 gene locus_tag LOCUS_19300 3928 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 4442 5443 gene locus_tag LOCUS_19310 4442 5443 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384202.1 protein_id gnl|my_center|LOCUS_19310 5725 5462 gene locus_tag LOCUS_19320 5725 5462 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681985.1 protein_id gnl|my_center|LOCUS_19320 5989 5729 gene locus_tag LOCUS_19330 5989 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 7432 6083 gene locus_tag LOCUS_19340 7432 6083 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_19340 8983 7487 gene locus_tag LOCUS_19350 8983 7487 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_19350 10493 9000 gene locus_tag LOCUS_19360 10493 9000 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_19360 12438 10504 gene locus_tag LOCUS_19370 gene nuoL 12438 10504 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568473.1 protein_id gnl|my_center|LOCUS_19370 12751 12446 gene locus_tag LOCUS_19380 gene nuoK 12751 12446 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_19380 13254 12748 gene locus_tag LOCUS_19390 13254 12748 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_19390 14350 13265 gene locus_tag LOCUS_19400 gene nuoH 14350 13265 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_19400 14779 14390 gene locus_tag LOCUS_19410 gene ndhC 14779 14390 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_19410 15048 14890 gene locus_tag LOCUS_19420 15048 14890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence081 <1 775 gene locus_tag LOCUS_19430 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975301.1:ectoine utilization protein EutC 828 1946 gene locus_tag LOCUS_19440 gene pepQ 828 1946 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249918.1 protein_id gnl|my_center|LOCUS_19440 1943 3016 gene locus_tag LOCUS_19450 1943 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 3055 4269 gene locus_tag LOCUS_19460 gene hacA 3055 4269 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_19460 4279 4800 gene locus_tag LOCUS_19470 4279 4800 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876999.1 protein_id gnl|my_center|LOCUS_19470 4811 6067 gene locus_tag LOCUS_19480 gene hacA 4811 6067 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_19480 6069 6578 gene locus_tag LOCUS_19490 gene leuD 6069 6578 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_19490 6589 7170 gene locus_tag LOCUS_19500 6589 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 8398 7175 gene locus_tag LOCUS_19510 8398 7175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_19510 9337 8399 gene locus_tag LOCUS_19520 9337 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19520 10288 9557 gene locus_tag LOCUS_19530 10288 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 10449 10303 gene locus_tag LOCUS_19540 10449 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 11859 10453 gene locus_tag LOCUS_19550 11859 10453 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_19550 12866 11952 gene locus_tag LOCUS_19560 12866 11952 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083896.1 protein_id gnl|my_center|LOCUS_19560 12938 13657 gene locus_tag LOCUS_19570 12938 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 13695 14669 gene locus_tag LOCUS_19580 13695 14669 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929960.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence082 448 726 gene locus_tag LOCUS_19590 448 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 803 1447 gene locus_tag LOCUS_19600 gene nthA 803 1447 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_19600 1485 2903 gene locus_tag LOCUS_19610 1485 2903 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_19610 3410 3096 gene locus_tag LOCUS_19620 3410 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 3637 3407 gene locus_tag LOCUS_19630 3637 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 4216 4863 gene locus_tag LOCUS_19640 4216 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 4863 5060 gene locus_tag LOCUS_19650 4863 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 5084 6727 gene locus_tag LOCUS_19660 5084 6727 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_19660 7149 8357 gene locus_tag LOCUS_19670 7149 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19670 8556 9629 gene locus_tag LOCUS_19680 8556 9629 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382906.1 protein_id gnl|my_center|LOCUS_19680 9662 10555 gene locus_tag LOCUS_19690 9662 10555 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528517.1 protein_id gnl|my_center|LOCUS_19690 10559 11350 gene locus_tag LOCUS_19700 10559 11350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966038.1 protein_id gnl|my_center|LOCUS_19700 11380 12462 gene locus_tag LOCUS_19710 11380 12462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966039.1 protein_id gnl|my_center|LOCUS_19710 12480 13487 gene locus_tag LOCUS_19720 12480 13487 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384202.1 protein_id gnl|my_center|LOCUS_19720 14497 13517 gene locus_tag LOCUS_19730 14497 13517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence083 3826 1742 gene locus_tag LOCUS_19740 3826 1742 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_19740 4908 3925 gene locus_tag LOCUS_19750 4908 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 5847 4945 gene locus_tag LOCUS_19760 5847 4945 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727690.1 protein_id gnl|my_center|LOCUS_19760 6065 6871 gene locus_tag LOCUS_19770 gene pcaD 6065 6871 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449960.1 protein_id gnl|my_center|LOCUS_19770 7290 6877 gene locus_tag LOCUS_19780 7290 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 8113 7295 gene locus_tag LOCUS_19790 8113 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 9374 8181 gene locus_tag LOCUS_19800 9374 8181 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_19800 9580 9957 gene locus_tag LOCUS_19810 9580 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 10460 10110 gene locus_tag LOCUS_19820 10460 10110 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545864.1 protein_id gnl|my_center|LOCUS_19820 10848 10447 gene locus_tag LOCUS_19830 10848 10447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 11212 10850 gene locus_tag LOCUS_19840 11212 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 11443 13329 gene locus_tag LOCUS_19850 11443 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 13607 14575 gene locus_tag LOCUS_19860 13607 14575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence084 446 2230 gene locus_tag LOCUS_19870 446 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3459 2245 gene locus_tag LOCUS_19880 3459 2245 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179295.1 protein_id gnl|my_center|LOCUS_19880 4233 4931 gene locus_tag LOCUS_19890 4233 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 5154 5459 gene locus_tag LOCUS_19900 5154 5459 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082959.1 protein_id gnl|my_center|LOCUS_19900 5553 5467 gene locus_tag LOCUS_t00130 5553 5467 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5725 6669 gene locus_tag LOCUS_19910 5725 6669 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_19910 6730 7668 gene locus_tag LOCUS_19920 6730 7668 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_19920 7673 9415 gene locus_tag LOCUS_19930 gene pilB 7673 9415 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_19930 9540 10625 gene locus_tag LOCUS_19940 9540 10625 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_19940 10689 11900 gene locus_tag LOCUS_19950 10689 11900 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_19950 11921 13960 gene locus_tag LOCUS_19960 11921 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 14270 14725 gene locus_tag LOCUS_19970 14270 14725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence085 2500 1535 gene locus_tag LOCUS_19980 2500 1535 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584104.1 protein_id gnl|my_center|LOCUS_19980 3483 2497 gene locus_tag LOCUS_19990 3483 2497 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584103.1 protein_id gnl|my_center|LOCUS_19990 4343 3501 gene locus_tag LOCUS_20000 4343 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 5574 4402 gene locus_tag LOCUS_20010 5574 4402 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_20010 7124 5589 gene locus_tag LOCUS_20020 7124 5589 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392612.1 protein_id gnl|my_center|LOCUS_20020 6708 6742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7426 7124 gene locus_tag LOCUS_20030 7426 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 8826 7423 gene locus_tag LOCUS_20040 8826 7423 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_20040 10505 8943 gene locus_tag LOCUS_20050 10505 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 11415 10495 gene locus_tag LOCUS_20060 11415 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 12101 11490 gene locus_tag LOCUS_20070 gene yihA 12101 11490 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_20070 12253 12456 gene locus_tag LOCUS_20080 12253 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 12676 13218 gene locus_tag LOCUS_20090 12676 13218 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_20090 13403 13639 gene locus_tag LOCUS_20100 13403 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 13632 13976 gene locus_tag LOCUS_20110 13632 13976 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289874.1 protein_id gnl|my_center|LOCUS_20110 14361 14080 gene locus_tag LOCUS_20120 14361 14080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence086 580 1221 gene locus_tag LOCUS_20130 gene rutB 580 1221 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640125.1 protein_id gnl|my_center|LOCUS_20130 1271 2284 gene locus_tag LOCUS_20140 1271 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2290 3060 gene locus_tag LOCUS_20150 2290 3060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 protein_id gnl|my_center|LOCUS_20150 3089 4150 gene locus_tag LOCUS_20160 3089 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 4208 5002 gene locus_tag LOCUS_20170 4208 5002 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393472.1 protein_id gnl|my_center|LOCUS_20170 5085 6476 gene locus_tag LOCUS_20180 5085 6476 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399863.1 protein_id gnl|my_center|LOCUS_20180 6480 7592 gene locus_tag LOCUS_20190 6480 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 7698 8807 gene locus_tag LOCUS_20200 7698 8807 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_20200 8900 11128 gene locus_tag LOCUS_20210 8900 11128 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_20210 11125 11547 gene locus_tag LOCUS_20220 11125 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20220 11698 11904 gene locus_tag LOCUS_20230 11698 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 12096 13508 gene locus_tag LOCUS_20240 12096 13508 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_20240 14156 13611 gene locus_tag LOCUS_20250 14156 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence087 523 2118 gene locus_tag LOCUS_20260 523 2118 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370099.1 protein_id gnl|my_center|LOCUS_20260 2273 3163 gene locus_tag LOCUS_20270 2273 3163 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972568.1 protein_id gnl|my_center|LOCUS_20270 3160 4524 gene locus_tag LOCUS_20280 3160 4524 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040326.1 protein_id gnl|my_center|LOCUS_20280 4599 5603 gene locus_tag LOCUS_20290 gene mer 4599 5603 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_20290 5665 6981 gene locus_tag LOCUS_20300 5665 6981 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394859.1 protein_id gnl|my_center|LOCUS_20300 8094 7090 gene locus_tag LOCUS_20310 8094 7090 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395914.1 protein_id gnl|my_center|LOCUS_20310 9500 8298 gene locus_tag LOCUS_20320 9500 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 9700 10581 gene locus_tag LOCUS_20330 9700 10581 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_20330 10601 11755 gene locus_tag LOCUS_20340 10601 11755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 12469 11765 gene locus_tag LOCUS_20350 12469 11765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 12901 12521 gene locus_tag LOCUS_20360 12901 12521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 12945 14216 gene locus_tag LOCUS_20370 12945 14216 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence088 1233 769 gene locus_tag LOCUS_20380 1233 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1445 1358 gene locus_tag LOCUS_t00140 1445 1358 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1849 1577 gene locus_tag LOCUS_20390 1849 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2389 1886 gene locus_tag LOCUS_20400 2389 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2554 3687 gene locus_tag LOCUS_20410 2554 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 4842 3715 gene locus_tag LOCUS_20420 4842 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 5122 5994 gene locus_tag LOCUS_20430 5122 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 6120 6046 gene locus_tag LOCUS_t00150 6120 6046 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6292 6822 gene locus_tag LOCUS_20440 6292 6822 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_20440 6819 9260 gene locus_tag LOCUS_20450 6819 9260 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_20450 9260 10279 gene locus_tag LOCUS_20460 9260 10279 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_20460 12671 10371 gene locus_tag LOCUS_20470 12671 10371 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_20470 13141 12674 gene locus_tag LOCUS_20480 13141 12674 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_20480 14017 13151 gene locus_tag LOCUS_20490 14017 13151 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence089 163 1542 gene locus_tag LOCUS_20500 163 1542 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_20500 1560 2879 gene locus_tag LOCUS_20510 1560 2879 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546417.1 protein_id gnl|my_center|LOCUS_20510 2962 3387 gene locus_tag LOCUS_20520 2962 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3633 4412 gene locus_tag LOCUS_20530 3633 4412 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_20530 4409 5341 gene locus_tag LOCUS_20540 4409 5341 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_20540 5431 6426 gene locus_tag LOCUS_20550 5431 6426 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_20550 6524 7285 gene locus_tag LOCUS_20560 6524 7285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_20560 7289 7573 gene locus_tag LOCUS_20570 7289 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 7528 8052 gene locus_tag LOCUS_20580 7528 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 8072 8905 gene locus_tag LOCUS_20590 8072 8905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395917.1 protein_id gnl|my_center|LOCUS_20590 8920 9246 gene locus_tag LOCUS_20600 8920 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 9494 10756 gene locus_tag LOCUS_20610 9494 10756 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014902978.1 protein_id gnl|my_center|LOCUS_20610 10769 11338 gene locus_tag LOCUS_20620 gene pyrR 10769 11338 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 protein_id gnl|my_center|LOCUS_20620 11369 12361 gene locus_tag LOCUS_20630 11369 12361 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973995.1 protein_id gnl|my_center|LOCUS_20630 12543 13151 gene locus_tag LOCUS_20640 12543 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 13148 13912 gene locus_tag LOCUS_20650 13148 13912 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_20650 13937 14281 gene locus_tag LOCUS_20660 13937 14281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence090 2288 1818 gene locus_tag LOCUS_20670 gene rpsG 2288 1818 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943490.1 protein_id gnl|my_center|LOCUS_20670 2670 2299 gene locus_tag LOCUS_20680 gene rpsL 2670 2299 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393942.1 protein_id gnl|my_center|LOCUS_20680 6829 2747 gene locus_tag LOCUS_20690 gene rpoC 6829 2747 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_20690 11013 6826 gene locus_tag LOCUS_20700 gene rpoB 11013 6826 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_20700 11442 11056 gene locus_tag LOCUS_20710 gene rplL 11442 11056 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546672.1 protein_id gnl|my_center|LOCUS_20710 11990 11472 gene locus_tag LOCUS_20720 gene rplJ 11990 11472 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_20720 12721 12017 gene locus_tag LOCUS_20730 gene rplA 12721 12017 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_20730 13145 12735 gene locus_tag LOCUS_20740 gene rplK 13145 12735 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_20740 13374 13171 gene locus_tag LOCUS_20750 13374 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20750 13739 13383 gene locus_tag LOCUS_20760 13739 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20760 13945 13739 gene locus_tag LOCUS_20770 13945 13739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 14045 13969 gene locus_tag LOCUS_t00160 14045 13969 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 14213 14061 gene locus_tag LOCUS_20780 gene rpmG 14213 14061 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence091 192 1457 gene locus_tag LOCUS_20790 192 1457 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812305.1 protein_id gnl|my_center|LOCUS_20790 1597 2622 gene locus_tag LOCUS_20800 1597 2622 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082945.1 protein_id gnl|my_center|LOCUS_20800 2689 3441 gene locus_tag LOCUS_20810 2689 3441 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_20810 3466 4545 gene locus_tag LOCUS_20820 3466 4545 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_20820 4651 5736 gene locus_tag LOCUS_20830 4651 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 5770 7215 gene locus_tag LOCUS_20840 5770 7215 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_20840 7241 8284 gene locus_tag LOCUS_20850 7241 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 8298 9281 gene locus_tag LOCUS_20860 8298 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 9388 10224 gene locus_tag LOCUS_20870 9388 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 10353 11399 gene locus_tag LOCUS_20880 10353 11399 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243786.1 protein_id gnl|my_center|LOCUS_20880 11478 12494 gene locus_tag LOCUS_20890 11478 12494 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338610.1 protein_id gnl|my_center|LOCUS_20890 12550 13971 gene locus_tag LOCUS_20900 12550 13971 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975054.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence092 <1 1554 gene locus_tag LOCUS_20910 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259624.1:ATP-dependent acyl-CoA ligase 1657 1848 gene locus_tag LOCUS_20920 1657 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 1841 3196 gene locus_tag LOCUS_20930 1841 3196 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_20930 3357 3917 gene locus_tag LOCUS_20940 3357 3917 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_20940 5107 3995 gene locus_tag LOCUS_20950 5107 3995 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_20950 6827 5157 gene locus_tag LOCUS_20960 6827 5157 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_20960 7209 6850 gene locus_tag LOCUS_20970 7209 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 8653 7388 gene locus_tag LOCUS_20980 gene hacA 8653 7388 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_20980 9181 8663 gene locus_tag LOCUS_20990 gene leuD 9181 8663 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_20990 10325 9279 gene locus_tag LOCUS_21000 10325 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 10960 10325 gene locus_tag LOCUS_21010 10960 10325 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140961.1 protein_id gnl|my_center|LOCUS_21010 12174 11065 gene locus_tag LOCUS_21020 12174 11065 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_21020 13228 12200 gene locus_tag LOCUS_21030 13228 12200 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040288.1 protein_id gnl|my_center|LOCUS_21030 <14007 13240 gene locus_tag LOCUS_21040 <14007 13240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222208.1:ABC transporter permease >Feature sequence093 1670 1014 gene locus_tag LOCUS_21050 1670 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21050 3773 1686 gene locus_tag LOCUS_21060 3773 1686 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_21060 4501 3887 gene locus_tag LOCUS_21070 4501 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 4681 6138 gene locus_tag LOCUS_21080 4681 6138 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_21080 7234 6218 gene locus_tag LOCUS_21090 7234 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 8789 7305 gene locus_tag LOCUS_21100 8789 7305 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_21100 9785 8817 gene locus_tag LOCUS_21110 9785 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 10827 9838 gene locus_tag LOCUS_21120 10827 9838 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_21120 11516 11019 gene locus_tag LOCUS_21130 11516 11019 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171505.1 protein_id gnl|my_center|LOCUS_21130 12396 11524 gene locus_tag LOCUS_21140 12396 11524 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_21140 12844 12461 gene locus_tag LOCUS_21150 12844 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence094 375 2330 gene locus_tag LOCUS_21160 375 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 3016 2345 gene locus_tag LOCUS_21170 3016 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3254 4237 gene locus_tag LOCUS_21180 3254 4237 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_21180 4678 4259 gene locus_tag LOCUS_21190 4678 4259 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_21190 5468 4833 gene locus_tag LOCUS_21200 5468 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 5856 5476 gene locus_tag LOCUS_21210 gene rplS 5856 5476 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_21210 6635 5847 gene locus_tag LOCUS_21220 gene trmD 6635 5847 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_21220 7190 6675 gene locus_tag LOCUS_21230 gene rimM 7190 6675 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858943.1 protein_id gnl|my_center|LOCUS_21230 7430 7200 gene locus_tag LOCUS_21240 7430 7200 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_21240 7746 7462 gene locus_tag LOCUS_21250 gene rpsP 7746 7462 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642952.1 protein_id gnl|my_center|LOCUS_21250 9179 7851 gene locus_tag LOCUS_21260 gene ffh 9179 7851 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_21260 9819 9298 gene locus_tag LOCUS_21270 9819 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 11436 11642 gene locus_tag LOCUS_21280 11436 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 12396 11893 gene locus_tag LOCUS_21290 12396 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 <13792 12732 gene locus_tag LOCUS_21300 <13792 12732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941906.1:choice-of-anchor D domain-containing protein >Feature sequence095 869 1828 gene locus_tag LOCUS_21310 869 1828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_21310 1825 2601 gene locus_tag LOCUS_21320 1825 2601 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_21320 2598 4049 gene locus_tag LOCUS_21330 2598 4049 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_21330 4054 5826 gene locus_tag LOCUS_21340 4054 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 6499 5852 gene locus_tag LOCUS_21350 gene tmk 6499 5852 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877575.1 protein_id gnl|my_center|LOCUS_21350 7514 6510 gene locus_tag LOCUS_21360 7514 6510 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_21360 7669 8463 gene locus_tag LOCUS_21370 7669 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21370 8350 8366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8388 8879 gene locus_tag LOCUS_21380 8388 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21380 9839 8910 gene locus_tag LOCUS_21390 9839 8910 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546183.1 protein_id gnl|my_center|LOCUS_21390 10003 10782 gene locus_tag LOCUS_21400 10003 10782 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144051.1 protein_id gnl|my_center|LOCUS_21400 10948 10721 gene locus_tag LOCUS_21410 10948 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 12014 11010 gene locus_tag LOCUS_21420 12014 11010 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_21420 12250 12507 gene locus_tag LOCUS_21430 12250 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 12508 12804 gene locus_tag LOCUS_21440 12508 12804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 13207 12830 gene locus_tag LOCUS_21450 13207 12830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence096 1672 905 gene locus_tag LOCUS_21460 1672 905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803988.1 protein_id gnl|my_center|LOCUS_21460 2475 1672 gene locus_tag LOCUS_21470 gene tauC 2475 1672 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095795.1 protein_id gnl|my_center|LOCUS_21470 3263 2472 gene locus_tag LOCUS_21480 3263 2472 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970045.1 protein_id gnl|my_center|LOCUS_21480 3677 4684 gene locus_tag LOCUS_21490 3677 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 4834 5127 gene locus_tag LOCUS_21500 4834 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 5324 5058 gene locus_tag LOCUS_21510 5324 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 5230 5730 gene locus_tag LOCUS_21520 5230 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 5776 6990 gene locus_tag LOCUS_21530 5776 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 7007 7747 gene locus_tag LOCUS_21540 7007 7747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_21540 7722 8447 gene locus_tag LOCUS_21550 7722 8447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680283.1 protein_id gnl|my_center|LOCUS_21550 9390 8413 gene locus_tag LOCUS_21560 9390 8413 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399212.1 protein_id gnl|my_center|LOCUS_21560 10274 9402 gene locus_tag LOCUS_21570 10274 9402 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_21570 11485 10298 gene locus_tag LOCUS_21580 11485 10298 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_21580 12678 11671 gene locus_tag LOCUS_21590 12678 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 <13756 12770 gene locus_tag LOCUS_21600 <13756 12770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061064.1:alanine dehydrogenase >Feature sequence097 <1 775 gene locus_tag LOCUS_21610 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250076.1:2-oxoacid:acceptor oxidoreductase subunit alpha 763 2088 gene locus_tag LOCUS_21620 763 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2548 3510 gene locus_tag LOCUS_21630 2548 3510 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_21630 3781 4830 gene locus_tag LOCUS_21640 3781 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 4833 5405 gene locus_tag LOCUS_21650 4833 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 5398 5850 gene locus_tag LOCUS_21660 5398 5850 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_21660 5862 6296 gene locus_tag LOCUS_21670 5862 6296 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635648.1 protein_id gnl|my_center|LOCUS_21670 6353 7993 gene locus_tag LOCUS_21680 6353 7993 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_21680 8360 9532 gene locus_tag LOCUS_21690 8360 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 9529 10914 gene locus_tag LOCUS_21700 9529 10914 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_21700 11036 11962 gene locus_tag LOCUS_21710 11036 11962 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_21710 11959 12192 gene locus_tag LOCUS_21720 11959 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 12816 13043 gene locus_tag LOCUS_21730 12816 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 13036 13425 gene locus_tag LOCUS_21740 13036 13425 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958096.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence098 1755 829 gene locus_tag LOCUS_21750 1755 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2100 2747 gene locus_tag LOCUS_21760 2100 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 3435 2785 gene locus_tag LOCUS_21770 3435 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 3645 4376 gene locus_tag LOCUS_21780 3645 4376 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_21780 4609 5604 gene locus_tag LOCUS_21790 4609 5604 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818658.1 protein_id gnl|my_center|LOCUS_21790 5707 7581 gene locus_tag LOCUS_21800 5707 7581 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_21800 9944 7629 gene locus_tag LOCUS_21810 9944 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 10628 9981 gene locus_tag LOCUS_21820 10628 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 10823 11533 gene locus_tag LOCUS_21830 10823 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 11556 11750 gene locus_tag LOCUS_21840 11556 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 11684 11986 gene locus_tag LOCUS_21850 11684 11986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 12259 11993 gene locus_tag LOCUS_21860 12259 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 12501 13148 gene locus_tag LOCUS_21870 12501 13148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence099 1536 322 gene locus_tag LOCUS_21880 1536 322 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_21880 2663 1527 gene locus_tag LOCUS_21890 2663 1527 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582756.1 protein_id gnl|my_center|LOCUS_21890 2887 4098 gene locus_tag LOCUS_21900 2887 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 5199 4192 gene locus_tag LOCUS_21910 5199 4192 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286161.1 protein_id gnl|my_center|LOCUS_21910 5712 5284 gene locus_tag LOCUS_21920 5712 5284 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_21920 6431 6862 gene locus_tag LOCUS_21930 6431 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 8072 6882 gene locus_tag LOCUS_21940 8072 6882 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392231.1 protein_id gnl|my_center|LOCUS_21940 8156 9628 gene locus_tag LOCUS_21950 8156 9628 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_21950 9684 10157 gene locus_tag LOCUS_21960 9684 10157 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142286.1 protein_id gnl|my_center|LOCUS_21960 10901 10254 gene locus_tag LOCUS_21970 gene rutB 10901 10254 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393558.1 protein_id gnl|my_center|LOCUS_21970 11118 12122 gene locus_tag LOCUS_21980 11118 12122 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229093.1 protein_id gnl|my_center|LOCUS_21980 13061 12132 gene locus_tag LOCUS_21990 13061 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence100 985 464 gene locus_tag LOCUS_22000 985 464 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975761.1 protein_id gnl|my_center|LOCUS_22000 1266 2966 gene locus_tag LOCUS_22010 1266 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2992 4059 gene locus_tag LOCUS_22020 2992 4059 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529865.1 protein_id gnl|my_center|LOCUS_22020 5135 4104 gene locus_tag LOCUS_22030 5135 4104 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_22030 6038 5178 gene locus_tag LOCUS_22040 6038 5178 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_22040 6560 6189 gene locus_tag LOCUS_22050 gene rsfS 6560 6189 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943827.1 protein_id gnl|my_center|LOCUS_22050 7323 6673 gene locus_tag LOCUS_22060 gene nadD 7323 6673 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_22060 8628 7357 gene locus_tag LOCUS_22070 8628 7357 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_22070 9691 8639 gene locus_tag LOCUS_22080 gene proB 9691 8639 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_22080 10806 9688 gene locus_tag LOCUS_22090 gene obgE 10806 9688 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_22090 11130 10861 gene locus_tag LOCUS_22100 gene rpmA 11130 10861 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_22100 11470 11159 gene locus_tag LOCUS_22110 gene rplU 11470 11159 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583641.1 protein_id gnl|my_center|LOCUS_22110 11976 11599 gene locus_tag LOCUS_22120 11976 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 13032 12274 gene locus_tag LOCUS_22130 13032 12274 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205409.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22130 >Feature sequence101 2325 1333 gene locus_tag LOCUS_22140 gene rfbB 2325 1333 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_22140 2781 2326 gene locus_tag LOCUS_22150 2781 2326 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391711.1 protein_id gnl|my_center|LOCUS_22150 3816 2812 gene locus_tag LOCUS_22160 3816 2812 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943148.1 protein_id gnl|my_center|LOCUS_22160 4571 3822 gene locus_tag LOCUS_22170 4571 3822 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_22170 5889 4582 gene locus_tag LOCUS_22180 5889 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 7601 5886 gene locus_tag LOCUS_22190 7601 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098076974.1 protein_id gnl|my_center|LOCUS_22190 8681 7617 gene locus_tag LOCUS_22200 8681 7617 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_22200 9643 8684 gene locus_tag LOCUS_22210 9643 8684 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_22210 10851 9643 gene locus_tag LOCUS_22220 10851 9643 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_22220 11210 10848 gene locus_tag LOCUS_22230 11210 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 11719 11207 gene locus_tag LOCUS_22240 11719 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 <13235 11812 gene locus_tag LOCUS_22250 <13235 11812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119978.1:asparagine synthase (glutamine-hydrolyzing) note possible pseudo, frameshifted >Feature sequence102 <1 2013 gene locus_tag LOCUS_22260 <1 2013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943758.1:isoleucine--tRNA ligase 2010 2507 gene locus_tag LOCUS_22270 gene lspA 2010 2507 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_22270 3213 2557 gene locus_tag LOCUS_22280 3213 2557 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243784.1 protein_id gnl|my_center|LOCUS_22280 3538 4935 gene locus_tag LOCUS_22290 3538 4935 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_22290 4988 5782 gene locus_tag LOCUS_22300 4988 5782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774227.1 protein_id gnl|my_center|LOCUS_22300 5817 6614 gene locus_tag LOCUS_22310 5817 6614 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337597.1 protein_id gnl|my_center|LOCUS_22310 6651 7667 gene locus_tag LOCUS_22320 6651 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 7693 8478 gene locus_tag LOCUS_22330 7693 8478 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395917.1 protein_id gnl|my_center|LOCUS_22330 8508 9428 gene locus_tag LOCUS_22340 8508 9428 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979108.1 protein_id gnl|my_center|LOCUS_22340 9944 9657 gene locus_tag LOCUS_22350 9944 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 11172 10417 gene locus_tag LOCUS_22360 11172 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 11435 12781 gene locus_tag LOCUS_22370 11435 12781 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence103 161 84 gene locus_tag LOCUS_t00170 161 84 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 828 229 gene locus_tag LOCUS_22380 828 229 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_22380 1599 877 gene locus_tag LOCUS_22390 gene rph 1599 877 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_22390 2514 1648 gene locus_tag LOCUS_22400 2514 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2727 3734 gene locus_tag LOCUS_22410 2727 3734 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532064.1 protein_id gnl|my_center|LOCUS_22410 3915 6113 gene locus_tag LOCUS_22420 3915 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 6726 6283 gene locus_tag LOCUS_22430 6726 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 7002 6823 gene locus_tag LOCUS_22440 7002 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 7243 6977 gene locus_tag LOCUS_22450 7243 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 8325 7633 gene locus_tag LOCUS_22460 8325 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 9166 8396 gene locus_tag LOCUS_22470 9166 8396 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087565.1 protein_id gnl|my_center|LOCUS_22470 9570 9244 gene locus_tag LOCUS_22480 9570 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 10285 10034 gene locus_tag LOCUS_22490 10285 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 10686 10282 gene locus_tag LOCUS_22500 10686 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 11285 10683 gene locus_tag LOCUS_22510 11285 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 11428 11435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11759 11932 gene locus_tag LOCUS_22520 11759 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 12473 12126 gene locus_tag LOCUS_22530 12473 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22530 <13054 12452 gene locus_tag LOCUS_22540 <13054 12452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940999.1:DegQ family serine endoprotease note possible pseudo, frameshifted >Feature sequence104 650 375 gene locus_tag LOCUS_22550 650 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22550 390 407 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1000 668 gene locus_tag LOCUS_22560 1000 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1206 2621 gene locus_tag LOCUS_22570 1206 2621 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_22570 2722 2940 gene locus_tag LOCUS_22580 2722 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 4023 2956 gene locus_tag LOCUS_22590 4023 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4248 5249 gene locus_tag LOCUS_22600 4248 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 6146 5340 gene locus_tag LOCUS_22610 6146 5340 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_22610 6257 6730 gene locus_tag LOCUS_22620 6257 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 7434 6823 gene locus_tag LOCUS_22630 7434 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 8162 7431 gene locus_tag LOCUS_22640 8162 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 8431 8159 gene locus_tag LOCUS_22650 8431 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 9185 8571 gene locus_tag LOCUS_22660 9185 8571 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808122.1 protein_id gnl|my_center|LOCUS_22660 10313 9276 gene locus_tag LOCUS_22670 10313 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 12778 10397 gene locus_tag LOCUS_22680 12778 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence105 2008 1019 gene locus_tag LOCUS_22690 2008 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2830 2129 gene locus_tag LOCUS_22700 2830 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3337 2834 gene locus_tag LOCUS_22710 3337 2834 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_22710 3465 4259 gene locus_tag LOCUS_22720 3465 4259 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389676.1 protein_id gnl|my_center|LOCUS_22720 4511 4789 gene locus_tag LOCUS_22730 4511 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 4969 5778 gene locus_tag LOCUS_22740 4969 5778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_22740 5762 7705 gene locus_tag LOCUS_22750 5762 7705 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_22750 7748 8632 gene locus_tag LOCUS_22760 7748 8632 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_22760 8636 9700 gene locus_tag LOCUS_22770 8636 9700 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_22770 9777 11024 gene locus_tag LOCUS_22780 9777 11024 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391253.1 protein_id gnl|my_center|LOCUS_22780 11040 11894 gene locus_tag LOCUS_22790 11040 11894 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_22790 11923 12501 gene locus_tag LOCUS_22800 11923 12501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence106 2740 2039 gene locus_tag LOCUS_22810 2740 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 3592 2756 gene locus_tag LOCUS_22820 3592 2756 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942570.1 protein_id gnl|my_center|LOCUS_22820 3981 3649 gene locus_tag LOCUS_22830 gene cutA 3981 3649 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_22830 5300 3978 gene locus_tag LOCUS_22840 gene miaB 5300 3978 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_22840 5622 5377 gene locus_tag LOCUS_22850 5622 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 5792 6187 gene locus_tag LOCUS_22860 5792 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 6254 8047 gene locus_tag LOCUS_22870 6254 8047 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249942.1 protein_id gnl|my_center|LOCUS_22870 8051 8332 gene locus_tag LOCUS_22880 8051 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 8358 8636 gene locus_tag LOCUS_22890 8358 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 8705 9727 gene locus_tag LOCUS_22900 8705 9727 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_22900 9724 10713 gene locus_tag LOCUS_22910 9724 10713 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_22910 10785 11681 gene locus_tag LOCUS_22920 10785 11681 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_22920 11761 12420 gene locus_tag LOCUS_22930 11761 12420 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence107 1602 2510 gene locus_tag LOCUS_22940 1602 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2848 2522 gene locus_tag LOCUS_22950 2848 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 4241 2877 gene locus_tag LOCUS_22960 4241 2877 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869985.1 protein_id gnl|my_center|LOCUS_22960 4547 5710 gene locus_tag LOCUS_22970 4547 5710 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_22970 6125 5733 gene locus_tag LOCUS_22980 6125 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 6606 6223 gene locus_tag LOCUS_22990 6606 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 7703 7044 gene locus_tag LOCUS_23000 7703 7044 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026924.1 protein_id gnl|my_center|LOCUS_23000 10023 7711 gene locus_tag LOCUS_23010 10023 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 10572 11366 gene locus_tag LOCUS_23020 10572 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 11703 12776 gene locus_tag LOCUS_23030 11703 12776 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence108 161 1012 gene locus_tag LOCUS_23040 161 1012 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943550.1 protein_id gnl|my_center|LOCUS_23040 1040 1987 gene locus_tag LOCUS_23050 1040 1987 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_23050 1984 2637 gene locus_tag LOCUS_23060 gene ftsE 1984 2637 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768285.1 protein_id gnl|my_center|LOCUS_23060 2655 3560 gene locus_tag LOCUS_23070 gene ftsX 2655 3560 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942418.1 protein_id gnl|my_center|LOCUS_23070 3557 4234 gene locus_tag LOCUS_23080 3557 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 4231 4779 gene locus_tag LOCUS_23090 4231 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 4776 6119 gene locus_tag LOCUS_23100 4776 6119 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_23100 6139 7512 gene locus_tag LOCUS_23110 gene xseA 6139 7512 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_23110 7509 8372 gene locus_tag LOCUS_23120 7509 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 8414 8662 gene locus_tag LOCUS_23130 8414 8662 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_23130 8692 9420 gene locus_tag LOCUS_23140 8692 9420 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_23140 9417 11159 gene locus_tag LOCUS_23150 9417 11159 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_23150 11269 11949 gene locus_tag LOCUS_23160 11269 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 11954 12310 gene locus_tag LOCUS_23170 11954 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence109 1147 380 gene locus_tag LOCUS_23180 1147 380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921642.1 protein_id gnl|my_center|LOCUS_23180 2105 1167 gene locus_tag LOCUS_23190 2105 1167 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727510.1 protein_id gnl|my_center|LOCUS_23190 2986 2114 gene locus_tag LOCUS_23200 2986 2114 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544937.1 protein_id gnl|my_center|LOCUS_23200 4287 3046 gene locus_tag LOCUS_23210 4287 3046 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038801.1 protein_id gnl|my_center|LOCUS_23210 4547 5698 gene locus_tag LOCUS_23220 4547 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529859.1 protein_id gnl|my_center|LOCUS_23220 6035 5778 gene locus_tag LOCUS_23230 6035 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 6357 6028 gene locus_tag LOCUS_23240 6357 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 6974 6786 gene locus_tag LOCUS_23250 6974 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 8745 7231 gene locus_tag LOCUS_23260 gene rpoD 8745 7231 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_23260 8946 9572 gene locus_tag LOCUS_23270 8946 9572 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859357.1 protein_id gnl|my_center|LOCUS_23270 10708 9674 gene locus_tag LOCUS_23280 10708 9674 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384354.1 protein_id gnl|my_center|LOCUS_23280 <12580 10763 gene locus_tag LOCUS_23290 <12580 10763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086313.1:UbiD family decarboxylase >Feature sequence110 857 2275 gene locus_tag LOCUS_23300 857 2275 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_23300 2710 4632 gene locus_tag LOCUS_23310 2710 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 4637 5698 gene locus_tag LOCUS_23320 4637 5698 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_23320 5757 6134 gene locus_tag LOCUS_23330 5757 6134 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878522.1 protein_id gnl|my_center|LOCUS_23330 6181 7071 gene locus_tag LOCUS_23340 6181 7071 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_23340 7086 7775 gene locus_tag LOCUS_23350 7086 7775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_23350 7782 8873 gene locus_tag LOCUS_23360 7782 8873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391617.1 protein_id gnl|my_center|LOCUS_23360 9458 8841 gene locus_tag LOCUS_23370 9458 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 11043 9448 gene locus_tag LOCUS_23380 gene cimA 11043 9448 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_23380 <12309 11065 gene locus_tag LOCUS_23390 <12309 11065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545682.1:aspartate kinase >Feature sequence111 <1 829 gene locus_tag LOCUS_23400 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583250.1:excinuclease ABC subunit UvrA 1081 860 gene locus_tag LOCUS_23410 1081 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2303 1311 gene locus_tag LOCUS_23420 2303 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 3469 2396 gene locus_tag LOCUS_23430 3469 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 3883 3482 gene locus_tag LOCUS_23440 3883 3482 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230092.1 protein_id gnl|my_center|LOCUS_23440 3993 4937 gene locus_tag LOCUS_23450 3993 4937 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_23450 5024 6490 gene locus_tag LOCUS_23460 5024 6490 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_23460 6749 6477 gene locus_tag LOCUS_23470 6749 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 8288 7116 gene locus_tag LOCUS_23480 8288 7116 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440662.1 protein_id gnl|my_center|LOCUS_23480 9744 8296 gene locus_tag LOCUS_23490 9744 8296 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_23490 11308 9698 gene locus_tag LOCUS_23500 11308 9698 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_23500 <12259 11254 gene locus_tag LOCUS_23510 <12259 11254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941017.1:NADH-quinone oxidoreductase subunit L >Feature sequence112 1055 72 gene locus_tag LOCUS_23520 1055 72 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973602.1 protein_id gnl|my_center|LOCUS_23520 2338 1217 gene locus_tag LOCUS_23530 2338 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 3395 2376 gene locus_tag LOCUS_23540 3395 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 4504 3452 gene locus_tag LOCUS_23550 4504 3452 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861411.1 protein_id gnl|my_center|LOCUS_23550 4784 5929 gene locus_tag LOCUS_23560 4784 5929 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_23560 5936 6802 gene locus_tag LOCUS_23570 5936 6802 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820410.1 protein_id gnl|my_center|LOCUS_23570 6812 7774 gene locus_tag LOCUS_23580 6812 7774 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_23580 7771 8541 gene locus_tag LOCUS_23590 7771 8541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064072.1 protein_id gnl|my_center|LOCUS_23590 8543 9241 gene locus_tag LOCUS_23600 8543 9241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_23600 10701 9313 gene locus_tag LOCUS_23610 gene hydA 10701 9313 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979132.1 protein_id gnl|my_center|LOCUS_23610 11494 10745 gene locus_tag LOCUS_23620 gene fabG 11494 10745 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_23620 <12203 11505 gene locus_tag LOCUS_23630 <12203 11505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930300.1:amino acid ABC transporter ATP-binding protein >Feature sequence113 324 1742 gene locus_tag LOCUS_23640 324 1742 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_23640 1898 1811 gene locus_tag LOCUS_t00180 1898 1811 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1969 3798 gene locus_tag LOCUS_23650 1969 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4912 3800 gene locus_tag LOCUS_23660 gene ald 4912 3800 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_23660 5113 5188 gene locus_tag LOCUS_t00190 5113 5188 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5407 5946 gene locus_tag LOCUS_23670 5407 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 6179 7564 gene locus_tag LOCUS_23680 gene gnfM 6179 7564 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_23680 7857 8072 gene locus_tag LOCUS_23690 7857 8072 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_23690 8193 8672 gene locus_tag LOCUS_23700 8193 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 8669 9316 gene locus_tag LOCUS_23710 8669 9316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 9313 10242 gene locus_tag LOCUS_23720 gene gvpN 9313 10242 CDS product gas vesicle protein GvpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890517.1 protein_id gnl|my_center|LOCUS_23720 10239 10556 gene locus_tag LOCUS_23730 10239 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 10573 11340 gene locus_tag LOCUS_23740 10573 11340 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_23740 11492 11932 gene locus_tag LOCUS_23750 11492 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 11851 12042 gene locus_tag LOCUS_23760 11851 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence114 <1 915 gene locus_tag LOCUS_23770 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967232.1:threonine synthase 1926 940 gene locus_tag LOCUS_23780 1926 940 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030183075.1 protein_id gnl|my_center|LOCUS_23780 2276 1968 gene locus_tag LOCUS_23790 2276 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2534 2280 gene locus_tag LOCUS_23800 2534 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 3450 2650 gene locus_tag LOCUS_23810 3450 2650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_23810 4314 3475 gene locus_tag LOCUS_23820 4314 3475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067355.1 protein_id gnl|my_center|LOCUS_23820 5445 4483 gene locus_tag LOCUS_23830 5445 4483 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276931.1 protein_id gnl|my_center|LOCUS_23830 6607 5336 gene locus_tag LOCUS_23840 6607 5336 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393751.1 protein_id gnl|my_center|LOCUS_23840 7368 6604 gene locus_tag LOCUS_23850 7368 6604 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459450.1 protein_id gnl|my_center|LOCUS_23850 7751 7368 gene locus_tag LOCUS_23860 7751 7368 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814045.1 protein_id gnl|my_center|LOCUS_23860 9191 8007 gene locus_tag LOCUS_23870 9191 8007 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728152.1 protein_id gnl|my_center|LOCUS_23870 10103 9261 gene locus_tag LOCUS_23880 10103 9261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 10074 10262 gene locus_tag LOCUS_23890 10074 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 10277 11302 gene locus_tag LOCUS_23900 10277 11302 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338610.1 protein_id gnl|my_center|LOCUS_23900 11335 11715 gene locus_tag LOCUS_23910 11335 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence115 652 527 gene locus_tag LOCUS_23920 652 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2056 794 gene locus_tag LOCUS_23930 2056 794 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391938.1 protein_id gnl|my_center|LOCUS_23930 2309 3040 gene locus_tag LOCUS_23940 2309 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3037 4047 gene locus_tag LOCUS_23950 3037 4047 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227955.1 protein_id gnl|my_center|LOCUS_23950 4389 4066 gene locus_tag LOCUS_23960 4389 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 5698 4445 gene locus_tag LOCUS_23970 5698 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 6712 5753 gene locus_tag LOCUS_23980 gene ala 6712 5753 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_23980 7239 6724 gene locus_tag LOCUS_23990 7239 6724 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021659.1 protein_id gnl|my_center|LOCUS_23990 8078 7359 gene locus_tag LOCUS_24000 8078 7359 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965772.1 protein_id gnl|my_center|LOCUS_24000 8758 8216 gene locus_tag LOCUS_24010 8758 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 9939 8893 gene locus_tag LOCUS_24020 9939 8893 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064892.1 protein_id gnl|my_center|LOCUS_24020 10864 9998 gene locus_tag LOCUS_24030 10864 9998 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_24030 <12049 10895 gene locus_tag LOCUS_24040 <12049 10895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009967865.1:2-methylaconitate cis-trans isomerase PrpF family protein >Feature sequence116 1150 389 gene locus_tag LOCUS_24050 1150 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1524 1147 gene locus_tag LOCUS_24060 1524 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2509 1526 gene locus_tag LOCUS_24070 2509 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 3137 4255 gene locus_tag LOCUS_24080 3137 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 5703 4243 gene locus_tag LOCUS_24090 5703 4243 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_24090 5994 7121 gene locus_tag LOCUS_24100 5994 7121 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966817.1 protein_id gnl|my_center|LOCUS_24100 7128 7697 gene locus_tag LOCUS_24110 7128 7697 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530298.1 protein_id gnl|my_center|LOCUS_24110 7698 8720 gene locus_tag LOCUS_24120 7698 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 8827 9618 gene locus_tag LOCUS_24130 8827 9618 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395936.1 protein_id gnl|my_center|LOCUS_24130 9713 10846 gene locus_tag LOCUS_24140 9713 10846 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_24140 10919 11380 gene locus_tag LOCUS_24150 10919 11380 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence117 <1 633 gene locus_tag LOCUS_24160 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940787.1:F0F1 ATP synthase subunit alpha 659 868 gene locus_tag LOCUS_24170 659 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 879 1751 gene locus_tag LOCUS_24180 gene atpG 879 1751 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_24180 1778 3184 gene locus_tag LOCUS_24190 gene atpD 1778 3184 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_24190 3187 3597 gene locus_tag LOCUS_24200 3187 3597 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940790.1 protein_id gnl|my_center|LOCUS_24200 4197 3604 gene locus_tag LOCUS_24210 4197 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 4413 4640 gene locus_tag LOCUS_24220 4413 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 4887 6197 gene locus_tag LOCUS_24230 4887 6197 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989388.1 protein_id gnl|my_center|LOCUS_24230 6301 7809 gene locus_tag LOCUS_24240 6301 7809 CDS product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065212.1 protein_id gnl|my_center|LOCUS_24240 7858 8349 gene locus_tag LOCUS_24250 7858 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 8286 8732 gene locus_tag LOCUS_24260 8286 8732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 8740 9648 gene locus_tag LOCUS_24270 8740 9648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368601.1 protein_id gnl|my_center|LOCUS_24270 11459 9651 gene locus_tag LOCUS_24280 11459 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence118 1601 213 gene locus_tag LOCUS_24290 1601 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1642 2115 gene locus_tag LOCUS_24300 1642 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3135 2437 gene locus_tag LOCUS_24310 3135 2437 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_24310 4029 3283 gene locus_tag LOCUS_24320 4029 3283 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_24320 4522 4106 gene locus_tag LOCUS_24330 4522 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 4950 5324 gene locus_tag LOCUS_24340 4950 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 7257 5389 gene locus_tag LOCUS_24350 7257 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 8550 7306 gene locus_tag LOCUS_24360 8550 7306 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113027.1 protein_id gnl|my_center|LOCUS_24360 9066 8644 gene locus_tag LOCUS_24370 gene queF 9066 8644 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_24370 9200 10420 gene locus_tag LOCUS_24380 9200 10420 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_24380 10421 10960 gene locus_tag LOCUS_24390 10421 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 11097 10933 gene locus_tag LOCUS_24400 11097 10933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 11351 11094 gene locus_tag LOCUS_24410 11351 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence119 630 376 gene locus_tag LOCUS_24420 630 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2972 627 gene locus_tag LOCUS_24430 2972 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24430 3934 3008 gene locus_tag LOCUS_24440 3934 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 3052 3105 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5088 3943 gene locus_tag LOCUS_24450 5088 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 5645 5376 gene locus_tag LOCUS_24460 5645 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 6627 5647 gene locus_tag LOCUS_24470 6627 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 7357 6608 gene locus_tag LOCUS_24480 7357 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 8111 7326 gene locus_tag LOCUS_24490 8111 7326 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_24490 9137 8121 gene locus_tag LOCUS_24500 gene trpS 9137 8121 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_24500 9825 9163 gene locus_tag LOCUS_24510 9825 9163 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_24510 10767 9847 gene locus_tag LOCUS_24520 gene xerD 10767 9847 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_24520 <11802 10745 gene locus_tag LOCUS_24530 <11802 10745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942465.1:[protein-PII] uridylyltransferase >Feature sequence120 1025 105 gene locus_tag LOCUS_24540 1025 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1217 2848 gene locus_tag LOCUS_24550 gene ilvB 1217 2848 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146975.1 protein_id gnl|my_center|LOCUS_24550 2860 3117 gene locus_tag LOCUS_24560 2860 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 3216 4379 gene locus_tag LOCUS_24570 3216 4379 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_24570 5236 4451 gene locus_tag LOCUS_24580 gene tauC 5236 4451 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706737.1 protein_id gnl|my_center|LOCUS_24580 5951 5292 gene locus_tag LOCUS_24590 5951 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 6778 5984 gene locus_tag LOCUS_24600 6778 5984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_24600 7966 6923 gene locus_tag LOCUS_24610 7966 6923 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256048.1 protein_id gnl|my_center|LOCUS_24610 8550 8038 gene locus_tag LOCUS_24620 8550 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 8953 8576 gene locus_tag LOCUS_24630 8953 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 9970 9200 gene locus_tag LOCUS_24640 gene fabG 9970 9200 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence121 19 1266 gene locus_tag LOCUS_24650 gene thiI 19 1266 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173822.1 protein_id gnl|my_center|LOCUS_24650 1276 2076 gene locus_tag LOCUS_24660 1276 2076 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233805.1 protein_id gnl|my_center|LOCUS_24660 2202 2603 gene locus_tag LOCUS_24670 2202 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 4560 2659 gene locus_tag LOCUS_24680 4560 2659 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_24680 4574 4852 gene locus_tag LOCUS_24690 4574 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 5073 5549 gene locus_tag LOCUS_24700 5073 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 5552 6163 gene locus_tag LOCUS_24710 gene thpR 5552 6163 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337456.1 protein_id gnl|my_center|LOCUS_24710 6166 7182 gene locus_tag LOCUS_24720 gene recA 6166 7182 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_24720 7203 8372 gene locus_tag LOCUS_24730 7203 8372 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_24730 8376 8855 gene locus_tag LOCUS_24740 8376 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 8934 9188 gene locus_tag LOCUS_24750 8934 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 9200 9442 gene locus_tag LOCUS_24760 9200 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence122 1131 127 gene locus_tag LOCUS_24770 1131 127 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925213.1 protein_id gnl|my_center|LOCUS_24770 2741 1179 gene locus_tag LOCUS_24780 2741 1179 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_24780 4137 2761 gene locus_tag LOCUS_24790 4137 2761 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969629.1 protein_id gnl|my_center|LOCUS_24790 5410 4247 gene locus_tag LOCUS_24800 5410 4247 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_24800 6350 5445 gene locus_tag LOCUS_24810 6350 5445 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_24810 6839 6372 gene locus_tag LOCUS_24820 6839 6372 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_24820 9131 6849 gene locus_tag LOCUS_24830 9131 6849 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_24830 10041 9193 gene locus_tag LOCUS_24840 10041 9193 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_24840 10561 10076 gene locus_tag LOCUS_24850 10561 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 10797 10597 gene locus_tag LOCUS_24860 10797 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 <11543 10794 gene locus_tag LOCUS_24870 <11543 10794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870644.1:UbiD family decarboxylase >Feature sequence123 376 1671 gene locus_tag LOCUS_24880 376 1671 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869885.1 protein_id gnl|my_center|LOCUS_24880 1727 3049 gene locus_tag LOCUS_24890 gene grdB 1727 3049 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011345263.1 transl_except (pos:2777..2779,aa:Sec) note codon on position 351 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_24890 3209 4639 gene locus_tag LOCUS_24900 3209 4639 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_24900 4687 5778 gene locus_tag LOCUS_24910 4687 5778 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_24910 5785 6678 gene locus_tag LOCUS_24920 5785 6678 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_24920 6711 7277 gene locus_tag LOCUS_24930 6711 7277 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_24930 7274 9610 gene locus_tag LOCUS_24940 7274 9610 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_24940 9684 10856 gene locus_tag LOCUS_24950 9684 10856 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942570.1 protein_id gnl|my_center|LOCUS_24950 >Feature sequence124 1286 324 gene locus_tag LOCUS_24960 1286 324 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_24960 1857 1291 gene locus_tag LOCUS_24970 1857 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1870 1916 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3868 2225 gene locus_tag LOCUS_24980 3868 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 4301 3972 gene locus_tag LOCUS_24990 4301 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 4802 4500 gene locus_tag LOCUS_25000 4802 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 4684 4959 gene locus_tag LOCUS_25010 4684 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 5126 6160 gene locus_tag LOCUS_25020 5126 6160 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082945.1 protein_id gnl|my_center|LOCUS_25020 6849 7100 gene locus_tag LOCUS_25030 6849 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 7622 7909 gene locus_tag LOCUS_25040 7622 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 8055 8705 gene locus_tag LOCUS_25050 8055 8705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 8902 9183 gene locus_tag LOCUS_25060 8902 9183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 9202 9525 gene locus_tag LOCUS_25070 9202 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25070 9575 10696 gene locus_tag LOCUS_25080 9575 10696 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_25080 11252 10668 gene locus_tag LOCUS_25090 11252 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence125 153 332 gene locus_tag LOCUS_25100 153 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 407 952 gene locus_tag LOCUS_25110 407 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 1357 1025 gene locus_tag LOCUS_25120 1357 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 1613 1350 gene locus_tag LOCUS_25130 1613 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2271 1891 gene locus_tag LOCUS_25140 2271 1891 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_25140 2576 2268 gene locus_tag LOCUS_25150 2576 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 2878 5364 gene locus_tag LOCUS_25160 2878 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 6038 5424 gene locus_tag LOCUS_25170 gene pal 6038 5424 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940702.1 protein_id gnl|my_center|LOCUS_25170 6297 6821 gene locus_tag LOCUS_25180 6297 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 6917 7474 gene locus_tag LOCUS_25190 gene def 6917 7474 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_25190 7494 8468 gene locus_tag LOCUS_25200 gene fmt 7494 8468 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_25200 8627 9985 gene locus_tag LOCUS_25210 gene rsmB 8627 9985 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_25210 10066 10722 gene locus_tag LOCUS_25220 gene rpe 10066 10722 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_25220 10828 11127 gene locus_tag LOCUS_25230 10828 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence126 228 980 gene locus_tag LOCUS_25240 228 980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088690.1 protein_id gnl|my_center|LOCUS_25240 1060 3129 gene locus_tag LOCUS_25250 1060 3129 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_25250 3160 3540 gene locus_tag LOCUS_25260 3160 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 3590 3934 gene locus_tag LOCUS_25270 3590 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 4085 4363 gene locus_tag LOCUS_25280 4085 4363 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928690.1 protein_id gnl|my_center|LOCUS_25280 4350 4595 gene locus_tag LOCUS_25290 4350 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 4634 4987 gene locus_tag LOCUS_25300 4634 4987 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_25300 4968 5534 gene locus_tag LOCUS_25310 4968 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 5885 5481 gene locus_tag LOCUS_25320 5885 5481 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272025.1 protein_id gnl|my_center|LOCUS_25320 6924 5995 gene locus_tag LOCUS_25330 6924 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 7156 6839 gene locus_tag LOCUS_25340 7156 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 8244 7381 gene locus_tag LOCUS_25350 8244 7381 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933695.1 protein_id gnl|my_center|LOCUS_25350 9149 8241 gene locus_tag LOCUS_25360 9149 8241 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706985.1 protein_id gnl|my_center|LOCUS_25360 10895 9189 gene locus_tag LOCUS_25370 10895 9189 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978474.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence127 1043 24 gene locus_tag LOCUS_25380 1043 24 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728489.1 protein_id gnl|my_center|LOCUS_25380 1631 1125 gene locus_tag LOCUS_25390 1631 1125 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_25390 3081 1663 gene locus_tag LOCUS_25400 3081 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 3569 3084 gene locus_tag LOCUS_25410 3569 3084 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479599.1 protein_id gnl|my_center|LOCUS_25410 4506 3655 gene locus_tag LOCUS_25420 4506 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25420 4719 4528 gene locus_tag LOCUS_25430 4719 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25430 5488 4802 gene locus_tag LOCUS_25440 5488 4802 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_25440 6175 5513 gene locus_tag LOCUS_25450 6175 5513 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862963.1 protein_id gnl|my_center|LOCUS_25450 7110 6208 gene locus_tag LOCUS_25460 7110 6208 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229949.1 protein_id gnl|my_center|LOCUS_25460 7491 7252 gene locus_tag LOCUS_25470 7491 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 7700 7488 gene locus_tag LOCUS_25480 7700 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 9090 7951 gene locus_tag LOCUS_25490 9090 7951 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_25490 9906 9106 gene locus_tag LOCUS_25500 gene mer 9906 9106 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_25500 10909 10145 gene locus_tag LOCUS_25510 gene modA 10909 10145 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258350.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence128 371 922 gene locus_tag LOCUS_25520 371 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 978 1337 gene locus_tag LOCUS_25530 978 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1652 1398 gene locus_tag LOCUS_25540 1652 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1914 2921 gene locus_tag LOCUS_25550 1914 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2846 3535 gene locus_tag LOCUS_25560 2846 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3540 4751 gene locus_tag LOCUS_25570 3540 4751 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_25570 4764 6293 gene locus_tag LOCUS_25580 4764 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 6303 6872 gene locus_tag LOCUS_25590 6303 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 6877 7431 gene locus_tag LOCUS_25600 6877 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 7520 9025 gene locus_tag LOCUS_25610 gene mshL 7520 9025 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_25610 9071 10345 gene locus_tag LOCUS_25620 9071 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence129 974 1219 gene locus_tag LOCUS_25630 974 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 1271 1540 gene locus_tag LOCUS_25640 1271 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 1565 2566 gene locus_tag LOCUS_25650 1565 2566 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_25650 3409 2591 gene locus_tag LOCUS_25660 3409 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 4285 3467 gene locus_tag LOCUS_25670 4285 3467 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337597.1 protein_id gnl|my_center|LOCUS_25670 5061 4261 gene locus_tag LOCUS_25680 5061 4261 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393472.1 protein_id gnl|my_center|LOCUS_25680 5855 5058 gene locus_tag LOCUS_25690 5855 5058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_25690 6941 5910 gene locus_tag LOCUS_25700 6941 5910 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808730.1 protein_id gnl|my_center|LOCUS_25700 7876 7103 gene locus_tag LOCUS_25710 7876 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 8396 7929 gene locus_tag LOCUS_25720 8396 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 9106 8513 gene locus_tag LOCUS_25730 9106 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 10873 9320 gene locus_tag LOCUS_25740 gene ggt 10873 9320 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence130 348 1115 gene locus_tag LOCUS_25750 348 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 1099 2799 gene locus_tag LOCUS_25760 1099 2799 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_25760 3478 2822 gene locus_tag LOCUS_25770 3478 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3770 4750 gene locus_tag LOCUS_25780 3770 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 4795 5859 gene locus_tag LOCUS_25790 gene eutC 4795 5859 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975301.1 protein_id gnl|my_center|LOCUS_25790 5891 6865 gene locus_tag LOCUS_25800 5891 6865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_25800 6875 7804 gene locus_tag LOCUS_25810 6875 7804 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_25810 7905 8660 gene locus_tag LOCUS_25820 7905 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 9269 9499 gene locus_tag LOCUS_25830 9269 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 9500 9877 gene locus_tag LOCUS_25840 9500 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 9889 10731 gene locus_tag LOCUS_25850 9889 10731 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085172.1 protein_id gnl|my_center|LOCUS_25850 >Feature sequence131 34 171 gene locus_tag LOCUS_25860 34 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 181 489 gene locus_tag LOCUS_25870 181 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25870 850 632 gene locus_tag LOCUS_25880 850 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 1881 964 gene locus_tag LOCUS_25890 1881 964 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791450.1 protein_id gnl|my_center|LOCUS_25890 2049 5435 gene locus_tag LOCUS_25900 gene mfd 2049 5435 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_25900 5540 6679 gene locus_tag LOCUS_25910 5540 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 6325 6353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6573 7526 gene locus_tag LOCUS_25920 6573 7526 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_25920 7534 10401 gene locus_tag LOCUS_25930 gene uvrA 7534 10401 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_25930 10606 10803 gene locus_tag LOCUS_25940 10606 10803 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence132 1057 299 gene locus_tag LOCUS_25950 gene tauC 1057 299 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095795.1 protein_id gnl|my_center|LOCUS_25950 2135 1074 gene locus_tag LOCUS_25960 2135 1074 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223278.1 protein_id gnl|my_center|LOCUS_25960 2968 2177 gene locus_tag LOCUS_25970 2968 2177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966629.1 protein_id gnl|my_center|LOCUS_25970 4396 2987 gene locus_tag LOCUS_25980 4396 2987 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974459.1 protein_id gnl|my_center|LOCUS_25980 5191 4406 gene locus_tag LOCUS_25990 5191 4406 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_25990 7442 5196 gene locus_tag LOCUS_26000 7442 5196 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083795.1 protein_id gnl|my_center|LOCUS_26000 7478 7527 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7710 8459 gene locus_tag LOCUS_26010 7710 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 8677 10083 gene locus_tag LOCUS_26020 gene gltA 8677 10083 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence133 2446 1493 gene locus_tag LOCUS_26030 2446 1493 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878327.1 protein_id gnl|my_center|LOCUS_26030 3345 2443 gene locus_tag LOCUS_26040 3345 2443 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_26040 4053 3349 gene locus_tag LOCUS_26050 4053 3349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 protein_id gnl|my_center|LOCUS_26050 4807 4046 gene locus_tag LOCUS_26060 4807 4046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_26060 6184 4955 gene locus_tag LOCUS_26070 6184 4955 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870134.1 protein_id gnl|my_center|LOCUS_26070 6377 7240 gene locus_tag LOCUS_26080 6377 7240 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 protein_id gnl|my_center|LOCUS_26080 7240 8103 gene locus_tag LOCUS_26090 7240 8103 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460367.1 protein_id gnl|my_center|LOCUS_26090 8194 9159 gene locus_tag LOCUS_26100 8194 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 9220 10224 gene locus_tag LOCUS_26110 9220 10224 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027908.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence134 861 1886 gene locus_tag LOCUS_26120 861 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2635 1985 gene locus_tag LOCUS_26130 2635 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2792 4210 gene locus_tag LOCUS_26140 gene pyk 2792 4210 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_26140 4359 4979 gene locus_tag LOCUS_26150 4359 4979 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_26150 6310 5048 gene locus_tag LOCUS_26160 6310 5048 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086725.1 protein_id gnl|my_center|LOCUS_26160 6484 7521 gene locus_tag LOCUS_26170 6484 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 7620 8186 gene locus_tag LOCUS_26180 7620 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26180 8217 8423 gene locus_tag LOCUS_26190 8217 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 8908 8468 gene locus_tag LOCUS_26200 8908 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 10049 8964 gene locus_tag LOCUS_26210 10049 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence135 1 159 gene locus_tag LOCUS_26220 1 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 203 1318 gene locus_tag LOCUS_26230 203 1318 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266126.1 protein_id gnl|my_center|LOCUS_26230 1358 3154 gene locus_tag LOCUS_26240 1358 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 3354 4361 gene locus_tag LOCUS_26250 3354 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 4416 5195 gene locus_tag LOCUS_26260 4416 5195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_26260 5195 5983 gene locus_tag LOCUS_26270 5195 5983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395917.1 protein_id gnl|my_center|LOCUS_26270 5994 6782 gene locus_tag LOCUS_26280 5994 6782 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395917.1 protein_id gnl|my_center|LOCUS_26280 7882 6851 gene locus_tag LOCUS_26290 7882 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 <10657 8022 gene locus_tag LOCUS_26300 <10657 8022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195813.1:branched-chain amino acid ABC transporter ATP-binding protein/permease >Feature sequence136 1573 569 gene locus_tag LOCUS_26310 1573 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 4846 1607 gene locus_tag LOCUS_26320 4846 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 5727 5065 gene locus_tag LOCUS_26330 5727 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 6030 6326 gene locus_tag LOCUS_26340 6030 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 6979 6404 gene locus_tag LOCUS_26350 gene hpt 6979 6404 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130055.1 protein_id gnl|my_center|LOCUS_26350 7792 7019 gene locus_tag LOCUS_26360 7792 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 9387 7816 gene locus_tag LOCUS_26370 gene metG 9387 7816 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_26370 10385 9384 gene locus_tag LOCUS_26380 gene holB 10385 9384 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence137 929 174 gene locus_tag LOCUS_26390 gene whiG 929 174 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_26390 1861 926 gene locus_tag LOCUS_26400 1861 926 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_26400 3136 1892 gene locus_tag LOCUS_26410 gene flhF 3136 1892 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460748.1 protein_id gnl|my_center|LOCUS_26410 4196 3117 gene locus_tag LOCUS_26420 4196 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 3624 3663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4278 4395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6285 5218 gene locus_tag LOCUS_26430 gene flhB 6285 5218 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545442.1 protein_id gnl|my_center|LOCUS_26430 7084 6275 gene locus_tag LOCUS_26440 7084 6275 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460802.1 protein_id gnl|my_center|LOCUS_26440 7845 7081 gene locus_tag LOCUS_26450 7845 7081 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_26450 8627 7845 gene locus_tag LOCUS_26460 8627 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 8898 8629 gene locus_tag LOCUS_26470 gene fliQ 8898 8629 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_26470 9688 8909 gene locus_tag LOCUS_26480 gene fliP 9688 8909 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_26480 10312 9695 gene locus_tag LOCUS_26490 10312 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence138 3094 1775 gene locus_tag LOCUS_26500 3094 1775 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_26500 3582 3094 gene locus_tag LOCUS_26510 3582 3094 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869225.1 protein_id gnl|my_center|LOCUS_26510 4378 3611 gene locus_tag LOCUS_26520 4378 3611 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_26520 4889 4362 gene locus_tag LOCUS_26530 4889 4362 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_26530 5557 4904 gene locus_tag LOCUS_26540 5557 4904 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257526.1 protein_id gnl|my_center|LOCUS_26540 5780 6757 gene locus_tag LOCUS_26550 gene mer 5780 6757 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_26550 6762 8072 gene locus_tag LOCUS_26560 6762 8072 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_26560 8082 9422 gene locus_tag LOCUS_26570 8082 9422 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391998.1 protein_id gnl|my_center|LOCUS_26570 9419 9712 gene locus_tag LOCUS_26580 9419 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 10081 9806 gene locus_tag LOCUS_26590 10081 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence139 639 106 gene locus_tag LOCUS_26600 639 106 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 protein_id gnl|my_center|LOCUS_26600 2648 651 gene locus_tag LOCUS_26610 2648 651 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_26610 3130 2645 gene locus_tag LOCUS_26620 3130 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3279 3127 gene locus_tag LOCUS_26630 3279 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 3920 3288 gene locus_tag LOCUS_26640 3920 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 4683 4006 gene locus_tag LOCUS_26650 4683 4006 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228657.1 protein_id gnl|my_center|LOCUS_26650 5411 4680 gene locus_tag LOCUS_26660 5411 4680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_26660 7002 5590 gene locus_tag LOCUS_26670 7002 5590 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_26670 8195 7119 gene locus_tag LOCUS_26680 8195 7119 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973995.1 protein_id gnl|my_center|LOCUS_26680 9440 8220 gene locus_tag LOCUS_26690 9440 8220 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086133.1 protein_id gnl|my_center|LOCUS_26690 <10305 9437 gene locus_tag LOCUS_26700 <10305 9437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393611.1:DUF1116 domain-containing protein >Feature sequence140 <1 872 gene locus_tag LOCUS_26710 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125281.1:acetoacetate metabolism transcriptional regulator AtoC 1387 995 gene locus_tag LOCUS_26720 1387 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2681 1497 gene locus_tag LOCUS_26730 2681 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2569 2814 gene locus_tag LOCUS_26740 2569 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 4754 2934 gene locus_tag LOCUS_26750 4754 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 8461 4751 gene locus_tag LOCUS_26760 8461 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 8932 8609 gene locus_tag LOCUS_26770 8932 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 <10249 9338 gene locus_tag LOCUS_26780 <10249 9338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869596.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence141 2153 540 gene locus_tag LOCUS_26790 2153 540 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_26790 2766 2302 gene locus_tag LOCUS_26800 2766 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 3215 2769 gene locus_tag LOCUS_26810 3215 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3458 3300 gene locus_tag LOCUS_26820 3458 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 3868 4971 gene locus_tag LOCUS_26830 3868 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 5033 6565 gene locus_tag LOCUS_26840 5033 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 6558 7964 gene locus_tag LOCUS_26850 6558 7964 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939391.1 protein_id gnl|my_center|LOCUS_26850 8016 9812 gene locus_tag LOCUS_26860 8016 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence142 3 212 gene locus_tag LOCUS_26870 3 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 229 936 gene locus_tag LOCUS_26880 229 936 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937996.1 protein_id gnl|my_center|LOCUS_26880 940 2412 gene locus_tag LOCUS_26890 940 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2474 3112 gene locus_tag LOCUS_26900 2474 3112 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461608.1 protein_id gnl|my_center|LOCUS_26900 3109 4389 gene locus_tag LOCUS_26910 3109 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 4846 4403 gene locus_tag LOCUS_26920 4846 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 5987 5109 gene locus_tag LOCUS_26930 5987 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 7133 5997 gene locus_tag LOCUS_26940 7133 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 9814 7145 gene locus_tag LOCUS_26950 9814 7145 CDS product arsenate reductase (azurin) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257094.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence143 1428 1727 gene locus_tag LOCUS_26960 1428 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26960 2211 1789 gene locus_tag LOCUS_26970 2211 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2705 2208 gene locus_tag LOCUS_26980 2705 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 2982 3269 gene locus_tag LOCUS_26990 gene gatC 2982 3269 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_26990 3317 4795 gene locus_tag LOCUS_27000 gene gatA 3317 4795 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_27000 4818 6464 gene locus_tag LOCUS_27010 4818 6464 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927003.1 protein_id gnl|my_center|LOCUS_27010 6520 8028 gene locus_tag LOCUS_27020 gene gatB 6520 8028 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence144 346 1233 gene locus_tag LOCUS_27030 346 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 1342 2400 gene locus_tag LOCUS_27040 1342 2400 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227641.1 protein_id gnl|my_center|LOCUS_27040 2411 2971 gene locus_tag LOCUS_27050 2411 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2968 3546 gene locus_tag LOCUS_27060 2968 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3543 4544 gene locus_tag LOCUS_27070 3543 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 4559 5161 gene locus_tag LOCUS_27080 4559 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 6190 5255 gene locus_tag LOCUS_27090 6190 5255 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674209.1 protein_id gnl|my_center|LOCUS_27090 7060 6203 gene locus_tag LOCUS_27100 7060 6203 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_27100 7721 7065 gene locus_tag LOCUS_27110 7721 7065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_27110 8464 7706 gene locus_tag LOCUS_27120 8464 7706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921642.1 protein_id gnl|my_center|LOCUS_27120 9641 8448 gene locus_tag LOCUS_27130 9641 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence145 126 1355 gene locus_tag LOCUS_27140 126 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 1352 1948 gene locus_tag LOCUS_27150 1352 1948 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_27150 1948 2556 gene locus_tag LOCUS_27160 1948 2556 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583738.1 protein_id gnl|my_center|LOCUS_27160 2621 3730 gene locus_tag LOCUS_27170 2621 3730 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942689.1 protein_id gnl|my_center|LOCUS_27170 3833 4513 gene locus_tag LOCUS_27180 3833 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27180 4452 6497 gene locus_tag LOCUS_27190 4452 6497 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27190 6543 7316 gene locus_tag LOCUS_27200 6543 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 7321 8109 gene locus_tag LOCUS_27210 7321 8109 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence146 1495 1082 gene locus_tag LOCUS_27220 1495 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 2693 1524 gene locus_tag LOCUS_27230 2693 1524 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815544.1 protein_id gnl|my_center|LOCUS_27230 3570 2869 gene locus_tag LOCUS_27240 3570 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 4365 3580 gene locus_tag LOCUS_27250 4365 3580 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_27250 5229 4414 gene locus_tag LOCUS_27260 5229 4414 CDS product p-hydroxycinnamoyl CoA hydratase/lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739372.1 protein_id gnl|my_center|LOCUS_27260 6761 5244 gene locus_tag LOCUS_27270 6761 5244 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_27270 6929 7978 gene locus_tag LOCUS_27280 6929 7978 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_27280 7986 9260 gene locus_tag LOCUS_27290 7986 9260 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence147 1862 1101 gene locus_tag LOCUS_27300 1862 1101 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_27300 2889 2530 gene locus_tag LOCUS_27310 2889 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 4307 3030 gene locus_tag LOCUS_27320 4307 3030 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391423.1 protein_id gnl|my_center|LOCUS_27320 4873 4304 gene locus_tag LOCUS_27330 4873 4304 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937321.1 protein_id gnl|my_center|LOCUS_27330 5883 4885 gene locus_tag LOCUS_27340 5883 4885 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_27340 7480 5933 gene locus_tag LOCUS_27350 7480 5933 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_27350 7514 7738 gene locus_tag LOCUS_27360 7514 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 7834 9342 gene locus_tag LOCUS_27370 7834 9342 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence148 25 1638 gene locus_tag LOCUS_27380 25 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 1666 4560 gene locus_tag LOCUS_27390 1666 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 4631 5341 gene locus_tag LOCUS_27400 4631 5341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_27400 5411 5773 gene locus_tag LOCUS_27410 5411 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 5795 6310 gene locus_tag LOCUS_27420 5795 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 6406 6840 gene locus_tag LOCUS_27430 gene mce 6406 6840 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879707.1 protein_id gnl|my_center|LOCUS_27430 6842 9016 gene locus_tag LOCUS_27440 6842 9016 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_27440 9221 8997 gene locus_tag LOCUS_27450 9221 8997 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545805.1 protein_id gnl|my_center|LOCUS_27450 9427 9221 gene locus_tag LOCUS_27460 9427 9221 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_27460 9636 9499 gene locus_tag LOCUS_27470 9636 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence149 2119 878 gene locus_tag LOCUS_27480 2119 878 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_27480 2508 3200 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcgacgcgctcgaccttctc 5210 4638 gene locus_tag LOCUS_27490 5210 4638 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085955.1 protein_id gnl|my_center|LOCUS_27490 5740 5207 gene locus_tag LOCUS_27500 5740 5207 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267479.1 protein_id gnl|my_center|LOCUS_27500 6005 6727 gene locus_tag LOCUS_27510 6005 6727 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582866.1 protein_id gnl|my_center|LOCUS_27510 6751 7380 gene locus_tag LOCUS_27520 6751 7380 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 protein_id gnl|my_center|LOCUS_27520 7377 8627 gene locus_tag LOCUS_27530 7377 8627 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_27530 8721 9500 gene locus_tag LOCUS_27540 8721 9500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064578.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence150 1899 1456 gene locus_tag LOCUS_27550 gene nusB 1899 1456 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_27550 2383 1913 gene locus_tag LOCUS_27560 gene ribE 2383 1913 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545200.1 protein_id gnl|my_center|LOCUS_27560 3606 2401 gene locus_tag LOCUS_27570 3606 2401 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_27570 4283 3642 gene locus_tag LOCUS_27580 4283 3642 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_27580 5398 4283 gene locus_tag LOCUS_27590 gene ribD 5398 4283 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_27590 5861 5391 gene locus_tag LOCUS_27600 gene nrdR 5861 5391 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_27600 7645 5936 gene locus_tag LOCUS_27610 7645 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 8896 7655 gene locus_tag LOCUS_27620 gene fabF 8896 7655 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_27620 9157 8921 gene locus_tag LOCUS_27630 gene acpP 9157 8921 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence151 497 246 gene locus_tag LOCUS_27640 497 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27640 991 494 gene locus_tag LOCUS_27650 991 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27650 508 515 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2547 1363 gene locus_tag LOCUS_27660 2547 1363 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258689.1 protein_id gnl|my_center|LOCUS_27660 2908 3579 gene locus_tag LOCUS_27670 gene purN 2908 3579 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_27670 3618 4085 gene locus_tag LOCUS_27680 3618 4085 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392153.1 protein_id gnl|my_center|LOCUS_27680 4131 4322 gene locus_tag LOCUS_27690 gene rpmB 4131 4322 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_27690 5657 4335 gene locus_tag LOCUS_27700 5657 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 6382 5663 gene locus_tag LOCUS_27710 6382 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 6632 6432 gene locus_tag LOCUS_27720 gene rpoZ 6632 6432 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942877.1 protein_id gnl|my_center|LOCUS_27720 7218 6613 gene locus_tag LOCUS_27730 gene gmk 7218 6613 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_27730 7544 7272 gene locus_tag LOCUS_27740 7544 7272 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938198.1 protein_id gnl|my_center|LOCUS_27740 8497 7619 gene locus_tag LOCUS_27750 8497 7619 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_27750 <9492 8594 gene locus_tag LOCUS_27760 <9492 8594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942727.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase >Feature sequence152 233 33 gene locus_tag LOCUS_27770 233 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402859.1 protein_id gnl|my_center|LOCUS_27770 2804 342 gene locus_tag LOCUS_27780 2804 342 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_27780 2982 4079 gene locus_tag LOCUS_27790 gene ansZ 2982 4079 CDS product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 protein_id gnl|my_center|LOCUS_27790 5699 4161 gene locus_tag LOCUS_27800 5699 4161 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640267.1 protein_id gnl|my_center|LOCUS_27800 5984 5908 gene locus_tag LOCUS_t00200 5984 5908 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6409 6909 gene locus_tag LOCUS_27810 6409 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 7221 8657 gene locus_tag LOCUS_27820 7221 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 8950 9105 gene locus_tag LOCUS_27830 8950 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence153 1329 640 gene locus_tag LOCUS_27840 1329 640 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_27840 1949 1530 gene locus_tag LOCUS_27850 1949 1530 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029173.1 protein_id gnl|my_center|LOCUS_27850 3049 1946 gene locus_tag LOCUS_27860 gene arsB 3049 1946 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421624.1 protein_id gnl|my_center|LOCUS_27860 3370 3837 gene locus_tag LOCUS_27870 3370 3837 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869814.1 protein_id gnl|my_center|LOCUS_27870 3866 4693 gene locus_tag LOCUS_27880 gene speE 3866 4693 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424696.1 protein_id gnl|my_center|LOCUS_27880 4690 5544 gene locus_tag LOCUS_27890 gene speB 4690 5544 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393315.1 protein_id gnl|my_center|LOCUS_27890 5696 6712 gene locus_tag LOCUS_27900 5696 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 7571 6744 gene locus_tag LOCUS_27910 7571 6744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531158.1 protein_id gnl|my_center|LOCUS_27910 8383 7583 gene locus_tag LOCUS_27920 8383 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 <9430 8390 gene locus_tag LOCUS_27930 <9430 8390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257589.1:acetyl ornithine aminotransferase family protein >Feature sequence154 1881 841 gene locus_tag LOCUS_27940 1881 841 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727119.1 protein_id gnl|my_center|LOCUS_27940 4207 1868 gene locus_tag LOCUS_27950 4207 1868 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_27950 4834 4223 gene locus_tag LOCUS_27960 4834 4223 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163300480.1 protein_id gnl|my_center|LOCUS_27960 5486 4899 gene locus_tag LOCUS_27970 5486 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 6471 5467 gene locus_tag LOCUS_27980 6471 5467 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084169.1 protein_id gnl|my_center|LOCUS_27980 7504 6476 gene locus_tag LOCUS_27990 7504 6476 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339097.1 protein_id gnl|my_center|LOCUS_27990 7895 8047 gene locus_tag LOCUS_28000 7895 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 8072 8905 gene locus_tag LOCUS_28010 8072 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence155 428 655 gene locus_tag LOCUS_28020 428 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 652 1632 gene locus_tag LOCUS_28030 652 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1714 2238 gene locus_tag LOCUS_28040 1714 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 3287 2301 gene locus_tag LOCUS_28050 3287 2301 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727690.1 protein_id gnl|my_center|LOCUS_28050 4249 3284 gene locus_tag LOCUS_28060 4249 3284 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067939.1 protein_id gnl|my_center|LOCUS_28060 4614 4414 gene locus_tag LOCUS_28070 4614 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 5392 4634 gene locus_tag LOCUS_28080 5392 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28080 5551 6336 gene locus_tag LOCUS_28090 gene lpxA 5551 6336 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_28090 8172 6529 gene locus_tag LOCUS_28100 8172 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 9207 8239 gene locus_tag LOCUS_28110 9207 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence156 398 428 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1254 622 gene locus_tag LOCUS_28120 1254 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28120 2659 1145 gene locus_tag LOCUS_28130 2659 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28130 2834 3367 gene locus_tag LOCUS_28140 2834 3367 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979773.1 protein_id gnl|my_center|LOCUS_28140 3364 3774 gene locus_tag LOCUS_28150 3364 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 4102 3833 gene locus_tag LOCUS_28160 4102 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 4737 4099 gene locus_tag LOCUS_28170 4737 4099 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545221.1 protein_id gnl|my_center|LOCUS_28170 6524 5001 gene locus_tag LOCUS_28180 6524 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 7249 6521 gene locus_tag LOCUS_28190 7249 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 7525 7268 gene locus_tag LOCUS_28200 7525 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 7894 7643 gene locus_tag LOCUS_28210 7894 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 8586 8119 gene locus_tag LOCUS_28220 8586 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28220 >Feature sequence157 379 1383 gene locus_tag LOCUS_28230 379 1383 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965807.1 protein_id gnl|my_center|LOCUS_28230 1457 2302 gene locus_tag LOCUS_28240 1457 2302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_28240 2304 3086 gene locus_tag LOCUS_28250 2304 3086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_28250 3257 4015 gene locus_tag LOCUS_28260 3257 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 4059 4646 gene locus_tag LOCUS_28270 4059 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 4715 6154 gene locus_tag LOCUS_28280 4715 6154 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_28280 6145 7548 gene locus_tag LOCUS_28290 6145 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 7553 8839 gene locus_tag LOCUS_28300 7553 8839 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_28300 >Feature sequence158 <1 670 gene locus_tag LOCUS_28310 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392739.1:molybdopterin-dependent oxidoreductase 726 1304 gene locus_tag LOCUS_28320 726 1304 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086605.1 protein_id gnl|my_center|LOCUS_28320 1371 1826 gene locus_tag LOCUS_28330 1371 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1907 3055 gene locus_tag LOCUS_28340 1907 3055 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039280.1 protein_id gnl|my_center|LOCUS_28340 3086 3952 gene locus_tag LOCUS_28350 3086 3952 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965993.1 protein_id gnl|my_center|LOCUS_28350 3966 4940 gene locus_tag LOCUS_28360 3966 4940 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674209.1 protein_id gnl|my_center|LOCUS_28360 4955 5524 gene locus_tag LOCUS_28370 4955 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 6054 5521 gene locus_tag LOCUS_28380 6054 5521 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979558.1 protein_id gnl|my_center|LOCUS_28380 7258 6149 gene locus_tag LOCUS_28390 7258 6149 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_28390 7496 8287 gene locus_tag LOCUS_28400 7496 8287 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878408.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence159 94 1185 gene locus_tag LOCUS_28410 94 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1182 2441 gene locus_tag LOCUS_28420 gene hisS 1182 2441 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_28420 2426 4267 gene locus_tag LOCUS_28430 gene aspS 2426 4267 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_28430 4284 5351 gene locus_tag LOCUS_28440 4284 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 5369 6613 gene locus_tag LOCUS_28450 gene icd 5369 6613 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868777.1 protein_id gnl|my_center|LOCUS_28450 6628 7557 gene locus_tag LOCUS_28460 gene mdh 6628 7557 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388965.1 protein_id gnl|my_center|LOCUS_28460 7585 8367 gene locus_tag LOCUS_28470 7585 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence160 947 441 gene locus_tag LOCUS_28480 gene tsaE 947 441 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049629.1 protein_id gnl|my_center|LOCUS_28480 2466 901 gene locus_tag LOCUS_28490 2466 901 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_28490 2906 2523 gene locus_tag LOCUS_28500 2906 2523 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_28500 3625 2903 gene locus_tag LOCUS_28510 3625 2903 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_28510 4424 3681 gene locus_tag LOCUS_28520 4424 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28520 5167 4457 gene locus_tag LOCUS_28530 5167 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28530 6032 5178 gene locus_tag LOCUS_28540 gene folP 6032 5178 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_28540 8002 6182 gene locus_tag LOCUS_28550 gene ftsH 8002 6182 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_28550 8664 8116 gene locus_tag LOCUS_28560 gene hpt 8664 8116 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817255.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence161 869 910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1570 1361 gene locus_tag LOCUS_28570 1570 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2061 1501 gene locus_tag LOCUS_28580 2061 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2151 2471 gene locus_tag LOCUS_28590 2151 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 2543 2770 gene locus_tag LOCUS_28600 2543 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 5005 3737 gene locus_tag LOCUS_28610 5005 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 5337 6770 gene locus_tag LOCUS_28620 5337 6770 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_28620 6822 7532 gene locus_tag LOCUS_28630 6822 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 <8978 7529 gene locus_tag LOCUS_28640 <8978 7529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162139548.1:ATP-dependent acyl-CoA ligase >Feature sequence162 330 842 gene locus_tag LOCUS_28650 330 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 1276 890 gene locus_tag LOCUS_28660 1276 890 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009876549.1 protein_id gnl|my_center|LOCUS_28660 2809 1355 gene locus_tag LOCUS_28670 2809 1355 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_28670 3084 5327 gene locus_tag LOCUS_28680 3084 5327 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528125.1 protein_id gnl|my_center|LOCUS_28680 5347 6327 gene locus_tag LOCUS_28690 5347 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28690 6252 6560 gene locus_tag LOCUS_28700 6252 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 6619 7491 gene locus_tag LOCUS_28710 6619 7491 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966751.1 protein_id gnl|my_center|LOCUS_28710 7488 8477 gene locus_tag LOCUS_28720 7488 8477 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence163 256 810 gene locus_tag LOCUS_28730 256 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 851 1156 gene locus_tag LOCUS_28740 851 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 1123 1608 gene locus_tag LOCUS_28750 1123 1608 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_28750 1619 2293 gene locus_tag LOCUS_28760 1619 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 2290 2586 gene locus_tag LOCUS_28770 2290 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 2702 2779 gene locus_tag LOCUS_t00210 2702 2779 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4123 2909 gene locus_tag LOCUS_28780 4123 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 4889 4404 gene locus_tag LOCUS_28790 4889 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 5280 5480 gene locus_tag LOCUS_28800 5280 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 5477 5656 gene locus_tag LOCUS_28810 5477 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 5718 7148 gene locus_tag LOCUS_28820 5718 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 7640 7266 gene locus_tag LOCUS_28830 7640 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 >Feature sequence164 114 1316 gene locus_tag LOCUS_28840 114 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 2761 1385 gene locus_tag LOCUS_28850 2761 1385 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929074.1 protein_id gnl|my_center|LOCUS_28850 3594 2758 gene locus_tag LOCUS_28860 3594 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 3786 3610 gene locus_tag LOCUS_28870 3786 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 4266 3913 gene locus_tag LOCUS_28880 4266 3913 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_28880 5367 4492 gene locus_tag LOCUS_28890 5367 4492 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_28890 6332 5364 gene locus_tag LOCUS_28900 6332 5364 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142938.1 protein_id gnl|my_center|LOCUS_28900 8008 6332 gene locus_tag LOCUS_28910 8008 6332 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_28910 >Feature sequence165 318 142 gene locus_tag LOCUS_28920 318 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 962 318 gene locus_tag LOCUS_28930 962 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28930 1134 1493 gene locus_tag LOCUS_28940 1134 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 3244 1490 gene locus_tag LOCUS_28950 3244 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 3476 4000 gene locus_tag LOCUS_28960 3476 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 4049 5326 gene locus_tag LOCUS_28970 gene dctM 4049 5326 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_28970 5364 6416 gene locus_tag LOCUS_28980 5364 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 6534 7592 gene locus_tag LOCUS_28990 6534 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 7710 7634 gene locus_tag LOCUS_t00220 7710 7634 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <8710 7723 gene locus_tag LOCUS_29000 <8710 7723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272522.1:flavocytochrome c >Feature sequence166 566 126 gene locus_tag LOCUS_29010 566 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 867 598 gene locus_tag LOCUS_29020 867 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 2204 864 gene locus_tag LOCUS_29030 2204 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 2451 2218 gene locus_tag LOCUS_29040 2451 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 2712 2485 gene locus_tag LOCUS_29050 2712 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 5286 2716 gene locus_tag LOCUS_29060 5286 2716 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393490.1 protein_id gnl|my_center|LOCUS_29060 5726 6130 gene locus_tag LOCUS_29070 5726 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 6558 6809 gene locus_tag LOCUS_29080 6558 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 7073 7783 gene locus_tag LOCUS_29090 7073 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence167 1119 55 gene locus_tag LOCUS_29100 1119 55 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930114.1 protein_id gnl|my_center|LOCUS_29100 1751 1116 gene locus_tag LOCUS_29110 1751 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 2734 1724 gene locus_tag LOCUS_29120 2734 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 2986 2849 gene locus_tag LOCUS_29130 2986 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 2946 3212 gene locus_tag LOCUS_29140 2946 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 3284 4303 gene locus_tag LOCUS_29150 3284 4303 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467792.1 protein_id gnl|my_center|LOCUS_29150 5371 4337 gene locus_tag LOCUS_29160 5371 4337 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_29160 5490 5735 gene locus_tag LOCUS_29170 5490 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 7554 5890 gene locus_tag LOCUS_29180 7554 5890 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_29180 7742 7551 gene locus_tag LOCUS_29190 7742 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 7897 8328 gene locus_tag LOCUS_29200 7897 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29200 8202 8206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence168 159 473 gene locus_tag LOCUS_29210 159 473 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_29210 1392 589 gene locus_tag LOCUS_29220 1392 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 1788 1474 gene locus_tag LOCUS_29230 1788 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 2936 1788 gene locus_tag LOCUS_29240 2936 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 4114 3122 gene locus_tag LOCUS_29250 4114 3122 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_29250 4392 6032 gene locus_tag LOCUS_29260 gene fumA 4392 6032 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413503.1 protein_id gnl|my_center|LOCUS_29260 6042 7424 gene locus_tag LOCUS_29270 6042 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 7421 8035 gene locus_tag LOCUS_29280 7421 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence169 2040 1009 gene locus_tag LOCUS_29290 2040 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 2744 2070 gene locus_tag LOCUS_29300 2744 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813876.1 protein_id gnl|my_center|LOCUS_29300 3559 2741 gene locus_tag LOCUS_29310 3559 2741 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461125.1 protein_id gnl|my_center|LOCUS_29310 5061 3592 gene locus_tag LOCUS_29320 gene gabD 5061 3592 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_29320 5463 5161 gene locus_tag LOCUS_29330 5463 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 5763 5521 gene locus_tag LOCUS_29340 5763 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 6807 5815 gene locus_tag LOCUS_29350 6807 5815 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_29350 7367 6873 gene locus_tag LOCUS_29360 7367 6873 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 protein_id gnl|my_center|LOCUS_29360 7706 7425 gene locus_tag LOCUS_29370 7706 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence170 1388 387 gene locus_tag LOCUS_29380 1388 387 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338610.1 protein_id gnl|my_center|LOCUS_29380 2241 1477 gene locus_tag LOCUS_29390 2241 1477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_29390 3066 2254 gene locus_tag LOCUS_29400 3066 2254 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728490.1 protein_id gnl|my_center|LOCUS_29400 3928 3077 gene locus_tag LOCUS_29410 3928 3077 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392225.1 protein_id gnl|my_center|LOCUS_29410 4333 4073 gene locus_tag LOCUS_29420 4333 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 5661 4318 gene locus_tag LOCUS_29430 5661 4318 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_29430 6426 5683 gene locus_tag LOCUS_29440 6426 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 7615 6326 gene locus_tag LOCUS_29450 7615 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 7938 8225 gene locus_tag LOCUS_29460 gene groES 7938 8225 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence171 2249 711 gene locus_tag LOCUS_29470 2249 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 3615 2218 gene locus_tag LOCUS_29480 gene nrfD 3615 2218 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228899.1 protein_id gnl|my_center|LOCUS_29480 4330 3596 gene locus_tag LOCUS_29490 4330 3596 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937996.1 protein_id gnl|my_center|LOCUS_29490 6786 4342 gene locus_tag LOCUS_29500 6786 4342 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272623.1 protein_id gnl|my_center|LOCUS_29500 7294 6794 gene locus_tag LOCUS_29510 7294 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 <8365 7544 gene locus_tag LOCUS_29520 <8365 7544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035214612.1:4Fe-4S binding protein >Feature sequence172 822 487 gene locus_tag LOCUS_29530 822 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 815 1861 gene locus_tag LOCUS_29540 815 1861 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29540 3031 2009 gene locus_tag LOCUS_29550 3031 2009 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_29550 3828 3049 gene locus_tag LOCUS_29560 3828 3049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067356.1 protein_id gnl|my_center|LOCUS_29560 4595 3825 gene locus_tag LOCUS_29570 4595 3825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_29570 5640 4612 gene locus_tag LOCUS_29580 5640 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 5872 6477 gene locus_tag LOCUS_29590 5872 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29590 6456 6884 gene locus_tag LOCUS_29600 6456 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 7022 7990 gene locus_tag LOCUS_29610 7022 7990 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479639.1 protein_id gnl|my_center|LOCUS_29610 >Feature sequence173 436 1989 gene locus_tag LOCUS_29620 436 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29620 2163 3185 gene locus_tag LOCUS_29630 2163 3185 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395914.1 protein_id gnl|my_center|LOCUS_29630 3276 4109 gene locus_tag LOCUS_29640 3276 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 4143 5114 gene locus_tag LOCUS_29650 4143 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 5142 6152 gene locus_tag LOCUS_29660 5142 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 6221 7633 gene locus_tag LOCUS_29670 6221 7633 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399863.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence174 <1 1309 gene locus_tag LOCUS_29680 <1 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965625.1:ABC transporter ATP-binding protein 1279 2409 gene locus_tag LOCUS_29690 1279 2409 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_29690 2409 3509 gene locus_tag LOCUS_29700 2409 3509 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_29700 3506 4708 gene locus_tag LOCUS_29710 3506 4708 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972900.1 protein_id gnl|my_center|LOCUS_29710 4702 6105 gene locus_tag LOCUS_29720 4702 6105 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_29720 6125 7444 gene locus_tag LOCUS_29730 6125 7444 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence175 990 586 gene locus_tag LOCUS_29740 990 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 1531 1016 gene locus_tag LOCUS_29750 1531 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 1991 1542 gene locus_tag LOCUS_29760 gene gspG 1991 1542 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_29760 3223 2006 gene locus_tag LOCUS_29770 gene gspF 3223 2006 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_29770 3685 3239 gene locus_tag LOCUS_29780 3685 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 5392 3695 gene locus_tag LOCUS_29790 gene gspE 5392 3695 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_29790 7619 5397 gene locus_tag LOCUS_29800 gene gspD 7619 5397 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_29800 >Feature sequence176 100 1608 gene locus_tag LOCUS_29810 100 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 1746 2222 gene locus_tag LOCUS_29820 1746 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 2227 3174 gene locus_tag LOCUS_29830 2227 3174 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_29830 3164 4111 gene locus_tag LOCUS_29840 3164 4111 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_29840 4412 4119 gene locus_tag LOCUS_29850 4412 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 4707 4561 gene locus_tag LOCUS_29860 4707 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 5559 4756 gene locus_tag LOCUS_29870 5559 4756 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871102.1 protein_id gnl|my_center|LOCUS_29870 5503 6036 gene locus_tag LOCUS_29880 5503 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 6038 6934 gene locus_tag LOCUS_29890 6038 6934 CDS product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816618.1 protein_id gnl|my_center|LOCUS_29890 <7697 7003 gene locus_tag LOCUS_29900 <7697 7003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967354.1:amidohydrolase family protein >Feature sequence177 301 774 gene locus_tag LOCUS_29910 301 774 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969257.1 protein_id gnl|my_center|LOCUS_29910 840 1760 gene locus_tag LOCUS_29920 840 1760 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392694.1 protein_id gnl|my_center|LOCUS_29920 1760 3277 gene locus_tag LOCUS_29930 1760 3277 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644796.1 protein_id gnl|my_center|LOCUS_29930 3290 4594 gene locus_tag LOCUS_29940 3290 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29940 4591 6243 gene locus_tag LOCUS_29950 4591 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29950 7342 6329 gene locus_tag LOCUS_29960 gene ilvA 7342 6329 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence178 <1 1209 gene locus_tag LOCUS_29970 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975336.1:ABC transporter substrate-binding protein 1215 2111 gene locus_tag LOCUS_29980 1215 2111 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338504.1 protein_id gnl|my_center|LOCUS_29980 2108 3121 gene locus_tag LOCUS_29990 2108 3121 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096543.1 protein_id gnl|my_center|LOCUS_29990 3271 4284 gene locus_tag LOCUS_30000 3271 4284 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429089.1 protein_id gnl|my_center|LOCUS_30000 4395 5204 gene locus_tag LOCUS_30010 4395 5204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_30010 5201 6058 gene locus_tag LOCUS_30020 5201 6058 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803988.1 protein_id gnl|my_center|LOCUS_30020 6385 6086 gene locus_tag LOCUS_30030 6385 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 7462 6449 gene locus_tag LOCUS_30040 7462 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence179 <1 673 gene locus_tag LOCUS_30050 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942643.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA 670 1197 gene locus_tag LOCUS_30060 670 1197 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_30060 1212 2378 gene locus_tag LOCUS_30070 1212 2378 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_30070 2429 2505 gene locus_tag LOCUS_t00230 2429 2505 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2585 4522 gene locus_tag LOCUS_30080 gene thrS 2585 4522 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_30080 4700 5074 gene locus_tag LOCUS_30090 4700 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30090 5328 5681 gene locus_tag LOCUS_30100 gene rplT 5328 5681 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_30100 5745 6770 gene locus_tag LOCUS_30110 gene pheS 5745 6770 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_30110 >Feature sequence180 1754 81 gene locus_tag LOCUS_30120 gene ilvD 1754 81 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_30120 1860 2660 gene locus_tag LOCUS_30130 1860 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30130 2644 2961 gene locus_tag LOCUS_30140 2644 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30140 3399 3019 gene locus_tag LOCUS_30150 3399 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 3789 4289 gene locus_tag LOCUS_30160 3789 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 4376 5350 gene locus_tag LOCUS_30170 4376 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 5386 6351 gene locus_tag LOCUS_30180 5386 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 6369 6743 gene locus_tag LOCUS_30190 6369 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 <7560 6934 gene locus_tag LOCUS_30200 <7560 6934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080684.1:galactose-1-phosphate uridylyltransferase >Feature sequence181 141 1481 gene locus_tag LOCUS_30210 141 1481 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_30210 1489 2493 gene locus_tag LOCUS_30220 1489 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 2717 4222 gene locus_tag LOCUS_30230 2717 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 4255 4434 gene locus_tag LOCUS_30240 4255 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 4561 5463 gene locus_tag LOCUS_30250 gene dapA 4561 5463 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_30250 5756 6301 gene locus_tag LOCUS_30260 5756 6301 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_30260 6506 7024 gene locus_tag LOCUS_30270 6506 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30270 >Feature sequence182 60 818 gene locus_tag LOCUS_30280 gene fabG 60 818 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_30280 913 1899 gene locus_tag LOCUS_30290 gene bioB 913 1899 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920732.1 protein_id gnl|my_center|LOCUS_30290 1883 3070 gene locus_tag LOCUS_30300 gene bioF 1883 3070 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_30300 3170 4459 gene locus_tag LOCUS_30310 3170 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 4517 5542 gene locus_tag LOCUS_30320 4517 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 5577 6389 gene locus_tag LOCUS_30330 5577 6389 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088940.1 protein_id gnl|my_center|LOCUS_30330 6397 7155 gene locus_tag LOCUS_30340 6397 7155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_30340 >Feature sequence183 <1 1557 gene locus_tag LOCUS_30350 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228735.1:amidohydrolase 1554 2237 gene locus_tag LOCUS_30360 1554 2237 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_30360 2230 2880 gene locus_tag LOCUS_30370 2230 2880 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412782.1 protein_id gnl|my_center|LOCUS_30370 2895 3737 gene locus_tag LOCUS_30380 gene couO 2895 3737 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_30380 3751 5124 gene locus_tag LOCUS_30390 3751 5124 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388548.1 protein_id gnl|my_center|LOCUS_30390 4727 4769 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5153 6271 gene locus_tag LOCUS_30400 5153 6271 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_30400 <7366 6294 gene locus_tag LOCUS_30410 <7366 6294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000928668.1:amidohydrolase >Feature sequence184 238 1911 gene locus_tag LOCUS_30420 238 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30420 2011 2469 gene locus_tag LOCUS_30430 2011 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30430 2534 3355 gene locus_tag LOCUS_30440 2534 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3418 3978 gene locus_tag LOCUS_30450 3418 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30450 3991 5676 gene locus_tag LOCUS_30460 3991 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30460 6687 5701 gene locus_tag LOCUS_30470 6687 5701 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803989.1 protein_id gnl|my_center|LOCUS_30470 >Feature sequence185 2074 1103 gene locus_tag LOCUS_30480 2074 1103 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_30480 3151 2147 gene locus_tag LOCUS_30490 gene pdhA 3151 2147 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_30490 4201 3221 gene locus_tag LOCUS_30500 gene aguB 4201 3221 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889160.1 protein_id gnl|my_center|LOCUS_30500 5294 4263 gene locus_tag LOCUS_30510 gene aguB 5294 4263 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209979.1 protein_id gnl|my_center|LOCUS_30510 6381 5338 gene locus_tag LOCUS_30520 6381 5338 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459458.1 protein_id gnl|my_center|LOCUS_30520 <7239 6394 gene locus_tag LOCUS_30530 <7239 6394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967169.1:NrtA/SsuA/CpmA family ABC transporter substrate-binding protein >Feature sequence186 473 24 gene locus_tag LOCUS_30540 473 24 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_30540 813 526 gene locus_tag LOCUS_30550 813 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 1193 2464 gene locus_tag LOCUS_30560 1193 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30560 2364 2900 gene locus_tag LOCUS_30570 2364 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 3160 3546 gene locus_tag LOCUS_30580 3160 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 4939 3641 gene locus_tag LOCUS_30590 4939 3641 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_30590 5036 5812 gene locus_tag LOCUS_30600 5036 5812 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_30600 6458 5832 gene locus_tag LOCUS_30610 6458 5832 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_30610 <7220 6486 gene locus_tag LOCUS_30620 <7220 6486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038796.1:ABC transporter substrate-binding protein >Feature sequence187 44 457 gene locus_tag LOCUS_30630 44 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 1484 429 gene locus_tag LOCUS_30640 1484 429 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807533.1 protein_id gnl|my_center|LOCUS_30640 1650 2390 gene locus_tag LOCUS_30650 1650 2390 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389167.1 protein_id gnl|my_center|LOCUS_30650 2392 3831 gene locus_tag LOCUS_30660 2392 3831 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531459.1 protein_id gnl|my_center|LOCUS_30660 2935 2966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3828 4418 gene locus_tag LOCUS_30670 3828 4418 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256718.1 protein_id gnl|my_center|LOCUS_30670 5868 4360 gene locus_tag LOCUS_30680 5868 4360 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_30680 6745 5876 gene locus_tag LOCUS_30690 6745 5876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence188 446 2716 gene locus_tag LOCUS_30700 446 2716 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_30700 2713 3777 gene locus_tag LOCUS_30710 2713 3777 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102358.1 protein_id gnl|my_center|LOCUS_30710 3774 4244 gene locus_tag LOCUS_30720 3774 4244 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_30720 4453 4713 gene locus_tag LOCUS_30730 4453 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 4788 5261 gene locus_tag LOCUS_30740 4788 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 5557 5345 gene locus_tag LOCUS_30750 5557 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30750 6575 5484 gene locus_tag LOCUS_30760 6575 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30760 >Feature sequence189 1255 479 gene locus_tag LOCUS_30770 1255 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 1719 1258 gene locus_tag LOCUS_30780 1719 1258 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_30780 2004 2222 gene locus_tag LOCUS_30790 2004 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 2209 2700 gene locus_tag LOCUS_30800 2209 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3007 2720 gene locus_tag LOCUS_30810 3007 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 4480 3275 gene locus_tag LOCUS_30820 4480 3275 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_30820 4885 5148 gene locus_tag LOCUS_30830 4885 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 5405 6991 gene locus_tag LOCUS_30840 5405 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 >Feature sequence190 78 3 gene locus_tag LOCUS_t00240 78 3 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 185 112 gene locus_tag LOCUS_t00250 185 112 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1689 289 gene locus_tag LOCUS_30850 gene gltX 1689 289 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_30850 2501 1698 gene locus_tag LOCUS_30860 gene amrB 2501 1698 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545930.1 protein_id gnl|my_center|LOCUS_30860 2763 3353 gene locus_tag LOCUS_30870 2763 3353 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942243.1 protein_id gnl|my_center|LOCUS_30870 3384 3569 gene locus_tag LOCUS_30880 gene rpmF 3384 3569 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_30880 3616 4638 gene locus_tag LOCUS_30890 gene plsX 3616 4638 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_30890 4671 5651 gene locus_tag LOCUS_30900 4671 5651 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_30900 5683 6609 gene locus_tag LOCUS_30910 gene fabD 5683 6609 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_30910 >Feature sequence191 247 705 gene locus_tag LOCUS_30920 247 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 1051 860 gene locus_tag LOCUS_30930 1051 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 1980 1099 gene locus_tag LOCUS_30940 1980 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2903 2229 gene locus_tag LOCUS_30950 2903 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 2949 3137 gene locus_tag LOCUS_30960 2949 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 3415 3221 gene locus_tag LOCUS_30970 3415 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 3615 3749 gene locus_tag LOCUS_30980 3615 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30980 3825 4034 gene locus_tag LOCUS_30990 3825 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30990 4031 5080 gene locus_tag LOCUS_31000 4031 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31000 6027 5077 gene locus_tag LOCUS_31010 6027 5077 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_31010 6378 6109 gene locus_tag LOCUS_31020 6378 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 >Feature sequence192 1389 331 gene locus_tag LOCUS_31030 1389 331 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_31030 2372 1386 gene locus_tag LOCUS_31040 2372 1386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_31040 2968 2375 gene locus_tag LOCUS_31050 gene plsY 2968 2375 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_31050 5981 3162 gene locus_tag LOCUS_31060 5981 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 <6939 5978 gene locus_tag LOCUS_31070 <6939 5978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868765.1:ABC transporter substrate-binding protein >Feature sequence193 685 89 gene locus_tag LOCUS_31080 685 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31080 2398 1304 gene locus_tag LOCUS_31090 2398 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 3470 2499 gene locus_tag LOCUS_31100 3470 2499 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_31100 3792 3637 gene locus_tag LOCUS_31110 3792 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 5227 3845 gene locus_tag LOCUS_31120 5227 3845 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_31120 5507 5343 gene locus_tag LOCUS_31130 5507 5343 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013190.1 protein_id gnl|my_center|LOCUS_31130 5776 5564 gene locus_tag LOCUS_31140 5776 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 <6912 5838 gene locus_tag LOCUS_31150 <6912 5838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003525631.1:branched-chain amino acid ABC transporter substrate-binding protein >Feature sequence194 <1 1189 gene locus_tag LOCUS_31160 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942515.1:sensor domain-containing diguanylate cyclase 2233 1196 gene locus_tag LOCUS_31170 2233 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 2446 2976 gene locus_tag LOCUS_31180 2446 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 2978 4492 gene locus_tag LOCUS_31190 2978 4492 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765727.1 protein_id gnl|my_center|LOCUS_31190 4489 5439 gene locus_tag LOCUS_31200 4489 5439 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506955.1 protein_id gnl|my_center|LOCUS_31200 5719 6663 gene locus_tag LOCUS_31210 5719 6663 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887573.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence195 1940 306 gene locus_tag LOCUS_31220 gene pchD 1940 306 CDS product pyochelin biosynthesis salicyl-AMP ligase PchD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114688.1 protein_id gnl|my_center|LOCUS_31220 2125 1925 gene locus_tag LOCUS_31230 2125 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 3836 2112 gene locus_tag LOCUS_31240 3836 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 4122 4997 gene locus_tag LOCUS_31250 gene yghX 4122 4997 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297303.1 protein_id gnl|my_center|LOCUS_31250 5001 6080 gene locus_tag LOCUS_31260 gene eutC 5001 6080 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969330.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence196 1677 688 gene locus_tag LOCUS_31270 1677 688 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532064.1 protein_id gnl|my_center|LOCUS_31270 1806 3014 gene locus_tag LOCUS_31280 1806 3014 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_31280 3335 3018 gene locus_tag LOCUS_31290 3335 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 4741 3344 gene locus_tag LOCUS_31300 4741 3344 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_31300 5630 4791 gene locus_tag LOCUS_31310 5630 4791 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803988.1 protein_id gnl|my_center|LOCUS_31310 6412 5627 gene locus_tag LOCUS_31320 6412 5627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803987.1 protein_id gnl|my_center|LOCUS_31320 6746 6447 gene locus_tag LOCUS_31330 6746 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence197 <1 2778 gene locus_tag LOCUS_31340 <1 2778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584100.1:diguanylate cyclase 3182 2856 gene locus_tag LOCUS_31350 3182 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 4521 3238 gene locus_tag LOCUS_31360 4521 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 4863 4549 gene locus_tag LOCUS_31370 4863 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 5987 4986 gene locus_tag LOCUS_31380 5987 4986 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399857.1 protein_id gnl|my_center|LOCUS_31380 <6849 6015 gene locus_tag LOCUS_31390 <6849 6015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040326.1:amidohydrolase family protein >Feature sequence198 1589 228 gene locus_tag LOCUS_31400 1589 228 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_31400 3028 1586 gene locus_tag LOCUS_31410 3028 1586 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941041.1 protein_id gnl|my_center|LOCUS_31410 3764 3135 gene locus_tag LOCUS_31420 3764 3135 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315687.1 protein_id gnl|my_center|LOCUS_31420 4960 3857 gene locus_tag LOCUS_31430 4960 3857 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_31430 5211 6320 gene locus_tag LOCUS_31440 5211 6320 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728241.1 protein_id gnl|my_center|LOCUS_31440 6844 6308 gene locus_tag LOCUS_31450 6844 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence199 511 38 gene locus_tag LOCUS_31460 511 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1414 965 gene locus_tag LOCUS_31470 1414 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 2286 1735 gene locus_tag LOCUS_31480 2286 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2627 3307 gene locus_tag LOCUS_31490 2627 3307 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_31490 3946 5184 gene locus_tag LOCUS_31500 3946 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 5517 6080 gene locus_tag LOCUS_31510 5517 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 6650 6102 gene locus_tag LOCUS_31520 6650 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence200 415 452 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 503 805 gene locus_tag LOCUS_31530 503 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 815 1600 gene locus_tag LOCUS_31540 815 1600 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808734.1 protein_id gnl|my_center|LOCUS_31540 1597 2418 gene locus_tag LOCUS_31550 1597 2418 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222208.1 protein_id gnl|my_center|LOCUS_31550 2435 3367 gene locus_tag LOCUS_31560 2435 3367 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389693.1 protein_id gnl|my_center|LOCUS_31560 3405 4382 gene locus_tag LOCUS_31570 3405 4382 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_31570 4420 5193 gene locus_tag LOCUS_31580 4420 5193 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_31580 5229 5936 gene locus_tag LOCUS_31590 5229 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 <6778 5962 gene locus_tag LOCUS_31600 <6778 5962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034859505.1:ABC transporter substrate-binding protein >Feature sequence201 301 56 gene locus_tag LOCUS_31610 301 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 1917 394 gene locus_tag LOCUS_31620 1917 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 2998 1970 gene locus_tag LOCUS_31630 2998 1970 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728489.1 protein_id gnl|my_center|LOCUS_31630 4235 3264 gene locus_tag LOCUS_31640 4235 3264 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030050.1 protein_id gnl|my_center|LOCUS_31640 4697 4377 gene locus_tag LOCUS_31650 4697 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 5073 4924 gene locus_tag LOCUS_31660 5073 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 5373 5245 gene locus_tag LOCUS_31670 5373 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 5922 5473 gene locus_tag LOCUS_31680 5922 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 <6752 6232 gene locus_tag LOCUS_31690 <6752 6232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012660467.1:Crp/Fnr family transcriptional regulator >Feature sequence202 648 436 gene locus_tag LOCUS_31700 648 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 959 2062 gene locus_tag LOCUS_31710 gene boxB 959 2062 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230333.1 protein_id gnl|my_center|LOCUS_31710 2105 2440 gene locus_tag LOCUS_31720 2105 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 2456 3715 gene locus_tag LOCUS_31730 gene nuoF 2456 3715 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396808.1 protein_id gnl|my_center|LOCUS_31730 3778 4551 gene locus_tag LOCUS_31740 3778 4551 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229011.1 protein_id gnl|my_center|LOCUS_31740 4597 4977 gene locus_tag LOCUS_31750 4597 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 5018 5752 gene locus_tag LOCUS_31760 5018 5752 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence203 2088 493 gene locus_tag LOCUS_31770 2088 493 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537708.1 protein_id gnl|my_center|LOCUS_31770 2853 2110 gene locus_tag LOCUS_31780 2853 2110 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_31780 3494 2850 gene locus_tag LOCUS_31790 3494 2850 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808122.1 protein_id gnl|my_center|LOCUS_31790 5204 3636 gene locus_tag LOCUS_31800 5204 3636 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880567.1 protein_id gnl|my_center|LOCUS_31800 6413 5439 gene locus_tag LOCUS_31810 6413 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence204 <1 676 gene locus_tag LOCUS_31820 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126863657.1:LLM class flavin-dependent oxidoreductase 1623 688 gene locus_tag LOCUS_31830 1623 688 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538206.1 protein_id gnl|my_center|LOCUS_31830 2544 1627 gene locus_tag LOCUS_31840 2544 1627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_31840 4067 2541 gene locus_tag LOCUS_31850 4067 2541 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973928.1 protein_id gnl|my_center|LOCUS_31850 5183 4146 gene locus_tag LOCUS_31860 5183 4146 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229093.1 protein_id gnl|my_center|LOCUS_31860 6317 5346 gene locus_tag LOCUS_31870 6317 5346 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529865.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence205 911 2221 gene locus_tag LOCUS_31880 911 2221 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 protein_id gnl|my_center|LOCUS_31880 2229 5366 gene locus_tag LOCUS_31890 2229 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 6455 5469 gene locus_tag LOCUS_31900 6455 5469 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_31900 >Feature sequence206 1548 538 gene locus_tag LOCUS_31910 1548 538 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965807.1 protein_id gnl|my_center|LOCUS_31910 3047 1611 gene locus_tag LOCUS_31920 3047 1611 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_31920 4260 3142 gene locus_tag LOCUS_31930 4260 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 4490 5359 gene locus_tag LOCUS_31940 4490 5359 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060992.1 protein_id gnl|my_center|LOCUS_31940 5352 6083 gene locus_tag LOCUS_31950 5352 6083 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_31950 >Feature sequence207 129 314 gene locus_tag LOCUS_31960 129 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 1894 311 gene locus_tag LOCUS_31970 1894 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 3009 2053 gene locus_tag LOCUS_31980 3009 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 4419 3091 gene locus_tag LOCUS_31990 4419 3091 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_31990 6077 4419 gene locus_tag LOCUS_32000 6077 4419 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_32000 >Feature sequence208 729 445 gene locus_tag LOCUS_32010 729 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 969 742 gene locus_tag LOCUS_32020 969 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 2312 966 gene locus_tag LOCUS_32030 2312 966 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_32030 3031 2315 gene locus_tag LOCUS_32040 3031 2315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_32040 3785 3045 gene locus_tag LOCUS_32050 3785 3045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809682.1 protein_id gnl|my_center|LOCUS_32050 4757 3789 gene locus_tag LOCUS_32060 4757 3789 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763252.1 protein_id gnl|my_center|LOCUS_32060 5634 4771 gene locus_tag LOCUS_32070 5634 4771 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544937.1 protein_id gnl|my_center|LOCUS_32070 6029 5754 gene locus_tag LOCUS_32080 6029 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 6082 6090 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence209 615 115 gene locus_tag LOCUS_32090 615 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 1590 685 gene locus_tag LOCUS_32100 1590 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 1472 1780 gene locus_tag LOCUS_32110 1472 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 4226 1896 gene locus_tag LOCUS_32120 4226 1896 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_32120 4510 4220 gene locus_tag LOCUS_32130 4510 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 4416 5186 gene locus_tag LOCUS_32140 4416 5186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748363.1 protein_id gnl|my_center|LOCUS_32140 5212 6180 gene locus_tag LOCUS_32150 5212 6180 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243786.1 protein_id gnl|my_center|LOCUS_32150 >Feature sequence210 2216 1299 gene locus_tag LOCUS_32160 2216 1299 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338750.1 protein_id gnl|my_center|LOCUS_32160 2498 3517 gene locus_tag LOCUS_32170 2498 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 3648 4571 gene locus_tag LOCUS_32180 3648 4571 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806973.1 protein_id gnl|my_center|LOCUS_32180 4728 5705 gene locus_tag LOCUS_32190 4728 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 >Feature sequence211 947 60 gene locus_tag LOCUS_32200 947 60 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_32200 1781 1020 gene locus_tag LOCUS_32210 1781 1020 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_32210 2964 1813 gene locus_tag LOCUS_32220 2964 1813 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_32220 2882 3076 gene locus_tag LOCUS_32230 2882 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 4433 3096 gene locus_tag LOCUS_32240 4433 3096 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926050.1 protein_id gnl|my_center|LOCUS_32240 4606 5088 gene locus_tag LOCUS_32250 4606 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 5321 5121 gene locus_tag LOCUS_32260 5321 5121 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_32260 5823 5978 gene locus_tag LOCUS_32270 5823 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence212 <1 1372 gene locus_tag LOCUS_32280 <1 1372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010977989.1:UbiD family decarboxylase 1853 1707 gene locus_tag LOCUS_32290 1853 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 3231 1813 gene locus_tag LOCUS_32300 3231 1813 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_32300 5376 3355 gene locus_tag LOCUS_32310 5376 3355 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271912.1 protein_id gnl|my_center|LOCUS_32310 <6311 5414 gene locus_tag LOCUS_32320 <6311 5414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878139.1:TAXI family TRAP transporter solute-binding subunit >Feature sequence213 140 1195 gene locus_tag LOCUS_32330 140 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038753.1 protein_id gnl|my_center|LOCUS_32330 1305 2333 gene locus_tag LOCUS_32340 1305 2333 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529865.1 protein_id gnl|my_center|LOCUS_32340 2363 2995 gene locus_tag LOCUS_32350 2363 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 3033 3689 gene locus_tag LOCUS_32360 3033 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 3706 4455 gene locus_tag LOCUS_32370 3706 4455 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_32370 4523 5551 gene locus_tag LOCUS_32380 4523 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence214 2171 1536 gene locus_tag LOCUS_32390 2171 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32390 3135 2200 gene locus_tag LOCUS_32400 3135 2200 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_32400 4430 3162 gene locus_tag LOCUS_32410 4430 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 4803 4516 gene locus_tag LOCUS_32420 4803 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 6030 4969 gene locus_tag LOCUS_32430 6030 4969 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence215 443 1006 gene locus_tag LOCUS_32440 443 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 1067 2677 gene locus_tag LOCUS_32450 1067 2677 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399863.1 protein_id gnl|my_center|LOCUS_32450 1883 1969 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2761 3654 gene locus_tag LOCUS_32460 2761 3654 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166741.1 protein_id gnl|my_center|LOCUS_32460 3713 5038 gene locus_tag LOCUS_32470 3713 5038 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000405.1 protein_id gnl|my_center|LOCUS_32470 5229 5369 gene locus_tag LOCUS_32480 5229 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 5405 5629 gene locus_tag LOCUS_32490 5405 5629 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_32490 5871 6188 gene locus_tag LOCUS_32500 5871 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence216 334 552 gene locus_tag LOCUS_32510 334 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32510 595 2124 gene locus_tag LOCUS_32520 595 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 2139 3140 gene locus_tag LOCUS_32530 2139 3140 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_32530 3137 3859 gene locus_tag LOCUS_32540 3137 3859 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_32540 3853 5433 gene locus_tag LOCUS_32550 3853 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 5440 5694 gene locus_tag LOCUS_32560 5440 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 >Feature sequence217 93 608 gene locus_tag LOCUS_32570 93 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 752 1744 gene locus_tag LOCUS_32580 752 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 1756 3819 gene locus_tag LOCUS_32590 1756 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3973 6057 gene locus_tag LOCUS_32600 3973 6057 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_32600 >Feature sequence218 669 1223 gene locus_tag LOCUS_32610 669 1223 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869771.1 protein_id gnl|my_center|LOCUS_32610 1220 1522 gene locus_tag LOCUS_32620 1220 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 1857 2060 gene locus_tag LOCUS_32630 1857 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 2368 2069 gene locus_tag LOCUS_32640 2368 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 3959 2349 gene locus_tag LOCUS_32650 3959 2349 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 protein_id gnl|my_center|LOCUS_32650 5287 3956 gene locus_tag LOCUS_32660 5287 3956 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942406.1 protein_id gnl|my_center|LOCUS_32660 5432 5785 gene locus_tag LOCUS_32670 5432 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence219 281 961 gene locus_tag LOCUS_32680 281 961 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_32680 966 1835 gene locus_tag LOCUS_32690 966 1835 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_32690 1832 2317 gene locus_tag LOCUS_32700 1832 2317 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969634.1 protein_id gnl|my_center|LOCUS_32700 2335 4674 gene locus_tag LOCUS_32710 2335 4674 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_32710 4721 5080 gene locus_tag LOCUS_32720 4721 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 5091 5789 gene locus_tag LOCUS_32730 5091 5789 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085745.1 protein_id gnl|my_center|LOCUS_32730 >Feature sequence220 1206 2195 gene locus_tag LOCUS_32740 1206 2195 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038796.1 protein_id gnl|my_center|LOCUS_32740 2228 3433 gene locus_tag LOCUS_32750 2228 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 3908 3516 gene locus_tag LOCUS_32760 3908 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 4275 3961 gene locus_tag LOCUS_32770 4275 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 4490 4290 gene locus_tag LOCUS_32780 4490 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 5164 4856 gene locus_tag LOCUS_32790 5164 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 5426 5136 gene locus_tag LOCUS_32800 5426 5136 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence221 692 6 gene locus_tag LOCUS_32810 692 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 1122 757 gene locus_tag LOCUS_32820 1122 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 1433 1119 gene locus_tag LOCUS_32830 1433 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 4748 1554 gene locus_tag LOCUS_32840 gene glnE 4748 1554 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_32840 5152 4745 gene locus_tag LOCUS_32850 5152 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32850 <5836 5152 gene locus_tag LOCUS_32860 <5836 5152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943990.1:S-methyl-5-thioribose-1-phosphate isomerase >Feature sequence222 <1 959 gene locus_tag LOCUS_32870 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114147.1:TAXI family TRAP transporter solute-binding subunit 1012 2055 gene locus_tag LOCUS_32880 1012 2055 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_32880 2172 2672 gene locus_tag LOCUS_32890 2172 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 2669 4060 gene locus_tag LOCUS_32900 2669 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 4103 5143 gene locus_tag LOCUS_32910 4103 5143 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399877.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence223 1385 906 gene locus_tag LOCUS_32920 1385 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 2129 1404 gene locus_tag LOCUS_32930 2129 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 2746 2132 gene locus_tag LOCUS_32940 2746 2132 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938166.1 protein_id gnl|my_center|LOCUS_32940 2899 2747 gene locus_tag LOCUS_32950 2899 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 3731 2940 gene locus_tag LOCUS_32960 3731 2940 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_32960 5174 3756 gene locus_tag LOCUS_32970 5174 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 >Feature sequence224 351 830 gene locus_tag LOCUS_32980 gene cutC 351 830 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_32980 934 2175 gene locus_tag LOCUS_32990 934 2175 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879167.1 protein_id gnl|my_center|LOCUS_32990 2255 3682 gene locus_tag LOCUS_33000 2255 3682 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_33000 3702 5066 gene locus_tag LOCUS_33010 3702 5066 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969629.1 protein_id gnl|my_center|LOCUS_33010 >Feature sequence225 <1 2582 gene locus_tag LOCUS_33020 <1 2582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941209.1:DNA polymerase I 2582 3151 gene locus_tag LOCUS_33030 2582 3151 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841351.1 protein_id gnl|my_center|LOCUS_33030 3152 4150 gene locus_tag LOCUS_33040 3152 4150 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_33040 5302 4394 gene locus_tag LOCUS_33050 5302 4394 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064396.1 protein_id gnl|my_center|LOCUS_33050 >Feature sequence226 3356 1308 gene locus_tag LOCUS_33060 3356 1308 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_33060 4336 3353 gene locus_tag LOCUS_33070 gene ala 4336 3353 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_33070 5328 4351 gene locus_tag LOCUS_33080 5328 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence227 1821 493 gene locus_tag LOCUS_33090 1821 493 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728152.1 protein_id gnl|my_center|LOCUS_33090 2485 1850 gene locus_tag LOCUS_33100 2485 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 2979 2479 gene locus_tag LOCUS_33110 gene comD 2979 2479 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496437.1 protein_id gnl|my_center|LOCUS_33110 3141 3563 gene locus_tag LOCUS_33120 3141 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 3776 4657 gene locus_tag LOCUS_33130 3776 4657 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971611.1 protein_id gnl|my_center|LOCUS_33130 >Feature sequence228 4074 2332 gene locus_tag LOCUS_33140 4074 2332 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399880.1 protein_id gnl|my_center|LOCUS_33140 4284 5399 gene locus_tag LOCUS_33150 4284 5399 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_33150 >Feature sequence229 802 2520 gene locus_tag LOCUS_33160 802 2520 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_33160 2517 3230 gene locus_tag LOCUS_33170 gene pyrF 2517 3230 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_33170 3227 4108 gene locus_tag LOCUS_33180 gene rlmB 3227 4108 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_33180 4678 3995 gene locus_tag LOCUS_33190 4678 3995 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_33190 4956 5031 gene locus_tag LOCUS_t00260 4956 5031 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5081 5166 gene locus_tag LOCUS_t00270 5081 5166 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5219 5295 gene locus_tag LOCUS_t00280 5219 5295 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence230 1158 1068 gene locus_tag LOCUS_t00290 1158 1068 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1386 1292 gene locus_tag LOCUS_t00300 1386 1292 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1883 1338 gene locus_tag LOCUS_33200 gene tadA 1883 1338 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_33200 2037 2675 gene locus_tag LOCUS_33210 2037 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 2702 4237 gene locus_tag LOCUS_33220 2702 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 4326 4514 gene locus_tag LOCUS_33230 4326 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 >Feature sequence231 2946 2341 gene locus_tag LOCUS_33240 2946 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33240 4032 2950 gene locus_tag LOCUS_33250 4032 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 4669 4040 gene locus_tag LOCUS_33260 4669 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 5016 4666 gene locus_tag LOCUS_33270 5016 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 5178 5047 gene locus_tag LOCUS_33280 5178 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence232 1604 1068 gene locus_tag LOCUS_33290 1604 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 1994 1731 gene locus_tag LOCUS_33300 1994 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 2401 2009 gene locus_tag LOCUS_33310 2401 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 4259 2406 gene locus_tag LOCUS_33320 4259 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 <5178 4261 gene locus_tag LOCUS_33330 <5178 4261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066275.1:PKD domain-containing protein >Feature sequence233 1843 833 gene locus_tag LOCUS_33340 1843 833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965807.1 protein_id gnl|my_center|LOCUS_33340 3041 2049 gene locus_tag LOCUS_33350 3041 2049 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_33350 3746 3045 gene locus_tag LOCUS_33360 3746 3045 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_33360 4240 3857 gene locus_tag LOCUS_33370 4240 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 4789 4313 gene locus_tag LOCUS_33380 gene bfr 4789 4313 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_33380 >Feature sequence234 <1 2077 gene locus_tag LOCUS_33390 <1 2077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041170065.1:hydantoinase/oxoprolinase family protein 2074 4233 gene locus_tag LOCUS_33400 2074 4233 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969352.1 protein_id gnl|my_center|LOCUS_33400 >Feature sequence235 <1 579 gene locus_tag LOCUS_33410 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190516.1:acetolactate synthase large subunit 1774 584 gene locus_tag LOCUS_33420 1774 584 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726880.1 protein_id gnl|my_center|LOCUS_33420 1930 2202 gene locus_tag LOCUS_33430 1930 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 3736 2318 gene locus_tag LOCUS_33440 3736 2318 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674116.1 protein_id gnl|my_center|LOCUS_33440 4801 3833 gene locus_tag LOCUS_33450 4801 3833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887573.1 protein_id gnl|my_center|LOCUS_33450 >Feature sequence236 <1 1366 gene locus_tag LOCUS_33460 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_133957058.1:TRAP transporter permease 1430 1837 gene locus_tag LOCUS_33470 1430 1837 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255194.1 protein_id gnl|my_center|LOCUS_33470 1872 3038 gene locus_tag LOCUS_33480 1872 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3038 4219 gene locus_tag LOCUS_33490 3038 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 4266 4625 gene locus_tag LOCUS_33500 4266 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence237 <1 646 gene locus_tag LOCUS_33510 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942709.1:replication-associated recombination protein A 1828 713 gene locus_tag LOCUS_33520 1828 713 CDS product PrpF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040164.1 protein_id gnl|my_center|LOCUS_33520 2339 1869 gene locus_tag LOCUS_33530 2339 1869 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975999.1 protein_id gnl|my_center|LOCUS_33530 2689 2378 gene locus_tag LOCUS_33540 2689 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33540 2938 2699 gene locus_tag LOCUS_33550 2938 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 3668 3156 gene locus_tag LOCUS_33560 3668 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 <4931 3668 gene locus_tag LOCUS_33570 <4931 3668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000432352.1:anion permease >Feature sequence238 <1 1771 gene locus_tag LOCUS_33580 <1 1771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973995.1:ABC transporter substrate-binding protein 1943 2344 gene locus_tag LOCUS_33590 1943 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 2375 3304 gene locus_tag LOCUS_33600 2375 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 3318 4208 gene locus_tag LOCUS_33610 3318 4208 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_33610 >Feature sequence239 3 869 gene locus_tag LOCUS_33620 gene panB 3 869 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_33620 927 1769 gene locus_tag LOCUS_33630 gene panC 927 1769 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_33630 2429 1809 gene locus_tag LOCUS_33640 2429 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 3605 2454 gene locus_tag LOCUS_33650 3605 2454 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_33650 3938 4411 gene locus_tag LOCUS_33660 gene smpB 3938 4411 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_33660 >Feature sequence240 354 1853 gene locus_tag LOCUS_33670 354 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 1841 2590 gene locus_tag LOCUS_33680 gene cofE 1841 2590 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_33680 2678 3274 gene locus_tag LOCUS_33690 2678 3274 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259451.1 protein_id gnl|my_center|LOCUS_33690 4378 3392 gene locus_tag LOCUS_33700 4378 3392 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222366.1 protein_id gnl|my_center|LOCUS_33700 >Feature sequence241 352 1329 gene locus_tag LOCUS_33710 352 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 1499 2176 gene locus_tag LOCUS_33720 1499 2176 CDS product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_33720 2213 2998 gene locus_tag LOCUS_33730 2213 2998 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 protein_id gnl|my_center|LOCUS_33730 3129 3851 gene locus_tag LOCUS_33740 3129 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 >Feature sequence242 204 647 gene locus_tag LOCUS_33750 204 647 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_33750 622 1488 gene locus_tag LOCUS_33760 gene larE 622 1488 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_33760 4044 1492 gene locus_tag LOCUS_33770 4044 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 4431 4195 gene locus_tag LOCUS_33780 4431 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 >Feature sequence243 921 88 gene locus_tag LOCUS_33790 921 88 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_33790 1215 979 gene locus_tag LOCUS_33800 1215 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 1253 1735 gene locus_tag LOCUS_33810 1253 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 1769 1694 gene locus_tag LOCUS_t00310 1769 1694 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2467 1868 gene locus_tag LOCUS_33820 gene recR 2467 1868 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_33820 2801 2484 gene locus_tag LOCUS_33830 2801 2484 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940772.1 protein_id gnl|my_center|LOCUS_33830 <4706 2794 gene locus_tag LOCUS_33840 <4706 2794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940771.1:DNA polymerase III subunit gamma/tau >Feature sequence244 16 495 gene locus_tag LOCUS_33850 16 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 495 1616 gene locus_tag LOCUS_33860 495 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33860 1601 2551 gene locus_tag LOCUS_33870 1601 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33870 2564 4435 gene locus_tag LOCUS_33880 2564 4435 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533167.1 protein_id gnl|my_center|LOCUS_33880 >Feature sequence245 862 1683 gene locus_tag LOCUS_33890 862 1683 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288041.1 protein_id gnl|my_center|LOCUS_33890 1686 2969 gene locus_tag LOCUS_33900 gene grdB 1686 2969 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011345263.1 transl_except (pos:2736..2738,aa:Sec) note codon on position 351 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_33900 2977 4245 gene locus_tag LOCUS_33910 2977 4245 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869885.1 protein_id gnl|my_center|LOCUS_33910 >Feature sequence246 2355 715 gene locus_tag LOCUS_33920 2355 715 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807873.1 protein_id gnl|my_center|LOCUS_33920 4194 2494 gene locus_tag LOCUS_33930 4194 2494 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727588.1 protein_id gnl|my_center|LOCUS_33930 >Feature sequence247 344 1375 gene locus_tag LOCUS_33940 344 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 1382 2113 gene locus_tag LOCUS_33950 1382 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 2177 3169 gene locus_tag LOCUS_33960 2177 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 3248 4369 gene locus_tag LOCUS_33970 3248 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 >Feature sequence248 <1 563 gene locus_tag LOCUS_33980 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188441.1:D-threitol dehydrogenase 930 601 gene locus_tag LOCUS_33990 930 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 1478 945 gene locus_tag LOCUS_34000 1478 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 1686 2849 gene locus_tag LOCUS_34010 1686 2849 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 protein_id gnl|my_center|LOCUS_34010 2849 4081 gene locus_tag LOCUS_34020 2849 4081 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461637.1 protein_id gnl|my_center|LOCUS_34020 >Feature sequence249 <1 569 gene locus_tag LOCUS_34030 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860393.1:HEAT repeat domain-containing protein 637 1008 gene locus_tag LOCUS_34040 637 1008 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545617.1 protein_id gnl|my_center|LOCUS_34040 1126 2103 gene locus_tag LOCUS_34050 1126 2103 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_34050 2103 3746 gene locus_tag LOCUS_34060 2103 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 >Feature sequence250 1051 263 gene locus_tag LOCUS_34070 1051 263 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_34070 1467 2495 gene locus_tag LOCUS_34080 1467 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 2542 4197 gene locus_tag LOCUS_34090 gene ggt 2542 4197 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140682.1 protein_id gnl|my_center|LOCUS_34090 >Feature sequence251 545 802 gene locus_tag LOCUS_34100 545 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 856 1164 gene locus_tag LOCUS_34110 856 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 1180 3474 gene locus_tag LOCUS_34120 1180 3474 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_34120 >Feature sequence252 3230 2295 gene locus_tag LOCUS_34130 3230 2295 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037419.1 protein_id gnl|my_center|LOCUS_34130 4174 3227 gene locus_tag LOCUS_34140 4174 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 >Feature sequence253 1053 223 gene locus_tag LOCUS_34150 1053 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 2420 945 gene locus_tag LOCUS_34160 gene bioA 2420 945 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_34160 2719 3312 gene locus_tag LOCUS_34170 2719 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 >Feature sequence254 2088 1036 gene locus_tag LOCUS_34180 2088 1036 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338610.1 protein_id gnl|my_center|LOCUS_34180 3054 2119 gene locus_tag LOCUS_34190 3054 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 3880 3044 gene locus_tag LOCUS_34200 3880 3044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence255 1836 505 gene locus_tag LOCUS_34210 1836 505 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_34210 2427 3350 gene locus_tag LOCUS_34220 2427 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 >Feature sequence256 1130 138 gene locus_tag LOCUS_34230 1130 138 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038796.1 protein_id gnl|my_center|LOCUS_34230 3742 1109 gene locus_tag LOCUS_34240 gene sreA 3742 1109 CDS product sulfur reductase subunit SreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880782.1 protein_id gnl|my_center|LOCUS_34240 4068 3748 gene locus_tag LOCUS_34250 4068 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence257 887 971 gene locus_tag LOCUS_t00320 887 971 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2168 921 gene locus_tag LOCUS_34260 2168 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 3009 2227 gene locus_tag LOCUS_34270 3009 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 3839 2940 gene locus_tag LOCUS_34280 3839 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence258 2 1288 gene locus_tag LOCUS_34290 gene nirJ2 2 1288 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_34290 1355 2074 gene locus_tag LOCUS_34300 1355 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 >Feature sequence259 1034 1825 gene locus_tag LOCUS_34310 1034 1825 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_34310 2393 1884 gene locus_tag LOCUS_34320 2393 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34320 3556 2843 gene locus_tag LOCUS_34330 3556 2843 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 protein_id gnl|my_center|LOCUS_34330 <4193 3553 gene locus_tag LOCUS_34340 <4193 3553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232087.1:calcium-translocating P-type ATPase, SERCA-type >Feature sequence260 810 16 gene locus_tag LOCUS_34350 810 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 1674 886 gene locus_tag LOCUS_34360 1674 886 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_34360 2782 1676 gene locus_tag LOCUS_34370 2782 1676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_34370 <4167 2795 gene locus_tag LOCUS_34380 <4167 2795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064852.1:iron ABC transporter permease >Feature sequence261 1322 249 gene locus_tag LOCUS_34390 gene leuB 1322 249 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393735.1 protein_id gnl|my_center|LOCUS_34390 1918 1421 gene locus_tag LOCUS_34400 gene leuD 1918 1421 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_34400 3231 1969 gene locus_tag LOCUS_34410 gene leuC 3231 1969 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880579.1 protein_id gnl|my_center|LOCUS_34410 <4021 3269 gene locus_tag LOCUS_34420 <4021 3269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942551.1:2-isopropylmalate synthase >Feature sequence262 <1 663 gene locus_tag LOCUS_34430 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929960.1:ABC transporter substrate-binding protein 735 1730 gene locus_tag LOCUS_34440 735 1730 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973995.1 protein_id gnl|my_center|LOCUS_34440 1834 2826 gene locus_tag LOCUS_34450 1834 2826 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965807.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence263 2435 1014 gene locus_tag LOCUS_34460 gene selA 2435 1014 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_34460 2597 3178 gene locus_tag LOCUS_34470 2597 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 3196 3453 gene locus_tag LOCUS_34480 3196 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 <3966 3450 gene locus_tag LOCUS_34490 <3966 3450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880651.1:formate dehydrogenase accessory protein FdhE >Feature sequence264 1682 1011 gene locus_tag LOCUS_34500 1682 1011 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_34500 3239 1695 gene locus_tag LOCUS_34510 3239 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34510 3793 3236 gene locus_tag LOCUS_34520 3793 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 >Feature sequence265 760 2424 gene locus_tag LOCUS_34530 760 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34530 2522 3340 gene locus_tag LOCUS_34540 2522 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 <3914 3411 gene locus_tag LOCUS_34550 <3914 3411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001276374.1:OFA family MFS transporter >Feature sequence266 306 1538 gene locus_tag LOCUS_34560 306 1538 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391998.1 protein_id gnl|my_center|LOCUS_34560 1739 3337 gene locus_tag LOCUS_34570 1739 3337 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830540.1 protein_id gnl|my_center|LOCUS_34570 3740 3665 gene locus_tag LOCUS_t00330 3740 3665 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence267 520 1032 gene locus_tag LOCUS_34580 520 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 1029 1592 gene locus_tag LOCUS_34590 1029 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 1681 2004 gene locus_tag LOCUS_34600 1681 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34600 2071 2307 gene locus_tag LOCUS_34610 2071 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 2322 2498 gene locus_tag LOCUS_34620 2322 2498 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393285.1 protein_id gnl|my_center|LOCUS_34620 2565 3083 gene locus_tag LOCUS_34630 2565 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence268 1096 344 gene locus_tag LOCUS_34640 1096 344 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380309.1 protein_id gnl|my_center|LOCUS_34640 2009 1248 gene locus_tag LOCUS_34650 2009 1248 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651594.1 protein_id gnl|my_center|LOCUS_34650 2294 2800 gene locus_tag LOCUS_34660 2294 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence269 340 501 gene locus_tag LOCUS_34670 340 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 3121 830 gene locus_tag LOCUS_34680 3121 830 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969352.1 protein_id gnl|my_center|LOCUS_34680 >Feature sequence270 <1 1333 gene locus_tag LOCUS_34690 <1 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875867.1:glutamate-1-semialdehyde 2,1-aminomutase 1347 2183 gene locus_tag LOCUS_34700 1347 2183 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_34700 2197 3348 gene locus_tag LOCUS_34710 2197 3348 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086105.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence271 <1 759 gene locus_tag LOCUS_34720 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000821727.1:magnesium/cobalt transporter CorA 1526 771 gene locus_tag LOCUS_34730 1526 771 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_34730 2739 1630 gene locus_tag LOCUS_34740 2739 1630 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_34740 3652 2750 gene locus_tag LOCUS_34750 3652 2750 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250859.1 protein_id gnl|my_center|LOCUS_34750 >Feature sequence272 <1 920 gene locus_tag LOCUS_34760 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257569.1:Glu/Leu/Phe/Val dehydrogenase 1153 1851 gene locus_tag LOCUS_34770 1153 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 2014 1838 gene locus_tag LOCUS_34780 2014 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 >Feature sequence273 <1 1289 gene locus_tag LOCUS_34790 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243083.1:(2,3-dihydroxybenzoyl)adenylate synthase 2102 1302 gene locus_tag LOCUS_34800 2102 1302 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392252.1 protein_id gnl|my_center|LOCUS_34800 2364 2131 gene locus_tag LOCUS_34810 2364 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 3233 2361 gene locus_tag LOCUS_34820 3233 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 3480 3241 gene locus_tag LOCUS_34830 3480 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 >Feature sequence274 1500 445 gene locus_tag LOCUS_34840 gene eutC 1500 445 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969330.1 protein_id gnl|my_center|LOCUS_34840 1810 1517 gene locus_tag LOCUS_34850 1810 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 3023 1794 gene locus_tag LOCUS_34860 3023 1794 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040635.1 protein_id gnl|my_center|LOCUS_34860 <3591 3040 gene locus_tag LOCUS_34870 <3591 3040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259102.1:5'-nucleotidase C-terminal domain-containing protein >Feature sequence275 903 139 gene locus_tag LOCUS_34880 903 139 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085532.1 protein_id gnl|my_center|LOCUS_34880 1747 959 gene locus_tag LOCUS_34890 1747 959 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529864.1 protein_id gnl|my_center|LOCUS_34890 2579 1734 gene locus_tag LOCUS_34900 2579 1734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818996.1 protein_id gnl|my_center|LOCUS_34900 <3563 2589 gene locus_tag LOCUS_34910 <3563 2589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973995.1:ABC transporter substrate-binding protein >Feature sequence276 1284 40 gene locus_tag LOCUS_34920 1284 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 2562 1480 gene locus_tag LOCUS_34930 2562 1480 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_34930 2825 3124 gene locus_tag LOCUS_34940 2825 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 2949 2954 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence277 2263 1241 gene locus_tag LOCUS_34950 2263 1241 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_34950 2665 2381 gene locus_tag LOCUS_34960 2665 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 2933 2649 gene locus_tag LOCUS_34970 2933 2649 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_34970 >Feature sequence278 1284 304 gene locus_tag LOCUS_34980 1284 304 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_34980 2111 1302 gene locus_tag LOCUS_34990 2111 1302 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 protein_id gnl|my_center|LOCUS_34990 >Feature sequence279 1963 542 gene locus_tag LOCUS_35000 1963 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 2633 2190 gene locus_tag LOCUS_35010 2633 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 2870 2637 gene locus_tag LOCUS_35020 2870 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 <3527 2917 gene locus_tag LOCUS_35030 <3527 2917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929319.1:tetratricopeptide repeat protein >Feature sequence280 637 473 gene locus_tag LOCUS_35040 637 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 2119 653 gene locus_tag LOCUS_35050 2119 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 2903 2172 gene locus_tag LOCUS_35060 gene fabG 2903 2172 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143495.1 protein_id gnl|my_center|LOCUS_35060 >Feature sequence281 1287 817 gene locus_tag LOCUS_35070 1287 817 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337817.1 protein_id gnl|my_center|LOCUS_35070 <3480 1301 gene locus_tag LOCUS_35080 <3480 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975050.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence282 786 184 gene locus_tag LOCUS_35090 786 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35090 1506 1156 gene locus_tag LOCUS_35100 1506 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 1819 1484 gene locus_tag LOCUS_35110 1819 1484 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_35110 2051 1830 gene locus_tag LOCUS_35120 2051 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 2479 2285 gene locus_tag LOCUS_35130 2479 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35130 2690 2472 gene locus_tag LOCUS_35140 2690 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 3204 3022 gene locus_tag LOCUS_35150 3204 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 >Feature sequence283 966 220 gene locus_tag LOCUS_35160 966 220 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_35160 1480 1253 gene locus_tag LOCUS_35170 1480 1253 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_35170 1680 1477 gene locus_tag LOCUS_35180 1680 1477 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_35180 1847 3352 gene locus_tag LOCUS_35190 1847 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence284 1432 344 gene locus_tag LOCUS_35200 1432 344 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440662.1 protein_id gnl|my_center|LOCUS_35200 1562 2590 gene locus_tag LOCUS_35210 1562 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35210 2578 3228 gene locus_tag LOCUS_35220 2578 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35220 >Feature sequence285 28 1035 gene locus_tag LOCUS_35230 28 1035 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395914.1 protein_id gnl|my_center|LOCUS_35230 1105 2208 gene locus_tag LOCUS_35240 1105 2208 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088477.1 protein_id gnl|my_center|LOCUS_35240 2335 3327 gene locus_tag LOCUS_35250 2335 3327 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973995.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence286 1625 1661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1685 2281 gene locus_tag LOCUS_35260 1685 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 >Feature sequence287 159 1406 gene locus_tag LOCUS_35270 159 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 1506 3074 gene locus_tag LOCUS_35280 1506 3074 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_35280 >Feature sequence288 <1 1503 gene locus_tag LOCUS_35290 <1 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:efflux RND transporter permease subunit 1520 2155 gene locus_tag LOCUS_35300 1520 2155 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895255.1 protein_id gnl|my_center|LOCUS_35300 2166 2864 gene locus_tag LOCUS_35310 gene nth 2166 2864 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_35310 >Feature sequence289 309 1676 gene locus_tag LOCUS_35320 309 1676 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 protein_id gnl|my_center|LOCUS_35320 3289 1835 gene locus_tag LOCUS_35330 3289 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 >Feature sequence290 106 423 gene locus_tag LOCUS_35340 106 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 626 1300 gene locus_tag LOCUS_35350 626 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 1319 1359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence291 147 2711 gene locus_tag LOCUS_35360 147 2711 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_35360 3252 2725 gene locus_tag LOCUS_35370 3252 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence292 420 344 gene locus_tag LOCUS_t00340 420 344 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1122 706 gene locus_tag LOCUS_35380 1122 706 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082021182.1 protein_id gnl|my_center|LOCUS_35380 1343 1119 gene locus_tag LOCUS_35390 1343 1119 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_35390 1221 1234 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3236 1408 gene locus_tag LOCUS_35400 <3236 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942167.1:phenylalanine--tRNA ligase subunit beta >Feature sequence293 1634 315 gene locus_tag LOCUS_35410 1634 315 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_35410 2366 1644 gene locus_tag LOCUS_35420 2366 1644 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941080.1 protein_id gnl|my_center|LOCUS_35420 <3234 2359 gene locus_tag LOCUS_35430 <3234 2359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941079.1:flagellar motor switch protein FliG >Feature sequence294 1496 696 gene locus_tag LOCUS_35440 1496 696 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_35440 2270 1503 gene locus_tag LOCUS_35450 2270 1503 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_35450 2487 2257 gene locus_tag LOCUS_35460 2487 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 <3233 2477 gene locus_tag LOCUS_35470 <3233 2477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144194.1:ABC transporter ATP-binding protein >Feature sequence295 1420 758 gene locus_tag LOCUS_35480 1420 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 2652 1594 gene locus_tag LOCUS_35490 2652 1594 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393751.1 protein_id gnl|my_center|LOCUS_35490 <3157 2624 gene locus_tag LOCUS_35500 <3157 2624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324237.1:galactitol-1-phosphate 5-dehydrogenase >Feature sequence296 248 844 gene locus_tag LOCUS_35510 248 844 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258349.1 protein_id gnl|my_center|LOCUS_35510 869 1534 gene locus_tag LOCUS_35520 gene modB 869 1534 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937491.1 protein_id gnl|my_center|LOCUS_35520 1534 2673 gene locus_tag LOCUS_35530 1534 2673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393322.1 protein_id gnl|my_center|LOCUS_35530 1771 1791 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence297 <1 1165 gene locus_tag LOCUS_35540 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896739.1:alpha/beta fold hydrolase 1704 1264 gene locus_tag LOCUS_35550 1704 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 1951 1688 gene locus_tag LOCUS_35560 1951 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 2680 2267 gene locus_tag LOCUS_35570 2680 2267 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_35570 >Feature sequence298 1579 185 gene locus_tag LOCUS_35580 1579 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 <3008 1866 gene locus_tag LOCUS_35590 <3008 1866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875980.1:Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain >Feature sequence299 <1 622 gene locus_tag LOCUS_35600 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393340.1:bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase 663 1640 gene locus_tag LOCUS_35610 663 1640 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_35610 2560 1667 gene locus_tag LOCUS_35620 2560 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence300 838 59 gene locus_tag LOCUS_35630 838 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 1814 972 gene locus_tag LOCUS_35640 gene lysX 1814 972 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_35640 1994 1833 gene locus_tag LOCUS_35650 gene lysW 1994 1833 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_35650 >Feature sequence301 1231 197 gene locus_tag LOCUS_35660 1231 197 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_35660 2049 1228 gene locus_tag LOCUS_35670 2049 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 <2891 2068 gene locus_tag LOCUS_35680 <2891 2068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256645.1:D-alanine--D-alanine ligase family protein >Feature sequence302 422 3 gene locus_tag LOCUS_35690 422 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 1802 432 gene locus_tag LOCUS_35700 1802 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 2561 1848 gene locus_tag LOCUS_35710 2561 1848 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879756.1 protein_id gnl|my_center|LOCUS_35710 >Feature sequence303 91 336 gene locus_tag LOCUS_35720 91 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 333 827 gene locus_tag LOCUS_35730 333 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 1213 1458 gene locus_tag LOCUS_35740 1213 1458 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_35740 1452 1787 gene locus_tag LOCUS_35750 1452 1787 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_35750 1885 2091 gene locus_tag LOCUS_35760 1885 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 >Feature sequence304 267 4 gene locus_tag LOCUS_35770 267 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence305 2 1702 gene locus_tag LOCUS_35780 2 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 1699 2676 gene locus_tag LOCUS_35790 1699 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 >Feature sequence306 423 1025 gene locus_tag LOCUS_35800 423 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 1126 2511 gene locus_tag LOCUS_35810 1126 2511 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_35810 >Feature sequence307 <2611 988 gene locus_tag LOCUS_35820 <2611 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039300.1:tetratricopeptide repeat protein >Feature sequence308 1381 137 gene locus_tag LOCUS_35830 1381 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 1676 1353 gene locus_tag LOCUS_35840 1676 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 1844 2371 gene locus_tag LOCUS_35850 1844 2371 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_35850